Sample records for binding site face

  1. Modeling the Binding of Neurotransmitter Transporter Inhibitors with Molecular Dynamics and Free Energy Calculations

    NASA Astrophysics Data System (ADS)

    Jean, Bernandie

    The monoamine transporter (MAT) proteins responsible for the reuptake of the neurotransmitter substrates, dopamine, serotonin, and norepinephrine, are drug targets for the treatment of psychiatric disorders including depression, anxiety, and attention deficit hyperactivity disorder. Small molecules that inhibit these proteins can serve as useful therapeutic agents. However, some dopamine transporter (DAT) inhibitors, such as cocaine and methamphetamine, are highly addictive and abusable. Efforts have been made to develop small molecules that will inhibit the transporters and elucidate specific binding site interactions. This work provides knowledge of molecular interactions associated with MAT inhibitors by offering an atomistic perspective that can guide designs of new pharmacotherapeutics with enhanced activity. The work described herein evaluates intermolecular interactions using computational methods to reveal the mechanistic detail of inhibitors binding in the DAT. Because cocaine recognizes the extracellular-facing or outward-facing (OF) DAT conformation and benztropine recognizes the intracellular-facing or inward-facing (IF) conformation, it was postulated that behaviorally "typical" (abusable, locomotor psychostimulant) inhibitors stabilize the OF DAT and "atypical" (little or no abuse potential) inhibitors favor IF DAT. Indeed, behaviorally-atypical cocaine analogs have now been shown to prefer the OF DAT conformation. Specifically, the binding interactions of two cocaine analogs, LX10 and LX11, were studied in the OF DAT using molecular dynamics simulations. LX11 was able to interact with residues of transmembrane helix 8 and bind in a fashion that allowed for hydration of the primary binding site (S1) from the intracellular space, thus impacting the intracellular interaction network capable of regulating conformational transitions in DAT. Additionally, a novel serotonin transporter (SERT) inhibitor previously discovered through virtual screening at the SERT secondary binding site (S2) was studied. Intermolecular interactions between SM11 and SERT have been assessed using binding free energy calculations to predict the ligand-binding site and optimize ligand-binding interactions. Results indicate the addition of atoms to the 4-chlorobenzyl moiety were most energetically favorable. The simulations carried out in DAT and SERT were supported by experimental results. Furthermore, the co-crystal structures of DAT and SERT share similar ligand-binding interactions with the homology models used in this study.

  2. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  3. Mapping Hfq-RNA interaction surfaces using tryptophan fluorescence quenching

    PubMed Central

    Robinson, Kirsten E.; Orans, Jillian; Kovach, Alexander R.; Link, Todd M.; Brennan, Richard G.

    2014-01-01

    Hfq is a posttranscriptional riboregulator and RNA chaperone that binds small RNAs and target mRNAs to effect their annealing and message-specific regulation in response to environmental stressors. Structures of Hfq-RNA complexes indicate that U-rich sequences prefer the proximal face and A-rich sequences the distal face; however, the Hfq-binding sites of most RNAs are unknown. Here, we present an Hfq-RNA mapping approach that uses single tryptophan-substituted Hfq proteins, all of which retain the wild-type Hfq structure, and tryptophan fluorescence quenching (TFQ) by proximal RNA binding. TFQ properly identified the respective distal and proximal binding of A15 and U6 RNA to Gram-negative Escherichia coli (Ec) Hfq and the distal face binding of (AA)3A, (AU)3A and (AC)3A to Gram-positive Staphylococcus aureus (Sa) Hfq. The inability of (GU)3G to bind the distal face of Sa Hfq reveals the (R-L)n binding motif is a more restrictive (A-L)n binding motif. Remarkably Hfq from Gram-positive Listeria monocytogenes (Lm) binds (GU)3G on its proximal face. TFQ experiments also revealed the Ec Hfq (A-R-N)n distal face-binding motif should be redefined as an (A-A-N)n binding motif. TFQ data also demonstrated that the 5′-untranslated region of hfq mRNA binds both the proximal and distal faces of Ec Hfq and the unstructured C-terminus. PMID:24288369

  4. Sugar-binding sites on the surface of the carbohydrate-binding module of CBH I from Trichoderma reesei.

    PubMed

    Tavagnacco, Letizia; Mason, Philip E; Schnupf, Udo; Pitici, Felicia; Zhong, Linghao; Himmel, Michael E; Crowley, Michael; Cesàro, Attilio; Brady, John W

    2011-05-01

    Molecular dynamics simulations were carried out for a system consisting of the carbohydrate-binding module (CBM) of the cellulase CBH I from Trichoderma reesei (Hypocrea jecorina) in a concentrated solution of β-D-glucopyranose, to determine whether there is any tendency for the sugar molecules to bind to the CBM. In spite of the general tendency of glucose to behave as an osmolyte, a marked tendency for the sugar molecules to bind to the protein was observed. However, the glucose molecules tended to bind only to specific sites on the protein. As expected, the hydrophobic face of the sugar molecules, comprising the axial H1, H3, and H5 aliphatic protons, tended to adhere to the flat faces of the three tyrosine side chains on the planar binding surface of the CBM. However, a significant tendency to bind to a groove-like feature on the upper surface of the CBM was also observed. These results would not be inconsistent with a model of the mechanism for this globular domain in which the cellodextrin chain being removed from the surface of crystalline cellulose passes over the upper surface of the CBM, presumably then available for hydrolysis in the active site tunnel of this processive cellulase. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. The selectivity of the Na+/K+-pump is controlled by binding site protonation and self-correcting occlusion

    PubMed Central

    Rui, Huan; Artigas, Pablo; Roux, Benoît

    2016-01-01

    The Na+/K+-pump maintains the physiological K+ and Na+ electrochemical gradients across the cell membrane. It operates via an 'alternating-access' mechanism, making iterative transitions between inward-facing (E1) and outward-facing (E2) conformations. Although the general features of the transport cycle are known, the detailed physicochemical factors governing the binding site selectivity remain mysterious. Free energy molecular dynamics simulations show that the ion binding sites switch their binding specificity in E1 and E2. This is accompanied by small structural arrangements and changes in protonation states of the coordinating residues. Additional computations on structural models of the intermediate states along the conformational transition pathway reveal that the free energy barrier toward the occlusion step is considerably increased when the wrong type of ion is loaded into the binding pocket, prohibiting the pump cycle from proceeding forward. This self-correcting mechanism strengthens the overall transport selectivity and protects the stoichiometry of the pump cycle. DOI: http://dx.doi.org/10.7554/eLife.16616.001 PMID:27490484

  6. Information analysis of sequences that bind the replication initiator RepA | Center for Cancer Research

    Cancer.gov

    The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.

  7. Characterization of a conformationally sensitive murine monoclonal antibody directed to the metal ion-dependent adhesion site face of integrin CD11b.

    PubMed

    Li, Rui; Haruta, Ikuko; Rieu, Philippe; Sugimori, Takashi; Xiong, Jian-Ping; Arnaout, M Amin

    2002-02-01

    Integrin binding to physiologic ligands requires divalent cations and an inside-out-driven switch of the integrin to a high-affinity state. Divalent cations at the metal ion-dependent adhesion site (MIDAS) face of the alpha subunit-derived A domain provide a direct bridge between ligands and the integrin, and it has been proposed that activation dependency is caused by reorientation of the surrounding residues relative to the metal ion, forming an optimal binding interface. To gain more insight into the functional significance of the protein movements on the MIDAS face, we raised and characterized a murine mAb 107 directed against the MIDAS face of the A domain from integrin CD11b. We find that mAb 107 behaves as a ligand mimic. It binds in a divalent-cation-dependent manner to solvent-exposed residues on the MIDAS face of CD11b, blocks interaction of 11bA or the holoreceptor with ligands, and inhibits spreading and phagocytosis by human neutrophils. However, in contrast to physiologic ligands, mAb 107 preferentially binds to the inactive low-affinity form of the integrin, suggesting that its antagonistic effects are exerted in part by stabilizing the receptor in the low-affinity state. These data support a functional relevance of the protein movements on the MIDAS face and suggest that stabilizing the A domain in the low-affinity state may have therapeutic benefit.

  8. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  9. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  10. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pejcha, Robert; Ludwig, Martha L.

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domainmore » evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.« less

  11. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  12. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  13. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  14. PDZ binding to the BAR domain of PICK1 is elucidated by coarse-grained molecular dynamics.

    PubMed

    He, Yi; Liwo, Adam; Weinstein, Harel; Scheraga, Harold A

    2011-01-07

    A key regulator of α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor traffic, PICK1 is known to interact with over 40 other proteins, including receptors, transporters and ionic channels, and to be active mostly as a homodimer. The current lack of a complete PICK1 structure determined at atomic resolution hinders the elucidation of its functional mechanisms. Here, we identify interactions between the component PDZ and BAR domains of PICK1 by calculating possible binding sites for the PDZ domain of PICK1 (PICK1-PDZ) to the homology-modeled, crescent-shaped dimer of the PICK1-BAR domain using multiplexed replica-exchange molecular dynamics (MREMD) and canonical molecular dynamics simulations with the coarse-grained UNRES force field. The MREMD results show that the preferred binding site for the single PDZ domain is the concave cavity of the BAR dimer. A second possible binding site is near the N-terminus of the BAR domain that is linked directly to the PDZ domain. Subsequent short canonical molecular dynamics simulations used to determine how the PICK1-PDZ domain moves to the preferred binding site on the BAR domain of PICK1 revealed that initial hydrophobic interactions drive the progress of the simulated binding. Thus, the concave face of the BAR dimer accommodates the PDZ domain first by weak hydrophobic interactions and then the PDZ domain slides to the center of the concave face, where more favorable hydrophobic interactions take over. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Structural Basis for Antifreeze Activity of Ice-binding Protein from Arctic Yeast*

    PubMed Central

    Lee, Jun Hyuck; Park, Ae Kyung; Do, Hackwon; Park, Kyoung Sun; Moh, Sang Hyun; Chi, Young Min; Kim, Hak Jun

    2012-01-01

    Arctic yeast Leucosporidium sp. produces a glycosylated ice-binding protein (LeIBP) with a molecular mass of ∼25 kDa, which can lower the freezing point below the melting point once it binds to ice. LeIBP is a member of a large class of ice-binding proteins, the structures of which are unknown. Here, we report the crystal structures of non-glycosylated LeIBP and glycosylated LeIBP at 1.57- and 2.43-Å resolution, respectively. Structural analysis of the LeIBPs revealed a dimeric right-handed β-helix fold, which is composed of three parts: a large coiled structural domain, a long helix region (residues 96–115 form a long α-helix that packs along one face of the β-helix), and a C-terminal hydrophobic loop region (243PFVPAPEVV251). Unexpectedly, the C-terminal hydrophobic loop region has an extended conformation pointing away from the body of the coiled structural domain and forms intertwined dimer interactions. In addition, structural analysis of glycosylated LeIBP with sugar moieties attached to Asn185 provides a basis for interpreting previous biochemical analyses as well as the increased stability and secretion of glycosylated LeIBP. We also determined that the aligned Thr/Ser/Ala residues are critical for ice binding within the B face of LeIBP using site-directed mutagenesis. Although LeIBP has a common β-helical fold similar to that of canonical hyperactive antifreeze proteins, the ice-binding site is more complex and does not have a simple ice-binding motif. In conclusion, we could identify the ice-binding site of LeIBP and discuss differences in the ice-binding modes compared with other known antifreeze proteins and ice-binding proteins. PMID:22303017

  16. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  17. The ASPP interaction network: electrostatic differentiation between pro- and anti-apoptotic proteins.

    PubMed

    Benyamini, Hadar; Friedler, Assaf

    2011-01-01

    The ASPP proteins are apoptosis regulators: ASPP1 and ASPP2 promote, while iASPP inhibits, apoptosis. The mechanism by which these different outcomes are achieved is still unknown. The C-terminal ankyrin repeats and SH3 domain (ANK-SH3) mediate the interactions of the ASPP proteins with major apoptosis regulators such as p53, Bcl-2, and NFκB. The structure of the complex between ASPP2(ANK-SH3) and the core domain of p53 (p53CD) was previously determined. We have recently characterized the individual interactions of ASPP2(ANK-SH3) with Bcl-2 and NFκB, as well as a regulatory intramolecular interaction with the proline rich domain of ASPP2. Here we compared the ASPP interactions at two levels: ASPP2(ANK-SH3) with different proteins, and different ASPP family members with each protein partner. We found that the binding sites of ASPP2 to p53CD, Bcl-2, and NFκB are different, yet lie on the same face of ASPP2(ANK-SH3) . The intramolecular binding site to the proline rich domain overlaps the three intermolecular binding sites. To reveal the basis of functional diversity in the ASPP family, we compared their protein-binding domains. A subset of surface-exposed residues differentiates ASPP1 and ASPP2 from iASPP: ASPP1/2 are more negatively charged in specific residues that contact positively charged residues of p53CD, Bcl-2, and NFκB. We also found a gain of positive charge at the non-protein binding face of ASPP1/2, suggesting a role in electrostatic direction towards the negatively charged protein binding face. The electrostatic differences in binding interfaces between the ASPP proteins may be one of the causes for their different function. Copyright © 2010 John Wiley & Sons, Ltd.

  18. Emulating proton-induced conformational changes in the vesicular monoamine transporter VMAT2 by mutagenesis.

    PubMed

    Yaffe, Dana; Vergara-Jaque, Ariela; Forrest, Lucy R; Schuldiner, Shimon

    2016-11-22

    Neurotransporters located in synaptic vesicles are essential for communication between nerve cells in a process mediated by neurotransmitters. Vesicular monoamine transporter (VMAT), a member of the largest superfamily of transporters, mediates transport of monoamines to synaptic vesicles and storage organelles in a process that involves exchange of two H + per substrate. VMAT transport is inhibited by the competitive inhibitor reserpine, a second-line agent to treat hypertension, and by the noncompetitive inhibitor tetrabenazine, presently in use for symptomatic treatment of hyperkinetic disorders. During the transport cycle, VMAT is expected to occupy at least three different conformations: cytoplasm-facing, occluded, and lumen-facing. The lumen- to cytoplasm-facing transition, facilitated by protonation of at least one of the essential membrane-embedded carboxyls, generates a binding site for reserpine. Here we have identified residues in the cytoplasmic gate and show that mutations that disrupt the interactions in this gate also shift the equilibrium toward the cytoplasm-facing conformation, emulating the effect of protonation. These experiments provide significant insight into the role of proton translocation in the conformational dynamics of a mammalian H + -coupled antiporter, and also identify key aspects of the mode of action and binding of two potent inhibitors of VMAT2: reserpine binds the cytoplasm-facing conformation, and tetrabenazine binds the lumen-facing conformation.

  19. Weakly Hydrated Surfaces and the Binding Interactions of Small Biological Solutes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brady, J. W.; Tavagnacco, L.; Ehrlich, L.

    2012-04-01

    Extended planar hydrophobic surfaces, such as are found in the side chains of the amino acids histidine, phenylalanine, tyrosine, and tryptophan, exhibit an affinity for the weakly hydrated faces of glucopyranose. In addition, molecular species such as these, including indole, caffeine, and imidazole, exhibit a weak tendency to pair together by hydrophobic stacking in aqueous solution. These interactions can be partially understood in terms of recent models for the hydration of extended hydrophobic faces and should provide insight into the architecture of sugar-binding sites in proteins.

  20. Weakly hydrated surfaces and the binding interactions of small biological solutes.

    PubMed

    Brady, John W; Tavagnacco, Letizia; Ehrlich, Laurent; Chen, Mo; Schnupf, Udo; Himmel, Michael E; Saboungi, Marie-Louise; Cesàro, Attilio

    2012-04-01

    Extended planar hydrophobic surfaces, such as are found in the side chains of the amino acids histidine, phenylalanine, tyrosine, and tryptophan, exhibit an affinity for the weakly hydrated faces of glucopyranose. In addition, molecular species such as these, including indole, caffeine, and imidazole, exhibit a weak tendency to pair together by hydrophobic stacking in aqueous solution. These interactions can be partially understood in terms of recent models for the hydration of extended hydrophobic faces and should provide insight into the architecture of sugar-binding sites in proteins.

  1. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  2. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  3. How proteins bind to DNA: target discrimination and dynamic sequence search by the telomeric protein TRF1

    PubMed Central

    2017-01-01

    Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355

  4. Sulphur shuttling across a chaperone during molybdenum cofactor maturation.

    PubMed

    Arnoux, Pascal; Ruppelt, Christian; Oudouhou, Flore; Lavergne, Jérôme; Siponen, Marina I; Toci, René; Mendel, Ralf R; Bittner, Florian; Pignol, David; Magalon, Axel; Walburger, Anne

    2015-02-04

    Formate dehydrogenases (FDHs) are of interest as they are natural catalysts that sequester atmospheric CO2, generating reduced carbon compounds with possible uses as fuel. FDHs activity in Escherichia coli strictly requires the sulphurtransferase EcFdhD, which likely transfers sulphur from IscS to the molybdenum cofactor (Mo-bisPGD) of FDHs. Here we show that EcFdhD binds Mo-bisPGD in vivo and has submicromolar affinity for GDP-used as a surrogate of the molybdenum cofactor's nucleotide moieties. The crystal structure of EcFdhD in complex with GDP shows two symmetrical binding sites located on the same face of the dimer. These binding sites are connected via a tunnel-like cavity to the opposite face of the dimer where two dynamic loops, each harbouring two functionally important cysteine residues, are present. On the basis of structure-guided mutagenesis, we propose a model for the sulphuration mechanism of Mo-bisPGD where the sulphur atom shuttles across the chaperone dimer.

  5. Sulphur shuttling across a chaperone during molybdenum cofactor maturation

    NASA Astrophysics Data System (ADS)

    Arnoux, Pascal; Ruppelt, Christian; Oudouhou, Flore; Lavergne, Jérôme; Siponen, Marina I.; Toci, René; Mendel, Ralf R.; Bittner, Florian; Pignol, David; Magalon, Axel; Walburger, Anne

    2015-02-01

    Formate dehydrogenases (FDHs) are of interest as they are natural catalysts that sequester atmospheric CO2, generating reduced carbon compounds with possible uses as fuel. FDHs activity in Escherichia coli strictly requires the sulphurtransferase EcFdhD, which likely transfers sulphur from IscS to the molybdenum cofactor (Mo-bisPGD) of FDHs. Here we show that EcFdhD binds Mo-bisPGD in vivo and has submicromolar affinity for GDP—used as a surrogate of the molybdenum cofactor’s nucleotide moieties. The crystal structure of EcFdhD in complex with GDP shows two symmetrical binding sites located on the same face of the dimer. These binding sites are connected via a tunnel-like cavity to the opposite face of the dimer where two dynamic loops, each harbouring two functionally important cysteine residues, are present. On the basis of structure-guided mutagenesis, we propose a model for the sulphuration mechanism of Mo-bisPGD where the sulphur atom shuttles across the chaperone dimer.

  6. Electrostatically Biased Binding of Kinesin to Microtubules

    PubMed Central

    Zheng, Wenjun; Alonso, Maria; Huber, Gary; Dlugosz, Maciej; McCammon, J. Andrew; Cross, Robert A.

    2011-01-01

    The minimum motor domain of kinesin-1 is a single head. Recent evidence suggests that such minimal motor domains generate force by a biased binding mechanism, in which they preferentially select binding sites on the microtubule that lie ahead in the progress direction of the motor. A specific molecular mechanism for biased binding has, however, so far been lacking. Here we use atomistic Brownian dynamics simulations combined with experimental mutagenesis to show that incoming kinesin heads undergo electrostatically guided diffusion-to-capture by microtubules, and that this produces directionally biased binding. Kinesin-1 heads are initially rotated by the electrostatic field so that their tubulin-binding sites face inwards, and then steered towards a plus-endwards binding site. In tethered kinesin dimers, this bias is amplified. A 3-residue sequence (RAK) in kinesin helix alpha-6 is predicted to be important for electrostatic guidance. Real-world mutagenesis of this sequence powerfully influences kinesin-driven microtubule sliding, with one mutant producing a 5-fold acceleration over wild type. We conclude that electrostatic interactions play an important role in the kinesin stepping mechanism, by biasing the diffusional association of kinesin with microtubules. PMID:22140358

  7. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

    PubMed

    Schneider, T D

    2001-12-01

    The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

  8. Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

    PubMed

    Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

    2012-09-01

    Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

  9. Insights on Na(+) binding and conformational dynamics in multidrug and toxic compound extrusion transporter NorM.

    PubMed

    Song, Jianing; Ji, Changge; Zhang, John Z H

    2014-02-01

    MATE (multidrug and toxic compound extrusion) transporter proteins mediate metabolite transport in plants and multidrug resistance in bacteria and mammals. MATE transporter NorM from Vibrio cholerae is an antiporter that is driven by Na+ gradient to extrude the substrates. To understand the molecular mechanism of Na+-substrate exchange, molecular dynamics simulation was performed to study conformational changes of both wild-type and mutant NorM with and without cation bindings. Our results show that NorM is able to bind two Na(+) ions simultaneously, one to each of the carboxylic groups of E255 and D371 in the binding pocket. Furthermore, this di-Na(+) binding state is likely more efficient for conformational changes of NorM_VC toward the inward-facing conformation than single-Na(+) binding state. The observation of two Na(+) binding sites of NorM_VC is consistent with the previous study that two sites for ion binding (denoted as Na1/Na2 sites) are found in the transporter LeuT and BetP, another two secondary transporters. Taken together, our findings shed light on the structure rearrangements of NorM on Na(+) binding and enrich our knowledge of the transport mechanism of secondary transporters. Copyright © 2013 Wiley Periodicals, Inc.

  10. Binding site in eag voltage sensor accommodates a variety of ions and is accessible in closed channel.

    PubMed

    Silverman, William R; Bannister, John P A; Papazian, Diane M

    2004-11-01

    In ether-a-go-go K+ channels, voltage-dependent activation is modulated by ion binding to a site located in an extracellular-facing crevice between transmembrane segments S2 and S3 in the voltage sensor. We find that acidic residues D278 in S2 and D327 in S3 are able to coordinate a variety of divalent cations, including Mg2+, Mn2+, and Ni2+, which have qualitatively similar functional effects, but different half-maximal effective concentrations. Our data indicate that ions binding to individual voltage sensors in the tetrameric channel act without cooperativity to modulate activation gating. We have taken advantage of the unique phenotype of Ni2+ in the D274A channel, which contains a mutation of a nonbinding site residue, to demonstrate that ions can access the binding site from the extracellular solution when the voltage sensor is in the resting conformation. Our results are difficult to reconcile with the x-ray structure of the KvAP K+ channel, in which the binding site residues are widely separated, and with the hydrophobic paddle model for voltage-dependent activation, in which the voltage sensor domain, including the S3-S4 loop, is near the cytoplasmic side of the membrane in the closed channel.

  11. Recognition of U-rich RNA by Hfq from the Gram-positive pathogen Listeria monocytogenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kovach, Alexander R.; Hoff, Kirsten E.; Canty, John T.

    Hfq is a post-transcriptional regulator that binds U- and A-rich regions of sRNAs and their target mRNAs to stimulate their annealing in order to effect translation regulation and, often, to alter their stability. The functional importance of Hfq and its RNA-binding properties are relatively well understood in Gram-negative bacteria, whereas less is known about the RNAbinding properties of this riboregulator in Gram-positive species. Here, we describe the structure of Hfq from the Grampositive pathogen Listeria monocytogenes in its RNA-free form and in complex with a U 6 oligoribonucleotide. As expected, the protein takes the canonical hexameric toroidal shape of allmore » other known Hfq structures. The U 6 RNA binds on the “proximal face” in a pocket formed by conserved residues Q9, N42, F43, and K58. Additionally residues G5 and Q6 are involved in protein-nucleic and inter-subunit contacts that promote uracil specificity. Unlike Staphylococcus aureus (Sa) Hfq, Lm Hfq requires magnesium to bind U 6 with high affinity. In contrast, the longer oligo-uridine, U 16, binds Lm Hfq tightly in the presence or absence of magnesium, thereby suggesting the importance of additional residues on the proximal face and possibly the lateral rim in RNA interaction. Lastly, intrinsic tryptophan fluorescence quenching (TFQ) studies reveal, surprisingly, that Lm Hfq can bind (GU) 3G and U6 on its proximal and distal faces, indicating a less stringent adenine-nucleotide specificity site on the distal face as compared to the Gram-positive Hfq proteins from Sa and Bacillus subtilis and suggesting as yet uncharacterized RNA-binding modes on both faces.« less

  12. Recognition of U-rich RNA by Hfq from the Gram-positive pathogen Listeria monocytogenes

    DOE PAGES

    Kovach, Alexander R.; Hoff, Kirsten E.; Canty, John T.; ...

    2014-08-22

    Hfq is a post-transcriptional regulator that binds U- and A-rich regions of sRNAs and their target mRNAs to stimulate their annealing in order to effect translation regulation and, often, to alter their stability. The functional importance of Hfq and its RNA-binding properties are relatively well understood in Gram-negative bacteria, whereas less is known about the RNAbinding properties of this riboregulator in Gram-positive species. Here, we describe the structure of Hfq from the Grampositive pathogen Listeria monocytogenes in its RNA-free form and in complex with a U 6 oligoribonucleotide. As expected, the protein takes the canonical hexameric toroidal shape of allmore » other known Hfq structures. The U 6 RNA binds on the “proximal face” in a pocket formed by conserved residues Q9, N42, F43, and K58. Additionally residues G5 and Q6 are involved in protein-nucleic and inter-subunit contacts that promote uracil specificity. Unlike Staphylococcus aureus (Sa) Hfq, Lm Hfq requires magnesium to bind U 6 with high affinity. In contrast, the longer oligo-uridine, U 16, binds Lm Hfq tightly in the presence or absence of magnesium, thereby suggesting the importance of additional residues on the proximal face and possibly the lateral rim in RNA interaction. Lastly, intrinsic tryptophan fluorescence quenching (TFQ) studies reveal, surprisingly, that Lm Hfq can bind (GU) 3G and U6 on its proximal and distal faces, indicating a less stringent adenine-nucleotide specificity site on the distal face as compared to the Gram-positive Hfq proteins from Sa and Bacillus subtilis and suggesting as yet uncharacterized RNA-binding modes on both faces.« less

  13. The High-Affinity Binding Site for Tricyclic Antidepressants Resides in the Outer Vestibule of the Serotonin TransporterⓈ

    PubMed Central

    Sarker, Subhodeep; Weissensteiner, René; Steiner, Ilka; Sitte, Harald H.; Ecker, Gerhard F.; Freissmuth, Michael; Sucic, Sonja

    2015-01-01

    The structure of the bacterial leucine transporter from Aquifex aeolicus (LeuTAa) has been used as a model for mammalian Na+/Cl−-dependent transporters, in particular the serotonin transporter (SERT). The crystal structure of LeuTAa liganded to tricyclic antidepressants predicts simultaneous binding of inhibitor and substrate. This is incompatible with the mutually competitive inhibition of substrates and inhibitors of SERT. We explored the binding modes of tricyclic antidepressants by homology modeling and docking studies. Two approaches were used subsequently to differentiate between three clusters of potential docking poses: 1) a diagnostic SERTY95F mutation, which greatly reduced the affinity for [3H]imipramine but did not affect substrate binding; 2) competition binding experiments in the presence and absence of carbamazepine (i.e., a tricyclic imipramine analog with a short side chain that competes with [3H]imipramine binding to SERT). Binding of releasers (para-chloroamphetamine, methylene-dioxy-methamphetamine/ecstasy) and of carbamazepine were mutually exclusive, but Dixon plots generated in the presence of carbamazepine yielded intersecting lines for serotonin, MPP+, paroxetine, and ibogaine. These observations are consistent with a model, in which 1) the tricyclic ring is docked into the outer vestibule and the dimethyl-aminopropyl side chain points to the substrate binding site; 2) binding of amphetamines creates a structural change in the inner and outer vestibule that precludes docking of the tricyclic ring; 3) simultaneous binding of ibogaine (which binds to the inward-facing conformation) and of carbamazepine is indicative of a second binding site in the inner vestibule, consistent with the pseudosymmetric fold of monoamine transporters. This may be the second low-affinity binding site for antidepressants. PMID:20829432

  14. The bacterial dicarboxylate transporter, VcINDY, uses a two-domain elevator-type mechanism

    PubMed Central

    Mulligan, Christopher; Fenollar-Ferrer, Cristina; Fitzgerald, Gabriel A.; Vergara-Jaque, Ariela; Kaufmann, Desirée; Li, Yan; Forrest, Lucy R.; Mindell, Joseph A.

    2016-01-01

    Secondary transporters use alternating access mechanisms to couple uphill substrate movement to downhill ion flux. Most known transporters utilize a “rocking bundle” motion, where the protein moves around an immobile substrate binding site. However, the glutamate transporter homolog, GltPh, translocates its substrate binding site vertically across the membrane, an “elevator” mechanism. Here, we used the “repeat swap” approach to computationally predict the outward-facing state of the Na+/succinate transporter VcINDY, from Vibrio cholerae. Our model predicts a substantial “elevator”-like movement of vcINDY’s substrate binding site, with a vertical translation of ~15 Å and a rotation of ~43°; multiple disulfide crosslinks which completely inhibit transport provide experimental confirmation and demonstrate that such movement is essential. In contrast, crosslinks across the VcINDY dimer interface preserve transport, revealing an absence of large scale coupling between protomers. PMID:26828963

  15. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    PubMed

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Human La binds mRNAs through contacts to the poly(A) tail.

    PubMed

    Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A

    2018-05-04

    In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3'OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3'OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail.

  17. Analysis of flavin oxidation and electron-transfer inhibition in Plasmodium falciparum dihydroorotate dehydrogenase.

    PubMed

    Malmquist, Nicholas A; Gujjar, Ramesh; Rathod, Pradipsinh K; Phillips, Margaret A

    2008-02-26

    Plasmodium falciparum dihydroorotate dehydrogenase (pfDHODH) is a flavin-dependent mitochondrial enzyme that provides the only route to pyrimidine biosynthesis in the parasite. Clinically significant inhibitors of human DHODH (e.g., A77 1726) bind to a pocket on the opposite face of the flavin cofactor from dihydroorotate (DHO). This pocket demonstrates considerable sequence variability, which has allowed species-specific inhibitors of the malarial enzyme to be identified. Ubiquinone (CoQ), the physiological oxidant in the reaction, has been postulated to bind this site despite a lack of structural evidence. To more clearly define the residues involved in CoQ binding and catalysis, we undertook site-directed mutagenesis of seven residues in the structurally defined A77 1726 binding site, which we term the species-selective inhibitor site. Mutation of several of these residues (H185, F188, and F227) to Ala substantially decreased the affinity of pfDHODH-specific inhibitors (40-240-fold). In contrast, only a modest increase in the Kmapp for CoQ was observed, although mutation of Y528 in particular caused a substantial reduction in kcat (40-100-fold decrease). Pre-steady-state kinetic analysis by single wavelength stopped-flow spectroscopy showed that the mutations had no effect on the rate of the DHO-dependent reductive half-reaction, but most reduced the rate of the CoQ-dependent flavin oxidation step (3-20-fold decrease), while not significantly altering the Kdox for CoQ. As with the mutants, inhibitors that bind this site block the CoQ-dependent oxidative half-reaction without affecting the DHO-dependent step. These results identify residues involved in inhibitor binding and electron transfer to CoQ. Importantly, the data provide compelling evidence that the binding sites for CoQ and species-selective site inhibitors do not overlap, and they suggest instead that inhibitors act either by blocking the electron path between flavin and CoQ or by stabilizing a conformation that excludes CoQ binding.

  18. Unbiased Simulations Reveal the Inward-Facing Conformation of the Human Serotonin Transporter and Na+ Ion Release

    PubMed Central

    Koldsø, Heidi; Noer, Pernille; Grouleff, Julie; Autzen, Henriette Elisabeth; Sinning, Steffen; Schiøtt, Birgit

    2011-01-01

    Monoamine transporters are responsible for termination of synaptic signaling and are involved in depression, control of appetite, and anxiety amongst other neurological processes. Despite extensive efforts, the structures of the monoamine transporters and the transport mechanism of ions and substrates are still largely unknown. Structural knowledge of the human serotonin transporter (hSERT) is much awaited for understanding the mechanistic details of substrate translocation and binding of antidepressants and drugs of abuse. The publication of the crystal structure of the homologous leucine transporter has resulted in homology models of the monoamine transporters. Here we present extended molecular dynamics simulations of an experimentally supported homology model of hSERT with and without the natural substrate yielding a total of more than 1.5 µs of simulation of the protein dimer. The simulations reveal a transition of hSERT from an outward-facing occluded conformation to an inward-facing conformation in a one-substrate-bound state. Simulations with a second substrate in the proposed symport effector site did not lead to conformational changes associated with translocation. The central substrate binding site becomes fully exposed to the cytoplasm leaving both the Na+-ion in the Na2-site and the substrate in direct contact with the cytoplasm through water interactions. The simulations reveal how sodium is released and show indications of early events of substrate transport. The notion that ion dissociation from the Na2-site drives translocation is supported by experimental studies of a Na2-site mutant. Transmembrane helices (TMs) 1 and 6 are identified as the helices involved in the largest movements during transport. PMID:22046120

  19. Trench-shaped binding sites promote multiple classes of interactions between collagen and the adherence receptors, alpha(1)beta(1) integrin and Staphylococcus aureus cna MSCRAMM.

    PubMed

    Rich, R L; Deivanayagam, C C; Owens, R T; Carson, M; Höök, A; Moore, D; Symersky, J; Yang, V W; Narayana, S V; Höök, M

    1999-08-27

    Most mammalian cells and some pathogenic bacteria are capable of adhering to collagenous substrates in processes mediated by specific cell surface adherence molecules. Crystal structures of collagen-binding regions of the human integrin alpha(2)beta(1) and a Staphylococcus aureus adhesin reveal a "trench" on the surface of both of these proteins. This trench can accommodate a collagen triple-helical structure and presumably represents the ligand-binding site (Emsley, J., King, S. L., Bergelson, J. M., and Liddington, R. C. (1997) J. Biol. Chem. 272, 28512-28517; Symersky, J., Patti, J. M., Carson, M., House-Pompeo, K., Teale, M., Moore, D., Jin, L., Schneider, A., DeLucas, L. J., Höök, M., and Narayana, S. V. L. (1997) Nat. Struct. Biol. 4, 833-838). We report here the crystal structure of the alpha subunit I domain from the alpha(1)beta(1) integrin. This collagen-binding protein also contains a trench on one face in which the collagen triple helix may be docked. Furthermore, we compare the collagen-binding mechanisms of the human alpha(1) integrin I domain and the A domain from the S. aureus collagen adhesin, Cna. Although the S. aureus and human proteins have unrelated amino acid sequences, secondary structure composition, and cation requirements for effective ligand binding, both proteins bind at multiple sites within one collagen molecule, with the sites in collagen varying in their affinity for the adherence molecule. We propose that (i) these evolutionarily dissimilar adherence proteins recognize collagen via similar mechanisms, (ii) the multisite, multiclass protein/ligand interactions observed in these two systems result from a binding-site trench, and (iii) this unusual binding mechanism may be thematic for proteins binding extended, rigid ligands that contain repeating structural motifs.

  20. An NMR-Based Structural Rationale for Contrasting Stoichiometry and Ligand Binding Site(s) in Fatty Acid-binding Proteins†

    PubMed Central

    He, Yan; Estephan, Rima; Yang, Xiaomin; Vela, Adriana; Wang, Hsin; Bernard, Cédric; Stark, Ruth E.

    2011-01-01

    Liver fatty acid-binding protein (LFABP) is a 14-kDa cytosolic polypeptide, differing from other family members in number of ligand binding sites, diversity of bound ligands, and transfer of fatty acid(s) to membranes primarily via aqueous diffusion rather than direct collisional interactions. Distinct two-dimensional 1H-15N NMR signals indicative of slowly exchanging LFABP assemblies formed during stepwise ligand titration were exploited, without solving the protein-ligand complex structures, to yield the stoichiometries for the bound ligands, their locations within the protein binding cavity, the sequence of ligand occupation, and the corresponding protein structural accommodations. Chemical shifts were monitored for wild-type LFABP and a R122L/S124A mutant in which electrostatic interactions viewed as essential to fatty acid binding were removed. For wild-type LFABP the results compared favorably with previous tertiary structures of oleate-bound wild-type LFABP in crystals and in solution: there are two oleates, one U-shaped ligand that positions the long hydrophobic chain deep within the cavity and another extended structure with the hydrophobic chain facing the cavity and the carboxylate group lying close to the protein surface. The NMR titration validated a prior hypothesis that the first oleate to enter the cavity occupies the internal protein site. In contrast, 1H/15N chemical shift changes supported only one liganded oleate for R122L/S124A LFABP, at an intermediate location within the protein cavity. A rationale based on protein sequence and electrostatics was developed to explain the stoichiometry and binding site trends for LFABPs and to put these findings into context within the larger protein family. PMID:21226535

  1. Aromatic amino acids in the cellulose binding domain of Penicillium crustosum endoglucanase EGL1 differentially contribute to the cellulose affinity of the enzyme

    PubMed Central

    Xiong, Wei; Chen, Fang-Yuan; Xu, Li; Han, Zheng-Gang

    2017-01-01

    The cellulose binding domain (CBD) of cellulase binding to cellulosic materials is the initiation of a synergistic action on the enzymatic hydrolysis of the most abundant renewable biomass resources in nature. The binding of the CBD domain to cellulosic substrates generally relies on the interaction between the aromatic amino acids structurally located on the flat face of the CBD domain and the glucose rings of cellulose. In this study, we found the CBD domain of a newly cloned Penicillium crustosum endoglucanase EGL1, which was phylogenetically related to Aspergillus, Fusarium and Rhizopus, and divergent from the well-characterized Trichoderma reeseis cellulase CBD domain, contain two conserved aromatic amino acid-rich regions, Y451-Y452 and Y477-Y478-Y479, among which three amino acids Y451, Y477, and Y478 structurally sited on a flat face of this domain. Cellulose binding assays with green fluorescence protein as the marker, adsorption isotherm assays and an isothermal titration calorimetry assays revealed that although these three amino acids participated in this process, the Y451-Y452 appears to contribute more to the cellulose binding than Y477-Y478-Y479. Further glycine scanning mutagenesis and structural modelling revealed that the binding between CBD domain and cellulosic materials might be multi-amino-acids that participated in this process. The flexible poly-glucose molecule could contact Y451, Y477, and Y478 which form the contacting flat face of CBD domain as the typical model, some other amino acids in or outside the flat face might also participate in the interaction. Thus, it is possible that the conserved Y451-Y452 of CBD might have a higher chance of contacting the cellulosic substrates, contributing more to the affinity of CBD than the other amino acids. PMID:28475645

  2. Human La binds mRNAs through contacts to the poly(A) tail

    PubMed Central

    Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A

    2018-01-01

    Abstract In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3’OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3’OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail. PMID:29447394

  3. New Cysteine-Rich Ice-Binding Protein Secreted from Antarctic Microalga, Chloromonas sp.

    PubMed

    Jung, Woongsic; Campbell, Robert L; Gwak, Yunho; Kim, Jong Im; Davies, Peter L; Jin, EonSeon

    2016-01-01

    Many microorganisms in Antarctica survive in the cold environment there by producing ice-binding proteins (IBPs) to control the growth of ice around them. An IBP from the Antarctic freshwater microalga, Chloromonas sp., was identified and characterized. The length of the Chloromonas sp. IBP (ChloroIBP) gene was 3.2 kb with 12 exons, and the molecular weight of the protein deduced from the ChloroIBP cDNA was 34.0 kDa. Expression of the ChloroIBP gene was up- and down-regulated by freezing and warming conditions, respectively. Western blot analysis revealed that native ChloroIBP was secreted into the culture medium. This protein has fifteen cysteines and is extensively disulfide bonded as shown by in-gel mobility shifts between oxidizing and reducing conditions. The open-reading frame of ChloroIBP was cloned and over-expressed in Escherichia coli to investigate the IBP's biochemical characteristics. Recombinant ChloroIBP produced as a fusion protein with thioredoxin was purified by affinity chromatography and formed single ice crystals of a dendritic shape with a thermal hysteresis activity of 0.4±0.02°C at a concentration of 5 mg/ml. In silico structural modeling indicated that the three-dimensional structure of ChloroIBP was that of a right-handed β-helix. Site-directed mutagenesis of ChloroIBP showed that a conserved region of six parallel T-X-T motifs on the β-2 face was the ice-binding region, as predicted from the model. In addition to disulfide bonding, hydrophobic interactions between inward-pointing residues on the β-1 and β-2 faces, in the region of ice-binding motifs, were crucial to maintaining the structural conformation of ice-binding site and the ice-binding activity of ChloroIBP.

  4. New Cysteine-Rich Ice-Binding Protein Secreted from Antarctic Microalga, Chloromonas sp.

    PubMed Central

    Jung, Woongsic; Gwak, Yunho; Kim, Jong Im; Davies, Peter L.; Jin, EonSeon

    2016-01-01

    Many microorganisms in Antarctica survive in the cold environment there by producing ice-binding proteins (IBPs) to control the growth of ice around them. An IBP from the Antarctic freshwater microalga, Chloromonas sp., was identified and characterized. The length of the Chloromonas sp. IBP (ChloroIBP) gene was 3.2 kb with 12 exons, and the molecular weight of the protein deduced from the ChloroIBP cDNA was 34.0 kDa. Expression of the ChloroIBP gene was up- and down-regulated by freezing and warming conditions, respectively. Western blot analysis revealed that native ChloroIBP was secreted into the culture medium. This protein has fifteen cysteines and is extensively disulfide bonded as shown by in-gel mobility shifts between oxidizing and reducing conditions. The open-reading frame of ChloroIBP was cloned and over-expressed in Escherichia coli to investigate the IBP’s biochemical characteristics. Recombinant ChloroIBP produced as a fusion protein with thioredoxin was purified by affinity chromatography and formed single ice crystals of a dendritic shape with a thermal hysteresis activity of 0.4±0.02°C at a concentration of 5 mg/ml. In silico structural modeling indicated that the three-dimensional structure of ChloroIBP was that of a right-handed β-helix. Site-directed mutagenesis of ChloroIBP showed that a conserved region of six parallel T-X-T motifs on the β-2 face was the ice-binding region, as predicted from the model. In addition to disulfide bonding, hydrophobic interactions between inward-pointing residues on the β-1 and β-2 faces, in the region of ice-binding motifs, were crucial to maintaining the structural conformation of ice-binding site and the ice-binding activity of ChloroIBP. PMID:27097164

  5. Charged/Polar-Residue Scanning of the Hydrophobic Face of Transmembrane Domain 9 of the Yeast Glutathione Transporter, Hgt1p, Reveals a Conformationally Critical Region for Substrate Transport

    PubMed Central

    Thakur, Anil; Bachhawat, Anand K.

    2015-01-01

    Unraveling the mechanistic workings of membrane transporters has remained a challenging task. We describe a novel strategy that involves subjecting the residues of the hydrophobic face of a transmembrane helix to a charged/polar scanning mutagenesis. TMD9 of the yeast glutathione transporter, Hgt1p, has been identified as being important in substrate binding, and two residues, F523 and Q526, are expected to line the substrate translocation channel while the other face is hydrophobic. The hydrophobic face of TMD9 helix consists of residues A509, V513, L517, L520, I524, and I528, and these were mutated to lysine, glutamine, and glutamic acid. Among the 16 charged mutants created, six were nonfunctional, revealing a surprising tolerance of charged residues in the hydrophobic part of TM helices. Furthermore, the only position that did not tolerate any charged residue was I524, proximal to the substrate binding residues. However, P525, also proximal to the substrate binding residues, did tolerate charged/polar residues, suggesting that mere proximity to the substrate binding residues was not the only factor. The I524K/E/Q mutants expressed well and localized correctly despite lacking any glutathione uptake capability. Isolation of suppressors for all nonfunctional mutants yielded second-site suppressors only for I524K and I524Q, and suppressors for these mutations appeared at G202K/I and G202K/Q, respectively. G202 is in the hydrophilic loop between TMD3 and TMD4. The results suggest that I524 in the hydrophobic face interacts with this region and is also in a conformationally critical region for substrate translocation. PMID:25784163

  6. Understanding transporter specificity and the discrete appearance of channel-like gating domains in transporters

    PubMed Central

    Diallinas, George

    2014-01-01

    Transporters are ubiquitous proteins mediating the translocation of solutes across cell membranes, a biological process involved in nutrition, signaling, neurotransmission, cell communication and drug uptake or efflux. Similarly to enzymes, most transporters have a single substrate binding-site and thus their activity follows Michaelis-Menten kinetics. Substrate binding elicits a series of structural changes, which produce a transporter conformer open toward the side opposite to the one from where the substrate was originally bound. This mechanism, involving alternate outward- and inward-facing transporter conformers, has gained significant support from structural, genetic, biochemical and biophysical approaches. Most transporters are specific for a given substrate or a group of substrates with similar chemical structure, but substrate specificity and/or affinity can vary dramatically, even among members of a transporter family that show high overall amino acid sequence and structural similarity. The current view is that transporter substrate affinity or specificity is determined by a small number of interactions a given solute can make within a specific binding site. However, genetic, biochemical and in silico modeling studies with the purine transporter UapA of the filamentous ascomycete Aspergillus nidulans have challenged this dogma. This review highlights results leading to a novel concept, stating that substrate specificity, but also transport kinetics and transporter turnover, are determined by subtle intramolecular interactions between a major substrate binding site and independent outward- or cytoplasmically-facing gating domains, analogous to those present in channels. This concept is supported by recent structural evidence from several, phylogenetically and functionally distinct transporter families. The significance of this concept is discussed in relationship to the role and potential exploitation of transporters in drug action. PMID:25309439

  7. Mistletoe lectin I in complex with galactose and lactose reveals distinct sugar-binding properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikeska, Ruth; Wacker, Roland; Arni, Raghuvir

    2005-01-01

    The structures of mistletoe lectin I in complex with lactose and galactose reveal differences in binding by the two known sites in subdomains α1 and γ2 and suggest the presence of a third low-affinity site in subdomain β1. The structures of mistletoe lectin I (ML-I) from Viscum album complexed with lactose and galactose have been determined at 2.3 Å resolution and refined to R factors of 20.9% (R{sub free} = 23.6%) and 20.9 (R{sub free} = 24.6%), respectively. ML-I is a heterodimer and belongs to the class of ribosome-inactivating proteins of type II, which consist of two chains. The A-chainmore » has rRNA N-glycosidase activity and irreversibly inhibits eukaryotic ribosomes. The B-chain is a lectin and preferentially binds to galactose-terminated glycolipids and glycoproteins on cell membranes. Saccharide binding is performed by two binding sites in subdomains α1 and γ2 of the ML-I B-chain separated by ∼62 Å from each other. The favoured binding of galactose in subdomain α1 is achieved via hydrogen bonds connecting the 4-hydroxyl and 3-hydroxyl groups of the sugar moiety with the side chains of Asp23B, Gln36B and Lys41B and the main chain of 26B. The aromatic ring of Trp38B on top of the preferred binding pocket supports van der Waals packing of the apolar face of galactose and stabilizes the sugar–lectin complex. In the galactose-binding site II of subdomain γ2, Tyr249B provides the hydrophobic stacking and the side chains of Asp235B, Gln238B and Asn256B are hydrogen-bonding partners for galactose. In the case of the galactose-binding site I, the 2-hydroxyl group also stabilizes the sugar–protein complex, an interaction thus far rarely detected in galactose-specific lectins. Finally, a potential third low-affinity galactose-binding site in subunit β1 was identified in the present ML-I structures, in which a glycerol molecule from the cryoprotectant buffer has bound, mimicking the sugar compound.« less

  8. The action of blocking agents applied to the inner face of Ca(2+)-activated K+ channels from human erythrocytes.

    PubMed

    Dunn, P M

    1998-09-15

    The actions of clotrimazole and cetiedil, two drugs known to inhibit the Gardos channel, have been studied on single intermediate conductance calcium-activated potassium (IKCa) channels in inside out patches from human red blood cells, and compared with those of TEA and Ba2+ applied to the cytoplasmic face of the membrane. TEA produced a fast block which was observed as a reduction in the amplitude of the single channel current. This effect was weakly voltage dependent with the fraction of the membrane potential sensed by TEA at its binding site (delta) of 0.18 and a Kd at 0 mV of 20.5 mM. Ba2+ was a very potent blocker of the channel, breaking the single channel activity up into bursts, inter-spersed with silent periods lasting several seconds. The effect of Ba2+ was very voltage sensitive, delta = 0.44, and a Kd at 0 mV of 0.15 microM. Clotrimazole applied to the inner face of the membrane at a concentration < or = 1 microM produced a slow block resulting in bursts of channel activity separated by quiescent periods lasting many seconds. The effect of clotrimazole was mimicked by a quaternary derivative UCL 1559, in keeping with an action at the cytoplasmic face of the channel. A high concentration of cetiedil (100 microM) produced only a weak block of the channel. The kinetics of this action were very slow, with burst and inter-burst intervals lasting several minutes. While inhibition of the Gardos channel by cetiedil is unlikely to involve an intracellular site of action, if clotrimazole is able to penetrate the membrane, part of its effect may result from binding to an intracellular site on the channel.

  9. Aspartic acid 397 in subunit B of the Na+-pumping NADH:quinone oxidoreductase from Vibrio cholerae forms part of a sodium-binding site, is involved in cation selectivity, and affects cation-binding site cooperativity.

    PubMed

    Shea, Michael E; Juárez, Oscar; Cho, Jonathan; Barquera, Blanca

    2013-10-25

    The Na(+)-pumping NADH:quinone complex is found in Vibrio cholerae and other marine and pathogenic bacteria. NADH:ubiquinone oxidoreductase oxidizes NADH and reduces ubiquinone, using the free energy released by this reaction to pump sodium ions across the cell membrane. In a previous report, a conserved aspartic acid residue in the NqrB subunit at position 397, located in the cytosolic face of this protein, was proposed to be involved in the capture of sodium. Here, we studied the role of this residue through the characterization of mutant enzymes in which this aspartic acid was substituted by other residues that change charge and size, such as arginine, serine, lysine, glutamic acid, and cysteine. Our results indicate that NqrB-Asp-397 forms part of one of the at least two sodium-binding sites and that both size and charge at this position are critical for the function of the enzyme. Moreover, we demonstrate that this residue is involved in cation selectivity, has a critical role in the communication between sodium-binding sites, by promoting cooperativity, and controls the electron transfer step involved in sodium uptake (2Fe-2S → FMNC).

  10. Aspartic Acid 397 in Subunit B of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae Forms Part of a Sodium-binding Site, Is Involved in Cation Selectivity, and Affects Cation-binding Site Cooperativity

    PubMed Central

    Shea, Michael E.; Juárez, Oscar; Cho, Jonathan; Barquera, Blanca

    2013-01-01

    The Na+-pumping NADH:quinone complex is found in Vibrio cholerae and other marine and pathogenic bacteria. NADH:ubiquinone oxidoreductase oxidizes NADH and reduces ubiquinone, using the free energy released by this reaction to pump sodium ions across the cell membrane. In a previous report, a conserved aspartic acid residue in the NqrB subunit at position 397, located in the cytosolic face of this protein, was proposed to be involved in the capture of sodium. Here, we studied the role of this residue through the characterization of mutant enzymes in which this aspartic acid was substituted by other residues that change charge and size, such as arginine, serine, lysine, glutamic acid, and cysteine. Our results indicate that NqrB-Asp-397 forms part of one of the at least two sodium-binding sites and that both size and charge at this position are critical for the function of the enzyme. Moreover, we demonstrate that this residue is involved in cation selectivity, has a critical role in the communication between sodium-binding sites, by promoting cooperativity, and controls the electron transfer step involved in sodium uptake (2Fe-2S → FMNC). PMID:24030824

  11. Identification of an Inhibitory Alcohol Binding Site in GABAA ρ1 Receptors

    PubMed Central

    Borghese, Cecilia M.; Ruiz, Carlos I.; Lee, Ui S.; Cullins, Madeline A.; Bertaccini, Edward J.; Trudell, James R.; Harris, R. Adron

    2016-01-01

    Alcohols inhibit γ-aminobutyric acid type A ρ1 receptor function. After introducing mutations in several positions of the second transmembrane helix in ρ1, we studied the effects of ethanol and hexanol on GABA responses using two-electrode voltage clamp electrophysiology in Xenopus laevis oocytes. The 6′ mutations produced the following effects on ethanol and hexanol responses: small increase or no change (T6′M), increased inhibition (T6′V) and small potentiation (T6′Y and T6′F). The 5′ mutations produced mainly increases in hexanol inhibition. Other mutations produced small (3′ and 9′) or no changes (2′ and L277 in the first transmembrane domain) in alcohol effects. These results suggest an inhibitory alcohol binding site near the 6′ position. Homology models of ρ1 receptors based on the X-ray structure of GluCl showed that the 2′, 5′, 6’ and 9′ residues were easily accessible from the ion pore, with 5′ and 6′ residues from neighboring subunits facing each other; L3′ and L277 also faced the neighboring subunit. We tested ethanol through octanol on single and double mutated ρ1 receptors [ρ1(I15′S), ρ1(T6′Y) and ρ1(T6′Y,I15′S)] to further characterize the inhibitory alcohol pocket in the wild-type ρ1 receptor. The pocket can only bind relatively short-chain alcohols and is eliminated by introducing Y in the 6’ position. Replacing the bulky 15′ residue with a smaller side chain introduced a potentiating binding site, more sensitive to long-chain than to short-chain alcohols. In conclusion, the net alcohol effect on the ρ1 receptor is determined by the sum of its actions on inhibitory and potentiating sites. PMID:26571107

  12. Crystal structure of a minimal eIF4E–Cup complex reveals a general mechanism of eIF4E regulation in translational repression

    PubMed Central

    Kinkelin, Kerstin; Veith, Katharina; Grünwald, Marlene; Bono, Fulvia

    2012-01-01

    Cup is an eIF4E-binding protein (4E-BP) that plays a central role in translational regulation of localized mRNAs during early Drosophila development. In particular, Cup is required for repressing translation of the maternally contributed oskar, nanos, and gurken mRNAs, all of which are essential for embryonic body axis determination. Here, we present the 2.8 Å resolution crystal structure of a minimal eIF4E–Cup assembly, consisting of the interacting regions of the two proteins. In the structure, two separate segments of Cup contact two orthogonal faces of eIF4E. The eIF4E-binding consensus motif of Cup (YXXXXLΦ) binds the convex side of eIF4E similarly to the consensus of other eIF4E-binding proteins, such as 4E-BPs and eIF4G. The second, noncanonical, eIF4E-binding site of Cup binds laterally and perpendicularly to the eIF4E β-sheet. Mutations of Cup at this binding site were shown to reduce binding to eIF4E and to promote the destabilization of the associated mRNA. Comparison with the binding mode of eIF4G to eIF4E suggests that Cup and eIF4G binding would be mutually exclusive at both binding sites. This shows how a common molecular surface of eIF4E might recognize different proteins acting at different times in the same pathway. The structure provides insight into the mechanism by which Cup disrupts eIF4E–eIF4G interaction and has broader implications for understanding the role of 4E-BPs in translational regulation. PMID:22832024

  13. Electrostatic interactions guide the active site face of a structure-specific ribonuclease to its RNA substrate.

    PubMed

    Plantinga, Matthew J; Korennykh, Alexei V; Piccirilli, Joseph A; Correll, Carl C

    2008-08-26

    Restrictocin, a member of the alpha-sarcin family of site-specific endoribonucleases, uses electrostatic interactions to bind to the ribosome and to RNA oligonucleotides, including the minimal specific substrate, the sarcin/ricin loop (SRL) of 23S-28S rRNA. Restrictocin binds to the SRL by forming a ground-state E:S complex that is stabilized predominantly by Coulomb interactions and depends on neither the sequence nor structure of the RNA, suggesting a nonspecific complex. The 22 cationic residues of restrictocin are dispersed throughout this protein surface, complicating a priori identification of a Coulomb interacting surface. Structural studies have identified an enzyme-substrate interface, which is expected to overlap with the electrostatic E:S interface. Here, we identified restrictocin residues that contribute to binding in the E:S complex by determining the salt dependence [partial differential log(k 2/ K 1/2)/ partial differential log[KCl

  14. Structural Basis for the Recognition of Tyrosine-based Sorting Signals by the μ3A Subunit of the AP-3 Adaptor Complex*

    PubMed Central

    Mardones, Gonzalo A.; Burgos, Patricia V.; Lin, Yimo; Kloer, Daniel P.; Magadán, Javier G.; Hurley, James H.; Bonifacino, Juan S.

    2013-01-01

    Tyrosine-based signals fitting the YXXØ motif mediate sorting of transmembrane proteins to endosomes, lysosomes, the basolateral plasma membrane of polarized epithelial cells, and the somatodendritic domain of neurons through interactions with the homologous μ1, μ2, μ3, and μ4 subunits of the corresponding AP-1, AP-2, AP-3, and AP-4 complexes. Previous x-ray crystallographic analyses identified distinct binding sites for YXXØ signals on μ2 and μ4, which were located on opposite faces of the proteins. To elucidate the mode of recognition of YXXØ signals by other members of the μ family, we solved the crystal structure at 1.85 Å resolution of the C-terminal domain of the μ3 subunit of AP-3 (isoform A) in complex with a peptide encoding a YXXØ signal (SDYQRL) from the trans-Golgi network protein TGN38. The μ3A C-terminal domain consists of an immunoglobulin-like β-sandwich organized into two subdomains, A and B. The YXXØ signal binds in an extended conformation to a site on μ3A subdomain A, at a location similar to the YXXØ-binding site on μ2 but not μ4. The binding sites on μ3A and μ2 exhibit similarities and differences that account for the ability of both proteins to bind distinct sets of YXXØ signals. Biochemical analyses confirm the identification of the μ3A site and show that this protein binds YXXØ signals with 14–19 μm affinity. The surface electrostatic potential of μ3A is less basic than that of μ2, in part explaining the association of AP-3 with intracellular membranes having less acidic phosphoinositides. PMID:23404500

  15. Structural basis for the recognition of tyrosine-based sorting signals by the μ3A subunit of the AP-3 adaptor complex.

    PubMed

    Mardones, Gonzalo A; Burgos, Patricia V; Lin, Yimo; Kloer, Daniel P; Magadán, Javier G; Hurley, James H; Bonifacino, Juan S

    2013-03-29

    Tyrosine-based signals fitting the YXXØ motif mediate sorting of transmembrane proteins to endosomes, lysosomes, the basolateral plasma membrane of polarized epithelial cells, and the somatodendritic domain of neurons through interactions with the homologous μ1, μ2, μ3, and μ4 subunits of the corresponding AP-1, AP-2, AP-3, and AP-4 complexes. Previous x-ray crystallographic analyses identified distinct binding sites for YXXØ signals on μ2 and μ4, which were located on opposite faces of the proteins. To elucidate the mode of recognition of YXXØ signals by other members of the μ family, we solved the crystal structure at 1.85 Å resolution of the C-terminal domain of the μ3 subunit of AP-3 (isoform A) in complex with a peptide encoding a YXXØ signal (SDYQRL) from the trans-Golgi network protein TGN38. The μ3A C-terminal domain consists of an immunoglobulin-like β-sandwich organized into two subdomains, A and B. The YXXØ signal binds in an extended conformation to a site on μ3A subdomain A, at a location similar to the YXXØ-binding site on μ2 but not μ4. The binding sites on μ3A and μ2 exhibit similarities and differences that account for the ability of both proteins to bind distinct sets of YXXØ signals. Biochemical analyses confirm the identification of the μ3A site and show that this protein binds YXXØ signals with 14-19 μm affinity. The surface electrostatic potential of μ3A is less basic than that of μ2, in part explaining the association of AP-3 with intracellular membranes having less acidic phosphoinositides.

  16. Occupancy of the Zinc-binding Site by Transition Metals Decreases the Substrate Affinity of the Human Dopamine Transporter by an Allosteric Mechanism*

    PubMed Central

    Li, Yang; Mayer, Felix P.; Hasenhuetl, Peter S.; Burtscher, Verena; Schicker, Klaus; Sitte, Harald H.; Freissmuth, Michael; Sandtner, Walter

    2017-01-01

    The human dopamine transporter (DAT) has a tetrahedral Zn2+-binding site. Zn2+-binding sites are also recognized by other first-row transition metals. Excessive accumulation of manganese or of copper can lead to parkinsonism because of dopamine deficiency. Accordingly, we examined the effect of Mn2+, Co2+, Ni2+, and Cu2+ on transport-associated currents through DAT and DAT-H193K, a mutant with a disrupted Zn2+-binding site. All transition metals except Mn2+ modulated the transport cycle of wild-type DAT with affinities in the low micromolar range. In this concentration range, they were devoid of any action on DAT-H193K. The active transition metals reduced the affinity of DAT for dopamine. The affinity shift was most pronounced for Cu2+, followed by Ni2+ and Zn2+ (= Co2+). The extent of the affinity shift and the reciprocal effect of substrate on metal affinity accounted for the different modes of action: Ni2+ and Cu2+ uniformly stimulated and inhibited, respectively, the substrate-induced steady-state currents through DAT. In contrast, Zn2+ elicited biphasic effects on transport, i.e. stimulation at 1 μm and inhibition at 10 μm. A kinetic model that posited preferential binding of transition metal ions to the outward-facing apo state of DAT and a reciprocal interaction of dopamine and transition metals recapitulated all experimental findings. Allosteric activation of DAT via the Zn2+-binding site may be of interest to restore transport in loss-of-function mutants. PMID:28096460

  17. Intrinsic Pleckstrin Homology (PH) Domain Motion in Phospholipase C-β Exposes a Gβγ Protein Binding Site.

    PubMed

    Kadamur, Ganesh; Ross, Elliott M

    2016-05-20

    Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Intrinsic Pleckstrin Homology (PH) Domain Motion in Phospholipase C-β Exposes a Gβγ Protein Binding Site*

    PubMed Central

    Kadamur, Ganesh

    2016-01-01

    Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. PMID:27002154

  19. Programming A Molecular Relay for Ultrasensitive Biodetection through 129 Xe NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yanfei; Roose, Benjamin W.; Philbin, John P.

    2015-12-21

    We reported a supramolecular strategy for detecting specific proteins in complex media by using hyperpolarized 129Xe NMR. A cucurbit[6]uril (CB[6])-based molecular relay was programmed for three sequential equilibrium conditions by designing a two-faced guest (TFG) that initially binds CB[6] and blocks the CB[6]–Xe interaction. Moreover, the protein analyte recruits the TFG and frees CB[6] for Xe binding. TFGs containing CB[6]- and carbonic anhydrase II (CAII)-binding domains were synthesized in one or two steps. X-ray crystallography confirmed TFG binding to Zn 2+ in the deep CAII active-site cleft, which precludes simultaneous CB[6] binding. The molecular relay was reprogrammed to detect avidinmore » by using a different TFG. Finally, Xe binding by CB[6] was detected in buffer and in E. coli cultures expressing CAII through ultrasensitive 129Xe NMR spectroscopy.« less

  20. Gating Topology of the Proton-Coupled Oligopeptide Symporters

    PubMed Central

    Fowler, Philip W.; Orwick-Rydmark, Marcella; Radestock, Sebastian; Solcan, Nicolae; Dijkman, Patricia M.; Lyons, Joseph A.; Kwok, Jane; Caffrey, Martin; Watts, Anthony; Forrest, Lucy R.; Newstead, Simon

    2015-01-01

    Summary Proton-coupled oligopeptide transporters belong to the major facilitator superfamily (MFS) of membrane transporters. Recent crystal structures suggest the MFS fold facilitates transport through rearrangement of their two six-helix bundles around a central ligand binding site; how this is achieved, however, is poorly understood. Using modeling, molecular dynamics, crystallography, functional assays, and site-directed spin labeling combined with double electron-electron resonance (DEER) spectroscopy, we present a detailed study of the transport dynamics of two bacterial oligopeptide transporters, PepTSo and PepTSt. Our results identify several salt bridges that stabilize outward-facing conformations and we show that, for all the current structures of MFS transporters, the first two helices of each of the four inverted-topology repeat units form half of either the periplasmic or cytoplasmic gate and that these function cooperatively in a scissor-like motion to control access to the peptide binding site during transport. PMID:25651061

  1. Structure- and Modeling-based Identification of the Adenovirus E4orf4 Binding Site in the Protein Phosphatase 2A B55α Subunit*

    PubMed Central

    Horowitz, Ben; Sharf, Rakefet; Avital-Shacham, Meirav; Pechkovsky, Antonina; Kleinberger, Tamar

    2013-01-01

    The adenovirus E4orf4 protein regulates the progression of viral infection and when expressed outside the context of the virus it induces nonclassical, cancer cell-specific apoptosis. All E4orf4 functions known to date require an interaction between E4orf4 and protein phosphatase 2A (PP2A), which is mediated through PP2A regulatory B subunits. Specifically, an interaction with the B55α subunit is required for induction of cell death by E4orf4. To gain a better insight into the E4orf4-PP2A interaction, mapping of the E4orf4 interaction site in PP2A-B55α has been undertaken. To this end we used a combination of bioinformatics analyses of PP2A-B55α and of E4orf4, which led to the prediction of E4orf4 binding sites on the surface of PP2A-B55α. Mutation analysis, immunoprecipitation, and GST pulldown assays based on the theoretical predictions revealed that the E4orf4 binding site included the α1 and α2 helices described in the B55α structure and involved at least three residues located in these helices facing each other. Loss of E4orf4 binding was accompanied by reduced contribution of the B55α mutants to E4orf4-induced cell death. The identified E4orf4 binding domain lies above the previously described substrate binding site and does not overlap it, although its location could be consistent with direct or indirect effects on substrate binding. This work assigns for the first time a functional significance to the α1,α2 helices of B55α, and we suggest that the binding site defined by these helices could also contribute to interactions between PP2A and some of its cellular regulators. PMID:23530045

  2. DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

    PubMed Central

    Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

    2000-01-01

    The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

  3. Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

    PubMed

    Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

    2013-06-14

    Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

  4. Comparative evaluation of several docking tools for docking small molecule ligands to DC-SIGN.

    PubMed

    Jug, Gregor; Anderluh, Marko; Tomašič, Tihomir

    2015-06-01

    Five docking tools, namely AutoDock, FRED, CDOCKER, FlexX and GOLD, have been critically examined, with the aim of selecting those most appropriate for use as docking tools for docking molecules to the lectin dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN). This lectin has been selected for its rather non-druggable binding site, which enables complex interactions that guide the binding of the core monosaccharide. Since optimal orientation is crucial for forming coordination bonds, it was important to assess whether the selected docking tools could reproduce the optimal binding conformation for several oligosaccharides that are known to bind DC-SIGN. Our results show that even widely used docking programs have certain limitations when faced with a rather shallow and featureless binding site, as is the case of DC-SIGN. The FRED docking software (OpenEye Scientific Software, Inc.) was found to score as the best tool for docking ligands to DC-SIGN. The performance of FRED was further assessed on another lectin, Langerin. We have demonstrated that this validated docking protocol could be used for docking to other lectins similar to DC-SIGN.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Jun; Byrne, Noel; Wang, John

    Clinical studies indicate that partial agonists of the G-protein-coupled, free fatty acid receptor 1 GPR40 enhance glucose-dependent insulin secretion and represent a potential mechanism for the treatment of type 2 diabetes mellitus. Full allosteric agonists (AgoPAMs) of GPR40 bind to a site distinct from partial agonists and can provide additional efficacy. We report the 3.2-Å crystal structure of human GPR40 (hGPR40) in complex with both the partial agonist MK-8666 and an AgoPAM, which exposes a novel lipid-facing AgoPAM-binding pocket outside the transmembrane helical bundle. Comparison with an additional 2.2-Å structure of the hGPR40–MK-8666 binary complex reveals an induced-fit conformational couplingmore » between the partial agonist and AgoPAM binding sites, involving rearrangements of the transmembrane helices 4 and 5 (TM4 and TM5) and transition of the intracellular loop 2 (ICL2) into a short helix. These conformational changes likely prime GPR40 to a more active-like state and explain the binding cooperativity between these ligands.« less

  6. The fundamental ribosomal RNA transcription initiation factor-IB (TIF-IB, SL1, factor D) binds to the rRNA core promoter primarily by minor groove contacts.

    PubMed

    Geiss, G K; Radebaugh, C A; Paule, M R

    1997-11-14

    Acanthamoeba castellanii transcription initiation factor-IB (TIF-IB) is the TATA-binding protein-containing transcription factor that binds the rRNA promoter to form the committed complex. Minor groove-specific drugs inhibit TIF-IB binding, with higher concentrations needed to disrupt preformed complexes because of drug exclusion by bound TIF-IB. TIF-IB/DNA interactions were mapped by hydroxyl radical and uranyl nitrate footprinting. TIF-IB contacts four minor grooves in its binding site. TIF-IB and DNA wrap around each other in a right-handed superhelix of high pitch, so the upstream and downstream contacts are on opposite faces of the helix. Dimethyl sulfate protection assays revealed limited contact with a few guanines in the major groove. This detailed analysis suggests significant DNA conformation dependence of the interaction.

  7. Structural basis of Na(+)-independent and cooperative substrate/product antiport in CaiT.

    PubMed

    Schulze, Sabrina; Köster, Stefan; Geldmacher, Ulrike; Terwisscha van Scheltinga, Anke C; Kühlbrandt, Werner

    2010-09-09

    Transport of solutes across biological membranes is performed by specialized secondary transport proteins in the lipid bilayer, and is essential for life. Here we report the structures of the sodium-independent carnitine/butyrobetaine antiporter CaiT from Proteus mirabilis (PmCaiT) at 2.3-A and from Escherichia coli (EcCaiT) at 3.5-A resolution. CaiT belongs to the family of betaine/carnitine/choline transporters (BCCT), which are mostly Na(+) or H(+) dependent, whereas EcCaiT is Na(+) and H(+) independent. The three-dimensional architecture of CaiT resembles that of the Na(+)-dependent transporters LeuT and BetP, but in CaiT a methionine sulphur takes the place of the Na(+) ion to coordinate the substrate in the central transport site, accounting for Na(+)-independent transport. Both CaiT structures show the fully open, inward-facing conformation, and thus complete the set of functional states that describe the alternating access mechanism. EcCaiT contains two bound butyrobetaine substrate molecules, one in the central transport site, the other in an extracellular binding pocket. In the structure of PmCaiT, a tryptophan side chain occupies the transport site, and access to the extracellular site is blocked. Binding of both substrates to CaiT reconstituted into proteoliposomes is cooperative, with Hill coefficients up to 1.7, indicating that the extracellular site is regulatory. We propose a mechanism whereby the occupied regulatory site increases the binding affinity of the transport site and initiates substrate translocation.

  8. Structural Insights into the Assembly of the Adeno-associated Virus Type 2 Rep68 Protein on the Integration Site AAVS1*

    PubMed Central

    Musayev, Faik N.; Zarate-Perez, Francisco; Bishop, Clayton; Burgner, John W.; Escalante, Carlos R.

    2015-01-01

    Adeno-associated virus (AAV) is the only eukaryotic virus with the property of establishing latency by integrating site-specifically into the human genome. The integration site known as AAVS1 is located in chromosome 19 and contains multiple GCTC repeats that are recognized by the AAV non-structural Rep proteins. These proteins are multifunctional, with an N-terminal origin-binding domain (OBD) and a helicase domain joined together by a short linker. As a first step to understand the process of site-specific integration, we proceeded to characterize the recognition and assembly of Rep68 onto the AAVS1 site. We first determined the x-ray structure of AAV-2 Rep68 OBD in complex with the AAVS1 DNA site. Specificity is achieved through the interaction of a glycine-rich loop that binds the major groove and an α-helix that interacts with a downstream minor groove on the same face of the DNA. Although the structure shows a complex with three OBD molecules bound to the AAVS1 site, we show by using analytical centrifugation and electron microscopy that the full-length Rep68 forms a heptameric complex. Moreover, we determined that a minimum of two direct repeats is required to form a stable complex and to melt DNA. Finally, we show that although the individual domains bind DNA poorly, complex assembly requires oligomerization and cooperation between its OBD, helicase, and the linker domains. PMID:26370092

  9. Protonation of key acidic residues is critical for the K+-selectivity of the Na/K pump

    PubMed Central

    Yu, Haibo; Ratheal, Ian; Artigas, Pablo; Roux, Benoît

    2011-01-01

    The sodium-potassium (Na/K) pump is a P-type ATPase that generates Na+ and K+ concentration gradients across the cell membrane. For each ATP molecule, the pump extrudes three Na+ and imports two K+ by alternating between outward- and inward-facing conformations that preferentially bind K+ or Na+, respectively. Remarkably, the selective K+ and Na+ binding sites share several residues, and how the pump is able to achieve the selectivity required for the functional cycle is unclear. Here, free energy perturbation molecular dynamics (FEP/MD) simulations based on the crystal structures of the Na/K pump in a K+-loaded state (E2·Pi) reveal that protonation of the high-field acidic side-chains involved in the binding sites is critical to achieve the proper K+ selectivity. This prediction is tested with electrophysiological experiments showing that the selectivity of the E2P state for K+ over Na+ is affected by extracellular pH. PMID:21909093

  10. Contributions of residues of pancreatic phospholipase A2 to interfacial binding, catalysis, and activation.

    PubMed

    Yu, B Z; Rogers, J; Tsai, M D; Pidgeon, C; Jain, M K

    1999-04-13

    Primary rate and equilibrium parameters for 60 site-directed mutants of bovine pancreatic phospholipase A2 (PLA2) are analyzed so incremental contributions of the substitution of specific residues can be evaluated. The magnitude of the change is evaluated so a functional role in the context of the N- and C-domains of PLA2 can be assigned, and their relationship to the catalytic residues and to the i-face that makes contact with the interface. The effect of substitutions and interfacial charge is characterized by the equilibrium dissociation constant for dissociation of the bound enzyme from the interface (Kd), the dissociation constant for dissociation of a substrate mimic from the active site of the bound enzyme (KL), and the interfacial Michaelis constants, KM and kcat. Activity is lost (>99.9%) on the substitution of H48 and D49, the catalytic residues. A more than 95% decrease in kcat is seen with the substitution of F5, I9, D99, A102, or F106, which form the substrate binding pocket. Certain residues, which are not part of the catalytic site or the substrate binding pocket, also modulate kcat. Interfacial anionic charge lowers Kd, and induces kcat activation through K56, K53, K119, or K120. Significant changes in KL are seen by the substitution of N6, I9, F22, Y52, K53, N71, Y73, A102, or A103. Changes in KM [=(k2+k-1)/k1] are attributed to kcat (=k2) and KL (=k-1/k1). Some substitutions change more than one parameter, implying an allosteric effect of the binding to the interface on KS, and the effect of the interfacial anionic charge on kcat. Interpreted in the context of the overall structure, results provide insights into the role of segments and domains in the microscopic events of catalytic turnover and processivity, and their allosteric regulation. We suggest that the interfacial recognition region (i-face) of PLA2, due to the plasticity of certain segments and domains, exercises an allosteric control on the substrate binding and chemical step.

  11. Importance of the Extracellular Loop 4 in the Human Serotonin Transporter for Inhibitor Binding and Substrate Translocation*

    PubMed Central

    Rannversson, Hafsteinn; Wilson, Pamela; Kristensen, Kristina Birch; Sinning, Steffen; Kristensen, Anders Skov; Strømgaard, Kristian; Andersen, Jacob

    2015-01-01

    The serotonin transporter (SERT) terminates serotonergic neurotransmission by performing reuptake of released serotonin, and SERT is the primary target for antidepressants. SERT mediates the reuptake of serotonin through an alternating access mechanism, implying that a central substrate site is connected to both sides of the membrane by permeation pathways, of which only one is accessible at a time. The coordinated conformational changes in SERT associated with substrate translocation are not fully understood. Here, we have identified a Leu to Glu mutation at position 406 (L406E) in the extracellular loop 4 (EL4) of human SERT, which induced a remarkable gain-of-potency (up to >40-fold) for a range of SERT inhibitors. The effects were highly specific for L406E relative to six other mutations in the same position, including the closely related L406D mutation, showing that the effects induced by L406E are not simply charge-related effects. Leu406 is located >10 Å from the central inhibitor binding site indicating that the mutation affects inhibitor binding in an indirect manner. We found that L406E decreased accessibility to a residue in the cytoplasmic pathway. The shift in equilibrium to favor a more outward-facing conformation of SERT can explain the reduced turnover rate and increased association rate of inhibitor binding we found for L406E. Together, our findings show that EL4 allosterically can modulate inhibitor binding within the central binding site, and substantiates that EL4 has an important role in controlling the conformational equilibrium of human SERT. PMID:25903124

  12. Structures of a Na+-coupled, substrate-bound MATE multidrug transporter

    PubMed Central

    Lu, Min; Symersky, Jindrich; Radchenko, Martha; Koide, Akiko; Guo, Yi; Nie, Rongxin; Koide, Shohei

    2013-01-01

    Multidrug transporters belonging to the multidrug and toxic compound extrusion (MATE) family expel dissimilar lipophilic and cationic drugs across cell membranes by dissipating a preexisting Na+ or H+ gradient. Despite its clinical relevance, the transport mechanism of MATE proteins remains poorly understood, largely owing to a lack of structural information on the substrate-bound transporter. Here we report crystal structures of a Na+-coupled MATE transporter NorM from Neisseria gonorrheae in complexes with three distinct translocation substrates (ethidium, rhodamine 6G, and tetraphenylphosphonium), as well as Cs+ (a Na+ congener), all captured in extracellular-facing and drug-bound states. The structures revealed a multidrug-binding cavity festooned with four negatively charged amino acids and surprisingly limited hydrophobic moieties, in stark contrast to the general belief that aromatic amino acids play a prominent role in multidrug recognition. Furthermore, we discovered an uncommon cation–π interaction in the Na+-binding site located outside the drug-binding cavity and validated the biological relevance of both the substrate- and cation-binding sites by conducting drug resistance and transport assays. Additionally, we uncovered potential rearrangement of at least two transmembrane helices upon Na+-induced drug export. Based on our structural and functional analyses, we suggest that Na+ triggers multidrug extrusion by inducing protein conformational changes rather than by directly competing for the substrate-binding amino acids. This scenario is distinct from the canonical antiport mechanism, in which both substrate and counterion compete for a shared binding site in the transporter. Collectively, our findings provide an important step toward a detailed and mechanistic understanding of multidrug transport. PMID:23341609

  13. Plasmid replication initiator RepB forms a hexamer reminiscent of ring helicases and has mobile nuclease domains

    PubMed Central

    Boer, D Roeland; Ruíz-Masó, José A; López-Blanco, José R; Blanco, Alexander G; Vives-Llàcer, Mireia; Chacón, Pablo; Usón, Isabel; Gomis-Rüth, F Xavier; Espinosa, Manuel; Llorca, Oscar; del Solar, Gloria; Coll, Miquel

    2009-01-01

    RepB initiates plasmid rolling-circle replication by binding to a triple 11-bp direct repeat (bind locus) and cleaving the DNA at a specific distant site located in a hairpin loop within the nic locus of the origin. The structure of native full-length RepB reveals a hexameric ring molecule, where each protomer has two domains. The origin-binding and catalytic domains show a three-layer α–β–α sandwich fold. The active site is positioned at one of the faces of the β-sheet and coordinates a Mn2+ ion at short distance from the essential nucleophilic Y99. The oligomerization domains (ODs), each consisting of four α-helices, together define a compact ring with a central channel, a feature found in ring helicases. The toroidal arrangement of RepB suggests that, similar to ring helicases, it encircles one of the DNA strands during replication to confer processivity to the replisome complex. The catalytic domains appear to be highly mobile with respect to ODs. This mobility may account for the adaptation of the protein to two distinct DNA recognition sites. PMID:19440202

  14. Bivalent phenethylamines as novel dopamine transporter inhibitors: evidence for multiple substrate-binding sites in a single transporter.

    PubMed

    Schmitt, Kyle C; Mamidyala, Sreeman; Biswas, Swati; Dutta, Aloke K; Reith, Maarten E A

    2010-03-01

    Bivalent ligands--compounds incorporating two receptor-interacting moieties linked by a flexible chain--often exhibit profoundly enhanced binding affinity compared with their monovalent components, implying concurrent binding to multiple sites on the target protein. It is generally assumed that neurotransmitter sodium symporter (NSS) proteins, such as the dopamine transporter (DAT), contain a single domain responsible for recognition of substrate molecules. In this report, we show that molecules possessing two substrate-like phenylalkylamine moieties linked by a progressively longer aliphatic spacer act as progressively more potent DAT inhibitors (rather than substrates). One compound bearing two dopamine (DA)-like pharmacophoric 'heads' separated by an 8-carbon linker achieved an 82-fold gain in inhibition of [(3)H] 2beta-carbomethoxy-3beta-(4-fluorophenyl)-tropane (CFT) binding compared with DA itself; bivalent compounds with a 6-carbon linker and heterologous combinations of DA-, amphetamine- and beta-phenethylamine-like heads all resulted in considerable and comparable gains in DAT affinity. A series of short-chain bivalent-like compounds with a single N-linkage was also identified, the most potent of which displayed a 74-fold gain in binding affinity. Computational modelling of the DAT protein and docking of the two most potent bivalent (-like) ligands suggested simultaneous occupancy of two discrete substrate-binding domains. Assays with the DAT mutants W84L and D313N--previously employed by our laboratory to probe conformation-specific binding of different structural classes of DAT inhibitors--indicated a bias of the bivalent ligands for inward-facing transporters. Our results strongly indicate the existence of multiple DAT substrate-interaction sites, implying that it is possible to design novel types of DAT inhibitors based upon the 'multivalent ligand' strategy.

  15. Role of Transmembrane Domain 8 in Substrate Selectivity and Translocation of SteT, a Member of the l-Amino Acid Transporter (LAT) Family*

    PubMed Central

    Bartoccioni, Paola; del Rio, César; Ratera, Merce; Kowalczyk, Lukasz; Baldwin, Jocelyn M.; Zorzano, Antonio; Quick, Matthias; Baldwin, Stephen A.; Vázquez-Ibar, José Luis; Palacín, Manuel

    2010-01-01

    System l-amino acid transporters (LAT) belong to the amino acid, polyamine, and organic cation superfamily of transporters and include the light subunits of heteromeric amino acid transporters and prokaryotic homologues. Cysteine reactivity of SteT (serine/threonine antiporter) has been used here to study the substrate-binding site of LAT transporters. Residue Cys-291, in transmembrane domain 8 (TM8), is inactivated by thiol reagents in a substrate protectable manner. Surprisingly, DTT activated the transporter by reducing residue Cys-291. Cysteine-scanning mutagenesis of TM8 showed DTT activation in the single-cysteine mutants S287C, G294C, and S298C, lining the same α-helical face. S-Thiolation in Escherichia coli cells resulted in complete inactivation of the single-cysteine mutant G294C. l-Serine blocked DTT activation with an EC50 similar to the apparent KM of this mutant. Thus, S-thiolation abolished substrate translocation but not substrate binding. Mutation of Lys-295, to Cys (K295C) broadened the profile of inhibitors and the spectrum of substrates with the exception of imino acids. A structural model of SteT based on the structural homologue AdiC (arginine/agmatine antiporter) positions residues Cys-291 and Lys-295 in the putative substrate binding pocket. All this suggests that Lys-295 is a main determinant in the recognition of the side chain of SteT substrates. In contrast, Gly-294 is not facing the surface, suggesting conformational changes involving TM8 during the transport cycle. Our results suggest that TM8 sculpts the substrate-binding site and undergoes conformational changes during the transport cycle of SteT. PMID:20610400

  16. Glutamine 57 at the complementary binding site face is a key determinant of morantel selectivity for {alpha}7 nicotinic receptors.

    PubMed

    Bartos, Mariana; Price, Kerry L; Lummis, Sarah C R; Bouzat, Cecilia

    2009-08-07

    Nicotinic receptors (AChRs) play key roles in synaptic transmission. We explored activation of neuronal alpha7 and mammalian muscle AChRs by morantel and oxantel. Our results revealed a novel action of morantel as a high efficacy and more potent agonist than ACh of alpha7 receptors. The EC(50) for activation by morantel of both alpha7 and alpha7-5HT(3A) receptors is 7-fold lower than that determined for ACh. The minimum morantel concentration required to activate alpha7-5HT(3A) channels is 6-fold lower than that of ACh, and activation episodes are more prolonged than in the presence of ACh. By contrast, oxantel is a weak agonist of alpha7 and alpha7-5HT(3A), and both drugs are very low efficacy agonists of muscle AChRs. The replacement of Gln(57) in alpha7 by glycine, which is found in the equivalent position of the muscle AChR, decreases the efficacy for activation and turns morantel into a partial agonist. The reverse mutation in the muscle AChR (epsilonG57Q) increases 7-fold the efficacy of morantel. The mutations do not affect activation by ACh or oxantel, indicating that this position is selective for morantel. In silico studies show that the tetrahydropyrimidinyl group, common to both drugs, is close to Trp(149) of the principal face of the binding site, whereas the other cyclic group is proximal to Gln(57) of the complementary face in morantel but not in oxantel. Thus, position 57 at the complementary face is a key determinant of the high selectivity of morantel for alpha7. These results provide new information for further progress in drug design.

  17. Active retrieval facilitates across-episode binding by modulating the content of memory

    PubMed Central

    Bridge, Donna J.; Voss, Joel L.

    2014-01-01

    The contents of memory can be updated when information from the current episode is bound with content retrieved from previous episodes. Little is known regarding factors that determine the memory content that is subject to this across-episode binding. We tested whether across-episode binding preferentially occurs for memory content that is currently “active” and identified relevant neural correlates. After studying objects at specific locations on scene backgrounds, subjects performed one of two retrieval tasks for the objects on different scene backgrounds. In an active condition, subjects recalled object locations, whereas subjects merely dragged objects to predetermined locations in a passive condition. Immediately following each object-location retrieval event, a novel face appeared on a blank screen. We hypothesized that the original episode content would be active in memory during face encoding in the active condition, but not in the passive condition (despite seeing the same content in both conditions). A ramification of the active condition would thus be preferential binding of original episode content to novel faces, with no such across-episode binding in the passive condition. Indeed, memory for faces was better when tested on the original background scenes in the active relative to passive condition, indicating that original episode content was bound with the active condition faces, whereas this occurred to a lesser extent for the passive condition faces. Likewise, early-onset negative ERP effects reflected binding of the face to the original episode content in the active but not the passive condition. In contrast, binding in the passive condition occurred only when faces were physically displayed on the original scenes during recognition testing, and a very similar early-onset negative ERP effect signaled binding in this condition. ERP correlates of binding were thus similar for across-episode and within-episode binding (and were distinct from other encoding and retrieval ERP signals in both cases), indicating that active retrieval modulated when binding occurred, not the nature of the binding process per se. These results suggest that active retrieval promotes binding of new information with contents of memory, whereas without active retrieval, these unrelated pieces of information might be bound only when they are physically paired. PMID:25173711

  18. Dendrimer-Linked Antifreeze Proteins Have Superior Activity and Thermal Recovery.

    PubMed

    Stevens, Corey A; Drori, Ran; Zalis, Shiran; Braslavsky, Ido; Davies, Peter L

    2015-09-16

    By binding to ice, antifreeze proteins (AFPs) depress the freezing point of a solution and inhibit ice recrystallization if freezing does occur. Previous work showed that the activity of an AFP was incrementally increased by fusing it to another protein. Even larger increases in activity were achieved by doubling the number of ice-binding sites by dimerization. Here, we have combined the two strategies by linking multiple outward-facing AFPs to a dendrimer to significantly increase both the size of the molecule and the number of ice-binding sites. Using a heterobifunctional cross-linker, we attached between 6 and 11 type III AFPs to a second-generation polyamidoamine (G2-PAMAM) dendrimer with 16 reactive termini. This heterogeneous sample of dendrimer-linked type III constructs showed a greater than 4-fold increase in freezing point depression over that of monomeric type III AFP. This multimerized AFP was particularly effective at ice recrystallization inhibition activity, likely because it can simultaneously bind multiple ice surfaces. Additionally, attachment to the dendrimer has afforded the AFP superior recovery from heat denaturation. Linking AFPs together via polymers can generate novel reagents for controlling ice growth and recrystallization.

  19. The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase

    NASA Astrophysics Data System (ADS)

    Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy

    2016-04-01

    Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.

  20. Species B adenovirus serotypes 3, 7, 11 and 35 share similar binding sites on the membrane cofactor protein CD46 receptor.

    PubMed

    Fleischli, Christoph; Sirena, Dominique; Lesage, Guillaume; Havenga, Menzo J E; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

    2007-11-01

    We recently characterized the domains of the human cofactor protein CD46 involved in binding species B2 adenovirus (Ad) serotype 35. Here, the CD46 binding determinants are mapped for the species B1 Ad serotypes 3 and 7 and for the species B2 Ad11. Ad3, 7 and 11 bound and transduced CD46-positive rodent BHK cells at levels similar to Ad35. By using antibody-blocking experiments, hybrid CD46-CD4 receptor constructs and CD46 single point mutants, it is shown that Ad3, 7 and 11 share many of the Ad35-binding features on CD46. Both CD46 short consensus repeat domains SCR I and SCR II were necessary and sufficient for optimal binding and transgene expression, provided that they were positioned at an appropriate distance from the cell membrane. Similar to Ad35, most of the putative binding residues of Ad3, 7 and 11 were located on the same glycan-free, solvent-exposed face of the SCR I or SCR II domains, largely overlapping with the binding surface of the recently solved fiber knob Ad11-SCR I-II three-dimensional structure. Differences between species B1 and B2 Ads were documented with competition experiments based on anti-CD46 antibodies directed against epitopes flanking the putative Ad-binding sites, and with competition experiments based on soluble CD46 protein. It is concluded that the B1 and B2 species of Ad engage CD46 through similar binding surfaces.

  1. Crystal Structure of the Botulinum Neurotoxin Type G Binding Domain: Insight into Cell Surface Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stenmark, Pål; Dong, Min; Dupuy, Jérôme

    2011-11-02

    Botulinum neurotoxins (BoNTs) typically bind the neuronal cell surface via dual interactions with both protein receptors and gangliosides. We present here the 1.9-{angstrom} X-ray structure of the BoNT serotype G (BoNT/G) receptor binding domain (residues 868-1297) and a detailed view of protein receptor and ganglioside binding regions. The ganglioside binding motif (SxWY) has a conserved structure compared to the corresponding regions in BoNT serotype A and BoNT serotype B (BoNT/B), but several features of interactions with the hydrophilic face of the ganglioside are absent at the opposite side of the motif in the BoNT/G ganglioside binding cleft. This may significantlymore » reduce the affinity between BoNT/G and gangliosides. BoNT/G and BoNT/B share the protein receptor synaptotagmin (Syt) I/II. The Syt binding site has a conserved hydrophobic plateau located centrally in the proposed protein receptor binding interface (Tyr1189, Phe1202, Ala1204, Pro1205, and Phe1212). Interestingly, only 5 of 14 residues that are important for binding between Syt-II and BoNT/B are conserved in BoNT/G, suggesting that the means by which BoNT/G and BoNT/B bind Syt diverges more than previously appreciated. Indeed, substitution of Syt-II Phe47 and Phe55 with alanine residues had little effect on the binding of BoNT/G, but strongly reduced the binding of BoNT/B. Furthermore, an extended solvent-exposed hydrophobic loop, located between the Syt binding site and the ganglioside binding cleft, may serve as a third membrane association and binding element to contribute to high-affinity binding to the neuronal membrane. While BoNT/G and BoNT/B are homologous to each other and both utilize Syt-I/Syt-II as their protein receptor, the precise means by which these two toxin serotypes bind to Syt appears surprisingly divergent.« less

  2. Crystal structure of the botulinum neurotoxin type G binding domain: insight into cell surface binding.

    PubMed

    Stenmark, Pål; Dong, Min; Dupuy, Jérôme; Chapman, Edwin R; Stevens, Raymond C

    2010-04-16

    Botulinum neurotoxins (BoNTs) typically bind the neuronal cell surface via dual interactions with both protein receptors and gangliosides. We present here the 1.9-A X-ray structure of the BoNT serotype G (BoNT/G) receptor binding domain (residues 868-1297) and a detailed view of protein receptor and ganglioside binding regions. The ganglioside binding motif (SxWY) has a conserved structure compared to the corresponding regions in BoNT serotype A and BoNT serotype B (BoNT/B), but several features of interactions with the hydrophilic face of the ganglioside are absent at the opposite side of the motif in the BoNT/G ganglioside binding cleft. This may significantly reduce the affinity between BoNT/G and gangliosides. BoNT/G and BoNT/B share the protein receptor synaptotagmin (Syt) I/II. The Syt binding site has a conserved hydrophobic plateau located centrally in the proposed protein receptor binding interface (Tyr1189, Phe1202, Ala1204, Pro1205, and Phe1212). Interestingly, only 5 of 14 residues that are important for binding between Syt-II and BoNT/B are conserved in BoNT/G, suggesting that the means by which BoNT/G and BoNT/B bind Syt diverges more than previously appreciated. Indeed, substitution of Syt-II Phe47 and Phe55 with alanine residues had little effect on the binding of BoNT/G, but strongly reduced the binding of BoNT/B. Furthermore, an extended solvent-exposed hydrophobic loop, located between the Syt binding site and the ganglioside binding cleft, may serve as a third membrane association and binding element to contribute to high-affinity binding to the neuronal membrane. While BoNT/G and BoNT/B are homologous to each other and both utilize Syt-I/Syt-II as their protein receptor, the precise means by which these two toxin serotypes bind to Syt appears surprisingly divergent. Copyright (c) 2010. Published by Elsevier Ltd.

  3. Structural Basis for the ABO Blood-Group Dependence of Plasmodium falciparum Rosetting

    PubMed Central

    Hessel, Audrey; Raynal, Bertrand; England, Patrick; Cohen, Jacques H.; Bertrand, Olivier; Peyrard, Thierry; Bentley, Graham A.; Lewit-Bentley, Anita; Mercereau-Puijalon, Odile

    2012-01-01

    The ABO blood group influences susceptibility to severe Plasmodium falciparum malaria. Recent evidence indicates that the protective effect of group O operates by virtue of reduced rosetting of infected red blood cells (iRBCs) with uninfected RBCs. Rosetting is mediated by a subgroup of PfEMP1 adhesins, with RBC binding being assigned to the N-terminal DBL1α1 domain. Here, we identify the ABO blood group as the main receptor for VarO rosetting, with a marked preference for group A over group B, which in turn is preferred to group O RBCs. We show that recombinant NTS-DBL1α1 and NTS-DBL1α1-CIDR1γ reproduce the VarO-iRBC blood group preference and document direct binding to blood group trisaccharides by surface plasmon resonance. More detailed RBC subgroup analysis showed preferred binding to group A1, weaker binding to groups A2 and B, and least binding to groups Ax and O. The 2.8 Å resolution crystal structure of the PfEMP1-VarO Head region, NTS-DBL1α1-CIDR1γ, reveals extensive contacts between the DBL1α1 and CIDR1γ and shows that the NTS-DBL1α1 hinge region is essential for RBC binding. Computer docking of the blood group trisaccharides and subsequent site-directed mutagenesis localized the RBC-binding site to the face opposite to the heparin-binding site of NTS-DBLα1. RBC binding involves residues that are conserved between rosette-forming PfEMP1 adhesins, opening novel opportunities for intervention against severe malaria. By deciphering the structural basis of blood group preferences in rosetting, we provide a link between ABO blood grouppolymorphisms and rosette-forming adhesins, consistent with the selective role of falciparum malaria on human genetic makeup. PMID:22807674

  4. Substrate-bound structure of the E. coli multidrug resistance transporter MdfA

    PubMed Central

    Heng, Jie; Zhao, Yan; Liu, Ming; Liu, Yue; Fan, Junping; Wang, Xianping; Zhao, Yongfang; Zhang, Xuejun C

    2015-01-01

    Multidrug resistance is a serious threat to public health. Proton motive force-driven antiporters from the major facilitator superfamily (MFS) constitute a major group of multidrug-resistance transporters. Currently, no reports on crystal structures of MFS antiporters in complex with their substrates exist. The E. coli MdfA transporter is a well-studied model system for biochemical analyses of multidrug-resistance MFS antiporters. Here, we report three crystal structures of MdfA-ligand complexes at resolutions up to 2.0 Å, all in the inward-facing conformation. The substrate-binding site sits proximal to the conserved acidic residue, D34. Our mutagenesis studies support the structural observations of the substrate-binding mode and the notion that D34 responds to substrate binding by adjusting its protonation status. Taken together, our data unveil the substrate-binding mode of MFS antiporters and suggest a mechanism of transport via this group of transporters. PMID:26238402

  5. Water-Tryptophan Interactions: Lone-pair⋅⋅⋅π or O-H⋅⋅⋅π? Molecular Dynamics Simulations of β-Galactosidase Suggest that Both Modes Can Co-exist.

    PubMed

    Durec, Matúš; Marek, Radek; Kozelka, Jiří

    2018-04-17

    In proteins, the indole side chain of tryptophan can interact with water molecules either in-plane, forming hydrogen bonds, or out-of-plane, with the water molecule contacting the aromatic π face. The latter interaction can be either of the lone pair⋅⋅⋅π (lp⋅⋅⋅π) type or corresponds to the O-H⋅⋅⋅π binding mode, an ambiguity that X-ray structures usually do not resolve. Here, we report molecular dynamics (MD) simulations of a solvated β-galactosidase monomer, which illustrate how a water molecule located at the π face of an indole side chain of tryptophan can adapt to the position of proximate residues and "select" its binding mode. In one such site, the water molecule is predicted to rapidly oscillate between the O-H⋅⋅⋅π and lp⋅⋅⋅π binding modes, thus gaining entropic advantage. Our MD simulations provide support for the role of lp⋅⋅⋅π interactions in the stabilization of protein structures. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Investigation and identification of functional post-translational modification sites associated with drug binding and protein-protein interactions.

    PubMed

    Su, Min-Gang; Weng, Julia Tzu-Ya; Hsu, Justin Bo-Kai; Huang, Kai-Yao; Chi, Yu-Hsiang; Lee, Tzong-Yi

    2017-12-21

    Protein post-translational modification (PTM) plays an essential role in various cellular processes that modulates the physical and chemical properties, folding, conformation, stability and activity of proteins, thereby modifying the functions of proteins. The improved throughput of mass spectrometry (MS) or MS/MS technology has not only brought about a surge in proteome-scale studies, but also contributed to a fruitful list of identified PTMs. However, with the increase in the number of identified PTMs, perhaps the more crucial question is what kind of biological mechanisms these PTMs are involved in. This is particularly important in light of the fact that most protein-based pharmaceuticals deliver their therapeutic effects through some form of PTM. Yet, our understanding is still limited with respect to the local effects and frequency of PTM sites near pharmaceutical binding sites and the interfaces of protein-protein interaction (PPI). Understanding PTM's function is critical to our ability to manipulate the biological mechanisms of protein. In this study, to understand the regulation of protein functions by PTMs, we mapped 25,835 PTM sites to proteins with available three-dimensional (3D) structural information in the Protein Data Bank (PDB), including 1785 modified PTM sites on the 3D structure. Based on the acquired structural PTM sites, we proposed to use five properties for the structural characterization of PTM substrate sites: the spatial composition of amino acids, residues and side-chain orientations surrounding the PTM substrate sites, as well as the secondary structure, division of acidity and alkaline residues, and solvent-accessible surface area. We further mapped the structural PTM sites to the structures of drug binding and PPI sites, identifying a total of 1917 PTM sites that may affect PPI and 3951 PTM sites associated with drug-target binding. An integrated analytical platform (CruxPTM), with a variety of methods and online molecular docking tools for exploring the structural characteristics of PTMs, is presented. In addition, all tertiary structures of PTM sites on proteins can be visualized using the JSmol program. Resolving the function of PTM sites is important for understanding the role that proteins play in biological mechanisms. Our work attempted to delineate the structural correlation between PTM sites and PPI or drug-target binding. CurxPTM could help scientists narrow the scope of their PTM research and enhance the efficiency of PTM identification in the face of big proteome data. CruxPTM is now available at http://csb.cse.yzu.edu.tw/CruxPTM/ .

  7. Active-site monovalent cations revealed in a 1.55-Å-resolution hammerhead ribozyme structure.

    PubMed

    Anderson, Michael; Schultz, Eric P; Martick, Monika; Scott, William G

    2013-10-23

    We have obtained a 1.55-Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni under conditions that permit detailed observations of Na(+) ion binding in the ribozyme's active site. At least two such Na(+) ions are observed. The first Na(+) ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical with that previously observed for divalent cations. A second Na(+) ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with that of previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na(+), but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na(+) directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active-site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest-resolution ribozyme structure in the Protein Data Bank. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Active retrieval facilitates across-episode binding by modulating the content of memory.

    PubMed

    Bridge, Donna J; Voss, Joel L

    2014-10-01

    The contents of memory can be updated when information from the current episode is bound with content retrieved from previous episodes. Little is known regarding factors that determine the memory content that is subject to this across-episode binding. We tested whether across-episode binding preferentially occurs for memory content that is currently "active" and identified relevant neural correlates. After studying objects at specific locations on scene backgrounds, subjects performed one of two retrieval tasks for the objects on different scene backgrounds. In an active condition, subjects recalled object locations, whereas subjects merely dragged objects to predetermined locations in a passive condition. Immediately following each object-location retrieval event, a novel face appeared on a blank screen. We hypothesized that the original episode content would be active in memory during face encoding in the active condition, but not in the passive condition (despite seeing the same content in both conditions). A ramification of the active condition would thus be preferential binding of original episode content to novel faces, with no such across-episode binding in the passive condition. Indeed, memory for faces was better when tested on the original background scenes in the active relative to passive condition, indicating that original episode content was bound with the active condition faces, whereas this occurred to a lesser extent for the passive condition faces. Likewise, early-onset negative ERP effects reflected binding of the face to the original episode content in the active but not the passive condition. In contrast, binding in the passive condition occurred only when faces were physically displayed on the original scenes during recognition testing, and a very similar early-onset negative ERP effect signaled binding in this condition. ERP correlates of binding were thus similar for across-episode and within-episode binding (and were distinct from other encoding and retrieval ERP signals in both cases), indicating that active retrieval modulated when binding occurred, not the nature of the binding process per se. These results suggest that active retrieval promotes binding of new information with contents of memory, whereas without active retrieval, these unrelated pieces of information might be bound only when they are physically paired. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Crystal Structure and Computational Characterization of the Lytic Polysaccharide Monooxygenase GH61D from the Basidiomycota Fungus Phanerochaete chrysosporium*

    PubMed Central

    Wu, Miao; Beckham, Gregg T.; Larsson, Anna M.; Ishida, Takuya; Kim, Seonah; Payne, Christina M.; Himmel, Michael E.; Crowley, Michael F.; Horn, Svein J.; Westereng, Bjørge; Igarashi, Kiyohiko; Samejima, Masahiro; Ståhlberg, Jerry; Eijsink, Vincent G. H.; Sandgren, Mats

    2013-01-01

    Carbohydrate structures are modified and degraded in the biosphere by a myriad of mostly hydrolytic enzymes. Recently, lytic polysaccharide mono-oxygenases (LPMOs) were discovered as a new class of enzymes for cleavage of recalcitrant polysaccharides that instead employ an oxidative mechanism. LPMOs employ copper as the catalytic metal and are dependent on oxygen and reducing agents for activity. LPMOs are found in many fungi and bacteria, but to date no basidiomycete LPMO has been structurally characterized. Here we present the three-dimensional crystal structure of the basidiomycete Phanerochaete chrysosporium GH61D LPMO, and, for the first time, measure the product distribution of LPMO action on a lignocellulosic substrate. The structure reveals a copper-bound active site common to LPMOs, a collection of aromatic and polar residues near the binding surface that may be responsible for regio-selectivity, and substantial differences in loop structures near the binding face compared with other LPMO structures. The activity assays indicate that this LPMO primarily produces aldonic acids. Last, molecular simulations reveal conformational changes, including the binding of several regions to the cellulose surface, leading to alignment of three tyrosine residues on the binding face of the enzyme with individual cellulose chains, similar to what has been observed for family 1 carbohydrate-binding modules. A calculated potential energy surface for surface translation indicates that P. chrysosporium GH61D exhibits energy wells whose spacing seems adapted to the spacing of cellobiose units along a cellulose chain. PMID:23525113

  10. ADAM13 cleavage of cadherin-11 promotes CNC migration independently of the homophilic binding site.

    PubMed

    Abbruzzese, Genevieve; Becker, Sarah F; Kashef, Jubin; Alfandari, Dominique

    2016-07-15

    The cranial neural crest (CNC) is a highly motile population of cells that is responsible for forming the face and jaw in all vertebrates and perturbing their migration can lead to craniofacial birth defects. Cell motility requires a dynamic modification of cell-cell and cell-matrix adhesion. In the CNC, cleavage of the cell adhesion molecule cadherin-11 by ADAM13 is essential for cell migration. This cleavage generates a shed extracellular fragment of cadherin-11 (EC1-3) that possesses pro-migratory activity via an unknown mechanism. Cadherin-11 plays an important role in modulating contact inhibition of locomotion (CIL) in the CNC to regulate directional cell migration. Here, we show that while the integral cadherin-11 requires the homophilic binding site to promote CNC migration in vivo, the EC1-3 fragment does not. In addition, we show that increased ADAM13 activity or expression of the EC1-3 fragment increases CNC invasiveness in vitro and blocks the repulsive CIL response in colliding cells. This activity requires the presence of an intact homophilic binding site on the EC1-3 suggesting that the cleavage fragment may function as a competitive inhibitor of cadherin-11 adhesion in CIL but not to promote cell migration in vivo. Copyright © 2015. Published by Elsevier Inc.

  11. ADAM13 cleavage of cadherin-11 promotes CNC migration independently of the homophilic binding site

    PubMed Central

    Kashef, Jubin; Alfandari, Dominique

    2015-01-01

    The cranial neural crest (CNC) is a highly motile population of cells that is responsible for forming the face and jaw in all vertebrates and perturbing their migration can lead to craniofacial birth defects. Cell motility requires a dynamic modification of cell–cell and cell-matrix adhesion. In the CNC, cleavage of the cell adhesion molecule cadherin-11 by ADAM13 is essential for cell migration. This cleavage generates a shed extracellular fragment of cadherin-11 (EC1-3) that possesses pro-migratory activity via an unknown mechanism. Cadherin-11 plays an important role in modulating contact inhibition of locomotion (CIL) in the CNC to regulate directional cell migration. Here, we show that while the integral cadherin-11 requires the homophilic binding site to promote CNC migration in vivo, the EC1-3 fragment does not. In addition, we show that increased ADAM13 activity or expression of the EC1-3 fragment increases CNC invasiveness in vitro and blocks the repulsive CIL response in colliding cells. This activity requires the presence of an intact homophilic binding site on the EC1-3 suggesting that the cleavage fragment may function as a competitive inhibitor of cadherin-11 adhesion in CIL but not to promote cell migration in vivo. PMID:26206614

  12. In situ imaging of single carbohydrate-binding modules on cellulose microfibrils.

    PubMed

    Dagel, Daryl J; Liu, Yu-San; Zhong, Lanlan; Luo, Yonghua; Himmel, Michael E; Xu, Qi; Zeng, Yining; Ding, Shi-You; Smith, Steve

    2011-02-03

    The low efficiency of enzymes used in the bioprocessing of biomass for biofuels is one of the primary bottlenecks that must be overcome to make lignocellulosic biofuels cost-competitive. One of the rate-limiting factors is the accessibility of the cellulase enzymes to insoluble cellulolytic substrates, facilitated by surface absorption of the carbohydrate-binding modules (CBMs), a component of most cellulase systems. Despite their importance, reports of direct observation of CBM function and activity using microscopic methods are still uncommon. Here, we examine the site-specific binding of individual CBMs to crystalline cellulose in an aqueous environment, using the single molecule fluorescence method known as Defocused Orientation and Position Imaging (DOPI). Systematic orientations were observed that are consistent with the CBMs binding to the two opposite hydrophobic faces of the cellulose microfibril, with a well-defined orientation relative to the fiber axis. The approach provides in situ physical evidence indicating the CBMs bind with a well-defined orientation on those planes, thus supporting a binding mechanism driven by chemical and structural recognition of the cellulose surface.

  13. K-Ras(G12C) inhibitors allosterically control GTP affinity and effector interactions

    PubMed Central

    Ostrem, Jonathan M.; Peters, Ulf; Sos, Martin L.; Wells, James A.; Shokat, Kevan M.

    2014-01-01

    Somatic mutations in the small GTPase K-Ras are the most common activating lesions found in human cancer, and are generally associated with poor response to standard therapies1–3. Efforts to target this oncogene directly have faced difficulties owing to its picomolar affinity for GTP/GDP4 and the absence of known allosteric regulatory sites. Oncogenic mutations result in functional activation of Ras family proteins by impairing GTP hydrolysis5,6. With diminished regulation by GTPase activity, the nucleotide state of Ras becomes more dependent on relative nucleotide affinity and concentration. This gives GTP an advantage over GDP7 and increases the proportion of active GTP-bound Ras. Here we report the development of small molecules that irreversibly bind to a common oncogenic mutant, K-Ras(G12C). These compounds rely on the mutant cysteine for binding and therefore do not affect the wild-type protein. Crystallographic studies reveal the formation of a new pocket that is not apparent in previous structures of Ras, beneath the effector binding switch-II region. Binding of these inhibitors to K-Ras(G12C) disrupts both switch-I and switch-II, subverting the native nucleotide preference to favour GDP over GTP and impairing binding to Raf. Our data provide structure-based validation of a new allosteric regulatory site on Ras that is targetable in a mutant-specific manner. PMID:24256730

  14. Phase stabilisation of hexagonal barium titanate doped with transition metals: A computational study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dawson, J.A., E-mail: mtp09jd@sheffield.ac.uk; Freeman, C.L.; Harding, J.H.

    Interatomic potentials recently developed for the modelling of BaTiO{sub 3} have been used to explore the stabilisation of the hexagonal polymorph of BaTiO{sub 3} by doping with transition metals (namely Mn, Co, Fe and Ni) at the Ti-site. Classical simulations have been completed on both the cubic and hexagonal polymorphs to investigate the energetic consequences of transition metal doping on each polymorph. Ti-site charge compensation mechanisms have been used for the multi-valent transition metal ions and cluster binding energies have been considered. Simulations show a significant energetic gain when doping occurs at Ti sites in the face sharing dimers (Ti{submore » 2} sites) of the hexagonal polymorph compared with the doping of the cubic polymorph. This energetic difference between the two polymorphs is true for all transition metals tested and all charge states and in the case of tri- and tetra-valent dopants negative solution energies are found for the hexagonal polymorph suggesting actual polymorph stabilisation occurs with the incorporation of these ions as observed experimentally. Oxidation during incorporation of Ni{sup 2+} and Fe{sup 3+} ions has also been considered. - Graphical abstract: The representation of the strongest binding energy clusters for tri-valent dopants—(a) Ti{sub 2}/O{sub 1} cluster and (b) Ti{sub 2}/O{sub 2} cluster. Highlights: ► Classical simulations show a significant energetic gain when doping occurs at Ti sites in the face sharing dimers (Ti2 sites) of the hexagonal polymorph compared with the doping of the cubic polymorph. ► This energetic difference between the two polymorphs is true for all transition metals tested and all charge states. ► In the case of tri- and tetra- valent dopants negative solution energies are found for the hexagonal polymorph suggesting actual polymorph stabilisation occurs with the incorporation of these ions.« less

  15. What's in a "face file"? Feature binding with facial identity, emotion, and gaze direction.

    PubMed

    Fitousi, Daniel

    2017-07-01

    A series of four experiments investigated the binding of facial (i.e., facial identity, emotion, and gaze direction) and non-facial (i.e., spatial location and response location) attributes. Evidence for the creation and retrieval of temporary memory face structures across perception and action has been adduced. These episodic structures-dubbed herein "face files"-consisted of both visuo-visuo and visuo-motor bindings. Feature binding was indicated by partial-repetition costs. That is repeating a combination of facial features or altering them altogether, led to faster responses than repeating or alternating only one of the features. Taken together, the results indicate that: (a) "face files" affect both action and perception mechanisms, (b) binding can take place with facial dimensions and is not restricted to low-level features (Hommel, Visual Cognition 5:183-216, 1998), and (c) the binding of facial and non-facial attributes is facilitated if the dimensions share common spatial or motor codes. The theoretical contributions of these results to "person construal" theories (Freeman, & Ambady, Psychological Science, 20(10), 1183-1188, 2011), as well as to face recognition models (Haxby, Hoffman, & Gobbini, Biological Psychiatry, 51(1), 59-67, 2000) are discussed.

  16. Structure of Chlorobium tepidum sepiapterin reductase complex reveals the novel substrate binding mode for stereospecific production of L-threo-tetrahydrobiopterin.

    PubMed

    Supangat, Supangat; Seo, Kyung Hye; Choi, Yong Kee; Park, Young Shik; Son, Daeyoung; Han, Chang-deok; Lee, Kon Ho

    2006-01-27

    Sepiapterin reductase (SR) is involved in the last step of tetrahydrobiopterin (BH(4)) biosynthesis by reducing the di-keto group of 6-pyruvoyl tetrahydropterin. Chlorobium tepidum SR (cSR) generates a distinct BH(4) product, L-threo-BH(4) (6R-(1'S,2'S)-5,6,7,8-BH(4)), whereas animal enzymes produce L-erythro-BH(4) (6R-(1'R,2'S)-5,6,7,8-BH(4)) although it has high amino acid sequence similarities to the other animal enzymes. To elucidate the structural basis for the different reaction stereospecificities, we have determined the three-dimensional structures of cSR alone and complexed with NADP and sepiapterin at 2.1 and 1.7 A resolution, respectively. The overall folding of the cSR, the binding site for the cofactor NADP(H), and the positions of active site residues were quite similar to the mouse and the human SR. However, significant differences were found in the substrate binding region of the cSR. In comparison to the mouse SR complex, the sepiapterin in the cSR is rotated about 180 degrees around the active site and bound between two aromatic side chains of Trp-196 and Phe-99 so that its pterin ring is shifted to the opposite side, but its side chain position is not changed. The swiveled sepiapterin binding results in the conversion of the side chain configuration, exposing the opposite face for hydride transfer from NADPH. The different sepiapterin binding mode within the conserved catalytic architecture presents a novel strategy of switching the reaction stereospecificities in the same protein fold.

  17. Electrostatic interaction map reveals a new binding position for tropomyosin on F-actin.

    PubMed

    Rynkiewicz, Michael J; Schott, Veronika; Orzechowski, Marek; Lehman, William; Fischer, Stefan

    2015-12-01

    Azimuthal movement of tropomyosin around the F-actin thin filament is responsible for muscle activation and relaxation. Recently a model of αα-tropomyosin, derived from molecular-mechanics and electron microscopy of different contractile states, showed that tropomyosin is rather stiff and pre-bent to present one specific face to F-actin during azimuthal transitions. However, a new model based on cryo-EM of troponin- and myosin-free filaments proposes that the interacting-face of tropomyosin can differ significantly from that in the original model. Because resolution was insufficient to assign tropomyosin side-chains, the interacting-face could not be unambiguously determined. Here, we use structural analysis and energy landscapes to further examine the proposed models. The observed bend in seven crystal structures of tropomyosin is much closer in direction and extent to the original model than to the new model. Additionally, we computed the interaction map for repositioning tropomyosin over the F-actin surface, but now extended over a much larger surface than previously (using the original interacting-face). This map shows two energy minima-one corresponding to the "blocked-state" as in the original model, and the other related by a simple 24 Å translation of tropomyosin parallel to the F-actin axis. The tropomyosin-actin complex defined by the second minimum fits perfectly into the recent cryo-EM density, without requiring any change in the interacting-face. Together, these data suggest that movement of tropomyosin between regulatory states does not require interacting-face rotation. Further, they imply that thin filament assembly may involve an interplay between initially seeded tropomyosin molecules growing from distinct binding-site regions on actin.

  18. Differential α4(+)/(−)β2 Agonist-binding Site Contributions to α4β2 Nicotinic Acetylcholine Receptor Function within and between Isoforms*

    PubMed Central

    Lucero, Linda M.; Weltzin, Maegan M.; Eaton, J. Brek; Cooper, John F.; Lindstrom, Jon M.; Lukas, Ronald J.; Whiteaker, Paul

    2016-01-01

    Two α4β2 nicotinic acetylcholine receptor (α4β2-nAChR) isoforms exist with (α4)2(β2)3 and (α4)3(β2)2 subunit stoichiometries and high versus low agonist sensitivities (HS and LS), respectively. Both isoforms contain a pair of α4(+)/(−)β2 agonist-binding sites. The LS isoform also contains a unique α4(+)/(−)α4 site with lower agonist affinity than the α4(+)/(−)β2 sites. However, the relative roles of the conserved α4(+)/(−)β2 agonist-binding sites in and between the isoforms have not been studied. We used a fully linked subunit concatemeric nAChR approach to express pure populations of HS or LS isoform α4β2*-nAChR. This approach also allowed us to mutate individual subunit interfaces, or combinations thereof, on each isoform background. We used this approach to systematically mutate a triplet of β2 subunit (−)-face E-loop residues to their non-conserved α4 subunit counterparts or vice versa (β2HQT and α4VFL, respectively). Mutant-nAChR constructs (and unmodified controls) were expressed in Xenopus oocytes. Acetylcholine concentration-response curves and maximum function were measured using two-electrode voltage clamp electrophysiology. Surface expression was measured with 125I-mAb 295 binding and was used to define function/nAChR. If the α4(+)/(−)β2 sites contribute equally to function, making identical β2HQT substitutions at either site should produce similar functional outcomes. Instead, highly differential outcomes within the HS isoform, and between the two isoforms, were observed. In contrast, α4VFL mutation effects were very similar in all positions of both isoforms. Our results indicate that the identity of subunits neighboring the otherwise equivalent α4(+)/(−)β2 agonist sites modifies their contributions to nAChR activation and that E-loop residues are an important contributor to this neighbor effect. PMID:26644472

  19. Parmodulins inhibit thrombus formation without inducing endothelial injury caused by vorapaxar.

    PubMed

    Aisiku, Omozuanvbo; Peters, Christian G; De Ceunynck, Karen; Ghosh, Chandra C; Dilks, James R; Fustolo-Gunnink, Susanna F; Huang, Mingdong; Dockendorff, Chris; Parikh, Samir M; Flaumenhaft, Robert

    2015-03-19

    Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein C (APC) stimulates cytoprotective and antiinflammatory signaling. A challenge in developing PAR1-targeted therapies is to inhibit detrimental signaling while sparing beneficial pathways. We now characterize a novel class of structurally unrelated small-molecule PAR1 antagonists, termed parmodulins, and compare the activity of these compounds to previously characterized compounds that act at the PAR1 ligand-binding site. We find that parmodulins target the cytoplasmic face of PAR1 without modifying the ligand-binding site, blocking signaling through Gαq but not Gα13 in vitro and thrombus formation in vivo. In endothelium, parmodulins inhibit prothrombotic and proinflammatory signaling without blocking APC-mediated pathways or inducing endothelial injury. In contrast, orthosteric PAR1 antagonists such as vorapaxar inhibit all signaling downstream of PAR1. Furthermore, exposure of endothelial cells to nanomolar concentrations of vorapaxar induces endothelial cell barrier dysfunction and apoptosis. These studies demonstrate how functionally selective antagonism can be achieved by targeting the cytoplasmic face of a G-protein-coupled receptor to selectively block pathologic signaling while preserving cytoprotective pathways. © 2015 by The American Society of Hematology.

  20. Functional architecture of the retromer cargo-recognition complex

    PubMed Central

    Hierro, Aitor; Rojas, Adriana L.; Rojas, Raul; Murthy, Namita; Effantin, Grégory; Kajava, Andrey V.; Steven, Alasdair C.; Bonifacino, Juan S.; Hurley, James H.

    2008-01-01

    The retromer complex 1, 2 is required for the sorting of acid hydrolases to lysosomes 3-7, transcytosis of the polymeric Ig receptor 8, Wnt gradient formation 9, 10, iron transporter recycling 11, and processing of the amyloid precursor protein 12. Human retromer consists of two smaller complexes, the cargo recognition Vps26:Vps29:Vps35 heterotrimer, and a membrane-targeting heterodimer or homodimer of SNX1 and/or SNX2 13. The crystal structure of a Vps29:Vps35 subcomplex shows how the metallophosphoesterase-fold subunit Vps29 14, 15 acts as a scaffold for the C-terminal half of Vps35. Vps35 forms a horseshoe-shaped right-handed α-helical solenoid whose concave face completely covers the metal-binding site of Vps29 and whose convex face exposes a series of hydrophobic interhelical grooves. Electron microscopy shows that the intact Vps26:Vps29:Vps35 complex is a stick-shaped, somewhat flexible, structure, ∼ 21 nm long. A hybrid structural model derived from crystal structures, electron microscopy, interaction studies, and bioinformatics shows that the α-solenoid fold extends the full length of Vps35, and that Vps26 is bound at the opposite end from Vps29. This extended structure presents multiple binding sites for the SNX complex and receptor cargo, and appears capable of flexing to conform to curved vesicular membranes. PMID:17891154

  1. Controlling the stereochemistry and regularity of butanethiol self-assembled monolayers on au(111).

    PubMed

    Yan, Jiawei; Ouyang, Runhai; Jensen, Palle S; Ascic, Erhad; Tanner, David; Mao, Bingwei; Zhang, Jingdong; Tang, Chunguang; Hush, Noel S; Ulstrup, Jens; Reimers, Jeffrey R

    2014-12-10

    The rich stereochemistry of the self-assembled monolayers (SAMs) of four butanethiols on Au(111) is described, the SAMs containing up to 12 individual C, S, or Au chiral centers per surface unit cell. This is facilitated by synthesis of enantiomerically pure 2-butanethiol (the smallest unsubstituted chiral alkanethiol), followed by in situ scanning tunneling microscopy (STM) imaging combined with density functional theory molecular dynamics STM image simulations. Even though butanethiol SAMs manifest strong headgroup interactions, steric interactions are shown to dominate SAM structure and chirality. Indeed, steric interactions are shown to dictate the nature of the headgroup itself, whether it takes on the adatom-bound motif RS(•)Au(0)S(•)R or involves direct binding of RS(•) to face-centered-cubic or hexagonal-close-packed sites. Binding as RS(•) produces large, organizationally chiral domains even when R is achiral, while adatom binding leads to rectangular plane groups that suppress long-range expression of chirality. Binding as RS(•) also inhibits the pitting intrinsically associated with adatom binding, desirably producing more regularly structured SAMs.

  2. Face-name learning in older adults: a benefit of hyper-binding.

    PubMed

    Weeks, Jennifer C; Biss, Renée K; Murphy, Kelly J; Hasher, Lynn

    2016-10-01

    Difficulty remembering faces and corresponding names is a hallmark of cognitive aging, as is increased susceptibility to distraction. Given evidence that older adults spontaneously encode relationships between target pictures and simultaneously occurring distractors (a hyper-binding phenomenon), we asked whether memory for face-name pairs could be improved through prior exposure to faces presented with distractor names. In three experiments, young and older adults performed a selective attention task on faces while ignoring superimposed names. After a delay, they learned and were tested on face-name pairs that were either maintained or rearranged from the initial task but were not told of the connection between tasks. In each experiment, older but not younger participants showed better memory for maintained than for rearranged pairs, indicating that older adults' natural propensity to tacitly encode and bind relevant and irrelevant information can be employed to aid face-name memory performance.

  3. Goethite surface reactivity: a macroscopic investigation unifying proton, chromate, carbonate, and lead(II) adsorption.

    PubMed

    Villalobos, Mario; Pérez-Gallegos, Ayax

    2008-10-15

    The goethite surface structure has been extensively studied, but no convincing quantitative description of its highly variable surface reactivity as inversely related to its specific surface area (SSA) has been found. The present study adds experimental evidence and provides a unified macroscopic explanation to this anomalous behavior from differences in average adsorption capacities, and not in average adsorption affinities. We investigated the chromate anion and lead(II) cation adsorption behavior onto three different goethites with SSA varying from 50 to 94 m(2)/g, and analyzed an extensive set of published anion adsorption and proton charging data for variable SSA goethites. Maximum chromate adsorption was found to occupy on average from 3.1 to 9.7 sites/nm(2), inversely related to SSA. Congruency of oxyanion and Pb(II) adsorption behavior based on fractional site occupancy using these values, and a site density analysis suggest that: (i) ion binding occurs to singly and doubly coordinated sites, (ii) proton binding occurs to singly and triply coordinated sites (ranging from 6.2 to 8 total sites/nm(2), in most cases), and (iii) a predominance of (210) and/or (010) faces explains the high reactivity of low SSA goethites. The results imply that the macroscopic goethite adsorption behavior may be predicted without a need to investigate extensive structural details of each specific goethite of interest.

  4. Proton movement and coupling in the POT family of peptide transporters

    PubMed Central

    Parker, Joanne L.; Li, Chenghan; Brinth, Allete; Wang, Zhi; Vogeley, Lutz; Solcan, Nicolae; Ledderboge-Vucinic, Gregory; Swanson, Jessica M. J.; Caffrey, Martin; Voth, Gregory A.

    2017-01-01

    POT transporters represent an evolutionarily well-conserved family of proton-coupled transport systems in biology. An unusual feature of the family is their ability to couple the transport of chemically diverse ligands to an inwardly directed proton electrochemical gradient. For example, in mammals, fungi, and bacteria they are predominantly peptide transporters, whereas in plants the family has diverged to recognize nitrate, plant defense compounds, and hormones. Although recent structural and biochemical studies have identified conserved sites of proton binding, the mechanism through which transport is coupled to proton movement remains enigmatic. Here we show that different POT transporters operate through distinct proton-coupled mechanisms through changes in the extracellular gate. A high-resolution crystal structure reveals the presence of ordered water molecules within the peptide binding site. Multiscale molecular dynamics simulations confirm proton transport occurs through these waters via Grotthuss shuttling and reveal that proton binding to the extracellular side of the transporter facilitates a reorientation from an inward- to outward-facing state. Together these results demonstrate that within the POT family multiple mechanisms of proton coupling have likely evolved in conjunction with variation of the extracellular gate. PMID:29180426

  5. Proton movement and coupling in the POT family of peptide transporters.

    PubMed

    Parker, Joanne L; Li, Chenghan; Brinth, Allete; Wang, Zhi; Vogeley, Lutz; Solcan, Nicolae; Ledderboge-Vucinic, Gregory; Swanson, Jessica M J; Caffrey, Martin; Voth, Gregory A; Newstead, Simon

    2017-12-12

    POT transporters represent an evolutionarily well-conserved family of proton-coupled transport systems in biology. An unusual feature of the family is their ability to couple the transport of chemically diverse ligands to an inwardly directed proton electrochemical gradient. For example, in mammals, fungi, and bacteria they are predominantly peptide transporters, whereas in plants the family has diverged to recognize nitrate, plant defense compounds, and hormones. Although recent structural and biochemical studies have identified conserved sites of proton binding, the mechanism through which transport is coupled to proton movement remains enigmatic. Here we show that different POT transporters operate through distinct proton-coupled mechanisms through changes in the extracellular gate. A high-resolution crystal structure reveals the presence of ordered water molecules within the peptide binding site. Multiscale molecular dynamics simulations confirm proton transport occurs through these waters via Grotthuss shuttling and reveal that proton binding to the extracellular side of the transporter facilitates a reorientation from an inward- to outward-facing state. Together these results demonstrate that within the POT family multiple mechanisms of proton coupling have likely evolved in conjunction with variation of the extracellular gate. Copyright © 2017 the Author(s). Published by PNAS.

  6. Neural Mechanisms of Context Effects on Face Recognition: Automatic Binding and Context Shift Decrements

    PubMed Central

    Hayes, Scott M.; Baena, Elsa; Truong, Trong-Kha; Cabeza, Roberto

    2011-01-01

    Although people do not normally try to remember associations between faces and physical contexts, these associations are established automatically, as indicated by the difficulty of recognizing familiar faces in different contexts (“butcher-on-the-bus” phenomenon). The present functional MRI (fMRI) study investigated the automatic binding of faces and scenes. In the Face-Face (F-F) condition, faces were presented alone during both encoding and retrieval, whereas in the Face/Scene-Face (FS-F) condition, they were presented overlaid on scenes during encoding but alone during retrieval (context change). Although participants were instructed to focus only on the faces during both encoding and retrieval, recognition performance was worse in the FS-F than the F-F condition (“context shift decrement”—CSD), confirming automatic face-scene binding during encoding. This binding was mediated by the hippocampus as indicated by greater subsequent memory effects (remembered > forgotten) in this region for the FS-F than the F-F condition. Scene memory was mediated by the right parahippocampal cortex, which was reactivated during successful retrieval when the faces were associated with a scene during encoding (FS-F condition). Analyses using the CSD as a regressor yielded a clear hemispheric asymmetry in medial temporal lobe activity during encoding: left hippocampal and parahippocampal activity was associated with a smaller CSD, indicating more flexible memory representations immune to context changes, whereas right hippocampal/rhinal activity was associated with a larger CSD, indicating less flexible representations sensitive to context change. Taken together, the results clarify the neural mechanisms of context effects on face recognition. PMID:19925208

  7. Crystal structure of a SLC11 (NRAMP) transporter reveals the basis for transition-metal ion transport.

    PubMed

    Ehrnstorfer, Ines A; Geertsma, Eric R; Pardon, Els; Steyaert, Jan; Dutzler, Raimund

    2014-11-01

    Members of the SLC11 (NRAMP) family transport iron and other transition-metal ions across cellular membranes. These membrane proteins are present in all kingdoms of life with a high degree of sequence conservation. To gain insight into the determinants of ion selectivity, we have determined the crystal structure of Staphylococcus capitis DMT (ScaDMT), a close prokaryotic homolog of the family. ScaDMT shows a familiar architecture that was previously identified in the amino acid permease LeuT. The protein adopts an inward-facing conformation with a substrate-binding site located in the center of the transporter. This site is composed of conserved residues, which coordinate Mn2+, Fe2+ and Cd2+ but not Ca2+. Mutations of interacting residues affect ion binding and transport in both ScaDMT and human DMT1. Our study thus reveals a conserved mechanism for transition-metal ion selectivity within the SLC11 family.

  8. Molecular dynamics of conformation-specific dopamine transporter-inhibitor complexes.

    PubMed

    Jean, Bernandie; Surratt, Christopher K; Madura, Jeffry D

    2017-09-01

    The recreational psychostimulant cocaine inhibits dopamine reuptake from the synapse, resulting in excessive stimulation of postsynaptic dopamine receptors in brain areas associated with reward and addiction. Cocaine binds to and stabilizes the outward- (extracellular-) facing conformation of the dopamine transporter (DAT) protein, while the low abuse potential DAT inhibitor benztropine prefers the inward- (cytoplasmic-) facing conformation. A correlation has been previously postulated between psychostimulant abuse potential and preference for the outward-facing DAT conformation. The 3β-aryltropane cocaine analogs LX10 and LX11, however, differ only in stereochemistry and share a preference for the outward-facing DAT, yet are reported to vary widely in abuse potential in an animal model. In search of the molecular basis for DAT conformation preference, complexes of cocaine, benztropine, LX10 or LX11 bound to each DAT conformation were subjected to 100ns of all-atom molecular dynamics simulation. Results were consistent with previous findings from cysteine accessibility assays used to assess an inhibitor's DAT conformation preference. The respective 2β- and 2α-substituted phenyltropanes of LX10 and LX11 interacted with hydrophobic regions of the DAT S1 binding site that were inaccessible to cocaine. Solvent accessibility measurements also revealed subtle differences in inhibitor positioning within a given DAT conformation. This work serves to advance our understanding of the conformational selectivity of DAT inhibitors and suggests that MD may be useful in antipsychostimulant therapeutic design. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation

    PubMed Central

    Hung, Victoria; Lam, Stephanie S; Udeshi, Namrata D; Svinkina, Tanya; Guzman, Gaelen; Mootha, Vamsi K; Carr, Steven A; Ting, Alice Y

    2017-01-01

    The cytosol-facing membranes of cellular organelles contain proteins that enable signal transduction, regulation of morphology and trafficking, protein import and export, and other specialized processes. Discovery of these proteins by traditional biochemical fractionation can be plagued with contaminants and loss of key components. Using peroxidase-mediated proximity biotinylation, we captured and identified endogenous proteins on the outer mitochondrial membrane (OMM) and endoplasmic reticulum membrane (ERM) of living human fibroblasts. The proteomes of 137 and 634 proteins, respectively, are highly specific and highlight 94 potentially novel mitochondrial or ER proteins. Dataset intersection identified protein candidates potentially localized to mitochondria-ER contact sites. We found that one candidate, the tail-anchored, PDZ-domain-containing OMM protein SYNJ2BP, dramatically increases mitochondrial contacts with rough ER when overexpressed. Immunoprecipitation-mass spectrometry identified ribosome-binding protein 1 (RRBP1) as SYNJ2BP’s ERM binding partner. Our results highlight the power of proximity biotinylation to yield insights into the molecular composition and function of intracellular membranes. DOI: http://dx.doi.org/10.7554/eLife.24463.001 PMID:28441135

  10. Structural Characterization of Two Metastable ATP-Bound States of P-Glycoprotein

    PubMed Central

    O’Mara, Megan L.; Mark, Alan E.

    2014-01-01

    ATP Binding Cassette (ABC) transporters couple the binding and hydrolysis of ATP to the transport of substrate molecules across the membrane. The mechanism by which ATP binding and/or hydrolysis drives the conformational changes associated with substrate transport has not yet been characterized fully. Here, changes in the conformation of the ABC export protein P-glycoprotein on ATP binding are examined in a series of molecular dynamics simulations. When one molecule of ATP is placed at the ATP binding site associated with each of the two nucleotide binding domains (NBDs), the membrane-embedded P-glycoprotein crystal structure adopts two distinct metastable conformations. In one, each ATP molecule interacts primarily with the Walker A motif of the corresponding NBD. In the other, the ATP molecules interacts with both Walker A motif of one NBD and the Signature motif of the opposite NBD inducing the partial dimerization of the NBDs. This interaction is more extensive in one of the two ATP binding site, leading to an asymmetric structure. The overall conformation of the transmembrane domains is not altered in either of these metastable states, indicating that the conformational changes associated with ATP binding observed in the simulations in the absence of substrate do not lead to the outward-facing conformation and thus would be insufficient in themselves to drive transport. Nevertheless, the metastable intermediate ATP-bound conformations observed are compatible with a wide range of experimental cross-linking data demonstrating the simulations do capture physiologically important conformations. Analysis of the interaction between ATP and its cofactor Mg2+ with each NBD indicates that the coordination of ATP and Mg2+ differs between the two NBDs. The role structural asymmetry may play in ATP binding and hydrolysis is discussed. Furthermore, we demonstrate that our results are not heavily influenced by the crystal structure chosen for initiation of the simulations. PMID:24632881

  11. The crystal structure of NADPH:ferredoxin reductase from Azotobacter vinelandii.

    PubMed Central

    Sridhar Prasad, G.; Kresge, N.; Muhlberg, A. B.; Shaw, A.; Jung, Y. S.; Burgess, B. K.; Stout, C. D.

    1998-01-01

    NADPH:ferredoxin reductase (AvFPR) is involved in the response to oxidative stress in Azotobacter vinelandii. The crystal structure of AvFPR has been determined at 2.0 A resolution. The polypeptide fold is homologous with six other oxidoreductases whose structures have been solved including Escherichia coli flavodoxin reductase (EcFldR) and spinach, and Anabaena ferredoxin:NADP+ reductases (FNR). AvFPR is overall most homologous to EcFldR. The structure is comprised of a N-terminal six-stranded antiparallel beta-barrel domain, which binds FAD, and a C-terminal five-stranded parallel beta-sheet domain, which binds NADPH/NADP+ and has a classical nucleotide binding fold. The two domains associate to form a deep cleft where the NADPH and FAD binding sites are juxtaposed. The structure displays sequence conserved motifs in the region surrounding the two dinucleotide binding sites, which are characteristic of the homologous enzymes. The folded over conformation of FAD in AvFPR is similar to that in EcFldR due to stacking of Phe255 on the adenine ring of FAD, but it differs from that in the FNR enzymes, which lack a homologous aromatic residue. The structure of AvFPR displays three unique features in the environment of the bound FAD. Two features may affect the rate of reduction of FAD: the absence of an aromatic residue stacked on the isoalloxazine ring in the NADPH binding site; and the interaction of a carbonyl group with N10 of the flavin. Both of these features are due to the substitution of a conserved C-terminal tyrosine residue with alanine (Ala254) in AvFPR. An additional unique feature may affect the interaction of AvFPR with its redox partner ferredoxin I (FdI). This is the extension of the C-terminus by three residues relative to EcFldR and by four residues relative to FNR. The C-terminal residue, Lys258, interacts with the AMP phosphate of FAD. Consequently, both phosphate groups are paired with a basic group due to the simultaneous interaction of the FMN phosphate with Arg51 in a conserved FAD binding motif. The fourth feature, common to homologous oxidoreductases, is a concentration of 10 basic residues on the face of the protein surrounding the active site, in addition to Arg51 and Lys258. PMID:9865948

  12. Location of the synaptosome-binding regions on botulinum neurotoxin B.

    PubMed

    Dolimbek, Behzod Z; Steward, Lance E; Aoki, K Roger; Atassi, M Zouhair

    2012-01-10

    The regions of botulinum neurotoxin B (BoNT/B) involved in binding to mouse brain synaptosomes (snps) were localized. Sixty 19-residue overlapping peptides (peptide C31 consisted of 24 residues) encompassing BoNT/B H chain (residues 442-1291) were synthesized and used to inhibit binding of (125)I-labeled BoNT/B to snps. Synaptosome-binding regions were noncompeting and existed on both H(N) and H(C) domains of neurotoxin. At 37 °C, inhibitory activities on H(N) resided, in decreasing order, in peptides 638-656 (26.7%), 596-614 (18.2%), 512-530 (13.9%), 778-796 (13.8%), and 526-544 (11.6%). On H(C), activity resided in decreasing order in peptides 1170-1188 (44.6%), 1128-1146 (21.6%), 1184-1202 (18.6%), 1156-1174 (13.0%), 946-964 (11.8%), 1114-1132 (11.2%), 1100-1118 (6.2%), 876-894 (6.1%), 1268-1291 (4.6%), and 1226-1244 (4.3%). The 45 remaining H(N) and H(C) peptides had no activity. At 4 °C, peptide C24 (1170-1188) remained quite active (inhibiting, 31.2%), while activities of peptides N15, C21, and C25 were little under 10%. The snp-binding regions contained sites that bind synaptotagmin II and gangliosides. Despite the low degree of sequence homology, BoNT/B and BoNT/A display significant structural homology and appeared to bind in part to the same snp-binding regions. Binding of each labeled toxin to snps was inhibited ~50% by the other toxin, 70-72% by its correlate H(C), and by the H(C) of the other toxin [29% (BoNT/A by H(C) of B) or 32% (BoNT/B by H(C) of A)]. In the three-dimensional structure of BoNT/B, the greater part of H(C), one H(N) face, and part of the belt on the same side interact with snps. Thus, BoNT/B binds to snps through the H(C) head and employs regions on one H(N) face and the belt, reserving flexibility for the belt's unbound part to release the light chain. Most snp-binding regions coincide or overlap with blocking antibody (Ab)-binding regions explaining how such Abs prevent BoNT/B toxicity.

  13. Sites Inferred by Metabolic Background Assertion Labeling (SIMBAL): adapting the Partial Phylogenetic Profiling algorithm to scan sequences for signatures that predict protein function

    PubMed Central

    2010-01-01

    Background Comparative genomics methods such as phylogenetic profiling can mine powerful inferences from inherently noisy biological data sets. We introduce Sites Inferred by Metabolic Background Assertion Labeling (SIMBAL), a method that applies the Partial Phylogenetic Profiling (PPP) approach locally within a protein sequence to discover short sequence signatures associated with functional sites. The approach is based on the basic scoring mechanism employed by PPP, namely the use of binomial distribution statistics to optimize sequence similarity cutoffs during searches of partitioned training sets. Results Here we illustrate and validate the ability of the SIMBAL method to find functionally relevant short sequence signatures by application to two well-characterized protein families. In the first example, we partitioned a family of ABC permeases using a metabolic background property (urea utilization). Thus, the TRUE set for this family comprised members whose genome of origin encoded a urea utilization system. By moving a sliding window across the sequence of a permease, and searching each subsequence in turn against the full set of partitioned proteins, the method found which local sequence signatures best correlated with the urea utilization trait. Mapping of SIMBAL "hot spots" onto crystal structures of homologous permeases reveals that the significant sites are gating determinants on the cytosolic face rather than, say, docking sites for the substrate-binding protein on the extracellular face. In the second example, we partitioned a protein methyltransferase family using gene proximity as a criterion. In this case, the TRUE set comprised those methyltransferases encoded near the gene for the substrate RF-1. SIMBAL identifies sequence regions that map onto the substrate-binding interface while ignoring regions involved in the methyltransferase reaction mechanism in general. Neither method for training set construction requires any prior experimental characterization. Conclusions SIMBAL shows that, in functionally divergent protein families, selected short sequences often significantly outperform their full-length parent sequence for making functional predictions by sequence similarity, suggesting avenues for improved functional classifiers. When combined with structural data, SIMBAL affords the ability to localize and model functional sites. PMID:20102603

  14. Intermediate activity of midge antifreeze protein is due to a tyrosine-rich ice-binding site and atypical ice plane affinity.

    PubMed

    Basu, Koli; Wasserman, Samantha S; Jeronimo, Paul S; Graham, Laurie A; Davies, Peter L

    2016-04-01

    An antifreeze protein (AFP) from a midge (Chironomidae) was recently discovered and modelled as a tightly wound disulfide-braced solenoid with a surface-exposed rank of stacked tyrosines. New isoforms of the midge AFP have been identified from RT-PCR and are fully consistent with the model. Although they differ in the number of 10-residue coils, the row of tyrosines that form the putative ice-binding site is conserved. Recombinant midge AFP has been produced, and the properly folded form purified by ice affinity. This monomeric AFP has a distinct circular dichroism spectrum, a melting temperature between 35 and 50 °C and is fully renaturable on cooling. Mutagenesis of the middle tyrosine in the rank of seven eliminates antifreeze activity, whereas mutation of a tyrosine off this predicted ice-binding face had no such effect. This AFP has unusual properties compared to other known AFPs. First, its freezing-point depression activity is intermediate between that of the hyperactive and moderately active AFPs. As with hyperactive AFPs, when midge AFP-bound ice crystals exceed their freezing-point depression, ice grows explosively perpendicular to the c-axis. However, midge AFP does not bind to the basal plane of ice as do hyperactive AFPs, but rather to a pyramidal plane that is at a shallower angle relative to the basal plane than binding planes of moderate AFPs. These properties distinguish midge AFP from all other ice-binding proteins and the intermediate activity level fits well to the modest challenge of protecting newly emerged adult insects from late spring frosts. Nucleotide sequences of new midge AFP isoforms are available in the GenBank database under accession numbers KU094814-8. Sequences will be released after publication. © 2016 Federation of European Biochemical Societies.

  15. Asymmetric Preorganization of Inverted Pair Residues in the Sodium-Calcium Exchanger

    PubMed Central

    Giladi, Moshe; Almagor, Lior; van Dijk, Liat; Hiller, Reuben; Man, Petr; Forest, Eric; Khananshvili, Daniel

    2016-01-01

    In analogy with many other proteins, Na+/Ca2+ exchangers (NCX) adapt an inverted twofold symmetry of repeated structural elements, while exhibiting a functional asymmetry by stabilizing an outward-facing conformation. Here, structure-based mutant analyses of the Methanococcus jannaschii Na+/Ca2+ exchanger (NCX_Mj) were performed in conjunction with HDX-MS (hydrogen/deuterium exchange mass spectrometry) to identify the structure-dynamic determinants of functional asymmetry. HDX-MS identified hallmark differences in backbone dynamics at ion-coordinating residues of apo-NCX_Mj, whereas Na+or Ca2+ binding to the respective sites induced relatively small, but specific, changes in backbone dynamics. Mutant analysis identified ion-coordinating residues affecting the catalytic capacity (kcat/Km), but not the stability of the outward-facing conformation. In contrast, distinct “noncatalytic” residues (adjacent to the ion-coordinating residues) control the stability of the outward-facing conformation, but not the catalytic capacity. The helix-breaking signature sequences (GTSLPE) on the α1 and α2 repeats (at the ion-binding core) differ in their folding/unfolding dynamics, while providing asymmetric contributions to transport activities. The present data strongly support the idea that asymmetric preorganization of the ligand-free ion-pocket predefines catalytic reorganization of ion-bound residues, where secondary interactions with adjacent residues couple the alternating access. These findings provide a structure-dynamic basis for ion-coupled alternating access in NCX and similar proteins. PMID:26876271

  16. Urate is a ligand for the transcriptional regulator PecS.

    PubMed

    Perera, Inoka C; Grove, Anne

    2010-09-24

    PecS is a member of the MarR (multiple antibiotic resistance regulator) family, which has been shown in Erwinia to regulate the expression of virulence genes. MarR homologs typically bind a small molecule ligand, resulting in attenuated DNA binding. For PecS, the natural ligand has not been identified. We have previously shown that urate is a ligand for the Deinococcus radiodurans-encoded MarR homolog HucR (hypothetical uricase regulator) and identified residues responsible for ligand binding. We show here that all four residues involved in urate binding and propagation of conformational changes to DNA recognition helices are conserved in PecS homologs, suggesting that urate is the ligand for PecS. Consistent with this prediction, Agrobacterium tumefaciens PecS specifically binds urate, and urate attenuates DNA binding in vitro. PecS binds two operator sites in the intergenic region between the divergent pecS gene and pecM genes, one of which features two partially overlapping repeats to which PecS binds as a dimer on opposite faces of the duplex. Notably, urate dissociates PecS from cognate DNA, allowing transcription of both genes in vivo. Taken together, our data show that urate is a ligand for PecS and suggest that urate serves a novel function in signaling the colonization of a host plant. Copyright © 2010 Elsevier Ltd. All rights reserved.

  17. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  18. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  19. In silico Analysis of Conformational Changes Induced by Mutation of Aromatic Binding Residues: Consequences for Drug Binding in the hERG K+ Channel

    PubMed Central

    Knape, Kirsten; Linder, Tobias; Wolschann, Peter; Beyer, Anton; Stary-Weinzinger, Anna

    2011-01-01

    Pharmacological inhibition of cardiac hERG K+ channels is associated with increased risk of lethal arrhythmias. Many drugs reduce hERG current by directly binding to the channel, thereby blocking ion conduction. Mutation of two aromatic residues (F656 and Y652) substantially decreases the potency of numerous structurally diverse compounds. Nevertheless, some drugs are only weakly affected by mutation Y652A. In this study we utilize molecular dynamics simulations and docking studies to analyze the different effects of mutation Y652A on a selected number of hERG blockers. MD simulations reveal conformational changes in the binding site induced by mutation Y652A. Loss of π-π-stacking between the two aromatic residues induces a conformational change of the F656 side chain from a cavity facing to cavity lining orientation. Docking studies and MD simulations qualitatively reproduce the diverse experimentally observed modulatory effects of mutation Y652A and provide a new structural interpretation for the sensitivity differences. PMID:22194911

  20. The ebola virus interferon antagonist VP24 directly binds STAT1 and has a novel, pyramidal fold.

    PubMed

    Zhang, Adrianna P P; Bornholdt, Zachary A; Liu, Tong; Abelson, Dafna M; Lee, David E; Li, Sheng; Woods, Virgil L; Saphire, Erica Ollmann

    2012-02-01

    Ebolaviruses cause hemorrhagic fever with up to 90% lethality and in fatal cases, are characterized by early suppression of the host innate immune system. One of the proteins likely responsible for this effect is VP24. VP24 is known to antagonize interferon signaling by binding host karyopherin α proteins, thereby preventing them from transporting the tyrosine-phosphorylated transcription factor STAT1 to the nucleus. Here, we report that VP24 binds STAT1 directly, suggesting that VP24 can suppress at least two distinct branches of the interferon pathway. Here, we also report the first crystal structures of VP24, derived from different species of ebolavirus that are pathogenic (Sudan) and nonpathogenic to humans (Reston). These structures reveal that VP24 has a novel, pyramidal fold. A site on a particular face of the pyramid exhibits reduced solvent exchange when in complex with STAT1. This site is above two highly conserved pockets in VP24 that contain key residues previously implicated in virulence. These crystal structures and accompanying biochemical analysis map differences between pathogenic and nonpathogenic viruses, offer templates for drug design, and provide the three-dimensional framework necessary for biological dissection of the many functions of VP24 in the virus life cycle.

  1. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  2. Divalent ions are potential permeating blockers of the non-selective NaK ion channel: combined QM and MD based investigations.

    PubMed

    Sadhu, Biswajit; Sundararajan, Mahesh; Bandyopadhyay, Tusar

    2017-10-18

    The bacterial NaK ion channel is distinctly different from other known ion channels due to its inherent non-selective feature. One of the unexplored and rather interesting features is its ability to permeate divalent metal ions (such as Ca 2+ and Ba 2+ ) and not monovalent alkali metal ions. Several intriguing questions about the energetics and structural aspects still remain unanswered. For instance, what causes Ca 2+ to permeate as well as block the selectivity filter (SF) of the NaK ion channel and act as a "permeating blocker"? How and at what energetic cost does another chemical congener, Sr 2+ , as well as Ba 2+ , a potent blocker of the K + ion channel, permeate through the SF of the NaK ion channel? Finally, how do their translocation energetics differ from those of monovalent ions such as K + ? Here, in an attempt to address these outstanding issues, we elucidate the structure, binding and selectivity of divalent ions (Ca 2+ , Sr 2+ and Ba 2+ ) as they permeate through the SF of the NaK ion channel using all-atom molecular dynamics simulations and density functional theory based calculations. We unveil mechanistic insight into this translocation event using well-tempered metadynamics simulations in a polarizable environment using the mean-field model of water and incorporating electronic continuum corrections for ions via charge rescaling. The results show that, akin to K + coordination, Sr 2+ and Ba 2+ bind at the SF in a very similar fashion and remain octa-coordinated at all sites. Interestingly, differing from its local hydration structure, Ca 2+ interacts with eight carbonyls to remain at the middle of the S3 site. Furthermore, the binding of divalent metals at SF binding sites is more favorable than the binding of K + . However, their permeation through the extracellular entrance faces a considerably higher energetic barrier compared to that for K + , which eventually manifests their inherent blocking feature.

  3. Salt bridge dynamics control substrate-induced conformational change in the membrane transporter GlpT

    PubMed Central

    Law, Christopher J.; Almqvist, Jonas; Bernstein, Adam; Goetz, Regina M.; Huang, Yafei; Soudant, Celine; Laaksonen, Aatto; Hovmöller, Sven; Wang, Da-Neng

    2008-01-01

    Summary Active transport of substrates across cytoplasmic membranes is of great physiological, medical and pharmaceutical importance. The glycerol-3-phosphate (G3P) transporter (GlpT) of the E. coli inner membrane is a secondary active antiporter from the ubiquitous major facilitator superfamily that couples the import of G3P to the efflux of inorganic phosphate (Pi) down its concentration gradient. Integrating information from a novel combination of structural, molecular dynamics simulations and biochemical studies, we identify the residues involved directly in binding of substrate to the inward-facing conformation of GlpT, thus defining the structural basis for the substrate-specificity of this transporter. The substrate binding mechanism involves protonation of a histidine residue at the binding site. Furthermore, our data suggest that the formation and breaking of inter- and intradomain salt bridges control the conformational change of the transporter that accompanies substrate translocation across the membrane. The mechanism we propose may be a paradigm for organophosphate/phosphate antiporters. PMID:18395745

  4. Mevalonate 5-diphosphate mediates ATP binding to the mevalonate diphosphate decarboxylase from the bacterial pathogen Enterococcus faecalis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Chun-Liang; Mermoud, James C.; Paul, Lake N.

    The mevalonate pathway produces isopentenyl diphosphate (IPP), a building block for polyisoprenoid synthesis, and is a crucial pathway for growth of the human bacterial pathogen Enterococcus faecalis. The final enzyme in this pathway, mevalonate diphosphate decarboxylase (MDD), acts on mevalonate diphosphate (MVAPP) to produce IPP while consuming ATP. This essential enzyme has been suggested as a therapeutic target for the treatment of drug-resistant bacterial infections. Here, we report functional and structural studies on the mevalonate diphosphate decarboxylase from E. faecalis (MDDEF). The MDDEF crystal structure in complex with ATP (MDDEF–ATP) revealed that the phosphate-binding loop (amino acids 97–105) is notmore » involved in ATP binding and that the phosphate tail of ATP in this structure is in an outward-facing position pointing away from the active site. This suggested that binding of MDDEF to MVAPP is necessary to guide ATP into a catalytically favorable position. Enzymology experiments show that the MDDEF performs a sequential ordered bi-substrate reaction with MVAPP as the first substrate, consistent with the isothermal titration calorimetry (ITC) experiments. On the basis of ITC results, we propose that this initial prerequisite binding of MVAPP enhances ATP binding. In summary, our findings reveal a substrate-induced substrate-binding event that occurs during the MDDEF-catalyzed reaction. The disengagement of the phosphate-binding loop concomitant with the alternative ATP-binding configuration may provide the structural basis for antimicrobial design against these pathogenic enterococci.« less

  5. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  6. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh,S.; Yamashita, A.; Gouaux, E.

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibitionmore » exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational design of new inhibitors.« less

  7. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  8. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  9. Conserved Arginines at the P-Protein Stalk Binding Site and the Active Site Are Critical for Ribosome Interactions of Shiga Toxins but Do Not Contribute to Differences in the Affinity of the A1 Subunits for the Ribosome.

    PubMed

    Basu, Debaleena; Kahn, Jennifer N; Li, Xiao-Ping; Tumer, Nilgun E

    2016-12-01

    The A1 subunits of Shiga toxin 1 (Stx1A1) and Shiga toxin 2 (Stx2A1) interact with the conserved C termini of ribosomal-stalk P-proteins to remove a specific adenine from the sarcin/ricin loop. We previously showed that Stx2A1 has higher affinity for the ribosome and higher catalytic activity than Stx1A1. To determine if conserved arginines at the distal face of the active site contribute to the higher affinity of Stx2A1 for the ribosome, we mutated Arg172, Arg176, and Arg179 in both toxins. We show that Arg172 and Arg176 are more important than Arg179 for the depurination activity and toxicity of Stx1A1 and Stx2A1. Mutation of a single arginine reduced the depurination activity of Stx1A1 more than that of Stx2A1. In contrast, mutation of at least two arginines was necessary to reduce depurination by Stx2A1 to a level similar to that of Stx1A1. R176A and R172A/R176A mutations eliminated interaction of Stx1A1 and Stx2A1 with ribosomes and with the stalk, while mutation of Arg170 at the active site reduced the binding affinity of Stx1A1 and Stx2A1 for the ribosome, but not for the stalk. These results demonstrate that conserved arginines at the distal face of the active site are critical for interactions of Stx1A1 and Stx2A1 with the stalk, while a conserved arginine at the active site is critical for non-stalk-specific interactions with the ribosome. Arginine mutations at either site reduced ribosome interactions of Stx1A1 and Stx2A1 similarly, indicating that conserved arginines are critical for ribosome interactions but do not contribute to the higher affinity of Stx2A1 for the ribosome. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  11. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  12. Exploring the Interaction of SV2A with Racetams Using Homology Modelling, Molecular Dynamics and Site-Directed Mutagenesis

    PubMed Central

    Lee, Joanna; Daniels, Veronique; Sands, Zara A.; Lebon, Florence; Shi, Jiye; Biggin, Philip C.

    2015-01-01

    The putative Major Facilitator Superfamily (MFS) transporter, SV2A, is the target for levetiracetam (LEV), which is a successful anti-epileptic drug. Furthermore, SV2A knock out mice display a severe seizure phenotype and die after a few weeks. Despite this, the mode of action of LEV is not known at the molecular level. It would be extremely desirable to understand this more fully in order to aid the design of improved anti-epileptic compounds. Since there is no structure for SV2A, homology modelling can provide insight into the ligand-binding site. However, it is not a trivial process to build such models, since SV2A has low sequence identity to those MFS transporters whose structures are known. A further level of complexity is added by the fact that it is not known which conformational state of the receptor LEV binds to, as multiple conformational states have been inferred by tomography and ligand binding assays or indeed, if binding is exclusive to a single state. Here, we explore models of both the inward and outward facing conformational states of SV2A (according to the alternating access mechanism for MFS transporters). We use a sequence conservation analysis to help guide the homology modelling process and generate the models, which we assess further with Molecular Dynamics (MD). By comparing the MD results in conjunction with docking and simulation of a LEV-analogue used in radioligand binding assays, we were able to suggest further residues that line the binding pocket. These were confirmed experimentally. In particular, mutation of D670 leads to a complete loss of binding. The results shed light on the way LEV analogues may interact with SV2A and may help with the on-going design of improved anti-epileptic compounds. PMID:25692762

  13. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  14. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  15. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  16. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  17. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  19. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  20. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  1. Asymmetry of inverted-topology repeats in the AE1 anion exchanger suggests an elevator-like mechanism

    PubMed Central

    Faraldo-Gómez, José D.

    2017-01-01

    The membrane transporter anion exchanger 1 (AE1), or band 3, is a key component in the processes of carbon-dioxide transport in the blood and urinary acidification in the renal collecting duct. In both erythrocytes and the basolateral membrane of the collecting-duct α-intercalated cells, the role of AE1 is to catalyze a one-for-one exchange of chloride for bicarbonate. After decades of biochemical and functional studies, the structure of the transmembrane region of AE1, which catalyzes the anion-exchange reaction, has finally been determined. Each protomer of the AE1 dimer comprises two repeats with inverted transmembrane topologies, but the structures of these repeats differ. This asymmetry causes the putative substrate-binding site to be exposed only to the extracellular space, consistent with the expectation that anion exchange occurs via an alternating-access mechanism. Here, we hypothesize that the unknown, inward-facing conformation results from inversion of this asymmetry, and we propose a model of this state constructed using repeat-swap homology modeling. By comparing this inward-facing model with the outward-facing experimental structure, we predict that the mechanism of AE1 involves an elevator-like motion of the substrate-binding domain relative to the nearly stationary dimerization domain and to the membrane plane. This hypothesis is in qualitative agreement with a wide range of biochemical and functional data, which we review in detail, and suggests new avenues of experimentation. PMID:29167180

  2. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  3. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  4. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  5. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  6. Vitreoscilla hemoglobin. Intracellular localization and binding to membranes.

    PubMed

    Ramandeep; Hwang, K W; Raje, M; Kim, K J; Stark, B C; Dikshit, K L; Webster, D A

    2001-07-06

    The obligate aerobic bacterium, Vitreoscilla, synthesizes elevated quantities of a homodimeric hemoglobin (VHb) under hypoxic growth conditions. Expression of VHb in heterologous hosts often enhances growth and product formation. A role in facilitating oxygen transfer to the respiratory membranes is one explanation of its cellular function. Immunogold labeling of VHb in both Vitreoscilla and recombinant Escherichia coli bearing the VHb gene clearly indicated that VHb has a cytoplasmic (not periplasmic) localization and is concentrated near the periphery of the cytosolic face of the cell membrane. OmpA signal-peptide VHb fusions were transported into the periplasm in E. coli, but this did not confer any additional growth advantage. The interaction of VHb with respiratory membranes was also studied. The K(d) values for the binding of VHb to Vitreoscilla and E. coli cell membranes were approximately 5-6 microm, a 4-8-fold higher affinity than those of horse myoglobin and hemoglobin for these same membranes. VHb stimulated the ubiquinol-1 oxidase activity of inverted Vitreoscilla membranes by 68%. The inclusion of Vitreoscilla cytochrome bo in proteoliposomes led to 2.4- and 6-fold increases in VHb binding affinity and binding site number, respectively, relative to control liposomes, suggesting a direct interaction between VHb and cytochrome bo.

  7. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  8. SLITHER: a web server for generating contiguous conformations of substrate molecules entering into deep active sites of proteins or migrating through channels in membrane transporters.

    PubMed

    Lee, Po-Hsien; Kuo, Kuei-Ling; Chu, Pei-Ying; Liu, Eric M; Lin, Jung-Hsin

    2009-07-01

    Many proteins use a long channel to guide the substrate or ligand molecules into the well-defined active sites for catalytic reactions or for switching molecular states. In addition, substrates of membrane transporters can migrate to another side of cellular compartment by means of certain selective mechanisms. SLITHER (http://bioinfo.mc.ntu.edu.tw/slither/or http://slither.rcas.sinica.edu.tw/) is a web server that can generate contiguous conformations of a molecule along a curved tunnel inside a protein, and the binding free energy profile along the predicted channel pathway. SLITHER adopts an iterative docking scheme, which combines with a puddle-skimming procedure, i.e. repeatedly elevating the potential energies of the identified global minima, thereby determines the contiguous binding modes of substrates inside the protein. In contrast to some programs that are widely used to determine the geometric dimensions in the ion channels, SLITHER can be applied to predict whether a substrate molecule can crawl through an inner channel or a half-channel of proteins across surmountable energy barriers. Besides, SLITHER also provides the list of the pore-facing residues, which can be directly compared with many genetic diseases. Finally, the adjacent binding poses determined by SLITHER can also be used for fragment-based drug design.

  9. Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes

    PubMed Central

    Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori

    2015-01-01

    Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955

  10. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  11. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  13. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  14. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  15. Simulation studies of substrate recognition by the exocellulase CelF from Clostridium cellulolyticum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Mo; Himmel, Michael E.; Wilson, David B.

    Molecular dynamics (MD) simulations were used to study substrate recognition by the family 48 exocellulase CelF from Clostridium cellulolyticum. It was hypothesized that residues around the entrance of the active site tunnel of this enzyme might serve to recognize and bind the substrate through an affinity for the cellulose monomer repeat unit, ..beta..-d-glucopyranose. Simulations were conducted of the catalytic domain of this enzyme surrounded by a concentrated solution of ..beta..-d-glucopyranose, and the full three-dimensional probability distribution for finding sugar molecules adjacent to the enzyme was calculated from the trajectory. A significant probability of finding the sugar stacked against the planarmore » faces of Trp 310 and Trp 312 at the entrance of the active site tunnel was observed.« less

  16. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  17. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  18. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  19. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  20. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  1. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  2. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  3. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  4. The membrane bound bacterial lipocalin Blc is a functional dimer with binding preference for lysophospholipids

    PubMed Central

    Campanacci, Valérie; Bishop, Russell E.; Blangy, Stéphanie; Tegoni, Mariella; Cambillau, Christian

    2016-01-01

    Lipocalins, a widespread multifunctional family of small proteins (15–25 kDa) have been first described in eukaryotes and more recently in Gram-negative bacteria. Bacterial lipocalins belonging to class I are outer membrane lipoproteins, among which Blc from E. coli is the better studied. Blc is expressed under conditions of starvation and high osmolarity, conditions known to exert stress on the cell envelope. The structure of Blc that we have previously solved (V. Campanacci, D. Nurizzo, S. Spinelli, C. Valencia, M. Tegoni, C. Cambillau, FEBS Lett. 562 (2004) 183–188.) suggested its possible role in binding fatty acids or phospholipids. Both physiological and structural data on Blc, therefore, point to a role in storage or transport of lipids necessary for membrane maintenance. In order to further document this hypothesis for Blc function, we have performed binding studies using fluorescence quenching experiments. Our results indicate that dimeric Blc binds fatty acids and phospholipids in a micromolar Kd range. The crystal structure of Blc with vaccenic acid, an unsaturated C18 fatty acid, reveals that the binding site spans across the Blc dimer, opposite to its membrane anchored face. An exposed unfilled pocket seemingly suited to bind a polar group attached to the fatty acid prompted us to investigate lyso-phospholipids, which were found to bind in a nanomolar Kd range. We discuss these findings in terms of a potential role for Blc in the metabolism of lysophospholipids generated in the bacterial outer membrane. PMID:16920109

  5. Side Fenestrations Provide an "Anchor" for a Stable Binding of A1899 to the Pore of TASK-1 Potassium Channels.

    PubMed

    Ramírez, David; Arévalo, Bárbara; Martínez, Gonzalo; Rinné, Susanne; Sepúlveda, Francisco V; Decher, Niels; González, Wendy

    2017-07-03

    A1899 is a potent and selective inhibitor of the two-pore domain potassium (K 2P ) channel TASK-1. It was previously reported that A1899 acts as an open-channel blocker and binds to residues of the P1 and P2 regions, the M2 and M4 segments, and the halothane response element. The recently described crystal structures of K 2P channels together with the newly identified side fenestrations indicate that residues relevant for TASK-1 inhibition are not purely facing the central cavity as initially proposed. Accordingly, the TASK-1 binding site and the mechanism of inhibition might need a re-evaluation. We have used TASK-1 homology models based on recently crystallized K 2P channels and molecular dynamics simulation to demonstrate that the highly potent TASK-1 blocker A1899 requires binding to residues located in the side fenestrations. Unexpectedly, most of the previously described residues that interfere with TASK-1 blockade by A1899 project their side chains toward the fenestration lumina, underlining the relevance of these structures for drug binding in K 2P channels. Despite its hydrophobicity, A1899 does not seem to use the fenestrations to gain access to the central cavity from the lipid bilayer. In contrast, binding of A1899 to residues of the side fenestrations might provide a physical "anchor", reflecting an energetically favorable binding mode that after pore occlusion stabilizes the closed state of the channels.

  6. Organic metal neutron detector

    DOEpatents

    Butler, Michael A.; Ginley, David S.

    1987-01-01

    A device for detecting neutrons comprises a layer of conductive polymer sandwiched between electrodes, which may be covered on each face with a neutron transmissive insulating material layer. Conventional electrodes are used for a non-imaging integrating total neutron fluence-measuring embodiment, while wire grids are used in an imaging version of the device. The change in conductivity of the polymer after exposure to a neutron flux is determined in either case to provide the desired data. Alternatively, the exposed conductive polymer layer may be treated with a chemical reagent which selectively binds to the sites altered by neutrons to produce an image of the flux detected.

  7. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  8. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  9. Increased phase synchronization during continuous face integration measured simultaneously with EEG and fMRI.

    PubMed

    Kottlow, Mara; Jann, Kay; Dierks, Thomas; Koenig, Thomas

    2012-08-01

    Gamma zero-lag phase synchronization has been measured in the animal brain during visual binding. Human scalp EEG studies used a phase locking factor (trial-to-trial phase-shift consistency) or gamma amplitude to measure binding but did not analyze common-phase signals so far. This study introduces a method to identify networks oscillating with near zero-lag phase synchronization in human subjects. We presented unpredictably moving face parts (NOFACE) which - during some periods - produced a complete schematic face (FACE). The amount of zero-lag phase synchronization was measured using global field synchronization (GFS). GFS provides global information on the amount of instantaneous coincidences in specific frequencies throughout the brain. Gamma GFS was increased during the FACE condition. To localize the underlying areas, we correlated gamma GFS with simultaneously recorded BOLD responses. Positive correlates comprised the bilateral middle fusiform gyrus and the left precuneus. These areas may form a network of areas transiently synchronized during face integration, including face-specific as well as binding-specific regions and regions for visual processing in general. Thus, the amount of zero-lag phase synchronization between remote regions of the human visual system can be measured with simultaneously acquired EEG/fMRI. Copyright © 2012 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  10. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  11. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  12. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  13. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  14. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  15. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  16. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  17. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  18. Changing Faces of Transcriptional Regulation Reflected by Zic3

    PubMed Central

    Winata, Cecilia Lanny; Kondrychyn, Igor; Deddens, J.C.; Korzh, Vladimir

    2015-01-01

    The advent of genomics in the study of developmental mechanisms has brought a trove of information on gene datasets and regulation during development, where the Zic family of zinc-finger proteins plays an important role. Genomic analysis of the modes of action of Zic3 in pluripotent cells demonstrated its requirement for maintenance of stem cells pluripotency upon binding to the proximal regulatory regions (promoters) of genes associated with cell pluripotency (Nanog, Sox2, Oct4, etc.) as well as cell cycle, proliferation, oncogenesis and early embryogenesis. In contrast, during gastrulation and neurulation Zic3 acts by binding the distal regulatory regions (enhancers, etc) associated with control of gene transcription in the Nodal and Wnt signaling pathways, including genes that act to break body symmetry. This illustrates a general role of Zic3 as a transcriptional regulator that acts not only alone, but in many instances in conjunction with other transcription factors. The latter is done by binding to adjacent sites in the context of multi-transcription factor complexes associated with regulatory elements. PMID:26085810

  19. Dual interaction of scaffold protein Tim44 of mitochondrial import motor with channel-forming translocase subunit Tim23

    PubMed Central

    Ting, See-Yeun; Yan, Nicholas L; Schilke, Brenda A; Craig, Elizabeth A

    2017-01-01

    Proteins destined for the mitochondrial matrix are targeted to the inner membrane Tim17/23 translocon by their presequences. Inward movement is driven by the matrix-localized, Hsp70-based motor. The scaffold Tim44, interacting with the matrix face of the translocon, recruits other motor subunits and binds incoming presequence. The basis of these interactions and their functional relationships remains unclear. Using site-specific in vivo crosslinking and genetic approaches in Saccharomyces cerevisiae, we found that both domains of Tim44 interact with the major matrix-exposed loop of Tim23, with the C-terminal domain (CTD) binding Tim17 as well. Results of in vitro experiments showed that the N-terminal domain (NTD) is intrinsically disordered and binds presequence near a region important for interaction with Hsp70 and Tim23. Our data suggest a model in which the CTD serves primarily to anchor Tim44 to the translocon, whereas the NTD is a dynamic arm, interacting with multiple components to drive efficient translocation. DOI: http://dx.doi.org/10.7554/eLife.23609.001 PMID:28440746

  20. Profile of apalutamide in the treatment of metastatic castration-resistant prostate cancer: evidence to date.

    PubMed

    Chong, Julio T; Oh, William K; Liaw, Bobby C

    2018-01-01

    Advances in therapies have led to the approval of six therapeutic agents since 2004, each demonstrating overall survival benefit in randomized studies, and these have significantly improved the outlook for men facing metastatic castration-resistant prostate cancer (CRPC). More recently, efforts have been directed at trying to effect change at earlier phases of the disease. Apalutamide (ARN-509), a second-generation androgen receptor antagonist, recently received approval in the nonmetastatic (M0) CRPC space. Similar to enzalutamide, apalutamide inhibits the binding of androgen to androgen receptor (AR), nuclear translocation of the androgen-AR complex, and binding of AR transcription complex to DNA-binding sites and transcription elements. Phase I and II trial experience demonstrates the safety and tolerability of apalutamide, as well as its efficacy in effecting prostate-specific antigen response and radiographic-free survival in CRPC. US Food and Drug Administration approval in M0 CRPC was granted following positive results from the phase III SPARTAN study, where apalutamide demonstrated significant improvements in metastasis-free survival and time to symptomatic progression as compared to placebo.

  1. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  2. On the distribution of Na+ pump sites in the frog skin

    PubMed Central

    Mills, JW; DiBona, DR

    1977-01-01

    Exposure of the outside of the isolated frog skin to a Ringer's solution, made hypertonic by the addition of mannitol, causes a rapid and sustained increase in transepithelial permeability through a structural distortion-a focal blistering-of the "tight" junctions of the outermost living cell layer. [(3)H]ouabain, used as an autoradiographic marker for the Na+-pump (Na+-K+-adenosine triphosphatase), is usually unable to penetrate the frog skin from the outside solution, but when added to a hypertonic mannitol- Ringer's solution in the outside bath it readily penetrates the epithelium, presumably through the opened shunt pathway. Radioautographic analysis of [(3)H]ouabain binding sites revealed that most of ouabain enters from the outside solution binds to the sites on the cell membranes of the stratum spinosum, as was the case when it was applied from the inside bath in an earlier study. The outer living cell layer, the first to be exposed to ouabain, does not appear to be the major site for the Na+-pump, and therefore, is not likely to be responsible for most of the active pumping of Na+. This result demonstrates that previous failure to show a high density of Na+-pump sites on the cells of the outermost layer, when [(3)H]ouabain was applied from the inside solution, was not due to the inability of the marker to reach these cells at a sufficient concentration to reveal all pump sites. These results provide further support for a model of Na+-transport across the frog skin which distributes the active pump step on the inward facing membranes of all living cells. PMID:144738

  3. Multisite adsorption of cadmium on goethite

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venema, P.; Hiemstra, T.; Riemsdijk, W.H. van

    1996-11-10

    Recently a new general ion adsorption model has been developed for ion binding to mineral surfaces (Hiemstra and van Riemsdijk, 1996). The model uses the Pauling concept of charge distribution (CD) and is an extension of the multi-site complexation (MUSIC) approach. In the CD-MUSIC model the charge of an adsorbing ion that forms an inner sphere complex is distributed over its ligands, which are present in two different electrostatic planes. In this paper the authors have applied the CD-MUSIC model to the adsorption of metal cations, using an extended data set for cadmium adsorbing on goethite. The adsorption of cadmiummore » and the cadmium-proton exchange ratio were measured as function of metal ion concentration, pH, and ionic strength. The data could be described well, taking into account the surface heterogeneity resulting from the presence of two different crystal planes (the dominant 110 face and the minor 021 face). The surface species used in the model are consistent with recent EXAFS data. In accordance with the EXAFS results, high-affinity complexes at the 021 face were used in the model.« less

  4. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  5. A Markov State-based Quantitative Kinetic Model of Sodium Release from the Dopamine Transporter

    NASA Astrophysics Data System (ADS)

    Razavi, Asghar M.; Khelashvili, George; Weinstein, Harel

    2017-01-01

    The dopamine transporter (DAT) belongs to the neurotransmitter:sodium symporter (NSS) family of membrane proteins that are responsible for reuptake of neurotransmitters from the synaptic cleft to terminate a neuronal signal and enable subsequent neurotransmitter release from the presynaptic neuron. The release of one sodium ion from the crystallographically determined sodium binding site Na2 had been identified as an initial step in the transport cycle which prepares the transporter for substrate translocation by stabilizing an inward-open conformation. We have constructed Markov State Models (MSMs) from extensive molecular dynamics simulations of human DAT (hDAT) to explore the mechanism of this sodium release. Our results quantify the release process triggered by hydration of the Na2 site that occurs concomitantly with a conformational transition from an outward-facing to an inward-facing state of the transporter. The kinetics of the release process are computed from the MSM, and transition path theory is used to identify the most probable sodium release pathways. An intermediate state is discovered on the sodium release pathway, and the results reveal the importance of various modes of interaction of the N-terminus of hDAT in controlling the pathways of release.

  6. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  7. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  8. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  9. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  10. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  11. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  13. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  14. Mapping the receptor site for alpha-scorpion toxins on a Na+ channel voltage sensor.

    PubMed

    Wang, Jinti; Yarov-Yarovoy, Vladimir; Kahn, Roy; Gordon, Dalia; Gurevitz, Michael; Scheuer, Todd; Catterall, William A

    2011-09-13

    The α-scorpions toxins bind to the resting state of Na(+) channels and inhibit fast inactivation by interaction with a receptor site formed by domains I and IV. Mutants T1560A, F1610A, and E1613A in domain IV had lower affinities for Leiurus quinquestriatus hebraeus toxin II (LqhII), and mutant E1613R had ~73-fold lower affinity. Toxin dissociation was accelerated by depolarization and increased by these mutations, whereas association rates at negative membrane potentials were not changed. These results indicate that Thr1560 in the S1-S2 loop, Phe1610 in the S3 segment, and Glu1613 in the S3-S4 loop in domain IV participate in toxin binding. T393A in the SS2-S6 loop in domain I also had lower affinity for LqhII, indicating that this extracellular loop may form a secondary component of the receptor site. Analysis with the Rosetta-Membrane algorithm resulted in a model of LqhII binding to the voltage sensor in a resting state, in which amino acid residues in an extracellular cleft formed by the S1-S2 and S3-S4 loops in domain IV interact with two faces of the wedge-shaped LqhII molecule. The conserved gating charges in the S4 segment are in an inward position and form ion pairs with negatively charged amino acid residues in the S2 and S3 segments of the voltage sensor. This model defines the structure of the resting state of a voltage sensor of Na(+) channels and reveals its mode of interaction with a gating modifier toxin.

  15. Characterization of the Heme Environment in Arabidopsis thaliana Fatty Acid α-Dioxygenase-1*

    PubMed Central

    Liu, Wen; Rogge, Corina E.; Bambai, Bijan; Palmer, Graham; Tsai, Ah-Lim; Kulmacz, Richard J.

    2010-01-01

    Plant α-dioxygenases (PADOX) are hemoproteins in the myeloperoxidase family. We have used a variety of spectroscopic, mutagenic, and kinetic approaches to characterize the heme environment in Arabidopsis thaliana PADOX-1. Recombinant PADOX-1 purified to homogeneity contained 1 mol of heme bound tightly but noncovalently per protein monomer. Electronic absorbance, electron paramagnetic resonance, and magnetic circular dichroism spectra showed a high spin ferric heme that could be reduced to the ferrous state by dithionite. Cyanide bound relatively weakly in the ferric PADOX-1 heme vicinity (Kd ~10 mm) but did not shift the heme to the low spin state. Cyanide was a very strong inhibitor of the fatty acid oxygenase activity (Ki ~5 µm) and increased the Km value for oxygen but not that for fatty acid. Spectroscopic analyses indicated that carbon monoxide, azide, imidazole, and a variety of substituted imidazoles did not bind appreciably in the ferric PADOX-1 heme vicinity. Substitution of His-163 and His-389 with cysteine, glutamine, tyrosine, or methionine resulted in variable degrees of perturbation of the heme absorbance spectrum and oxygenase activity, consistent with His-389 serving as the proximal heme ligand and indicating that the heme has a functional role in catalysis. Overall, A. thaliana PADOX-1 resembles a b-type cytochrome, although with much more restricted access to the distal face of the heme than seen in most other myeloperoxidase family members, explaining the previously puzzling lack of peroxidase activity in the plant protein. PADOX-1 is unusual in that it has a high affinity, inhibitory cyanide-binding site distinct from the distal heme face and the fatty acid site. PMID:15100225

  16. Crystal structure of the Xpo1p nuclear export complex bound to the SxFG/PxFG repeats of the nucleoporin Nup42p.

    PubMed

    Koyama, Masako; Hirano, Hidemi; Shirai, Natsuki; Matsuura, Yoshiyuki

    2017-10-01

    Xpo1p (yeast CRM1) is the major nuclear export receptor that carries a plethora of proteins and ribonucleoproteins from the nucleus to cytoplasm. The passage of the Xpo1p nuclear export complex through nuclear pore complexes (NPCs) is facilitated by interactions with nucleoporins (Nups) containing extensive repeats of phenylalanine-glycine (so-called FG repeats), although the precise role of each Nup in the nuclear export reaction remains incompletely understood. Here we report structural and biochemical characterization of the interactions between the Xpo1p nuclear export complex and the FG repeats of Nup42p, a nucleoporin localized at the cytoplasmic face of yeast NPCs and has characteristic SxFG/PxFG sequence repeat motif. The crystal structure of Xpo1p-PKI-Nup42p-Gsp1p-GTP complex identified three binding sites for the SxFG/PxFG repeats on HEAT repeats 14-20 of Xpo1p. Mutational analyses of Nup42p showed that the conserved serines and prolines in the SxFG/PxFG repeats contribute to Xpo1p-Nup42p binding. Our structural and biochemical data suggest that SxFG/PxFG-Nups such as Nup42p and Nup159p at the cytoplasmic face of NPCs provide high-affinity docking sites for the Xpo1p nuclear export complex in the terminal stage of NPC passage and that subsequent disassembly of the nuclear export complex facilitates recycling of free Xpo1p back to the nucleus. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  17. Molecular model of the outward facing state of the human P-glycoprotein (ABCB1), and comparison to a model of the human MRP5 (ABCC5)

    PubMed Central

    Ravna, Aina W; Sylte, Ingebrigt; Sager, Georg

    2007-01-01

    Background Multidrug resistance is a particular limitation to cancer chemotherapy, antibiotic treatment and HIV medication. The ABC (ATP binding cassette) transporters human P-glycoprotein (ABCB1) and the human MRP5 (ABCC5) are involved in multidrug resistance. Results In order to elucidate structural and molecular concepts of multidrug resistance, we have constructed a molecular model of the ATP-bound outward facing conformation of the human multidrug resistance protein ABCB1 using the Sav1866 crystal structure as a template, and compared the ABCB1 model with a previous ABCC5 model. The electrostatic potential surface (EPS) of the ABCB1 substrate translocation chamber, which transports cationic amphiphilic and lipophilic substrates, was neutral with negative and weakly positive areas. In contrast, EPS of the ABCC5 substrate translocation chamber, which transports organic anions, was generally positive. Positive-negative ratios of amino acids in the TMDs of ABCB1 and ABCC5 were also analyzed, and the positive-negative ratio of charged amino acids was higher in the ABCC5 TMDs than in the ABCB1 TMDs. In the ABCB1 model residues Leu65 (transmembrane helix 1 (TMH1)), Ile306 (TMH5), Ile340 (TMH6) and Phe343 (TMH6) may form a binding site, and this is in accordance with previous site directed mutagenesis studies. Conclusion The Sav1866 X-ray structure may serve as a suitable template for the ABCB1 model, as it did with ABCC5. The EPS in the substrate translocation chambers and the positive-negative ratio of charged amino acids were in accordance with the transport of cationic amphiphilic and lipophilic substrates by ABCB1, and the transport of organic anions by ABCC5. PMID:17803828

  18. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  19. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  20. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  2. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  4. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  5. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  6. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  7. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  8. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  9. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  10. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  11. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  12. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  13. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  14. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-binding Module on Cellulose*

    PubMed Central

    Nimlos, Mark R.; Beckham, Gregg T.; Matthews, James F.; Bu, Lintao; Himmel, Michael E.; Crowley, Michael F.

    2012-01-01

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 μs of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose. PMID:22496371

  15. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  16. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  17. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  18. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  19. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  20. Face Memory: Implications for theories of binding items to context

    PubMed Central

    Reder, L. M.; Victoria, L. W.; Manelis, A.; Oates, J. M.; Dutcher, J. M.; Bates, J. T.; Cook, S.; Aizenstein, H. A.; Quinlan, J.; Gyulai, F.

    2014-01-01

    Two experiments tested the hypothesis that it is easier to bind a stimulus to context when the stimulus already has a stable (i.e., pre-existing) memory representation by comparing episodic memory of faces of celebrities vs. unknown individuals. Each face was superimposed on a picture of a well-known location (e.g., Eiffel Tower) during encoding and at a later unexpected recognition test but the background could change from encoding to test. Although recognition was to be based on the face, irrespective of background, performance was better when encoding context was reinstated. Further, a given background could be shown with many faces ("high fan") or only a few ("low fan") and this variable modulated the value added of context reinstatement. Importantly, manipulations of context only mattered for famous faces. As predicted, these effects were observed in recollection ("Remember") responses not in familiarity (“Know”) responses. Experiment 2 used the same design except that half of the subjects were administered midazolam, a drug that produces temporary anterograde amnesia, prior to encoding faces and backgrounds. Subjects injected with saline (control condition) showed the same pattern as Experiment 1; however subjects injected with midazolam showed a large decrease in the use of the "Remember" responses for famous faces and neither context reinstatement nor background fan affected performance. These results support the view that it is easier to bind stimuli to context when stimuli have a pre-existing, stable memory representation (e.g., faces of people whose identity we know) than when stimuli do not have pre-existing, stable memory representations. PMID:23395827

  1. Engineering of a Bacillus subtilis strain with adjustable levels of intracellular biotin for secretory production of functional streptavidin.

    PubMed

    Wu, Sau-Ching; Wong, Sui-Lam

    2002-03-01

    Streptavidin is a biotin-binding protein which has been widely used in many in vitro and in vivo applications. Because of the ease of protein recovery and availability of protease-deficient strains, the Bacillus subtilis expression-secretion system is an attractive system for streptavidin production. However, attempts to produce streptavidin using B. subtilis face the problem that cells overproducing large amounts of streptavidin suffer poor growth, presumably because of biotin deficiency. This problem cannot be solved by supplementing biotin to the culture medium, as this will saturate the biotin binding sites in streptavidin. We addressed this dilemma by engineering a B. subtilis strain (WB800BIO) which overproduces intracellular biotin. The strategy involves replacing the natural regulatory region of the B. subtilis chromosomal biotin biosynthetic operon (bioWAFDBIorf2) with an engineered one consisting of the B. subtilis groE promoter and gluconate operator. Biotin production in WB800BIO is induced by gluconate, and the level of biotin produced can be adjusted by varying the gluconate dosage. A level of gluconate was selected to allow enhanced intracellular production of biotin without getting it released into the culture medium. WB800BIO, when used as a host for streptavidin production, grows healthily in a biotin-limited medium and produces large amounts (35 to 50 mg/liter) of streptavidin, with over 80% of its biotin binding sites available for future applications.

  2. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    PubMed

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  3. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  4. Diverse specificity and effector function among human antibodies to HIV-1 envelope glycoprotein epitopes exposed by CD4 binding

    DOE PAGES

    Guan, Yongjun; Pazgier, Marzena; Sajadi, Mohammad M.; ...

    2012-12-13

    The HIV-1 envelope glycoprotein (Env) undergoes conformational transitions consequent to CD4 binding and coreceptor engagement during viral entry. The physical steps in this process are becoming defined, but less is known about their significance as targets of antibodies potentially protective against HIV-1 infection. Here we probe the functional significance of transitional epitope exposure by characterizing 41 human mAbs specific for epitopes exposed on trimeric Env after CD4 engagement. These mAbs recognize three epitope clusters: cluster A, the gp120 face occluded by gp41 in trimeric Env; cluster B, a region proximal to the coreceptor-binding site (CoRBS) and involving the V1/V2 domain;more » and cluster C, the coreceptor-binding site. The mAbs were evaluated functionally by antibody-dependent, cell-mediated cytotoxicity (ADCC) and for neutralization of Tiers 1 and 2 pseudoviruses. All three clusters included mAbs mediating ADCC. However, there was a strong potency bias for cluster A, which harbors at least three potent ADCC epitopes whose cognate mAbs have electropositive paratopes. Cluster A epitopes are functional ADCC targets during viral entry in an assay format using virion-sensitized target cells. In contrast, only cluster C contained epitopes that were recognized by neutralizing mAbs. There was significant diversity in breadth and potency that correlated with epitope fine specificity. In contrast, ADCC potency had no relationship with neutralization potency or breadth for any epitope cluster. In conclusion, Fc-mediated effector function and neutralization coselect with specificity in anti-Env antibody responses, but the nature of selection is distinct for these two antiviral activities.« less

  5. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  6. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  7. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  8. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  9. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  10. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  11. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  12. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  13. Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

    PubMed Central

    Pérez, J J; Portugal, J

    1990-01-01

    It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

  14. Conformational Changes Represent the Rate-Limiting Step in the Transport Cycle of Maize SUCROSE TRANSPORTER1[C][W

    PubMed Central

    Derrer, Carmen; Wittek, Anke; Bamberg, Ernst; Carpaneto, Armando; Dreyer, Ingo; Geiger, Dietmar

    2013-01-01

    Proton-driven Suc transporters allow phloem cells of higher plants to accumulate Suc to more than 1 M, which is up to ∼1000-fold higher than in the surrounding extracellular space. The carrier protein can accomplish this task only because proton and Suc transport are tightly coupled. This study provides insights into this coupling by resolving the first step in the transport cycle of the Suc transporter SUT1 from maize (Zea mays). Voltage clamp fluorometry measurements combining electrophysiological techniques with fluorescence-based methods enable the visualization of conformational changes of SUT1 expressed in Xenopus laevis oocytes. Using the Suc derivate sucralose, binding of which hinders conformational changes of SUT1, the association of protons to the carrier could be dissected from transport-associated movements of the protein. These combined approaches enabled us to resolve the binding of protons to the carrier and its interrelationship with the alternating movement of the protein. The data indicate that the rate-limiting step of the reaction cycle is determined by the accessibility of the proton binding site. This, in turn, is determined by the conformational change of the SUT1 protein, alternately exposing the binding pockets to the inward and to the outward face of the membrane. PMID:23964025

  15. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  16. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  17. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  18. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  19. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  20. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  1. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  2. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  3. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  4. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  5. Implicit Binding of Facial Features During Change Blindness

    PubMed Central

    Lyyra, Pessi; Mäkelä, Hanna; Hietanen, Jari K.; Astikainen, Piia

    2014-01-01

    Change blindness refers to the inability to detect visual changes if introduced together with an eye-movement, blink, flash of light, or with distracting stimuli. Evidence of implicit detection of changed visual features during change blindness has been reported in a number of studies using both behavioral and neurophysiological measurements. However, it is not known whether implicit detection occurs only at the level of single features or whether complex organizations of features can be implicitly detected as well. We tested this in adult humans using intact and scrambled versions of schematic faces as stimuli in a change blindness paradigm while recording event-related potentials (ERPs). An enlargement of the face-sensitive N170 ERP component was observed at the right temporal electrode site to changes from scrambled to intact faces, even if the participants were not consciously able to report such changes (change blindness). Similarly, the disintegration of an intact face to scrambled features resulted in attenuated N170 responses during change blindness. Other ERP deflections were modulated by changes, but unlike the N170 component, they were indifferent to the direction of the change. The bidirectional modulation of the N170 component during change blindness suggests that implicit change detection can also occur at the level of complex features in the case of facial stimuli. PMID:24498165

  6. Implicit binding of facial features during change blindness.

    PubMed

    Lyyra, Pessi; Mäkelä, Hanna; Hietanen, Jari K; Astikainen, Piia

    2014-01-01

    Change blindness refers to the inability to detect visual changes if introduced together with an eye-movement, blink, flash of light, or with distracting stimuli. Evidence of implicit detection of changed visual features during change blindness has been reported in a number of studies using both behavioral and neurophysiological measurements. However, it is not known whether implicit detection occurs only at the level of single features or whether complex organizations of features can be implicitly detected as well. We tested this in adult humans using intact and scrambled versions of schematic faces as stimuli in a change blindness paradigm while recording event-related potentials (ERPs). An enlargement of the face-sensitive N170 ERP component was observed at the right temporal electrode site to changes from scrambled to intact faces, even if the participants were not consciously able to report such changes (change blindness). Similarly, the disintegration of an intact face to scrambled features resulted in attenuated N170 responses during change blindness. Other ERP deflections were modulated by changes, but unlike the N170 component, they were indifferent to the direction of the change. The bidirectional modulation of the N170 component during change blindness suggests that implicit change detection can also occur at the level of complex features in the case of facial stimuli.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kong, Leopold; Giang, Erick; Robbins, Justin B.

    Hepatitis C virus (HCV) infects more than 2% of the global population and is a leading cause of liver cirrhosis, hepatocellular carcinoma, and end-stage liver diseases. Circulating HCV is genetically diverse, and therefore a broadly effective vaccine must target conserved T- and B-cell epitopes of the virus. Human mAb HCV1 has broad neutralizing activity against HCV isolates from at least four major genotypes and protects in the chimpanzee model from primary HCV challenge. The antibody targets a conserved antigenic site (residues 412-423) on the virus E2 envelope glycoprotein. Two crystal structures of HCV1 Fab in complex with an epitope peptidemore » at 1.8-{angstrom} resolution reveal that the epitope is a {beta}-hairpin displaying a hydrophilic face and a hydrophobic face on opposing sides of the hairpin. The antibody predominantly interacts with E2 residues Leu{sup 413} and Trp{sup 420} on the hydrophobic face of the epitope, thus providing an explanation for how HCV isolates bearing mutations at Asn{sup 415} on the same binding face escape neutralization by this antibody. The results provide structural information for a neutralizing epitope on the HCV E2 glycoprotein and should help guide rational design of HCV immunogens to elicit similar broadly neutralizing antibodies through vaccination.« less

  8. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  9. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  10. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  11. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  12. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  13. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  14. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  15. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  16. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  17. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  18. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  19. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  20. The distal short consensus repeats 1 and 2 of the membrane cofactor protein CD46 and their distance from the cell membrane determine productive entry of species B adenovirus serotype 35.

    PubMed

    Fleischli, Christoph; Verhaagh, Sandra; Havenga, Menzo; Sirena, Dominique; Schaffner, Walter; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

    2005-08-01

    The human regulator of complement activation membrane cofactor protein (CD46) has recently been identified as an attachment receptor for most species B adenoviruses (Ads), including Ad type 3 (Ad3), Ad11, and Ad35, as well as species D Ad37. To characterize the interaction between Ad35 and CD46, hybrid receptors composed of different CD46 short consensus repeat (SCR) domains fused to immunoglobulin-like domains of CD4 and a set of 36 CD46 mutants containing semiconservative changes of single amino acids within SCR domains I and II were tested in binding and in Ad35-mediated luciferase transduction assays. In addition, anti-CD46 antibodies and soluble polypeptides constituting various CD46 domains were used in binding inhibition studies. Our data indicate that (i) CD46 SCR I or SCR II alone confers low but significant Ad35 binding; (ii) the presence of SCR I and II is required for optimal binding and transgene expression; (iii) transduction efficiencies equivalent to that of full-length CD46 are obtained if SCR I and II are at an appropriate distance from the cell membrane; (iv) ablation of the N-glycan attached to SCR I has no influence on receptor function, whereas ablation of the SCR II N-glycan results in about a two- to threefold reduction of binding and transgene expression; (v) most putative Ad35 binding residues are located on the same solvent-exposed face of the SCR I or SCR II domain, which are twisted by about 90 degrees ; and (vi) the putative Ad35 binding sites partly overlap with the measles virus binding surface.

  1. The Distal Short Consensus Repeats 1 and 2 of the Membrane Cofactor Protein CD46 and Their Distance from the Cell Membrane Determine Productive Entry of Species B Adenovirus Serotype 35

    PubMed Central

    Fleischli, Christoph; Verhaagh, Sandra; Havenga, Menzo; Sirena, Dominique; Schaffner, Walter; Cattaneo, Roberto; Greber, Urs F.; Hemmi, Silvio

    2005-01-01

    The human regulator of complement activation membrane cofactor protein (CD46) has recently been identified as an attachment receptor for most species B adenoviruses (Ads), including Ad type 3 (Ad3), Ad11, and Ad35, as well as species D Ad37. To characterize the interaction between Ad35 and CD46, hybrid receptors composed of different CD46 short consensus repeat (SCR) domains fused to immunoglobulin-like domains of CD4 and a set of 36 CD46 mutants containing semiconservative changes of single amino acids within SCR domains I and II were tested in binding and in Ad35-mediated luciferase transduction assays. In addition, anti-CD46 antibodies and soluble polypeptides constituting various CD46 domains were used in binding inhibition studies. Our data indicate that (i) CD46 SCR I or SCR II alone confers low but significant Ad35 binding; (ii) the presence of SCR I and II is required for optimal binding and transgene expression; (iii) transduction efficiencies equivalent to that of full-length CD46 are obtained if SCR I and II are at an appropriate distance from the cell membrane; (iv) ablation of the N-glycan attached to SCR I has no influence on receptor function, whereas ablation of the SCR II N-glycan results in about a two- to threefold reduction of binding and transgene expression; (v) most putative Ad35 binding residues are located on the same solvent-exposed face of the SCR I or SCR II domain, which are twisted by about 90°; and (vi) the putative Ad35 binding sites partly overlap with the measles virus binding surface. PMID:16014961

  2. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  3. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  5. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  6. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  7. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  8. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  9. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  10. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  11. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  12. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  13. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  14. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  15. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  16. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  17. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  18. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  19. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  20. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  1. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  2. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  3. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  4. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  5. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  6. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  7. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  8. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  9. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  10. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Accuracy of Answers Provided by Digital/Face-to-Face Reference Services in Japanese Public Libraries and Q & A Sites

    ERIC Educational Resources Information Center

    Tsuji, Keita; To, Haruna; Hara, Atsuyuki

    2011-01-01

    We asked the same 60 questions using DRS (digital reference services) in Japanese public libraries, face-to-face reference services and Q & A (question and answer) sites. It was found that: (1) The correct answer ratio of DRS is higher than that of Q & A sites; (2) DRS takes longer to provide answers as compared to Q & A sites; and (3)…

  13. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  14. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  15. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  17. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  18. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  19. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  20. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  1. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  2. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  3. Structural and mechanistic basis of proton-coupled metal ion transport in the SLC11/NRAMP family

    PubMed Central

    Ehrnstorfer, Ines A.; Manatschal, Cristina; Arnold, Fabian M.; Laederach, Juerg; Dutzler, Raimund

    2017-01-01

    Secondary active transporters of the SLC11/NRAMP family catalyse the uptake of iron and manganese into cells. These proteins are highly conserved across all kingdoms of life and thus likely share a common transport mechanism. Here we describe the structural and functional properties of the prokaryotic SLC11 transporter EcoDMT. Its crystal structure reveals a previously unknown outward-facing state of the protein family. In proteoliposomes EcoDMT mediates proton-coupled uptake of manganese at low micromolar concentrations. Mutants of residues in the transition-metal ion-binding site severely affect transport, whereas a mutation of a conserved histidine located near this site results in metal ion transport that appears uncoupled to proton transport. Combined with previous results, our study defines the conformational changes underlying transition-metal ion transport in the SLC11 family and it provides molecular insight to its coupling to protons. PMID:28059071

  4. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  5. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  6. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  7. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  8. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  9. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  10. Direct observation of transcription activator-like effector (TALE) protein dynamics

    NASA Astrophysics Data System (ADS)

    Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

    2014-03-01

    In this work, we describe a single molecule assay to probe the site-search dynamics of transcription activator-like effector (TALE) proteins along DNA. In modern genetics, the ability to selectively edit the human genome is an unprecedented development, driven by recent advances in targeted nuclease proteins. Specific gene editing can be accomplished using TALE proteins, which are programmable DNA-binding proteins that can be fused to a nuclease domain. In this way, TALENs are a leading technology that has shown great success in the genomic editing of pluripotent stem cells. A major hurdle facing clinical implementation, however, is the potential for deleterious off-target binding events. For these reasons, a molecular-level understanding of TALE binding and target sequence search on DNA is essential. To this end, we developed a single-molecule fluorescence imaging assay that provides a first-of-its-kind view of the 1-D diffusion of TALE proteins along stretched DNA. Taken together with co-crystal structures of DNA-bound TALEs, our results suggest a rotationally-coupled, major groove tracking model for diffusion. We further report diffusion constants for TALE proteins as a function of salt concentration, consistent with previously described models of 1-D protein diffusion.

  11. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  12. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  13. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  14. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  15. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  16. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  17. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  18. Disulfide Cross-linking of a Multidrug and Toxic Compound Extrusion Transporter Impacts Multidrug Efflux*

    PubMed Central

    Radchenko, Martha; Nie, Rongxin; Lu, Min

    2016-01-01

    Multidrug and toxic compound extrusion (MATE) transporters contribute to multidrug resistance by extruding different drugs across cell membranes. The MATE transporters alternate between their extracellular and intracellular facing conformations to propel drug export, but how these structural changes occur is unclear. Here we combine site-specific cross-linking and functional studies to probe the movement of transmembrane helices in NorM from Neiserria gonorrheae (NorM-NG), a MATE transporter with known extracellular facing structure. We generated an active, cysteine-less NorM-NG and conducted pairwise cysteine mutagenesis on this variant. We found that copper phenanthroline catalyzed disulfide bond formation within five cysteine pairs and increased the electrophoretic mobility of the corresponding mutants. Furthermore, copper phenanthroline abolished the activity of the five paired cysteine mutants, suggesting that these substituted amino acids come in spatial proximity during transport, and the proximity changes are functionally indispensable. Our data also implied that the substrate-binding transmembrane helices move up to 10 Å in NorM-NG during transport and afforded distance restraints for modeling the intracellular facing transporter, thereby casting new light on the underlying mechanism. PMID:26975373

  19. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  1. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  2. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  3. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  5. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  6. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  7. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  8. Cultural Resources Reconnaissance Along the Cheyenne River Arm of Lake Oahe in Dewey, Haakon, Stanley, and Ziebach Counties, South Dakota. Volume 1. Main Report

    DTIC Science & Technology

    1988-03-01

    of site 39ST282................................227 39 Plan of site 39ST283................................230 40 Detailed plans of Features 1 and 2...268 53 Plan of site 39DW64 .............................. 272 54 Plan of Feature 1, site 39DW64 ................... 273 55 Plan of site 39DW65...facing E ........................... 228 46 Site 39ST283, facing NE .......................... 232 47 Detail of Feature 1, site 39ST283, facing NW

  9. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  10. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  11. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  12. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  13. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  14. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  15. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  16. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  17. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  18. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  19. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  20. Structural model of an mRNA in complex with the bacterial chaperone Hfq

    DOE PAGES

    Peng, Yi; Curtis, Joseph E.; Fang, Xianyang; ...

    2014-11-17

    The Sm-like protein Hfq (host factor Q-beta phage) facilitates regulation by bacterial small noncoding RNAs (sRNAs) in response to stress and other environmental signals. In this paper, we present a low-resolution model of Escherichia coli Hfq bound to the rpoS mRNA, a bacterial stress response gene that is targeted by three different sRNAs. Selective 2'-hydroxyl acylation and primer extension, small-angle X-ray scattering, and Monte Carlo molecular dynamics simulations show that the distal face and lateral rim of Hfq interact with three sites in the rpoS leader, folding the RNA into a compact tertiary structure. These interactions are needed for sRNAmore » regulation of rpoS translation and position the sRNA target adjacent to an sRNA binding region on the proximal face of Hfq. Finally, our results show how Hfq specifically distorts the structure of the rpoS mRNA to enable sRNA base pairing and translational control.« less

  1. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  2. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  3. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  4. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  5. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  6. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  7. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  8. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  9. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  10. Modulation of calcium oxalate dihydrate growth by selective crystal-face binding of phosphorylated osteopontin and polyaspartate peptide showing occlusion by sectoral (compositional) zoning.

    PubMed

    Chien, Yung-Ching; Masica, David L; Gray, Jeffrey J; Nguyen, Sarah; Vali, Hojatollah; McKee, Marc D

    2009-08-28

    Calcium oxalate dihydrate (COD) mineral and the urinary protein osteopontin/uropontin (OPN) are commonly found in kidney stones. To investigate the effects of OPN on COD growth, COD crystals were grown with phosphorylated OPN or a polyaspartic acid-rich peptide of OPN (DDLDDDDD, poly-Asp(86-93)). Crystals grown with OPN showed increased dimensions of the {110} prismatic faces attributable to selective inhibition at this crystallographic face. At high concentrations of OPN, elongated crystals with dominant {110} faces were produced, often with intergrown, interpenetrating twin crystals. Poly-Asp(86-93) dose-dependently elongated crystal morphology along the {110} faces in a manner similar to OPN. In crystal growth studies using fluorescently tagged poly-Asp(86-93) followed by imaging of crystal interiors using confocal microscopy, sectoral (compositional) zoning in COD was observed resulting from selective binding and incorporation (occlusion) of peptide exclusively into {110} crystal sectors. Computational modeling of poly-Asp(86-93) adsorption to COD {110} and {101} surfaces also suggests increased stabilization of the COD {110} surface and negligible change to the natively stable {101} surface. Ultrastructural, colloidal-gold immunolocalization of OPN by transmission electron microscopy in human stones confirmed an intracrystalline distribution of OPN. In summary, OPN and its poly-Asp(86-93) sequence similarly affect COD mineral growth; the {110} crystallographic faces become enhanced and dominant attributable to {110} face inhibition by the protein/peptide, and peptides can incorporate into the mineral phase. We, thus, conclude that the poly-Asp(86-93) domain is central to the OPN ability to interact with the {110} faces of COD, where it binds to inhibit crystal growth with subsequent intracrystalline incorporation (occlusion).

  11. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  12. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  13. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  14. Molecular requirements for the insecticidal activity of the plant peptide pea albumin 1 subunit b (PA1b).

    PubMed

    Da Silva, Pedro; Rahioui, Isabelle; Laugier, Christian; Jouvensal, Laurence; Meudal, Hervé; Chouabe, Christophe; Delmas, Agnès F; Gressent, Frédéric

    2010-10-22

    PA1b (pea albumin 1, subunit b) is a small and compact 37-amino acid protein, isolated from pea seeds (Pisum sativum), that adopts a cystine knot fold. It acts as a potent insecticidal agent against major pests in stored crops and vegetables, making it a promising bioinsecticide. Here, we investigate the influence of individual residues on the structure and bioactivity of PA1b. A collection of 13 PA1b mutants was successfully chemically synthesized in which the residues involved in the definition of PA1b amphiphilic and electrostatic characteristics were individually replaced with an alanine. The three-dimensional structure of PA1b was outstandingly tolerant of modifications. Remarkably, receptor binding and insecticidal activities were both dependent on common well defined clusters of residues located on one single face of the toxin, with Phe-10, Arg-21, Ile-23, and Leu-27 being key residues of the binding interaction. The inactivity of the mutants is clearly due to a change in the nature of the side chain rather than to a side effect, such as misfolding or degradation of the peptide, in the insect digestive tract. We have shown that a hydrophobic patch is the putative site of the interaction of PA1b with its binding site. Overall, the mutagenesis data provide major insights into the functional elements responsible for PA1b entomotoxic properties and give some clues toward a better understanding of the PA1b mode of action.

  15. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  16. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  17. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  18. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  19. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  1. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  2. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  3. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  4. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  5. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  6. Pheromone Recognition and Selectivity by ComR Proteins among Streptococcus Species

    PubMed Central

    Morrison, Donald A.; Talagas, Antoine; Nessler, Sylvie; Federle, Michael J.; Prehna, Gerd

    2016-01-01

    Natural transformation, or competence, is an ability inherent to bacteria for the uptake of extracellular DNA. This process is central to bacterial evolution and allows for the rapid acquirement of new traits, such as antibiotic resistance in pathogenic microorganisms. For the Gram-positive bacteria genus Streptococcus, genes required for competence are under the regulation of quorum sensing (QS) mediated by peptide pheromones. One such system, ComRS, consists of a peptide (ComS) that is processed (XIP), secreted, and later imported into the cytoplasm, where it binds and activates the transcription factor ComR. ComR then engages in a positive feedback loop for the expression of ComS and the alternative sigma-factor SigX. Although ComRS are present in the majority of Streptococcus species, the sequence of both ComS/XIP and ComR diverge significantly, suggesting a mechanism for species-specific communication. To study possible cross-talk between streptococcal species in the regulation of competence, and to explore in detail the molecular interaction between ComR and XIP we undertook an interdisciplinary approach. We developed a ‘test-bed’ assay to measure the activity of different ComR proteins in response to cognate and heterologous XIP peptides in vivo, revealing distinct ComR classes of strict, intermediate, and promiscuous specificity among species. We then solved an X-ray crystal structure of ComR from S. suis to further understand the interaction with XIP and to search for structural features in ComR proteins that may explain XIP recognition. Using the structure as a guide, we probed the apo conformation of the XIP-binding pocket by site-directed mutagenesis, both in test-bed cultures and biochemically in vitro. In alignments with ComR proteins from other species, we find that the pocket is lined by a variable and a conserved face, where residues of the conserved face contribute to ligand binding and the variable face discriminate among XIP peptides. Together, our results not only provide a model for XIP recognition and specificity, but also allow for the prediction of novel XIP peptides that induce ComR activity. PMID:27907154

  7. Basic Residues R260 and K357 Affect the Conformational Dynamics of the Major Facilitator Superfamily Multidrug Transporter LmrP

    PubMed Central

    Wang, Wei; van Veen, Hendrik W.

    2012-01-01

    Secondary-active multidrug transporters can confer resistance on cells to pharmaceuticals by mediating their extrusion away from intracellular targets via substrate/H+(Na+) antiport. While the interactions of catalytic carboxylates in these transporters with coupling ions and substrates (drugs) have been studied in some detail, the functional importance of basic residues has received much less attention. The only two basic residues R260 and K357 in transmembrane helices in the Major Facilitator Superfamily transporter LmrP from Lactococcus lactis are present on the outer surface of the protein, where they are exposed to the phospholipid head group region of the outer leaflet (R260) and inner leaflet (K357) of the cytoplasmic membrane. Although our observations on the proton-motive force dependence and kinetics of substrate transport, and substrate-dependent proton transport demonstrate that K357A and R260A mutants are affected in ethidium-proton and benzalkonium-proton antiport compared to wildtype LmrP, our findings suggest that R260 and K357 are not directly involved in the binding of substrates or the translocation of protons. Secondary-active multidrug transporters are thought to operate by a mechanism in which binding sites for substrates are alternately exposed to each face of the membrane. Disulfide crosslinking experiments were performed with a double cysteine mutant of LmrP that reports the substrate-stimulated transition from the outward-facing state to the inward-facing state with high substrate-binding affinity. In the experiments, the R260A and K357A mutations were found to influence the dynamics of these major protein conformations in the transport cycle, potentially by removing the interactions of R260 and K357 with phospholipids and/or other residues in LmrP. The R260A and K357A mutations therefore modify the maximum rate at which the transport cycle can operate and, as the transitions between conformational states are differently affected by components of the proton-motive force, the mutations also influence the energetics of transport. PMID:22761697

  8. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  9. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  10. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  11. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  12. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  13. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces.

    PubMed

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-09-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design.

  14. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  15. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  16. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  17. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  18. Heterochromatin protein 1: don't judge the book by its cover!

    PubMed

    Hediger, Florence; Gasser, Susan M

    2006-04-01

    The name heterochromatin protein 1 (HP1) suggests that this small nuclear factor plays a role in forming heterochromatic domains. It was noticed years ago, however, that the distribution of HP1 on polytene chromosomes was not restricted to chromocenters or telomeres. HP1 was also found, reproducibly, along the euchromatic arms. A possible function in euchromatic gene regulation was postulated. Now, a large body of data has blurred the definition of HP1 as a structural component of heterochromatin, revealing its two-faced nature. Not only do HP1 isoforms have specific binding sites in both heterochromatic and euchromatic domains but they might also participate in the repression and activation of transcription in both compartments.

  19. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  20. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  1. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  2. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  3. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  4. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  5. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  6. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  7. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  8. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  9. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  10. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  11. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  12. Site-discrimination by molecular imposters at dissymmetric molecular crystal surfaces

    NASA Astrophysics Data System (ADS)

    Poloni, Laura N.

    The organization of atoms and molecules into crystalline forms is ubiquitous in nature and has been critical to the development of many technologies on which modern society relies. Classical crystal growth theory can describe atomic crystal growth, however, a description of molecular crystal growth is lacking. Molecular crystals are often characterized by anisotropic intermolecular interactions and dissymmetric crystal surfaces with anisotropic growth rates along different crystallographic directions. This thesis describes combination of experimental and computational techniques to relate crystal structure to surface structure and observed growth rates. Molecular imposters, also known as tailor-made impurities, can be used to control crystal growth for practical applications such as inhibition of pathological crystals, but can also be used to understand site specificity at crystal growth surfaces. The first part of this thesis builds on previous real-time in situ atomic force microscopy (AFM) observations of dislocation-actuated growth on the morphologically significant face of hexagonal L-cystine crystals, which aggregate in vivo to form kidney stones in patients suffering from cystinuria. The inhibitory effect of various L-cystine structural mimics (a.k.a. molecular imposters) was investigated through experimental and computational methods to identify the key structural factors responsible for molecular recognition between molecular imposters and L-cystine crystal surface sites. The investigation of L-cystine crystal growth in the presence of molecular imposters through a combination of kinetic analysis using in situ AFM, morphology analysis and birefringence measurements of bulk crystals, and molecular modeling of imposter binding to energetically inequivalent surface sites revealed that different molecular imposters inhibited crystal growth by a Cabrera-Vermilyea pinning mechanism and that imposters bind to a single binding site on the dissymmetric {1000} L-cystine surfaces. Collectively, these findings identify the key structural factors responsible for molecular recognition between molecular imposters and L-cystine crystal step sites, thereby articulating a strategy for stone prevention based on molecular design. The second part of this thesis describes the crystal growth and inhibition of a P2X3 receptor antagonist, denoted as DAPSA, recently reported as a non-opioid treatment of chronic pain. The low solubility of this compound results in the formation of drug-induced renal calculi (a.k.a. xenostones). in situ AFM of the morphologically significant (011) DAPSA surface revealed dislocation-actuated growth spirals with an anisotropic morphology, behavior that can be attributed to the non-uniform rate of solute attachment to eight crystallographically unique steps of the spiral, a direct consequence of the dissymmetry of this crystal surface. Eighteen molecular imposters were selected from the screening library to systematically investigate the roles of imposter substitute position, size, and functionality on the step velocities along the eight unique crystallographic directions. A non-uniform reduction in step velocities was observed, signaling site discrimination of imposter binding that can be attributed to stereochemical recognition of the imposters at specific crystal sites. The anisotropy of growth inhibition observed in the presence of the various imposters is consistent with binding energies calculated for the thirty-two crystallographically unique kink sites on steps advancing along predominant growth directions. These results provide insight to the design of growth inhibitors for molecular crystalline solids with complex and dissymmetric surfaces, while also suggesting a strategy for formulations containing congeners that can prevent harmful crystal growth in human renal structures. The last two crystalline systems discussed in this thesis are two isomorphous crystal systems that are ideal for the study of impurity incorporation at dissymmetric surfaces because their morphology is dominated by dissymmetric {101} growth faces. Growth processes on the dissymmetric (101) surfaces of these crystalline systems were investigated using metadynamics simulations to determine the free energy of adsorption for solute and impurity attachment to different flat, stepped, and kinked (101) surface terminations. Results suggest that growth occurs via a non-Kossel crystal growth mechanism, and highlights the need for dissymmetric surface structures (i.e. steps and kinks) for a higher fidelity in the orientation of adsorbed molecules. Overall, the results presented in this thesis suggest that growth of molecular crystals, particularly at dissymmetric surfaces, is complex and requires the combination of several experimental and computational techniques to decipher the mechanisms responsible for growth phenomena. The use of molecular imposters to inhibit growth can be useful for the development of therapeutics for pathological crystals, but can also inform processes by which crystal growth occurs at complex surfaces as a result of their site selectivity.

  13. Characterization of an antigenic site that contains a dominant, type-specific neutralization determinant on the envelope protein domain III (ED3) of dengue 2 virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gromowski, Gregory D.; Barrett, Alan D.T.

    2007-09-30

    The surface of the mature dengue virus (DENV) particle consists of 90 envelope (E) protein dimers that mediate both receptor binding and fusion. The E protein ectodomain can be divided into three structural domains designated ED1, ED2, and ED3, of which ED3 contains the critical and dominant virus-specific neutralization sites. In this study the ED3 epitopes recognized by seven, murine, IgG1 DENV-2 type-specific, monoclonal antibodies (MAbs) were determined using site-directed mutagenesis of a recombinant DENV-2 ED3 (rED3) protein. A total of 41 single amino acid substitutions were introduced into the rED3 at 30 different surface accessible residues. The affinity ofmore » each MAb with the mutant rED3s was assessed by indirect ELISA and the results indicate that all seven MAbs recognize overlapping epitopes with residues K305 and P384 critical for binding. These residues are conserved among DENV-2 strains and cluster together on the upper lateral face of ED3. A linear relationship was observed between relative occupancy of ED3 on the virion by MAb and neutralization of the majority of virus infectivity ({approx} 90%) for all seven MAbs. Depending on the MAb, it is predicted that between 10% and 50% relative occupancy of ED3 on the virion is necessary for virus neutralization and for all seven MAbs occupancy levels approaching saturation were required for 100% neutralization of virus infectivity. Overall, the conserved antigenic site recognized by all seven MAbs is likely to be a dominant DENV-2 type-specific, neutralization determinant.« less

  14. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  15. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  16. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  17. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  18. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  19. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  20. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  1. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  2. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  3. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  4. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  5. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  6. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  7. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  8. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  10. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  11. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  13. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  14. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  15. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  16. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  17. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  18. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  19. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  20. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  1. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  2. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  3. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  4. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  5. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  6. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  7. Nucleoplasmin Binds Histone H2A-H2B Dimers through Its Distal Face*

    PubMed Central

    Ramos, Isbaal; Martín-Benito, Jaime; Finn, Ron; Bretaña, Laura; Aloria, Kerman; Arizmendi, Jesús M.; Ausió, Juan; Muga, Arturo; Valpuesta, José M.; Prado, Adelina

    2010-01-01

    Nucleoplasmin (NP) is a pentameric chaperone that regulates the condensation state of chromatin extracting specific basic proteins from sperm chromatin and depositing H2A-H2B histone dimers. It has been proposed that histones could bind to either the lateral or distal face of the pentameric structure. Here, we combine different biochemical and biophysical techniques to show that natural, hyperphosphorylated NP can bind five H2A-H2B dimers and that the amount of bound ligand depends on the overall charge (phosphorylation level) of the chaperone. Three-dimensional reconstruction of NP/H2A-H2B complex carried out by electron microscopy reveals that histones interact with the chaperone distal face. Limited proteolysis and mass spectrometry indicate that the interaction results in protection of the histone fold and most of the H2A and H2B C-terminal tails. This structural information can help to understand the function of NP as a histone chaperone. PMID:20696766

  8. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

    PubMed Central

    Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2008-01-01

    Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

  10. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  11. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  12. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  13. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  14. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  15. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  16. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  17. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  18. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  19. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  20. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  1. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  2. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  3. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  4. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

  5. Assessment of the binding performance of histamine-imprinted microspheres by frontal analysis capillary electrophoresis.

    PubMed

    Romano, Edwin F; Quirino, Joselito P; Holdsworth, John L; So, Regina C; Holdsworth, Clovia I

    2017-05-01

    Frontal analysis capillary electrophoresis was used to evaluate the binding performance of molecularly imprinted microspheres (MIM) toward its template histamine and analogs at pH 7, and compared to the high performance liquid chromatographic method. In both methods, batch binding was employed and the binding parameters were calculated from the measured concentration of unbound amine analytes and afforded comparable histamine equilibrium dissociation constants (K d ∼ 0.4 mM). FACE was easily carried out at shorter binding equilibration time (i.e. 30 min) and without the need to separate the microspheres, circumventing laborious and, in the case of the system under study, inefficient sample filtration. It also allowed for competitive binding studies by virtue of its ability to distinctly separate intact microspheres and all tested amines which could not be resolved in HPLC. K d 's for nonimprinted (control) microspheres (NIM) from FACE and HPLC were also comparable (∼ 0.6 mM) but at higher histamine concentrations, HPLC gave lower histamine binding. This discrepancy was attributed to inefficient filtration of the batch binding samples prior to HPLC analysis resulting in an over-estimation of the concentration of free histamine brought about by the presence of unfiltered histamine-bound microspheres. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  7. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  8. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

    2015-01-01

    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  9. Mechanism of human antibody-mediated neutralization of Marburg virus.

    PubMed

    Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

    2015-02-26

    The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  11. Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, E.B.; Kuyatt, B.L.

    1987-01-01

    Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

  12. Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

    USGS Publications Warehouse

    Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

    2002-01-01

    The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

  13. Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

    NASA Astrophysics Data System (ADS)

    Dyer, Brian

    2014-03-01

    Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

  14. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  15. Electrical Stimulation of the Left and Right Human Fusiform Gyrus Causes Different Effects in Conscious Face Perception

    PubMed Central

    Rangarajan, Vinitha; Hermes, Dora; Foster, Brett L.; Weiner, Kevin S.; Jacques, Corentin; Grill-Spector, Kalanit

    2014-01-01

    Neuroimaging and electrophysiological studies across species have confirmed bilateral face-selective responses in the ventral temporal cortex (VTC) and prosopagnosia is reported in patients with lesions in the VTC including the fusiform gyrus (FG). As imaging and electrophysiological studies provide correlative evidence, and brain lesions often comprise both white and gray matter structures beyond the FG, we designed the current study to explore the link between face-related electrophysiological responses in the FG and the causal effects of electrical stimulation of the left or right FG in face perception. We used a combination of electrocorticography (ECoG) and electrical brain stimulation (EBS) in 10 human subjects implanted with intracranial electrodes in either the left (5 participants, 30 FG sites) or right (5 participants, 26 FG sites) hemispheres. We identified FG sites with face-selective ECoG responses, and recorded perceptual reports during EBS of these sites. In line with existing literature, face-selective ECoG responses were present in both left and right FG sites. However, when the same sites were stimulated, we observed a striking difference between hemispheres. Only EBS of the right FG caused changes in the conscious perception of faces, whereas EBS of strongly face-selective regions in the left FG produced non-face-related visual changes, such as phosphenes. This study examines the relationship between correlative versus causal nature of ECoG and EBS, respectively, and provides important insight into the differential roles of the right versus left FG in conscious face perception. PMID:25232118

  16. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  17. Selection of the simplest RNA that binds isoleucine

    PubMed Central

    LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

    2003-01-01

    We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

  18. Converting One-Face α-Helix Mimetics into Amphiphilic α-Helix Mimetics as Potent Inhibitors of Protein-Protein Interactions.

    PubMed

    Lee, Ji Hoon; Oh, Misook; Kim, Hyun Soo; Lee, Huisun; Im, Wonpil; Lim, Hyun-Suk

    2016-01-11

    Many biologically active α-helical peptides adopt amphiphilic helical structures that contain hydrophobic residues on one side and hydrophilic residues on the other side. Therefore, α-helix mimetics capable of mimicking such amphiphilic helical peptides should possess higher binding affinity and specificity to target proteins. Here we describe an efficient method for generating amphiphilic α-helix mimetics. One-face α-helix mimetics having hydrophobic side chains on one side was readily converted into amphiphilic α-helix mimetics by introducing appropriate charged residues on the opposite side. We also demonstrate that such two-face amphiphilic α-helix mimetics indeed show remarkably improved binding affinity to a target protein, compared to one-face hydrophobic α-helix mimetics. We believe that generating a large combinatorial library of these amphiphilic α-helix mimetics can be valuable for rapid discovery of highly potent and specific modulators of protein-protein interactions.

  19. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shima, K.; Kitayama, S.; Nakano, R.

    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

  20. Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Aalberts, Daniel P.; Garland, Jeffrey A.

    2004-03-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  1. Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Reid, A.; Mahboubi, A.

    1991-02-01

    Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

  2. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

  3. Conformational dynamics and ligand binding in the multi-domain protein PDC109.

    PubMed

    Kim, Hyun Jin; Choi, Moo Young; Kim, Hyung J; Llinás, Miguel

    2010-02-18

    PDC109 is a modular multi-domain protein with two fibronectin type II (Fn2) repeats joined by a linker. It plays a major role in bull sperm binding to the oviductal epithelium through its interactions with phosphorylcholines (PhCs), a head group of sperm cell membrane lipids. The crystal structure of the PDC109-PhC complex shows that each PhC binds to the corresponding Fn2 domain, while the two domains are on the same face of the protein. Long timescale explicit solvent molecular dynamics (MD) simulations of PDC109, in the presence and absence of PhC, suggest that PhC binding strongly correlates with the relative orientation of choline-phospholipid binding sites of the two Fn2 domains; unless the two domains tightly bind PhCs, they tend to change their relative orientation by deforming the flexible linker. The effective PDC109-PhC association constant of 28 M(-1), estimated from their potential of mean force is consistent with the experimental result. Principal component analysis of the long timescale MD simulations was compared to the significantly less expensive normal mode analysis of minimized structures. The comparison indicates that difference between relative domain motions of PDC109 with bound and unbound PhC is captured by the first principal component in the principal component analysis as well as the three lowest normal modes in the normal mode analysis. The present study illustrates the use of detailed MD simulations to clarify the energetics of specific ligand-domain interactions revealed by a static crystallographic model, as well as their influence on relative domain motions in a multi-domain protein.

  4. 1. Northeast face of missile site control building, commonly known ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Northeast face of missile site control building, commonly known as the missile site radar building, showing open blast door #BD2. This emergency escape, at stair no. 12, is NEMP/RFI-shielded and 16" thick. The large circle in the center is the radar face, also known as the antennae array aperture. The small circle to the right of the radar face is the "Q" channel. The antennae atop the turret provided lightning protection for the building - Stanley R. Mickelsen Safeguard Complex, Missile Site Control Building, Northeast of Tactical Road; southeast of Tactical Road South, Nekoma, Cavalier County, ND

  5. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

  6. Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

    2010-01-01

    The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

  7. Cooperative interplay of let-7 mimic and HuR with MYC RNA

    PubMed Central

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

  8. Two classes of binding sites for [3H]substance P in rat cerebral cortex.

    PubMed

    Geraghty, D P; Burcher, E

    1993-01-22

    The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. A web server for analysis, comparison and prediction of protein ligand binding sites.

    PubMed

    Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

    2016-03-25

    One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

  10. Neurophysiological Organization of the Middle Face Patch in Macaque Inferior Temporal Cortex

    PubMed Central

    Aparicio, Paul L.; Issa, Elias B.

    2016-01-01

    While early cortical visual areas contain fine scale spatial organization of neuronal properties, such as orientation preference, the spatial organization of higher-level visual areas is less well understood. The fMRI demonstration of face-preferring regions in human ventral cortex and monkey inferior temporal cortex (“face patches”) raises the question of how neural selectivity for faces is organized. Here, we targeted hundreds of spatially registered neural recordings to the largest fMRI-identified face-preferring region in monkeys, the middle face patch (MFP), and show that the MFP contains a graded enrichment of face-preferring neurons. At its center, as much as 93% of the sites we sampled responded twice as strongly to faces than to nonface objects. We estimate the maximum neurophysiological size of the MFP to be ∼6 mm in diameter, consistent with its previously reported size under fMRI. Importantly, face selectivity in the MFP varied strongly even between neighboring sites. Additionally, extremely face-selective sites were ∼40 times more likely to be present inside the MFP than outside. These results provide the first direct quantification of the size and neural composition of the MFP by showing that the cortical tissue localized to the fMRI defined region consists of a very high fraction of face-preferring sites near its center, and a monotonic decrease in that fraction along any radial spatial axis. SIGNIFICANCE STATEMENT The underlying organization of neurons that give rise to the large spatial regions of activity observed with fMRI is not well understood. Neurophysiological studies that have targeted the fMRI identified face patches in monkeys have provided evidence for both large-scale clustering and a heterogeneous spatial organization. Here we used a novel x-ray imaging system to spatially map the responses of hundreds of sites in and around the middle face patch. We observed that face-selective signal localized to the middle face patch was characterized by a gradual spatial enrichment. Furthermore, strongly face-selective sites were ∼40 times more likely to be found inside the patch than outside of the patch. PMID:27810930

  11. Neurophysiological Organization of the Middle Face Patch in Macaque Inferior Temporal Cortex.

    PubMed

    Aparicio, Paul L; Issa, Elias B; DiCarlo, James J

    2016-12-14

    While early cortical visual areas contain fine scale spatial organization of neuronal properties, such as orientation preference, the spatial organization of higher-level visual areas is less well understood. The fMRI demonstration of face-preferring regions in human ventral cortex and monkey inferior temporal cortex ("face patches") raises the question of how neural selectivity for faces is organized. Here, we targeted hundreds of spatially registered neural recordings to the largest fMRI-identified face-preferring region in monkeys, the middle face patch (MFP), and show that the MFP contains a graded enrichment of face-preferring neurons. At its center, as much as 93% of the sites we sampled responded twice as strongly to faces than to nonface objects. We estimate the maximum neurophysiological size of the MFP to be ∼6 mm in diameter, consistent with its previously reported size under fMRI. Importantly, face selectivity in the MFP varied strongly even between neighboring sites. Additionally, extremely face-selective sites were ∼40 times more likely to be present inside the MFP than outside. These results provide the first direct quantification of the size and neural composition of the MFP by showing that the cortical tissue localized to the fMRI defined region consists of a very high fraction of face-preferring sites near its center, and a monotonic decrease in that fraction along any radial spatial axis. The underlying organization of neurons that give rise to the large spatial regions of activity observed with fMRI is not well understood. Neurophysiological studies that have targeted the fMRI identified face patches in monkeys have provided evidence for both large-scale clustering and a heterogeneous spatial organization. Here we used a novel x-ray imaging system to spatially map the responses of hundreds of sites in and around the middle face patch. We observed that face-selective signal localized to the middle face patch was characterized by a gradual spatial enrichment. Furthermore, strongly face-selective sites were ∼40 times more likely to be found inside the patch than outside of the patch. Copyright © 2016 the authors 0270-6474/16/3612729-17$15.00/0.

  12. Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

    PubMed Central

    Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

    2011-01-01

    Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

  13. Variola Virus IL-18 Binding Protein Interacts with Three Human IL-18 Residues That Are Part of a Binding Site for Human IL-18 Receptor Alpha Subunit

    PubMed Central

    Meng, Xiangzhi; Leman, Michael; Xiang, Yan

    2007-01-01

    Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683

  14. Core Binding Site of a Thioflavin-T-Derived Imaging Probe on Amyloid β Fibrils Predicted by Computational Methods.

    PubMed

    Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi

    2018-05-16

    Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.

  15. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  16. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces

    PubMed Central

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-01-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design. PMID:21693557

  17. Site-directed mutagenesis of the regulatory light-chain Ca2+/Mg2+ binding site and its role in hybrid myosins

    NASA Astrophysics Data System (ADS)

    Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John

    1986-07-01

    The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.

  18. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

    PubMed

    Marsh, Lorraine

    2015-01-01

    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

  19. Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.

    PubMed

    Fehr, Marcus; Wolf, Antje; Stammler, Gerd

    2016-03-01

    Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.

  20. Batrachotoxin Changes the Properties of the Muscarinic Receptor in Rat Brain and Heart: Possible Interaction(s) between Muscarinic Receptors and Sodium Channels

    NASA Astrophysics Data System (ADS)

    Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai

    1985-05-01

    The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).

  1. Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

    PubMed

    DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

    2003-07-08

    Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

  2. Mapping of a binding site for ATP within the extracellular region of the Torpedo nicotinic acetylcholine receptor beta-subunit.

    PubMed

    Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A

    1997-10-28

    Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.

  3. Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

    PubMed Central

    Jayasena, S D; Johnston, B H

    1992-01-01

    tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

  4. A position effect on TRPS1 is associated with Ambras syndrome in humans and the Koala phenotype in mice

    PubMed Central

    Fantauzzo, Katherine A.; Tadin-Strapps, Marija; You, Yun; Mentzer, Sarah E.; Baumeister, Friedrich A.M.; Cianfarani, Stefano; Van Maldergem, Lionel; Warburton, Dorothy; Sundberg, John P.; Christiano, Angela M.

    2008-01-01

    Ambras syndrome (AS) is a rare form of congenital hypertrichosis with excessive hair on the shoulders, face and ears. Cytogenetic studies have previously implicated an association with rearrangements of chromosome 8. Here we define an 11.5 Mb candidate interval for AS on chromosome 8q based on cytogenetic breakpoints in three patients. TRPS1, a gene within this interval, was deleted in a patient with an 8q23 chromosomal rearrangement, while its expression was significantly downregulated in another patient with an inversion breakpoint 7.3 Mb downstream of TRPS1. Here, we describe the first potential long-range position effect on the expression of TRPS1. To gain insight into the mechanisms by which Trps1 affects the hair follicle, we performed a detailed analysis of the hair abnormalities in Koa mice, a mouse model of hypertrichosis. We found that the proximal breakpoint of the Koa inversion is located 791 kb upstream of Trps1. Quantitative real-time polymerase chain reaction, in situ hybridization and immunofluorescence analysis revealed that Trps1 expression levels are reduced in Koa mutant mice at the sites of pathology for the phenotype. We determined that the Koa inversion creates a new Sp1 binding site and translocates additional Sp1 binding sites within a highly conserved stretch spanning the proximal breakpoint, providing a potential mechanism for the position effect. Collectively, these results describe a position effect that downregulates TRPS1 expression as the probable cause of hypertrichosis in AS in humans and the Koa phenotype in mice. PMID:18713754

  5. Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

    PubMed

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-04-01

    Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

  6. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

    PubMed Central

    Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

  7. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

    PubMed

    Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

  8. The correlation between ouabain binding and potassium pump inhibition in human and sheep erythrocytes.

    PubMed Central

    Joiner, C H; Lauf, P K

    1978-01-01

    1. [3H]Ouabain binding to human and sheep red blood cells was shown to be specific for receptors associated with Na/K transport. Virtually all tritium binding was abolished by dilution with unlabelled drug. Saturation levels of binding were independent of glycoside concentration and were identical to those associated with 100% inhibition of K pumping. 2. [3H]Ouabain binding and 42K influx were measured simultaneously in order to correlate the degree of K pump inhibition with the amount of glycoside bound. Results by this method agreed exactly with those obtained by pre-exposing cells to drug, followed by washing and then measuring K influx. 3. Plots of [3H]oubain binding vs. K pump inhibition were rectilinear for human and low K (LK) sheep red cells, indicating one glycoside receptor per K pump site and functional homogeneity of pump sites. High K (HK) sheep red cells exhibited curved plots of binding versus inhibition, which were best explained in terms of one receptor per pump, but a heterogeneous population of pump sites. 4. External K reduced the rate of glycoside binding, but did not alter the relationship between binding and inhibition. 5. The number of K pump sites was estimated as 450--500 per human cell and 30--50 per LK sheep cell. HK sheep cells had 90--130 sites per cell, of which eighty to ninety were functionally dominant. The number of K pump sites on LK sheep cells was not changed by anti-L, although the maximum velocity of pump turnover was increased. PMID:722573

  9. Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

    PubMed

    Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

    2009-01-01

    Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

  10. Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

    PubMed Central

    Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

    2018-01-01

    Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

  11. Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

    PubMed Central

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-01-01

    Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beaumont, K.; Vaughn, D.A.; Fanestil, D.D.

    Thiazides and related diuretics inhibit NaCl reabsorption in the distal tubule through an unknown mechanism. The authors report here that ({sup 3}H)metolazone, a diuretic with a thiazide-like mechanism of action, labels a site in rat kidney membranes that has characteristics of the thiazide-sensitive ion transporter. ({sup 3}H)Metolazone bound with high affinity to a site with a density of 0.717 pmol/mg of protein in kidney membranes. The binding site was localized to the renal cortex, with little or not binding in other kidney regions and 11 other tissues. The affinities of thiazide-type diuretics for this binding site were significantly correlated withmore » their clinical potency. Halide anions specifically inhibited high-affinity binding of ({sup 3}H)metolazone to this site. ({sup 3})Metolazone also bound with lower affinity to sites present in kidney as well as in liver, testis, lung, brain, heart, and other tissues. Calcium antagonists and certain smooth muscle relaxants had K{sub i} values of 0.6-10 {mu}M for these low-affinity sites, which were not inhibited by most of the thiazide diuretics tested. Properties of the high-affinity ({sup 3}H)metolazone binding site are consistent with its identity as the receptor for thiazide-type diuretics.« less

  13. Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

    PubMed

    Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

    2007-08-15

    In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

  14. The D-galactose specific lectin of field bean (Dolichos lablab) seed binds sugars with extreme negative cooperativity and half-of-the-sites binding.

    PubMed

    Rao, Devavratha H; Gowda, Lalitha R

    2012-08-15

    The field bean (Dolichos lablab) lectin designated as PPO-haemagglutinin (DLL-II) is bifunctional, exhibiting both polyphenol oxidase and haemagglutinating activity. The lectin is unusual in that it binds galactose (Gal), lactose (Lac) and N-acetylgalactosamine (GalNAc) only in the presence of (NH₄)₂SO₄ and exhibits negative cooperativity and half-of-the-sites binding. Circular dichroism, isothermal titration calorimetry and fluorescence quenching were used to assess the sugar binding in the presence of (NH₄)₂O₄. Comparison of the near-UV CD spectra with and without bound sugar revealed ligand induced conformational changes. The intrinsic fluorescence quenching data indicate that DLL-II exhibits weak binding to Gal in the presence of (NH₄)₂SO₄ with a stoichiometry of one bound ligand per dimer. ITC data fitted using a two sets of sites binding model presented a similar picture. The K(a)'s for Gal, Lac and GalNAc in the presence of (NH₄)₂SO₄ were 0.16±0.002, 0.21±0.004 and 8.45±0.78 (×10⁻³) M⁻¹ respectively. The Hill plot for the binding of these sugars to DLL-II was curvilinear with a tangent slope <1.0 indicating negative cooperativity. DLL-II thus exhibits half-of-the-site binding, an extreme form of negative cooperativity in which the second ligand does not bind at all. This is the first report of a legume lectin, exhibiting half-of-the-sites binding. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Negatively Cooperative Binding of High Density Lipoprotein to the HDL Receptor SR-BI†

    PubMed Central

    Nieland, Thomas J.F.; Xu, Shangzhe; Penman, Marsha; Krieger, Monty

    2011-01-01

    Scavenger receptor class B, type I (SR-BI) is a high-density lipoprotein (HDL) receptor, which also binds low density lipoprotein (LDL), and mediates the cellular selective uptake of cholesteryl esters from lipoproteins. SR-BI also is a co-receptor for hepatitis C virus and a signaling receptor that regulates cell metabolism. Many investigators have reported that lipoproteins bind to SR-BI via a single class of independent (not interacting), high affinity binding sites (one site model). We have re-investigated the ligand concentration dependence of 125I-HDL binding to SR-BI and SR-BI-mediated specific uptake of [3H]CE from [3H]CE-HDL using an expanded range of ligand concentrations (<1 µg protein/ml, lower than previously reported). Scatchard and non-linear least squares model fitting analyses of the binding and uptake data were both inconsistent with a single class of independent binding sites binding univalent lipoprotein ligands. The data are best fit by models in which SR-BI has either two independent classes of binding sites, or one class of sites exhibiting negative cooperativity due to either classic allostery or ensemble effects (‘ lattice model’). Similar results were observed for LDL. Application of the ‘infinite dilution’ dissociation rate method established that the binding of 125I-HDL to SR-BI at 4 °C exhibits negative cooperativity. The unexpected complexity of the interactions of lipoproteins with SR-BI should be taken into account when interpreting the results of experiments that explore the mechanism(s) by which SR-BI mediates ligand binding, lipid transport and cell signaling. PMID:21254782

  16. Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

    PubMed Central

    Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

    2007-01-01

    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

  17. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    PubMed

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Discovery of a small-molecule HIV-1 integrase inhibitor-binding site | Center for Cancer Research

    Cancer.gov

    The lowest energy-binding conformation of an inhibitor bound to the dimeric interface of HIV-1 integrase core domain. The yellow region represents a unique allosteric binding site identified by affinity labeling and mass spectrometry and validated through mutagenesis. This site can provide a potential platform for the rational design of inhibitors selective for disruption of

  19. Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

    PubMed Central

    Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

    2011-01-01

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

  20. Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

    PubMed

    Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

    2011-01-14

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

Top