Cooperative binding modes of Cu(II) in prion protein
NASA Astrophysics Data System (ADS)
Hodak, Miroslav; Chisnell, Robin; Lu, Wenchang; Bernholc, Jerry
2007-03-01
The misfolding of the prion protein, PrP, is responsible for a group of neurodegenerative diseases including mad cow disease and Creutzfeldt-Jakob disease. It is known that the PrP can efficiently bind copper ions; four high-affinity binding sites located in the octarepeat region of PrP are now well known. Recent experiments suggest that at low copper concentrations new binding modes, in which one copper ion is shared between two or more binding sites, are possible. Using our hybrid Thomas-Fermi/DFT computational scheme, which is well suited for simulations of biomolecules in solution, we investigate the geometries and energetics of two, three and four binding sites cooperatively binding one copper ion. These geometries are then used as inputs for classical molecular dynamics simulations. We find that copper binding affects the secondary structure of the PrP and that it stabilizes the unstructured (unfolded) part of the protein.
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Bruschi, Maurizio; Tiberti, Matteo; Guerra, Alessandro; De Gioia, Luca
2014-02-05
A comparative analysis of a series of DFT models of [NiFe]-hydrogenases, ranging from minimal NiFe clusters to very large systems including both the first and second coordination sphere of the bimetallic cofactor, was carried out with the aim of unraveling which stereoelectronic properties of the active site of [NiFe]-hydrogenases are crucial for efficient H2 binding and cleavage. H2 binding to the Ni-SIa redox state is energetically favored (by 4.0 kcal mol(-1)) only when H2 binds to Ni, the NiFe metal cluster is in a low spin state, and the Ni cysteine ligands have a peculiar seesaw coordination geometry, which in the enzyme is stabilized by the protein environment. The influence of the Ni coordination geometry on the H2 binding affinity was then quantitatively evaluated and rationalized analyzing frontier molecular orbitals and populations. Several plausible reaction pathways leading to H2 cleavage were also studied. It turned out that a two-step pathway, where H2 cleavage takes place on the Ni-SIa redox state of the enzyme, is characterized by very low reaction barriers and favorable reaction energies. More importantly, the seesaw coordination geometry of Ni was found to be a key feature for facile H2 cleavage. The discovery of the crucial influence of the Ni coordination geometry on H2 binding and activation in the active site of [NiFe]-hydrogenases could be exploited in the design of novel biomimetic synthetic catalysts.
NASA Astrophysics Data System (ADS)
Rose, Francis; Hodak, Miroslav; Bernholc, Jerry
2007-03-01
The Non-Amyloid-Beta Component Precursor (NACP) is a natively unfolded synaptic protein that is implicated in Alzheimers and Parkinsons diseases. Its aggregation into fibrillar structures is accelerated by the binding of copper(II). Experimental studies suggest that the dominant copper binding site is located at the histidine residue in NACP. Based on this evidence we assembled a model fragment of the binding site and used DFT to analyze the conformational details of the most probable binding motifs. We investigated the overall conformational effects with classical MD by constraining the copper binding site to the most energetically favorable geometry obtained from the DFT calculations. These results are compared and contrasted with those of the unbound NACP.
Milenkovic, Stefan; Bondar, Ana-Nicoleta
2016-02-01
SecA uses the energy yielded by the binding and hydrolysis of adenosine triphosphate (ATP) to push secretory pre-proteins across the plasma membrane in bacteria. Hydrolysis of ATP occurs at the nucleotide-binding site, which contains the conserved carboxylate groups of the DEAD-box helicases. Although crystal structures provide valuable snapshots of SecA along its reaction cycle, the mechanism that ensures conformational coupling between the nucleotide-binding site and the other domains of SecA remains unclear. The observation that SecA contains numerous hydrogen-bonding groups raises important questions about the role of hydrogen-bonding networks and hydrogen-bond dynamics in long-distance conformational couplings. To address these questions, we explored the molecular dynamics of SecA from three different organisms, with and without bound nucleotide, in water. By computing two-dimensional hydrogen-bonding maps we identify networks of hydrogen bonds that connect the nucleotide-binding site to remote regions of the protein, and sites in the protein that respond to specific perturbations. We find that the nucleotide-binding site of ADP-bound SecA has a preferred geometry whereby the first two carboxylates of the DEAD motif bridge via hydrogen-bonding water. Simulations of a mutant with perturbed ATP hydrolysis highlight the water-bridged geometry as a key structural element of the reaction path. Copyright © 2015. Published by Elsevier B.V.
Extending rule-based methods to model molecular geometry and 3D model resolution.
Hoard, Brittany; Jacobson, Bruna; Manavi, Kasra; Tapia, Lydia
2016-08-01
Computational modeling is an important tool for the study of complex biochemical processes associated with cell signaling networks. However, it is challenging to simulate processes that involve hundreds of large molecules due to the high computational cost of such simulations. Rule-based modeling is a method that can be used to simulate these processes with reasonably low computational cost, but traditional rule-based modeling approaches do not include details of molecular geometry. The incorporation of geometry into biochemical models can more accurately capture details of these processes, and may lead to insights into how geometry affects the products that form. Furthermore, geometric rule-based modeling can be used to complement other computational methods that explicitly represent molecular geometry in order to quantify binding site accessibility and steric effects. We propose a novel implementation of rule-based modeling that encodes details of molecular geometry into the rules and binding rates. We demonstrate how rules are constructed according to the molecular curvature. We then perform a study of antigen-antibody aggregation using our proposed method. We simulate the binding of antibody complexes to binding regions of the shrimp allergen Pen a 1 using a previously developed 3D rigid-body Monte Carlo simulation, and we analyze the aggregate sizes. Then, using our novel approach, we optimize a rule-based model according to the geometry of the Pen a 1 molecule and the data from the Monte Carlo simulation. We use the distances between the binding regions of Pen a 1 to optimize the rules and binding rates. We perform this procedure for multiple conformations of Pen a 1 and analyze the impact of conformation and resolution on the optimal rule-based model. We find that the optimized rule-based models provide information about the average steric hindrance between binding regions and the probability that antibodies will bind to these regions. These optimized models quantify the variation in aggregate size that results from differences in molecular geometry and from model resolution.
Testing inhomogeneous solvation theory in structure-based ligand discovery.
Balius, Trent E; Fischer, Marcus; Stein, Reed M; Adler, Thomas B; Nguyen, Crystal N; Cruz, Anthony; Gilson, Michael K; Kurtzman, Tom; Shoichet, Brian K
2017-08-15
Binding-site water is often displaced upon ligand recognition, but is commonly neglected in structure-based ligand discovery. Inhomogeneous solvation theory (IST) has become popular for treating this effect, but it has not been tested in controlled experiments at atomic resolution. To do so, we turned to a grid-based version of this method, GIST, readily implemented in molecular docking. Whereas the term only improves docking modestly in retrospective ligand enrichment, it could be added without disrupting performance. We thus turned to prospective docking of large libraries to investigate GIST's impact on ligand discovery, geometry, and water structure in a model cavity site well-suited to exploring these terms. Although top-ranked docked molecules with and without the GIST term often overlapped, many ligands were meaningfully prioritized or deprioritized; some of these were selected for testing. Experimentally, 13/14 molecules prioritized by GIST did bind, whereas none of the molecules that it deprioritized were observed to bind. Nine crystal complexes were determined. In six, the ligand geometry corresponded to that predicted by GIST, for one of these the pose without the GIST term was wrong, and three crystallographic poses differed from both predictions. Notably, in one structure, an ordered water molecule with a high GIST displacement penalty was observed to stay in place. Inclusion of this water-displacement term can substantially improve the hit rates and ligand geometries from docking screens, although the magnitude of its effects can be small and its impact in drug binding sites merits further controlled studies.
Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.
Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donormore » ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.« less
NASA Astrophysics Data System (ADS)
Wang, Weinan; Zhang, Wei; Duan, Yaokai; Jiang, Yong; Zhang, Liangren; Zhao, Bing; Tu, Pengfei
2013-11-01
Fluorescence, normal Raman and surface-enhanced Raman scattering (SERS) were introduced to explore the absorptive geometry of caffeine on Human Serum Albumin (HSA) at physiological condition. The molecular docking was also employed to make a better understanding of the interaction between caffeine and HSA as well as to elucidate the detailed information of the major binding site. The results showed that caffeine could bind to HSA via the hydrophobic force of aromatic stacking and the main binding group on caffeine could be the pyrimidine ring. In addition, a consecutive set of changes in the orientation of caffeine molecule had been demonstrated during the process of caffeine binding to HSA, and the primary binding site was considered to be a hydrophobic cavity formed by Leu198, Lys199, Ser202, Phe211, Trp214, Val344, Ser454 and Leu481 in domain II.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less
Keck, P C; Huston, J S
1996-01-01
Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174
Copper attachment to a non-octarepeat site in prion protein
NASA Astrophysics Data System (ADS)
Hodak, Miroslav; Bernholc, Jerry
2010-03-01
Prion protein, PrP, plays a causative role in several neurodegenerative diseases, including mad cow disease in cattle and Creutzfeldt-Jakob disease in humans. The PrP is known to efficiently bind copper ions and this ability has been linked to its function. PrP contains up to six binding sites, four of which are located in the so-called octarepeat region and are now well known. The binding sites outside this region are still largely undetermined, despite evidence of their relevance to prion diseases. Using a hybrid DFT/DFT, which combines Kohn-Sham DFT with orbital-free DFT to achieve accurate and efficient description of solvent effects in ab initio calculations, we have investigated copper attachment to the sequence GGGTH, which represents the copper binding site located at His96. We have considered both NNNN and NNNO types of copper coordination, as suggested by experiments. Our calculations have determined the geometry of copper attachment site and its energetics. Comparison to the already known binding sites provides insight into the process of copper uptake in PrP.
Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun
2018-06-16
Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.
ProBiS-CHARMMing: Web Interface for Prediction and Optimization of Ligands in Protein Binding Sites.
Konc, Janez; Miller, Benjamin T; Štular, Tanja; Lešnik, Samo; Woodcock, H Lee; Brooks, Bernard R; Janežič, Dušanka
2015-11-23
Proteins often exist only as apo structures (unligated) in the Protein Data Bank, with their corresponding holo structures (with ligands) unavailable. However, apoproteins may not represent the amino-acid residue arrangement upon ligand binding well, which is especially problematic for molecular docking. We developed the ProBiS-CHARMMing web interface by connecting the ProBiS ( http://probis.cmm.ki.si ) and CHARMMing ( http://www.charmming.org ) web servers into one functional unit that enables prediction of protein-ligand complexes and allows for their geometry optimization and interaction energy calculation. The ProBiS web server predicts ligands (small compounds, proteins, nucleic acids, and single-atom ligands) that may bind to a query protein. This is achieved by comparing its surface structure against a nonredundant database of protein structures and finding those that have binding sites similar to that of the query protein. Existing ligands found in the similar binding sites are then transposed to the query according to predictions from ProBiS. The CHARMMing web server enables, among other things, minimization and potential energy calculation for a wide variety of biomolecular systems, and it is used here to optimize the geometry of the predicted protein-ligand complex structures using the CHARMM force field and to calculate their interaction energies with the corresponding query proteins. We show how ProBiS-CHARMMing can be used to predict ligands and their poses for a particular binding site, and minimize the predicted protein-ligand complexes to obtain representations of holoproteins. The ProBiS-CHARMMing web interface is freely available for academic users at http://probis.nih.gov.
CH/π Interactions in Carbohydrate Recognition.
Spiwok, Vojtěch
2017-06-23
Many carbohydrate-binding proteins contain aromatic amino acid residues in their binding sites. These residues interact with carbohydrates in a stacking geometry via CH/π interactions. These interactions can be found in carbohydrate-binding proteins, including lectins, enzymes and carbohydrate transporters. Besides this, many non-protein aromatic molecules (natural as well as artificial) can bind saccharides using these interactions. Recent computational and experimental studies have shown that carbohydrate-aromatic CH/π interactions are dispersion interactions, tuned by electrostatics and partially stabilized by a hydrophobic effect in solvated systems.
Copper attachment to prion protein at a non-octarepeat site
NASA Astrophysics Data System (ADS)
Hodak, Miroslav; Bernholc, Jerry
2011-03-01
Prion protein (PrP) plays a causative role in a group of neurodegenerative diseases, which include ``mad cow disease'' or its human form variant Creutzfeld-Jacob disease. Normal function of PrP remains unknown, but it is now well established that PrP can efficiently bind copper ions and this ability has been linked to its function. The primary binding sites are located in the so-called octarepeat region located between residues 60-91. While these are by now well characterized, the sites located outside these region remain mostly undetermined. In this work, we investigate the properties of Cu binding site located at His 111 using recently developed hybrid Kohn-Sham/orbital-free density functional simulations. Experimental data indicate that copper is coordinated by either four nitrogens or three nitrogens and one oxygen. We investigate both possibilities, comparing their energetics and attachment geometries. Similarities and differences with other binding sites and implications for PrP function will also be discussed.
Tuning the ion selectivity of tetrameric cation channels by changing the number of ion binding sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Derebe, Mehabaw G.; Sauer, David B.; Zeng, Weizhong
2015-11-30
Selective ion conduction across ion channel pores is central to cellular physiology. To understand the underlying principles of ion selectivity in tetrameric cation channels, we engineered a set of cation channel pores based on the nonselective NaK channel and determined their structures to high resolution. These structures showcase an ensemble of selectivity filters with a various number of contiguous ion binding sites ranging from 2 to 4, with each individual site maintaining a geometry and ligand environment virtually identical to that of equivalent sites in K{sup +} channel selectivity filters. Combined with single channel electrophysiology, we show that only themore » channel with four ion binding sites is K{sup +} selective, whereas those with two or three are nonselective and permeate Na{sup +} and K{sup +} equally well. These observations strongly suggest that the number of contiguous ion binding sites in a single file is the key determinant of the channel's selectivity properties and the presence of four sites in K{sup +} channels is essential for highly selective and efficient permeation of K{sup +} ions.« less
Schvartzman, Mark; Palma, Matteo; Sable, Julia; Abramson, Justin; Hu, Xian; Sheetz, Michael P.; Wind, Shalom J.
2011-01-01
The ability to control the placement of individual molecules promises to enable a wide range of applications and is a key challenge in nanoscience and nanotechnology. Many biological interactions, in particular, are sensitive to the precise geometric arrangement of proteins. We have developed a technique which combines molecular-scale nanolithography with site-selective biochemistry to create biomimetic arrays of individual protein binding sites. The binding sites can be arranged in heterogeneous patterns of virtually any possible geometry with a nearly unlimited number of degrees of freedom. We have used these arrays to explore how the geometric organization of the extracellular matrix (ECM) binding ligand RGD (Arg-Gly-Asp) affects cell adhesion and spreading. Systematic variation of spacing, density and cluster size of individual integrin binding sites was used to elicit different cell behavior. Cell spreading assays on arrays of different geometric arrangements revealed a dramatic increase in spreading efficiency when at least 4 liganded sites were spaced within 60 nm or less, with no dependence on global density. This points to the existence of a minimal matrix adhesion unit for fibronectin defined in space and stoichiometry. Developing an understanding of the ECM geometries that activate specific cellular functional complexes is a critical step toward controlling cell behavior. Potential practical applications range from new therapeutic treatments to the rational design of tissue scaffolds that can optimize healing without scarring. More broadly, spatial control at the single-molecule level can elucidate factors controlling individual molecular interactions and can enable synthesis of new systems based on molecular-scale architectures. PMID:21319842
Computational Optimization and Characterization of Molecularly Imprinted Polymers
NASA Astrophysics Data System (ADS)
Terracina, Jacob J.
Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.
Spectroscopic Characterization of a Green Copper Site in a Single-Domain Cupredoxin
Roger, Magali; Biaso, Frédéric; Castelle, Cindy J.; Bauzan, Marielle; Chaspoul, Florence; Lojou, Elisabeth; Sciara, Giuliano; Caffarri, Stefano; Giudici-Orticoni, Marie-Thérèse; Ilbert, Marianne
2014-01-01
Cupredoxins are widespread copper-binding proteins, mainly involved in electron transfer pathways. They display a typical rigid greek key motif consisting of an eight stranded β-sandwich. A fascinating feature of cupredoxins is the natural diversity of their copper center geometry. These geometry variations give rise to drastic changes in their color, such as blue, green, red or purple. Based on several spectroscopic and structural analyses, a connection between the geometry of their copper-binding site and their color has been proposed. However, little is known about the relationship between such diversity of copper center geometry in cupredoxins and possible implications for function. This has been difficult to assess, as only a few naturally occurring green and red copper sites have been described so far. We report herein the spectrocopic characterization of a novel kind of single domain cupredoxin of green color, involved in a respiratory pathway of the acidophilic organism Acidithiobacillus ferrooxidans. Biochemical and spectroscopic characterization coupled to bioinformatics analysis reveal the existence of some unusual features for this novel member of the green cupredoxin sub-family. This protein has the highest redox potential reported to date for a green-type cupredoxin. It has a constrained green copper site insensitive to pH or temperature variations. It is a green-type cupredoxin found for the first time in a respiratory pathway. These unique properties might be explained by a region of unknown function never found in other cupredoxins, and by an unusual length of the loop between the second and the fourth copper ligands. These discoveries will impact our knowledge on non-engineered green copper sites, whose involvement in respiratory chains seems more widespread than initially thought. PMID:24932914
Spectroscopic characterization of a green copper site in a single-domain cupredoxin.
Roger, Magali; Biaso, Frédéric; Castelle, Cindy J; Bauzan, Marielle; Chaspoul, Florence; Lojou, Elisabeth; Sciara, Giuliano; Caffarri, Stefano; Giudici-Orticoni, Marie-Thérèse; Ilbert, Marianne
2014-01-01
Cupredoxins are widespread copper-binding proteins, mainly involved in electron transfer pathways. They display a typical rigid greek key motif consisting of an eight stranded β-sandwich. A fascinating feature of cupredoxins is the natural diversity of their copper center geometry. These geometry variations give rise to drastic changes in their color, such as blue, green, red or purple. Based on several spectroscopic and structural analyses, a connection between the geometry of their copper-binding site and their color has been proposed. However, little is known about the relationship between such diversity of copper center geometry in cupredoxins and possible implications for function. This has been difficult to assess, as only a few naturally occurring green and red copper sites have been described so far. We report herein the spectrocopic characterization of a novel kind of single domain cupredoxin of green color, involved in a respiratory pathway of the acidophilic organism Acidithiobacillus ferrooxidans. Biochemical and spectroscopic characterization coupled to bioinformatics analysis reveal the existence of some unusual features for this novel member of the green cupredoxin sub-family. This protein has the highest redox potential reported to date for a green-type cupredoxin. It has a constrained green copper site insensitive to pH or temperature variations. It is a green-type cupredoxin found for the first time in a respiratory pathway. These unique properties might be explained by a region of unknown function never found in other cupredoxins, and by an unusual length of the loop between the second and the fourth copper ligands. These discoveries will impact our knowledge on non-engineered green copper sites, whose involvement in respiratory chains seems more widespread than initially thought.
Finding the target sites of RNA-binding proteins
Li, Xiao; Kazan, Hilal; Lipshitz, Howard D; Morris, Quaid D
2014-01-01
RNA–protein interactions differ from DNA–protein interactions because of the central role of RNA secondary structure. Some RNA-binding domains (RBDs) recognize their target sites mainly by their shape and geometry and others are sequence-specific but are sensitive to secondary structure context. A number of small- and large-scale experimental approaches have been developed to measure RNAs associated in vitro and in vivo with RNA-binding proteins (RBPs). Generalizing outside of the experimental conditions tested by these assays requires computational motif finding. Often RBP motif finding is done by adapting DNA motif finding methods; but modeling secondary structure context leads to better recovery of RBP-binding preferences. Genome-wide assessment of mRNA secondary structure has recently become possible, but these data must be combined with computational predictions of secondary structure before they add value in predicting in vivo binding. There are two main approaches to incorporating structural information into motif models: supplementing primary sequence motif models with preferred secondary structure contexts (e.g., MEMERIS and RNAcontext) and directly modeling secondary structure recognized by the RBP using stochastic context-free grammars (e.g., CMfinder and RNApromo). The former better reconstruct known binding preferences for sequence-specific RBPs but are not suitable for modeling RBPs that recognize shape and geometry of RNAs. Future work in RBP motif finding should incorporate interactions between multiple RBDs and multiple RBPs in binding to RNA. WIREs RNA 2014, 5:111–130. doi: 10.1002/wrna.1201 PMID:24217996
Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas
2014-01-01
The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248
A structural informatics approach to mine kinase knowledge bases.
Brooijmans, Natasja; Mobilio, Dominick; Walker, Gary; Nilakantan, Ramaswamy; Denny, Rajiah A; Feyfant, Eric; Diller, David; Bikker, Jack; Humblet, Christine
2010-03-01
In this paper, we describe a combination of structural informatics approaches developed to mine data extracted from existing structure knowledge bases (Protein Data Bank and the GVK database) with a focus on kinase ATP-binding site data. In contrast to existing systems that retrieve and analyze protein structures, our techniques are centered on a database of ligand-bound geometries in relation to residues lining the binding site and transparent access to ligand-based SAR data. We illustrate the systems in the context of the Abelson kinase and related inhibitor structures. 2009 Elsevier Ltd. All rights reserved.
Martin, David P; Blachly, Patrick G; Marts, Amy R; Woodruff, Tessa M; de Oliveira, César A F; McCammon, J Andrew; Tierney, David L; Cohen, Seth M
2014-04-09
The binding of three closely related chelators: 5-hydroxy-2-methyl-4H-pyran-4-thione (allothiomaltol, ATM), 3-hydroxy-2-methyl-4H-pyran-4-thione (thiomaltol, TM), and 3-hydroxy-4H-pyran-4-thione (thiopyromeconic acid, TPMA) to the active site of human carbonic anhydrase II (hCAII) has been investigated. Two of these ligands display a monodentate mode of coordination to the active site Zn(2+) ion in hCAII that is not recapitulated in model complexes of the enzyme active site. This unprecedented binding mode in the hCAII-thiomaltol complex has been characterized by both X-ray crystallography and X-ray spectroscopy. In addition, the steric restrictions of the active site force the ligands into a 'flattened' mode of coordination compared with inorganic model complexes. This change in geometry has been shown by density functional computations to significantly decrease the strength of the metal-ligand binding. Collectively, these data demonstrate that the mode of binding by small metal-binding groups can be significantly influenced by the protein active site. Diminishing the strength of the metal-ligand bond results in unconventional modes of metal coordination not found in typical coordination compounds or even carefully engineered active site models, and understanding these effects is critical to the rational design of inhibitors that target clinically relevant metalloproteins.
NASA Astrophysics Data System (ADS)
Böhm, Hans-Joachim
1998-07-01
A dataset of 82 protein-ligand complexes of known 3D structure and binding constant Ki was analysed to elucidate the important factors that determine the strength of protein-ligand interactions. The following parameters were investigated: the number and geometry of hydrogen bonds and ionic interactions between the protein and the ligand, the size of the lipophilic contact surface, the flexibility of the ligand, the electrostatic potential in the binding site, water molecules in the binding site, cavities along the protein-ligand interface and specific interactions between aromatic rings. Based on these parameters, a new empirical scoring function is presented that estimates the free energy of binding for a protein-ligand complex of known 3D structure. The function distinguishes between buried and solvent accessible hydrogen bonds. It tolerates deviations in the hydrogen bond geometry of up to 0.25 Å in the length and up to 30 °Cs in the hydrogen bond angle without penalizing the score. The new energy function reproduces the binding constants (ranging from 3.7 × 10-2 M to 1 × 10-14 M, corresponding to binding energies between -8 and -80 kJ/mol) of the dataset with a standard deviation of 7.3 kJ/mol corresponding to 1.3 orders of magnitude in binding affinity. The function can be evaluated very fast and is therefore also suitable for the application in a 3D database search or de novo ligand design program such as LUDI. The physical significance of the individual contributions is discussed.
Postprocessing of docked protein-ligand complexes using implicit solvation models.
Lindström, Anton; Edvinsson, Lotta; Johansson, Andreas; Andersson, C David; Andersson, Ida E; Raubacher, Florian; Linusson, Anna
2011-02-28
Molecular docking plays an important role in drug discovery as a tool for the structure-based design of small organic ligands for macromolecules. Possible applications of docking are identification of the bioactive conformation of a protein-ligand complex and the ranking of different ligands with respect to their strength of binding to a particular target. We have investigated the effect of implicit water on the postprocessing of binding poses generated by molecular docking using MM-PB/GB-SA (molecular mechanics Poisson-Boltzmann and generalized Born surface area) methodology. The investigation was divided into three parts: geometry optimization, pose selection, and estimation of the relative binding energies of docked protein-ligand complexes. Appropriate geometry optimization afforded more accurate binding poses for 20% of the complexes investigated. The time required for this step was greatly reduced by minimizing the energy of the binding site using GB solvation models rather than minimizing the entire complex using the PB model. By optimizing the geometries of docking poses using the GB(HCT+SA) model then calculating their free energies of binding using the PB implicit solvent model, binding poses similar to those observed in crystal structures were obtained. Rescoring of these poses according to their calculated binding energies resulted in improved correlations with experimental binding data. These correlations could be further improved by applying the postprocessing to several of the most highly ranked poses rather than focusing exclusively on the top-scored pose. The postprocessing protocol was successfully applied to the analysis of a set of Factor Xa inhibitors and a set of glycopeptide ligands for the class II major histocompatibility complex (MHC) A(q) protein. These results indicate that the protocol for the postprocessing of docked protein-ligand complexes developed in this paper may be generally useful for structure-based design in drug discovery.
Transition States and transition state analogue interactions with enzymes.
Schramm, Vern L
2015-04-21
Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.
Mechanism of pathogen recognition by human dectin-2.
Feinberg, Hadar; Jégouzo, Sabine A F; Rex, Maximus J; Drickamer, Kurt; Weis, William I; Taylor, Maureen E
2017-08-11
Dectin-2, a C-type lectin on macrophages and other cells of the innate immune system, functions in response to pathogens, particularly fungi. The carbohydrate-recognition domain (CRD) in dectin-2 is linked to a transmembrane sequence that interacts with the common Fc receptor γ subunit to initiate immune signaling. The molecular mechanism by which dectin-2 selectively binds to pathogens has been investigated by characterizing the CRD expressed in a bacterial system. Competition binding studies indicated that the CRD binds to monosaccharides with modest affinity and that affinity was greatly enhanced for mannose-linked α1-2 or α1-4 to a second mannose residue. Glycan array analysis confirmed selective binding of the CRD to glycans that contain Manα1-2Man epitopes. Crystals of the CRD in complex with a mammalian-type high-mannose Man 9 GlcNAc 2 oligosaccharide exhibited interaction with Manα1-2Man on two different termini of the glycan, with the reducing-end mannose residue ligated to Ca 2+ in a primary binding site and the nonreducing terminal mannose residue occupying an adjacent secondary site. Comparison of the binding sites in DC-SIGN and langerin, two other pathogen-binding receptors of the innate immune system, revealed why these two binding sites accommodate only terminal Manα1-2Man structures, whereas dectin-2 can bind Manα1-2Man in internal positions in mannans and other polysaccharides. The specificity and geometry of the dectin-2-binding site provide the molecular mechanism for binding of dectin-2 to fungal mannans and also to bacterial lipopolysaccharides, capsular polysaccharides, and lipoarabinomannans that contain the Manα1-2Man disaccharide unit. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas
2014-07-01
The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
A global optimization algorithm for protein surface alignment
2010-01-01
Background A relevant problem in drug design is the comparison and recognition of protein binding sites. Binding sites recognition is generally based on geometry often combined with physico-chemical properties of the site since the conformation, size and chemical composition of the protein surface are all relevant for the interaction with a specific ligand. Several matching strategies have been designed for the recognition of protein-ligand binding sites and of protein-protein interfaces but the problem cannot be considered solved. Results In this paper we propose a new method for local structural alignment of protein surfaces based on continuous global optimization techniques. Given the three-dimensional structures of two proteins, the method finds the isometric transformation (rotation plus translation) that best superimposes active regions of two structures. We draw our inspiration from the well-known Iterative Closest Point (ICP) method for three-dimensional (3D) shapes registration. Our main contribution is in the adoption of a controlled random search as a more efficient global optimization approach along with a new dissimilarity measure. The reported computational experience and comparison show viability of the proposed approach. Conclusions Our method performs well to detect similarity in binding sites when this in fact exists. In the future we plan to do a more comprehensive evaluation of the method by considering large datasets of non-redundant proteins and applying a clustering technique to the results of all comparisons to classify binding sites. PMID:20920230
Gudmundsson, Mikael; Kim, Seonah; Wu, Miao; Ishida, Takuya; Momeni, Majid Hadadd; Vaaje-Kolstad, Gustav; Lundberg, Daniel; Royant, Antoine; Ståhlberg, Jerry; Eijsink, Vincent G H; Beckham, Gregg T; Sandgren, Mats
2014-07-04
Lytic polysaccharide monooxygenases (LPMOs) are a recently discovered class of enzymes that employ a copper-mediated, oxidative mechanism to cleave glycosidic bonds. The LPMO catalytic mechanism likely requires that molecular oxygen first binds to Cu(I), but the oxidation state in many reported LPMO structures is ambiguous, and the changes in the LPMO active site required to accommodate both oxidation states of copper have not been fully elucidated. Here, a diffraction data collection strategy minimizing the deposited x-ray dose was used to solve the crystal structure of a chitin-specific LPMO from Enterococcus faecalis (EfaCBM33A) in the Cu(II)-bound form. Subsequently, the crystalline protein was photoreduced in the x-ray beam, which revealed structural changes associated with the conversion from the initial Cu(II)-oxidized form with two coordinated water molecules, which adopts a trigonal bipyramidal geometry, to a reduced Cu(I) form in a T-shaped geometry with no coordinated water molecules. A comprehensive survey of Cu(II) and Cu(I) structures in the Cambridge Structural Database unambiguously shows that the geometries observed in the least and most reduced structures reflect binding of Cu(II) and Cu(I), respectively. Quantum mechanical calculations of the oxidized and reduced active sites reveal little change in the electronic structure of the active site measured by the active site partial charges. Together with a previous theoretical investigation of a fungal LPMO, this suggests significant functional plasticity in LPMO active sites. Overall, this study provides molecular snapshots along the reduction process to activate the LPMO catalytic machinery and provides a general method for solving LPMO structures in both copper oxidation states. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Sakkal, Leon A; Rajkowski, Kyle Z; Armen, Roger S
2017-06-05
Following insights from recent crystal structures of the muscarinic acetylcholine receptor, binding modes of Positive Allosteric Modulators (PAMs) were predicted under the assumption that PAMs should bind to the extracellular surface of the active state. A series of well-characterized PAMs for adenosine (A 1 R, A 2A R, A 3 R) and muscarinic acetylcholine (M 1 R, M 5 R) receptors were modeled using both rigid and flexible receptor CHARMM-based molecular docking. Studies of adenosine receptors investigated the molecular basis of the probe-dependence of PAM activity by modeling in complex with specific agonist radioligands. Consensus binding modes map common pharmacophore features of several chemical series to specific binding interactions. These models provide a rationalization of how PAM binding slows agonist radioligand dissociation kinetics. M 1 R PAMs were predicted to bind in the analogous M 2 R PAM LY2119620 binding site. The M 5 R NAM (ML-375) was predicted to bind in the PAM (ML-380) binding site with a unique induced-fit receptor conformation. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Monomeric Yeast Frataxin is an Iron-Binding Protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook,J.; Bencze, K.; Jankovic, A.
Friedreich's ataxia, an autosomal cardio- and neurodegenerative disorder that affects 1 in 50 000 humans, is caused by decreased levels of the protein frataxin. Although frataxin is nuclear-encoded, it is targeted to the mitochondrial matrix and necessary for proper regulation of cellular iron homeostasis. Frataxin is required for the cellular production of both heme and iron-sulfur (Fe-S) clusters. Monomeric frataxin binds with high affinity to ferrochelatase, the enzyme involved in iron insertion into porphyrin during heme production. Monomeric frataxin also binds to Isu, the scaffold protein required for assembly of Fe-S cluster intermediates. These processes (heme and Fe-S cluster assembly)more » share requirements for iron, suggesting that monomeric frataxin might function as the common iron donor. To provide a molecular basis to better understand frataxin's function, we have characterized the binding properties and metal-site structure of ferrous iron bound to monomeric yeast frataxin. Yeast frataxin is stable as an iron-loaded monomer, and the protein can bind two ferrous iron atoms with micromolar binding affinity. Frataxin amino acids affected by the presence of iron are localized within conserved acidic patches located on the surfaces of both helix-1 and strand-1. Under anaerobic conditions, bound metal is stable in the high-spin ferrous state. The metal-ligand coordination geometry of both metal-binding sites is consistent with a six-coordinate iron-(oxygen/nitrogen) based ligand geometry, surely constructed in part from carboxylate and possibly imidazole side chains coming from residues within these conserved acidic patches on the protein. On the basis of our results, we have developed a model for how we believe yeast frataxin interacts with iron.« less
Monomeric Yeast Frataxin is an Iron Binding Protein†
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, J.; Bencze, K; Jankovic, A
Friedreich's ataxia, an autosomal cardio- and neurodegenerative disorder that affects 1 in 50000 humans, is caused by decreased levels of the protein frataxin. Although frataxin is nuclear-encoded, it is targeted to the mitochondrial matrix and necessary for proper regulation of cellular iron homeostasis. Frataxin is required for the cellular production of both heme and iron-sulfur (Fe-S) clusters. Monomeric frataxin binds with high affinity to ferrochelatase, the enzyme involved in iron insertion into porphyrin during heme production. Monomeric frataxin also binds to Isu, the scaffold protein required for assembly of Fe-S cluster intermediates. These processes (heme and Fe-S cluster assembly) sharemore » requirements for iron, suggesting that monomeric frataxin might function as the common iron donor. To provide a molecular basis to better understand frataxin's function, we have characterized the binding properties and metal-site structure of ferrous iron bound to monomeric yeast frataxin. Yeast frataxin is stable as an iron-loaded monomer, and the protein can bind two ferrous iron atoms with micromolar binding affinity. Frataxin amino acids affected by the presence of iron are localized within conserved acidic patches located on the surfaces of both helix-1 and strand-1. Under anaerobic conditions, bound metal is stable in the high-spin ferrous state. The metal-ligand coordination geometry of both metal-binding sites is consistent with a six-coordinate iron-(oxygen/nitrogen) based ligand geometry, surely constructed in part from carboxylate and possibly imidazole side chains coming from residues within these conserved acidic patches on the protein. On the basis of our results, we have developed a model for how we believe yeast frataxin interacts with iron.« less
Cations Stiffen Actin Filaments by Adhering a Key Structural Element to Adjacent Subunits
2016-01-01
Ions regulate the assembly and mechanical properties of actin filaments. Recent work using structural bioinformatics and site-specific mutagenesis favors the existence of two discrete and specific divalent cation binding sites on actin filaments, positioned in the long axis between actin subunits. Cation binding at one site drives polymerization, while the other modulates filament stiffness and plays a role in filament severing by the regulatory protein, cofilin. Existing structural methods have not been able to resolve filament-associated cations, and so in this work we turn to molecular dynamics simulations to suggest a candidate binding pocket geometry for each site and to elucidate the mechanism by which occupancy of the “stiffness site” affects filament mechanical properties. Incorporating a magnesium ion in the “polymerization site” does not seem to require any large-scale change to an actin subunit’s conformation. Binding of a magnesium ion in the “stiffness site” adheres the actin DNase-binding loop (D-loop) to its long-axis neighbor, which increases the filament torsional stiffness and bending persistence length. Our analysis shows that bound D-loops occupy a smaller region of accessible conformational space. Cation occupancy buries key conserved residues of the D-loop, restricting accessibility to regulatory proteins and enzymes that target these amino acids. PMID:27146246
Binding of dinitrogen to an iron-sulfur-carbon site
NASA Astrophysics Data System (ADS)
Čorić, Ilija; Mercado, Brandon Q.; Bill, Eckhard; Vinyard, David J.; Holland, Patrick L.
2015-10-01
Nitrogenases are the enzymes by which certain microorganisms convert atmospheric dinitrogen (N2) to ammonia, thereby providing essential nitrogen atoms for higher organisms. The most common nitrogenases reduce atmospheric N2 at the FeMo cofactor, a sulfur-rich iron-molybdenum cluster (FeMoco). The central iron sites that are coordinated to sulfur and carbon atoms in FeMoco have been proposed to be the substrate binding sites, on the basis of kinetic and spectroscopic studies. In the resting state, the central iron sites each have bonds to three sulfur atoms and one carbon atom. Addition of electrons to the resting state causes the FeMoco to react with N2, but the geometry and bonding environment of N2-bound species remain unknown. Here we describe a synthetic complex with a sulfur-rich coordination sphere that, upon reduction, breaks an Fe-S bond and binds N2. The product is the first synthetic Fe-N2 complex in which iron has bonds to sulfur and carbon atoms, providing a model for N2 coordination in the FeMoco. Our results demonstrate that breaking an Fe-S bond is a chemically reasonable route to N2 binding in the FeMoco, and show structural and spectroscopic details for weakened N2 on a sulfur-rich iron site.
Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels.
Elinder, Fredrik; Liin, Sara I
2017-01-01
Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (Na V ), potassium (K V ), calcium (Ca V ), and proton (H V ) channels, as well as calcium-activated potassium (K Ca ), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1 : The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2 : The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3 : The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4 : The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5 : The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels.
Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels
Elinder, Fredrik; Liin, Sara I.
2017-01-01
Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (NaV), potassium (KV), calcium (CaV), and proton (HV) channels, as well as calcium-activated potassium (KCa), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1: The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2: The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3: The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4: The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5: The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels. PMID:28220076
Principles for designing proteins with cavities formed by curved β sheets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marcos, Enrique; Basanta, Benjamin; Chidyausiku, Tamuka M.
Active sites and ligand-binding cavities in native proteins are often formed by curved β sheets, and the ability to control β-sheet curvature would allow design of binding proteins with cavities customized to specific ligands. Toward this end, we investigated the mechanisms controlling β-sheet curvature by studying the geometry of β sheets in naturally occurring protein structures and folding simulations. The principles emerging from this analysis were used to design, de novo, a series of proteins with curved β sheets topped with α helices. Nuclear magnetic resonance and crystal structures of the designs closely match the computational models, showing that β-sheetmore » curvature can be controlled with atomic-level accuracy. Our approach enables the design of proteins with cavities and provides a route to custom design ligand-binding and catalytic sites.« less
NASA Astrophysics Data System (ADS)
da Silva, Jorge Alberto Valle; Modesto-Costa, Lucas; de Koning, Martijn C.; Borges, Itamar; França, Tanos Celmar Costa
2018-01-01
In this work, quaternary and non-quaternary oximes designed to bind at the peripheral site of acetylcholinesterase previously inhibited by organophosphates were investigated theoretically. Some of those oximes have a large number of degrees of freedom, thus requiring an accurate method to obtain molecular geometries. For this reason, the density functional theory (DFT) was employed to refine their molecular geometries after conformational analysis and to compare their 1H and 13C nuclear magnetic resonance (NMR) theoretical signals in gas-phase and in solvent. A good agreement with experimental data was achieved and the same theoretical approach was employed to obtain the geometries in water environment for further studies.
Patel, D J; Canuel, L L
1977-07-01
The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.
Patel, Dinshaw J.; Canuel, Lita L.
1977-01-01
The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613
Sedlak, Steffen M.; Bauer, Magnus S.; Kluger, Carleen; Schendel, Leonard C.; Milles, Lukas F.; Pippig, Diana A.
2017-01-01
The widely used interaction of the homotetramer streptavidin with the small molecule biotin has been intensively studied by force spectroscopy and has become a model system for receptor ligand interaction. However, streptavidin’s tetravalency results in diverse force propagation pathways through the different binding interfaces. This multiplicity gives rise to polydisperse force spectroscopy data. Here, we present an engineered monovalent streptavidin tetramer with a single cysteine in its functional subunit that allows for site-specific immobilization of the molecule, orthogonal to biotin binding. Functionality of streptavidin and its binding properties for biotin remain unaffected. We thus created a stable and reliable molecular anchor with a unique high-affinity binding site for biotinylated molecules or nanoparticles, which we expect to be useful for many single-molecule applications. To characterize the mechanical properties of the bond between biotin and our monovalent streptavidin, we performed force spectroscopy experiments using an atomic force microscope. We were able to conduct measurements at the single-molecule level with 1:1-stoichiometry and a well-defined geometry, in which force exclusively propagates through a single subunit of the streptavidin tetramer. For different force loading rates, we obtained narrow force distributions of the bond rupture forces ranging from 200 pN at 1,500 pN/s to 230 pN at 110,000 pN/s. The data are in very good agreement with the standard Bell-Evans model with a single potential barrier at Δx0 = 0.38 nm and a zero-force off-rate koff,0 in the 10−6 s-1 range. PMID:29206886
Sedlak, Steffen M; Bauer, Magnus S; Kluger, Carleen; Schendel, Leonard C; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E
2017-01-01
The widely used interaction of the homotetramer streptavidin with the small molecule biotin has been intensively studied by force spectroscopy and has become a model system for receptor ligand interaction. However, streptavidin's tetravalency results in diverse force propagation pathways through the different binding interfaces. This multiplicity gives rise to polydisperse force spectroscopy data. Here, we present an engineered monovalent streptavidin tetramer with a single cysteine in its functional subunit that allows for site-specific immobilization of the molecule, orthogonal to biotin binding. Functionality of streptavidin and its binding properties for biotin remain unaffected. We thus created a stable and reliable molecular anchor with a unique high-affinity binding site for biotinylated molecules or nanoparticles, which we expect to be useful for many single-molecule applications. To characterize the mechanical properties of the bond between biotin and our monovalent streptavidin, we performed force spectroscopy experiments using an atomic force microscope. We were able to conduct measurements at the single-molecule level with 1:1-stoichiometry and a well-defined geometry, in which force exclusively propagates through a single subunit of the streptavidin tetramer. For different force loading rates, we obtained narrow force distributions of the bond rupture forces ranging from 200 pN at 1,500 pN/s to 230 pN at 110,000 pN/s. The data are in very good agreement with the standard Bell-Evans model with a single potential barrier at Δx0 = 0.38 nm and a zero-force off-rate koff,0 in the 10-6 s-1 range.
Joseph, Prem Raj B.; Mosier, Philip D.; Desai, Umesh R.; Rajarathnam, Krishna
2015-01-01
Chemokine CXCL8/interleukin-8 (IL-8) plays a crucial role in directing neutrophils and oligodendrocytes to combat infection/injury and tumour cells in metastasis development. CXCL8 exists as monomers and dimers and interaction of both forms with glycosaminoglycans (GAGs) mediate these diverse cellular processes. However, very little is known regarding the structural basis underlying CXCL8–GAG interactions. There are conflicting reports on the affinities, geometry and whether the monomer or dimer is the high-affinity GAG ligand. To resolve these issues, we characterized the binding of a series of heparin-derived oligosaccharides [heparin disaccharide (dp2), heparin tetrasaccharide (dp4), heparin octasaccharide (dp8) and heparin 14-mer (dp14)] to the wild-type (WT) dimer and a designed monomer using solution NMR spectroscopy. The pattern and extent of binding-induced chemical shift perturbation (CSP) varied between dimer and monomer and between longer and shorter oligosaccharides. NMR-based structural models show that different interaction modes coexist and that the nature of interactions varied between monomer and dimer and oligosaccharide length. MD simulations indicate that the binding interface is structurally plastic and provided residue-specific details of the dynamic nature of the binding interface. Binding studies carried out under conditions at which WT CXCL8 exists as monomers and dimers provide unambiguous evidence that the dimer is the high-affinity GAG ligand. Together, our data indicate that a set of core residues function as the major recognition/binding site, a set of peripheral residues define the various binding geometries and that the structural plasticity of the binding interface allows multiplicity of binding interactions. We conclude that structural plasticity most probably regulates in vivo CXCL8 monomer/dimer–GAG interactions and function. PMID:26371375
Oxygen binding to partially nitrosylated hemoglobin.
Fago, Angela; Crumbliss, Alvin L; Hendrich, Michael P; Pearce, Linda L; Peterson, Jim; Henkens, Robert; Bonaventura, Celia
2013-09-01
Reactions of nitric oxide (NO) with hemoglobin (Hb) are important elements in protection against nitrosative damage. NO in the vasculature is depleted by the oxidative reaction with oxy Hb or by binding to deoxy Hb to generate partially nitrosylated Hb (Hb-NO). Many aspects of the formation and persistence of Hb-NO are yet to be clarified. In this study, we used a combination of EPR and visible absorption spectroscopy to investigate the interactions of partially nitrosylated Hb with O2. Partially nitrosylated Hb samples had predominantly hexacoordinate NO-heme geometry and resisted oxidation when exposed to O2 in the absence of anionic allosteric effectors. Faster oxidation occurred in the presence of 2,3-diphosphoglycerate (DPG) or inositol hexaphosphate (IHP), where the NO-heme derivatives had higher levels of pentacoordinate heme geometry. The anion-dependence of the NO-heme geometry also affected O2 binding equilibria. O2-binding curves of partially nitrosylated Hb in the absence of anions were left-shifted at low saturations, indicating destabilization of the low O2 affinity T-state of the Hb by increasing percentages of NO-heme, much as occurs with increasing levels of CO-heme. Samples containing IHP showed small decreases in O2 affinity, indicating shifts toward the low-affinity T-state and formation of inert α-NO/β-met tetramers. Most remarkably, O2-equilibria in the presence of the physiological effector DPG were essentially unchanged by up to 30% NO-heme in the samples. As will be discussed, under physiological conditions the interactions of Hb with NO provide protection against nitrosative damage without impairing O2 transport by Hb's unoccupied heme sites. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.
Henry, Brian L.; Desai, Umesh R.
2014-01-01
Sulfated low molecular weight lignins (LMWLs) have been found to bind in the heparin binding sites of coagulation proteinases. LMWLs represent a library of diverse non-carbohydrate, aromatic molecules which are structures different from heparin, but still potently inhibit thrombin and factor Xa. To better understand their mechanism of action, we studied the effects of three sulfated LMWLs (CDSO3, FDSO3, and SDSO3) on the active sites of thrombin and factor Xa. LMWLs were found to uniformly inhibit the catalytic activity of thrombin and factor Xa, regardless of the substrate used. Michaelis-Menten kinetic studies indicate that maximal velocity of hydrolysis of each chromogenic substrate decreases significantly in the presence of sulfated LMWLs, while the effect on Michaelis constant is dependent on the nature of the substrate. These studies indicate that LMWLs inhibit thrombin and factor Xa through allosteric disruption of the catalytic apparatus, specifically through the catalytic step. As opposed to heparin, LMWLs significantly alter the binding of the active site fluorescent ligand p-aminobenzamidine. LMWLs also had a greater effect on the molecular orientation of fluorescein-labeled His 57 than heparin. The molecular geometry surrounding the most important catalytic amino acid, Ser 195, was significantly altered by the binding of LMWLs while heparin had no measurable effect on Ser 195. These results further advance the concept of sulfated LMWLs as heparin mimics and will aid the design of anticoagulants based on their novel scaffold. PMID:25242245
Henry, Brian L; Desai, Umesh R
2014-11-01
Sulfated low molecular weight lignins (LMWLs) have been found to bind in the heparin binding sites of coagulation proteinases. LMWLs represent a library of diverse non-carbohydrate, aromatic molecules which are structures different from heparin, but still potently inhibit thrombin and factor Xa. To better understand their mechanism of action, we studied the effects of three sulfated LMWLs (CDSO3, FDSO3, and SDSO3) on the active sites of thrombin and factor Xa. LMWLs were found to uniformly inhibit the catalytic activity of thrombin and factor Xa, regardless of the substrate used. Michaelis-Menten kinetic studies indicate that maximal velocity of hydrolysis of each chromogenic substrate decreases significantly in the presence of sulfated LMWLs, while the effect on Michaelis constant is dependent on the nature of the substrate. These studies indicate that LMWLs inhibit thrombin and factor Xa through allosteric disruption of the catalytic apparatus, specifically through the catalytic step. As opposed to heparin, LMWLs significantly alter the binding of the active site fluorescent ligand p-aminobenzamidine. LMWLs also had a greater effect on the molecular orientation of fluorescein-labeled His 57 than heparin. The molecular geometry surrounding the most important catalytic amino acid, Ser 195, was significantly altered by the binding of LMWLs while heparin had no measurable effect on Ser 195. These results further advance the concept of sulfated LMWLs as heparin mimics and will aid the design of anticoagulants based on their novel scaffold. Copyright © 2014 Elsevier Ltd. All rights reserved.
Exploration of the Ca2+ interaction modes of the nifedipine calcium channel antagonist.
Liu, Huichun; Zhang, Liang; Li, Ping; Cukier, Robert I; Bu, Yuxiang
2007-02-02
A comprehensive study is carried out using quantum chemical computation and molecular dynamics (MD) simulations to gain insight into the interaction between Ca(2+) ions and the most important class of calcium channel antagonists--nifedipine. First, the chelating structures and energetic characters of nifedipine-Ca(2+) in the gas phase are explored, and 25 isomers are found. The most favorable chelating mode is a tridentate one, that is, Ca(2+) binds to two carbonyl O atoms and one nitryl O atom, where Ca(2+) is above the plane of the three O atoms to form a pyramidal structure. Accurate geometric structures, relative stabilities, vertical and adiabatic binding energies, and charge distributions are discussed. The differences in the geometries and energies among these isomers are analyzed from the contributions of chelating sites, electrostatics and polarizations, steric repulsions, and charge distributions. The interconversions among isomers with similar geometries and energies are also investigated because of the importance of the geometric transformation in the biological system. Furthermore, certain numbers of water molecules are added to the nifedipine-Ca(2+) system to probe the effect of water. A detailed study is performed on the hydrated geometries on the basis of the most stable isomer 1. Stepwise hydration can weaken the nifedipine-Ca(2+) interaction, and the chelating sites of nifedipine are gradually replaced by the added water molecules. Hexacoordination is found to be the most favorable geometry no matter how many water molecules were added, which can be verified by the MD simulations. The transfer of water molecules from the inner shell to the outer shell is also supported by MD simulations of the hexahydrated complexes.
Wang, Xue; Zhao, Kun; Kirberger, Michael; Wong, Hing; Chen, Guantao; Yang, Jenny J
2010-01-01
Calcium binding in proteins exhibits a wide range of polygonal geometries that relate directly to an equally diverse set of biological functions. The binding process stabilizes protein structures and typically results in local conformational change and/or global restructuring of the backbone. Previously, we established the MUG program, which utilized multiple geometries in the Ca2+-binding pockets of holoproteins to identify such pockets, ignoring possible Ca2+-induced conformational change. In this article, we first report our progress in the analysis of Ca2+-induced conformational changes followed by improved prediction of Ca2+-binding sites in the large group of Ca2+-binding proteins that exhibit only localized conformational changes. The MUGSR algorithm was devised to incorporate side chain torsional rotation as a predictor. The output from MUGSR presents groups of residues where each group, typically containing two to five residues, is a potential binding pocket. MUGSR was applied to both X-ray apo structures and NMR holo structures, which did not use calcium distance constraints in structure calculations. Predicted pockets were validated by comparison with homologous holo structures. Defining a “correct hit” as a group of residues containing at least two true ligand residues, the sensitivity was at least 90%; whereas for a “correct hit” defined as a group of residues containing at least three true ligand residues, the sensitivity was at least 78%. These data suggest that Ca2+-binding pockets are at least partially prepositioned to chelate the ion in the apo form of the protein. PMID:20512971
Peterson, R C; Reich, M F; Dunn, P E; Law, J H; Katzenellnbogen, J A
1977-05-17
A series of analogues of insect juvenile hormone (four geometric isomers of methyl epoxyfarnesenate, several para-substituted epoxygeranyl phenyl ethers, and epoxyfarnesol and its acetate and haloacetate derivatives) was prepared to investigate the binding specificity of the hemolymph juvenile hormone binding protein from the tobacco hornworm Manduct sexta. The relative binding affinities were determined by a competition assay against radiolabeled methyl (E,E)-3,11-dimethyl-7-ethyl-cis-10,11-epoxytrideca-2,6-dienoate (JH I). The ratio of dissociation constants was estimated by plotting competitor data according to a linear transformation of the dissociation equations describing competition of two ligands for a binding protein. The importance of the geometry of the sesquiterpene hydrocarbon chain is indicated by the fact that the binding affinity is decreased as Z (cis) double bonds are substituted for E (trans) double bonds in the methyl epoxyfarnesenate series; the unepoxidized analogues do not bind. A carboxylic ester function is important although its orientation can be reversed, as indicated by the good binding of epoxyfarnesyl acetate. In the monoterpene series, methyl epoxygeranoate shows no affinity for the binding protein, but substitution of a phenyl or p-carbomethoxyphenyl ether for the ester function imparts a low, but significant affinity. These data taken together with earlier results indicate that the binding site for juvenile hormone in the hemolymph binding protein is characterized by a sterically defined hydrophobic region with polar sites that recognize the epoxide and the ester functions.
Luo, Feng; Yan, Changsheng; Dang, Lilong; Krishna, Rajamani; Zhou, Wei; Wu, Hui; Dong, Xinglong; Han, Yu; Hu, Tong-Liang; O'Keeffe, Michael; Wang, Lingling; Luo, Mingbiao; Lin, Rui-Biao; Chen, Banglin
2016-05-04
A new metal-organic framework Zn2(H2O)(dobdc)·0.5(H2O) (UTSA-74, H4dobdc = 2,5-dioxido-1,4-benzenedicarboxylic acid), Zn-MOF-74/CPO-27-Zn isomer, has been synthesized and structurally characterized. It has a novel four coordinated fgl topology with one-dimensional channels of about 8.0 Å. Unlike metal sites in the well-established MOF-74 with a rod-packing structure in which each of them is in a five coordinate square pyramidal coordination geometry, there are two different Zn(2+) sites within the binuclear secondary building units in UTSA-74 in which one of them (Zn1) is in a tetrahedral while another (Zn2) in an octahedral coordination geometry. After activation, the two axial water molecules on Zn2 sites can be removed, generating UTSA-74a with two accessible gas binding sites per Zn2 ion. Accordingly, UTSA-74a takes up a moderately high and comparable amount of acetylene (145 cm(3)/cm(3)) to Zn-MOF-74. Interestingly, the accessible Zn(2+) sites in UTSA-74a are bridged by carbon dioxide molecules instead of being terminally bound in Zn-MOF-74, so UTSA-74a adsorbs a much smaller amount of carbon dioxide (90 cm(3)/cm(3)) than Zn-MOF-74 (146 cm(3)/cm(3)) at room temperature and 1 bar, leading to a superior MOF material for highly selective C2H2/CO2 separation. X-ray crystal structures, gas sorption isotherms, molecular modeling, and simulated and experimental breakthroughs comprehensively support this result.
A computational model of the nicotinic acetylcholine binding site
NASA Astrophysics Data System (ADS)
Gálvez-ruano, Enrique; Iriepa-Canalda, Isabel; Morreale, Antonio; Lipkowitz, Kenny B.
1999-01-01
We have derived a model of the nicotinic acetylcholine binding site. This was accomplished by using three known agonists (acetylcholine, nicotine and epibatidine) as templates around which polypeptide side chains, found to be part of the receptor cavity from published molecular biology studies, are allowed to flow freely in molecular dynamics simulations and mold themselves around these templates. The resulting supramolecular complex should thus be a complement, both in terms of steric effects as well as electronic effects, to the agonists and it should be a good estimation of the true receptor cavity structure. The shapes of those minireceptor cavities equilibrated rapidly on the simulation time scale and their structural congruence is very high, implying that a satisfactory model of the nicotinic acetylcholine binding site has been achieved. The computational methodology was internally tested against two rigid and specific antagonists (dihydro-β-erytroidine and erysoidine), that are expected to give rise to a somewhat differently shaped binding site compared to that derived from the agonists. Using these antagonists as templates there were structural reorganizations of the initial receptor cavities leading to distinctly different cavities compared to agonists. This indicates that adequate times and temperatures were used in our computational protocols to achieve equilibrium structures for the agonists. Overall, both minireceptor geometries for agonists and antagonists are similar with the exception of one amino acid (ARG209).
Molecular Basis of the Bohr Effect in Arthropod Hemocyanin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hirota, S.; Kawahara, T; Beltramini, M
2008-01-01
Flash photolysis and K-edge x-ray absorption spectroscopy (XAS) were used to investigate the functional and structural effects of pH on the oxygen affinity of three homologous arthropod hemocyanins (Hcs). Flash photolysis measurements showed that the well-characterized pH dependence of oxygen affinity (Bohr effect) is attributable to changes in the oxygen binding rate constant, kon, rather than changes in koff. In parallel, coordination geometry of copper in Hc was evaluated as a function of pH by XAS. It was found that the geometry of copper in the oxygenated protein is unchanged at all pH values investigated, while significant changes were observedmore » for the deoxygenated protein as a function of pH. The interpretation of these changes was based on previously described correlations between spectral lineshape and coordination geometry obtained for model compounds of known structure A pH-dependent change in the geometry of cuprous copper in the active site of deoxyHc, from pseudotetrahedral toward trigonal was assigned from the observed intensity dependence of the 1s ? 4pz transition in x-ray absorption near edge structure (XANES) spectra. The structural alteration correlated well with increase in oxygen affinity at alkaline pH determined in flash photolysis experiments. These results suggest that the oxygen binding rate in deoxyHc depends on the coordination geometry of Cu(I) and suggest a structural origin for the Bohr effect in arthropod Hcs.« less
Kekenes-Huskey, P. M.; Gillette, A.; Hake, J.; McCammon, J. A.
2012-01-01
We introduce a computational pipeline and suite of software tools for the approximation of diffusion-limited binding based on a recently developed theoretical framework. Our approach handles molecular geometries generated from high-resolution structural data and can account for active sites buried within the protein or behind gating mechanisms. Using tools from the FEniCS library and the APBS solver, we implement a numerical code for our method and study two Ca2+-binding proteins: Troponin C and the Sarcoplasmic Reticulum Ca2+ ATPase (SERCA). We find that a combination of diffusional encounter and internal ‘buried channel’ descriptions provide superior descriptions of association rates, improving estimates by orders of magnitude. PMID:23293662
Kekenes-Huskey, P M; Gillette, A; Hake, J; McCammon, J A
2012-10-31
We introduce a computational pipeline and suite of software tools for the approximation of diffusion-limited binding based on a recently developed theoretical framework. Our approach handles molecular geometries generated from high-resolution structural data and can account for active sites buried within the protein or behind gating mechanisms. Using tools from the FEniCS library and the APBS solver, we implement a numerical code for our method and study two Ca(2+)-binding proteins: Troponin C and the Sarcoplasmic Reticulum Ca(2+) ATPase (SERCA). We find that a combination of diffusional encounter and internal 'buried channel' descriptions provide superior descriptions of association rates, improving estimates by orders of magnitude.
NASA Astrophysics Data System (ADS)
Kekenes-Huskey, P. M.; Gillette, A.; Hake, J.; McCammon, J. A.
2012-01-01
We introduce a computational pipeline and suite of software tools for the approximation of diffusion-limited binding based on a recently developed theoretical framework. Our approach handles molecular geometries generated from high-resolution structural data and can account for active sites buried within the protein or behind gating mechanisms. Using tools from the FEniCS library and the APBS solver, we implement a numerical code for our method and study two Ca2+-binding proteins: troponin C and the sarcoplasmic reticulum Ca2+ ATPase. We find that a combination of diffusional encounter and internal ‘buried channel’ descriptions provides superior descriptions of association rates, improving estimates by orders of magnitude.
Benson, Oguarabau; da Silva, Ivan; Argent, Stephen P; Cabot, Rafel; Savage, Mathew; Godfrey, Harry G W; Yan, Yong; Parker, Stewart F; Manuel, Pascal; Lennox, Matthew J; Mitra, Tamoghna; Easun, Timothy L; Lewis, William; Blake, Alexander J; Besley, Elena; Yang, Sihai; Schröder, Martin
2016-11-16
An amide-functionalized metal organic framework (MOF) material, MFM-136, shows a high CO 2 uptake of 12.6 mmol g -1 at 20 bar and 298 K. MFM-136 is the first example of an acylamide pyrimidyl isophthalate MOF without open metal sites and, thus, provides a unique platform to study guest binding, particularly the role of free amides. Neutron diffraction reveals that, surprisingly, there is no direct binding between the adsorbed CO 2 /CH 4 molecules and the pendant amide group in the pore. This observation has been confirmed unambiguously by inelastic neutron spectroscopy. This suggests that introduction of functional groups solely may not necessarily induce specific guest-host binding in porous materials, but it is a combination of pore size, geometry, and functional group that leads to enhanced gas adsorption properties.
Analysis of zinc binding sites in protein crystal structures.
Alberts, I L; Nadassy, K; Wodak, S J
1998-08-01
The geometrical properties of zinc binding sites in a dataset of high quality protein crystal structures deposited in the Protein Data Bank have been examined to identify important differences between zinc sites that are directly involved in catalysis and those that play a structural role. Coordination angles in the zinc primary coordination sphere are compared with ideal values for each coordination geometry, and zinc coordination distances are compared with those in small zinc complexes from the Cambridge Structural Database as a guide of expected trends. We find that distances and angles in the primary coordination sphere are in general close to the expected (or ideal) values. Deviations occur primarily for oxygen coordinating atoms and are found to be mainly due to H-bonding of the oxygen coordinating ligand to protein residues, bidentate binding arrangements, and multi-zinc sites. We find that H-bonding of oxygen containing residues (or water) to zinc bound histidines is almost universal in our dataset and defines the elec-His-Zn motif. Analysis of the stereochemistry shows that carboxyl elec-His-Zn motifs are geometrically rigid, while water elec-His-Zn motifs show the most geometrical variation. As catalytic motifs have a higher proportion of carboxyl elec atoms than structural motifs, they provide a more rigid framework for zinc binding. This is understood biologically, as a small distortion in the zinc position in an enzyme can have serious consequences on the enzymatic reaction. We also analyze the sequence pattern of the zinc ligands and residues that provide elecs, and identify conserved hydrophobic residues in the endopeptidases that also appear to contribute to stabilizing the catalytic zinc site. A zinc binding template in protein crystal structures is derived from these observations.
Temml, Veronika; Kuehnl, Susanne; Schuster, Daniela; Schwaiger, Stefan; Stuppner, Hermann; Fuchs, Dietmar
2013-01-01
Mediterranean Carthamus tinctorius (Safflower) is used for treatment of inflammatory conditions and neuropsychiatric disorders. Recently C. tinctorius lignans arctigenin and trachelogenin but not matairesinol were described to interfere with the activity of tryptophan-degrading enzyme indoleamine 2,3-dioxygenase (IDO) in peripheral blood mononuclear cells in vitro. We examined a potential direct influence of compounds on IDO enzyme activity applying computational calculations based on 3D geometry of the compounds. The interaction pattern analysis and force field-based minimization was performed within LigandScout 3.03, the docking simulation with MOE 2011.10 using the X-ray crystal structure of IDO. Results confirm the possibility of an intense interaction of arctigenin and trachelogenin with the binding site of the enzyme, while matairesinol had no such effect. PMID:24251110
How Does Mg2+ Modulate the RNA Folding Mechanism: A Case Study of the G:C W:W Trans Basepair.
Halder, Antarip; Roy, Rohit; Bhattacharyya, Dhananjay; Mitra, Abhijit
2017-07-25
Reverse Watson-Crick G:C basepairs (G:C W:W Trans) occur frequently in different functional RNAs. This is one of the few basepairs whose gas-phase-optimized isolated geometry is inconsistent with the corresponding experimental geometry. Several earlier studies indicate that through post-transcriptional modification, direct protonation, or coordination with Mg 2+ , accumulation of positive charge near N7 of guanine can stabilize the experimental geometry. Interestingly, recent studies reveal significant variation in the position of putatively bound Mg 2+ . This, in conjunction with recently raised doubts regarding some of the Mg 2+ assignments near the imino nitrogen of guanine, is suggestive of the existence of multiple Mg 2+ binding modes for this basepair. Our detailed investigation of Mg 2+ -bound G:C W:W Trans pairs occurring in high-resolution RNA crystal structures shows that they are found in 14 different contexts, eight of which display Mg 2+ binding at the Hoogsteen edge of guanine. Further examination of occurrences in these eight contexts led to the characterization of three different Mg 2+ binding modes: 1) direct binding via N7 coordination, 2) direct binding via O6 coordination, and 3) binding via hydrogen-bonding interaction with the first-shell water molecules. In the crystal structures, the latter two modes are associated with a buckled and propeller-twisted geometry of the basepair. Interestingly, respective optimized geometries of these different Mg 2+ binding modes (optimized using six different DFT functionals) are consistent with their corresponding experimental geometries. Subsequent interaction energy calculations at the MP2 level, and decomposition of its components, suggest that for G:C W:W Trans , Mg 2+ binding can fine tune the basepair geometries without compromising with their stability. Our results, therefore, underline the importance of the mode of binding of Mg 2+ ions in shaping RNA structure, folding and function. Copyright © 2017. Published by Elsevier Inc.
Ligand Binding Site Detection by Local Structure Alignment and Its Performance Complementarity
Lee, Hui Sun; Im, Wonpil
2013-01-01
Accurate determination of potential ligand binding sites (BS) is a key step for protein function characterization and structure-based drug design. Despite promising results of template-based BS prediction methods using global structure alignment (GSA), there is a room to improve the performance by properly incorporating local structure alignment (LSA) because BS are local structures and often similar for proteins with dissimilar global folds. We present a template-based ligand BS prediction method using G-LoSA, our LSA tool. A large benchmark set validation shows that G-LoSA predicts drug-like ligands’ positions in single-chain protein targets more precisely than TM-align, a GSA-based method, while the overall success rate of TM-align is better. G-LoSA is particularly efficient for accurate detection of local structures conserved across proteins with diverse global topologies. Recognizing the performance complementarity of G-LoSA to TM-align and a non-template geometry-based method, fpocket, a robust consensus scoring method, CMCS-BSP (Complementary Methods and Consensus Scoring for ligand Binding Site Prediction), is developed and shows improvement on prediction accuracy. The G-LoSA source code is freely available at http://im.bioinformatics.ku.edu/GLoSA. PMID:23957286
Whispering gallery mode resonators for rapid label-free biosensing in small volume droplets.
Wildgen, Sarah M; Dunn, Robert C
2015-03-23
Rapid biosensing requires fast mass transport of the analyte to the surface of the sensing element. To optimize analysis times, both mass transport in solution and the geometry and size of the sensing element need to be considered. Small dielectric spheres, tens of microns in diameter, can act as label-free biosensors using whispering gallery mode (WGM) resonances. WGM resonances are sensitive to the effective refractive index, which changes upon analyte binding to recognition sites on functionalized resonators. The spherical geometry and tens of microns diameter of these resonators provides an efficient target for sensing while their compact size enables detection in limited volumes. Here, we explore conditions leading to rapid analyte detection using WGM resonators as label-free sensors in 10 μL sample droplets. Droplet evaporation leads to potentially useful convective mixing, but also limits the time over which analysis can be completed. We show that active droplet mixing combined with initial binding rate measurements is required for accurate nanomolar protein quantification within the first minute following injection.
Laine, Elodie; Carbone, Alessandra
2015-01-01
Protein-protein interactions (PPIs) are essential to all biological processes and they represent increasingly important therapeutic targets. Here, we present a new method for accurately predicting protein-protein interfaces, understanding their properties, origins and binding to multiple partners. Contrary to machine learning approaches, our method combines in a rational and very straightforward way three sequence- and structure-based descriptors of protein residues: evolutionary conservation, physico-chemical properties and local geometry. The implemented strategy yields very precise predictions for a wide range of protein-protein interfaces and discriminates them from small-molecule binding sites. Beyond its predictive power, the approach permits to dissect interaction surfaces and unravel their complexity. We show how the analysis of the predicted patches can foster new strategies for PPIs modulation and interaction surface redesign. The approach is implemented in JET2, an automated tool based on the Joint Evolutionary Trees (JET) method for sequence-based protein interface prediction. JET2 is freely available at www.lcqb.upmc.fr/JET2. PMID:26690684
Studies of the Binding of Modest Modulators of the Human Enzyme, Sirtuin 6, by STD NMR.
Bolívar, Beatriz E; Welch, John T
2017-05-18
Pyrazinamide (PZA), an essential constituent of short-course tuberculosis chemotherapy, binds weakly but selectively to Sirtuin 6 (SIRT6). Despite the structural similarities between nicotinamide (NAM), PZA, and pyrazinoic acid (POA), these inhibitors modulate SIRT6 by different mechanisms and through different binding sites, as suggested by saturation transfer difference (STD) NMR. Available experimental evidence, such as that derived from crystal structures and kinetic experiments, has been of only limited utility in elucidation of the mechanistic details of sirtuin inhibition by NAM or other inhibitors. For instance, crystallographic structural analysis of sirtuin binding sites does not help us understand important differences in binding affinities among sirtuins or capture details of such dynamic process. Hence, STD NMR was utilized throughout this study. Our results not only agreed with the binding kinetics experiments but also gave a qualitative insight into the binding process. The data presented herein suggested some details about the geometry of the binding epitopes of the ligands in solution with the apo- and holoenzyme. Recognition that SIRT6 is affected selectively by PZA, an established clinical agent, suggests that the rational development of more potent and selective NAM surrogates might be possible. These derivatives might be accessible by employing the malleability of this scaffold to assist in the identification by STD NMR of the motifs that interact with the apo- and holoenzymes in solution. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liu, Yanyan; Yan, Bing; Winkler, David A; Fu, Jianjie; Zhang, Aiqian
2017-06-07
Acetylcholinesterase (AChE) activity regulation by chemical agents or, potentially, nanomaterials is important for both toxicology and pharmacology. Competitive inhibition via direct catalytic active sites (CAS) binding or noncompetitive inhibition through interference with substrate and product entering and exiting has been recognized previously as an AChE-inhibition mechanism for bespoke nanomaterials. The competitive inhibition by peripheral anionic site (PAS) interaction without CAS binding remains unexplored. Here, we proposed and verified the occurrence of a presumed competitive inhibition of AChE without CAS binding for hydrophobically functionalized C 60 nanoparticles (NPs) by employing both experimental and computational methods. The kinetic inhibition analysis distinguished six competitive inhibitors, probably targeting the PAS, from the pristine and hydrophilically modified C 60 NPs. A simple quantitative nanostructure-activity relationship (QNAR) model relating the pocket accessible length of substituent to inhibition capacity was then established to reveal how the geometry of the surface group decides the NP difference in AChE inhibition. Molecular docking identified the PAS as the potential binding site interacting with the NPs via a T-shaped plug-in mode. Specifically, the fullerene core covered the enzyme gorge as a lid through π-π stacking with Tyr72 and Trp286 in the PAS, while the hydrophobic ligands on the fullerene surface inserted into the AChE active site to provide further stability for the complexes. The modeling predicted that inhibition would be severely compromised by Tyr72 and Trp286 deletions, and the subsequent site-directed mutagenesis experiments proved this prediction. Our results demonstrate AChE competitive inhibition of NPs without CAS participation to gain further understanding of both the neurotoxicity and the curative effect of NPs.
Grasso, Gianvito; Deriu, Marco Agostino; Patrulea, Viorica; Borchard, Gerrit; Möller, Michael; Danani, Andrea
2017-01-01
The success of medical threatments with DNA and silencing interference RNA is strongly related to the design of efficient delivery technologies. Cationic polymers represent an attractive strategy to serve as nucleic-acid carriers with the envisioned advantages of efficient complexation, low cost, ease of production, well-defined size, and low polydispersity index. However, the balance between efficacy and toxicity (safety) of these polymers is a challenge and in need of improvement. With the aim of designing more effective polycationic-based gene carriers, many parameters such as carrier morphology, size, molecular weight, surface chemistry, and flexibility/rigidity ratio need to be taken into consideration. In the present work, the binding mechanism of three cationic polymers (polyarginine, polylysine and polyethyleneimine) to a model siRNA target is computationally investigated at the atomistic level. In order to better understand the polycationic carrier-siRNA interactions, replica exchange molecular dynamic simulations were carried out to provide an exhaustive exploration of all the possible binding sites, taking fully into account the siRNA flexibility together with the presence of explicit solvent and ions. Moreover, well-tempered metadynamics simulations were employed to elucidate how molecular geometry, polycation flexibility, and charge neutralization affect the siRNA-polycations free energy landscape in term of low-energy binding modes and unbinding free energy barriers. Significant differences among polymer binding modes have been detected, revealing the advantageous binding properties of polyarginine and polylysine compared to polyethyleneimine.
Patrulea, Viorica; Borchard, Gerrit; Möller, Michael; Danani, Andrea
2017-01-01
The success of medical threatments with DNA and silencing interference RNA is strongly related to the design of efficient delivery technologies. Cationic polymers represent an attractive strategy to serve as nucleic-acid carriers with the envisioned advantages of efficient complexation, low cost, ease of production, well-defined size, and low polydispersity index. However, the balance between efficacy and toxicity (safety) of these polymers is a challenge and in need of improvement. With the aim of designing more effective polycationic-based gene carriers, many parameters such as carrier morphology, size, molecular weight, surface chemistry, and flexibility/rigidity ratio need to be taken into consideration. In the present work, the binding mechanism of three cationic polymers (polyarginine, polylysine and polyethyleneimine) to a model siRNA target is computationally investigated at the atomistic level. In order to better understand the polycationic carrier-siRNA interactions, replica exchange molecular dynamic simulations were carried out to provide an exhaustive exploration of all the possible binding sites, taking fully into account the siRNA flexibility together with the presence of explicit solvent and ions. Moreover, well-tempered metadynamics simulations were employed to elucidate how molecular geometry, polycation flexibility, and charge neutralization affect the siRNA-polycations free energy landscape in term of low-energy binding modes and unbinding free energy barriers. Significant differences among polymer binding modes have been detected, revealing the advantageous binding properties of polyarginine and polylysine compared to polyethyleneimine. PMID:29088239
2016-01-01
An amide-functionalized metal organic framework (MOF) material, MFM-136, shows a high CO2 uptake of 12.6 mmol g–1 at 20 bar and 298 K. MFM-136 is the first example of an acylamide pyrimidyl isophthalate MOF without open metal sites and, thus, provides a unique platform to study guest binding, particularly the role of free amides. Neutron diffraction reveals that, surprisingly, there is no direct binding between the adsorbed CO2/CH4 molecules and the pendant amide group in the pore. This observation has been confirmed unambiguously by inelastic neutron spectroscopy. This suggests that introduction of functional groups solely may not necessarily induce specific guest–host binding in porous materials, but it is a combination of pore size, geometry, and functional group that leads to enhanced gas adsorption properties. PMID:27665845
Atomic and molecular adsorption on Au(111)
Santiago-Rodriguez, Yohaselly; Herron, Jeffrey A.; Curet-Arana, Maria C.; ...
2014-05-02
Periodic self-consistent density functional theory (DFT-GGA) calculations were used to study the adsorption of several atomic species, molecular species and molecular fragments on the Au(111) surface with a coverage of 1/4 monolayer (ML). Binding geometries, binding energies, and diffusion barriers were calculated for 27 species. Furthermore, we calculated the surface deformation energy associated with the binding events. The binding strength for all the analyzed species can be ordered as follows: NH 3 < NO < CO < CH 3 < HCO < NH 2 < COOH < OH < HCOO < CNH 2 < H < N < NH
Cofactor specificity motifs and the induced fit mechanism in class I ketol-acid reductoisomerases.
Cahn, Jackson K B; Brinkmann-Chen, Sabine; Spatzal, Thomas; Wiig, Jared A; Buller, Andrew R; Einsle, Oliver; Hu, Yilin; Ribbe, Markus W; Arnold, Frances H
2015-06-15
Although most sequenced members of the industrially important ketol-acid reductoisomerase (KARI) family are class I enzymes, structural studies to date have focused primarily on the class II KARIs, which arose through domain duplication. In the present study, we present five new crystal structures of class I KARIs. These include the first structure of a KARI with a six-residue β2αB (cofactor specificity determining) loop and an NADPH phosphate-binding geometry distinct from that of the seven- and 12-residue loops. We also present the first structures of naturally occurring KARIs that utilize NADH as cofactor. These results show insertions in the specificity loops that confounded previous attempts to classify them according to loop length. Lastly, we explore the conformational changes that occur in class I KARIs upon binding of cofactor and metal ions. The class I KARI structures indicate that the active sites close upon binding NAD(P)H, similar to what is observed in the class II KARIs of rice and spinach and different from the opening of the active site observed in the class II KARI of Escherichia coli. This conformational change involves a decrease in the bending of the helix that runs between the domains and a rearrangement of the nicotinamide-binding site. © The Authors Journal Compilation © 2015 Biochemical Society.
Biochemical profiling in silico--predicting substrate specificities of large enzyme families.
Tyagi, Sadhna; Pleiss, Juergen
2006-06-25
A general high-throughput method for in silico biochemical profiling of enzyme families has been developed based on covalent docking of potential substrates into the binding sites of target enzymes. The method has been tested by systematically docking transition state--analogous intermediates of 12 substrates into the binding sites of 20 alpha/beta hydrolases from 15 homologous families. To evaluate the effect of side chain orientations to the docking results, 137 crystal structures were included in the analysis. A good substrate must fulfil two criteria: it must bind in a productive geometry with four hydrogen bonds between the substrate and the catalytic histidine and the oxyanion hole, and a high affinity of the enzyme-substrate complex as predicted by a high docking score. The modelling results in general reproduce experimental data on substrate specificity and stereoselectivity: the differences in substrate specificity of cholinesterases toward acetyl- and butyrylcholine, the changes of activity of lipases and esterases upon the size of the acid moieties, activity of lipases and esterases toward tertiary alcohols, and the stereopreference of lipases and esterases toward chiral secondary alcohols. Rigidity of the docking procedure was the major reason for false positive and false negative predictions, as the geometry of the complex and docking score may sensitively depend on the orientation of individual side chains. Therefore, appropriate structures have to be identified. In silico biochemical profiling provides a time efficient and cost saving protocol for virtual screening to identify the potential substrates of the members of large enzyme family from a library of molecules.
Theoretical Insights into Methane C–H Bond Activation on Alkaline Metal Oxides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aljama, Hassan; Nørskov, Jens K.; Abild-Pedersen, Frank
Here, we investigate the role of alkaline metal oxides (AMO) (MgO, CaO, and SrO) in activating the C–H bond in methane. We also use Density Functional Theory (DFT) and microkinetic modeling to study the catalytic elementary steps in breaking the C–H bond in methane and creating the methyl radical, a precursor prior to creating C2 products. We also study the effects of surface geometry on the catalytic activity of AMO by examining terrace and step sites. We observe that the process of activating methane depends strongly on the structure of the AMO. When the AMO surface is doped with anmore » alkali metal, the transition state (TS) structure has a methyl radical-like behavior, where the methyl radical interacts weakly with the AMO surface. In this case, the TS energy scales with the hydrogen binding energy. On pure AMO, the TS interacts with AMO surface oxygen as well as the metal atom on the surface, and consequently the TS energy scales with the binding energy of hydrogen and methyl. We study the activity of AMO using a mean-field microkinetic model. The results indicate that terrace sites have similar catalytic activity, with the exception of MgO(100). Step sites bind hydrogen more strongly, making them more active, and this confirms previously reported experimental results. We map the catalytic activity of AMO using a volcano plot with two descriptors: the methyl and the hydrogen binding energies, with the latter being a more significant descriptor. The microkinetic model results suggest that C–H bond dissociation is not always the rate-limiting step. At weak hydrogen binding, the reaction is limited by C–H bond activation. At strong hydrogen binding, the reaction is limited due to poisoning of the active site. We found an increase in activity of AMO as the basicity increased. Finally, the developed microkinetic model allows screening for improved catalysts using simple calculations of the hydrogen binding energy.« less
Theoretical Insights into Methane C–H Bond Activation on Alkaline Metal Oxides
Aljama, Hassan; Nørskov, Jens K.; Abild-Pedersen, Frank
2017-07-17
Here, we investigate the role of alkaline metal oxides (AMO) (MgO, CaO, and SrO) in activating the C–H bond in methane. We also use Density Functional Theory (DFT) and microkinetic modeling to study the catalytic elementary steps in breaking the C–H bond in methane and creating the methyl radical, a precursor prior to creating C2 products. We also study the effects of surface geometry on the catalytic activity of AMO by examining terrace and step sites. We observe that the process of activating methane depends strongly on the structure of the AMO. When the AMO surface is doped with anmore » alkali metal, the transition state (TS) structure has a methyl radical-like behavior, where the methyl radical interacts weakly with the AMO surface. In this case, the TS energy scales with the hydrogen binding energy. On pure AMO, the TS interacts with AMO surface oxygen as well as the metal atom on the surface, and consequently the TS energy scales with the binding energy of hydrogen and methyl. We study the activity of AMO using a mean-field microkinetic model. The results indicate that terrace sites have similar catalytic activity, with the exception of MgO(100). Step sites bind hydrogen more strongly, making them more active, and this confirms previously reported experimental results. We map the catalytic activity of AMO using a volcano plot with two descriptors: the methyl and the hydrogen binding energies, with the latter being a more significant descriptor. The microkinetic model results suggest that C–H bond dissociation is not always the rate-limiting step. At weak hydrogen binding, the reaction is limited by C–H bond activation. At strong hydrogen binding, the reaction is limited due to poisoning of the active site. We found an increase in activity of AMO as the basicity increased. Finally, the developed microkinetic model allows screening for improved catalysts using simple calculations of the hydrogen binding energy.« less
Structural changes at the metal ion binding site during the phosphoglucomutase reaction.
Ray, W J; Post, C B; Liu, Y; Rhyu, G I
1993-01-12
An electron density map of the reactive, Cd2+ form of crystalline phosphoglucomutase from X-ray diffraction studies shows that the enzymic phosphate donates a nonbridging oxygen to the ligand sphere of the bound metal ion, which appears to be tetracoordinate. 31P and 113Cd NMR spectroscopy are used to assess changes in the properties of bound Cd2+ produced by substrate/product and by substrate/product analog inhibitors. The approximately 50 ppm downfield shift of the 113Cd resonance on formation of the complex of dephosphoenzyme and glucose 1,6-bisphosphate is associated with the initial sugar-phosphate binding step and likely involves a change in the geometry of the coordinating ligands. This interpretation is supported by spectral studies involving various complexes of the active Co2+ and Ni(2+)-enzyme. In addition, there is a loss of the 31P-113Cd J coupling that characterizes the monophosphate complexes of the Cd2+ enzyme either during or immediately after the PO3- transfer step that produces the bisphosphate complex, indicating a further change at the metal binding site. The implications of these observations with respect to the PO3- transfer process in the phosphoglucomutase reaction are considered. The apparent plasticity of the ligand sphere of the active site metal ion in this system may allow a single metal ion to act as a chaperone for a nonbridging oxygen during PO3- transfer or to allow a change in metal ion coordination during catalysis. A general NMR line shape/chemical-exchange analysis for evaluating binding in protein-ligand systems when exchange is intermediate to fast on the NMR time scale is described. Its application to the present system involves multiple exchange sites that depend on a single binding rate, thereby adding further constraints to the analysis.
NASA Astrophysics Data System (ADS)
Sharma, Deepti; Ojha, Himanshu; Pathak, Mallika; Singh, Bhawna; Sharma, Navneet; Singh, Anju; Kakkar, Rita; Sharma, Rakesh K.
2016-08-01
Metformin is a biguanide class of drug used for the treatment of diabetes mellitus. It is well known that serum protein-ligand binding interaction significantly influence the biodistribution of a drug. Current study was performed to characterize the binding mechanism of metformin with serum albumin. The binding interaction of the metformin with bovine serum albumin (BSA) was examined using UV-Vis absorption spectroscopy, fluorescence, circular dichroism, density functional theory and molecular docking studies. Absorption spectra and fluorescence emission spectra pointed out the weak binding of metformin with BSA as was apparent from the slight change in absorbance and fluorescence intensity of BSA in presence of metformin. Circular dichroism study implied the significant change in the conformation of BSA upon binding with metformin. Density functional theory calculations showed that metformin has non-planar geometry and has two energy states. The docking studies evidently signified that metformin could bind significantly to the three binding sites in BSA via hydrophobic, hydrogen bonding and electrostatic interactions. The data suggested the existence of non-covalent specific binding interaction in the complexation of metformin with BSA. The present study will certainly contribute to the development of metformin as a therapeutic molecule.
Monovalent Strep-Tactin for strong and site-specific tethering in nanospectroscopy.
Baumann, Fabian; Bauer, Magnus S; Milles, Lukas F; Alexandrovich, Alexander; Gaub, Hermann E; Pippig, Diana A
2016-01-01
Strep-Tactin, an engineered form of streptavidin, binds avidly to the genetically encoded peptide Strep-tag II in a manner comparable to streptavidin binding to biotin. These interactions have been used in protein purification and detection applications. However, in single-molecule studies, for example using atomic force microscopy-based single-molecule force spectroscopy (AFM-SMFS), the tetravalency of these systems impedes the measurement of monodispersed data. Here, we introduce a monovalent form of Strep-Tactin that harbours a unique binding site for Strep-tag II and a single cysteine that allows Strep-Tactin to specifically attach to the atomic force microscope cantilever and form a consistent pulling geometry to obtain homogeneous rupture data. Using AFM-SMFS, the mechanical properties of the interaction between Strep-tag II and monovalent Strep-Tactin were characterized. Rupture forces comparable to biotin:streptavidin unbinding were observed. Using titin kinase and green fluorescent protein, we show that monovalent Strep-Tactin is generally applicable to protein unfolding experiments. We expect monovalent Strep-Tactin to be a reliable anchoring tool for a range of single-molecule studies.
Monovalent Strep-Tactin for strong and site-specific tethering in nanospectroscopy
NASA Astrophysics Data System (ADS)
Baumann, Fabian; Bauer, Magnus S.; Milles, Lukas F.; Alexandrovich, Alexander; Gaub, Hermann E.; Pippig, Diana A.
2016-01-01
Strep-Tactin, an engineered form of streptavidin, binds avidly to the genetically encoded peptide Strep-tag II in a manner comparable to streptavidin binding to biotin. These interactions have been used in protein purification and detection applications. However, in single-molecule studies, for example using atomic force microscopy-based single-molecule force spectroscopy (AFM-SMFS), the tetravalency of these systems impedes the measurement of monodispersed data. Here, we introduce a monovalent form of Strep-Tactin that harbours a unique binding site for Strep-tag II and a single cysteine that allows Strep-Tactin to specifically attach to the atomic force microscope cantilever and form a consistent pulling geometry to obtain homogeneous rupture data. Using AFM-SMFS, the mechanical properties of the interaction between Strep-tag II and monovalent Strep-Tactin were characterized. Rupture forces comparable to biotin:streptavidin unbinding were observed. Using titin kinase and green fluorescent protein, we show that monovalent Strep-Tactin is generally applicable to protein unfolding experiments. We expect monovalent Strep-Tactin to be a reliable anchoring tool for a range of single-molecule studies.
Multipoint molecular recognition within a calix[6]arene funnel complex
Coquière, David; de la Lande, Aurélien; Martí, Sergio; Parisel, Olivier; Prangé, Thierry; Reinaud, Olivia
2009-01-01
A multipoint recognition system based on a calix[6]arene is described. The calixarene core is decorated on alternating aromatic subunits by 3 imidazole arms at the small rim and 3 aniline groups at the large rim. This substitution pattern projects the aniline nitrogens toward each other when Zn(II) binds at the Tris-imidazole site or when a proton binds at an aniline. The XRD structure of the monoprotonated complex having an acetonitrile molecule bound to Zn(II) in the cavity revealed a constrained geometry at the metal center reminiscent of an entatic state. Computer modeling suggests that the aniline groups behave as a tritopic monobasic site in which only 1 aniline unit is protonated and interacts with the other 2 through strong hydrogen bonding. The metal complex selectively binds a monoprotonated diamine vs. a monoamine through multipoint recognition: coordination to the metal ion at the small rim, hydrogen bonding to the calix-oxygen core, CH/π interaction within the cavity's aromatic walls, and H-bonding to the anilines at the large rim. PMID:19237564
NASA Astrophysics Data System (ADS)
Rupp, Bernd; Raub, Stephan; Marian, Christel; Höltje, Hans-Dieter
2005-03-01
Sterol 14α-demethylase (CYP51) is one of the known major targets for azole antifungals. Therapeutic side effects of these antifungals are based on interactions of the azoles with the human analogue enzyme. This study describes for the first time a comparison of a human CYP51 (HU-CYP51) homology model with a homology model of the fungal CYP51 of Candida albicans (CA-CYP51). Both models are constructed by using the crystal structure of Mycobacterium tuberculosis MT-CYP51 (PDB code: 1EA1). The binding mode of the azole ketoconazole is investigated in molecular dynamics simulations with the GROMACS force field. The usage of special parameters for the iron azole complex binding is necessary to obtain the correct complex geometry in the active site of the enzyme models. Based on the dynamics simulations it is possible to explain the enantioselectivity of the human enzyme and also to predict the binding mode of the isomers of ketoconazole in the active site of the fungal model.
Arakawa, H; Neault, J F; Tajmir-Riahi, H A
2001-01-01
Ag(I) is a strong nucleic acids binder and forms several complexes with DNA such as types I, II, and III. However, the details of the binding mode of silver(I) in the Ag-polynucleotides remains unknown. Therefore, it was of interest to examine the binding of Ag(I) with calf-thymus DNA and bakers yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentration of DNA or RNA and various concentrations of Ag(I). Fourier transform infrared spectroscopy and capillary electrophoresis were used to analyze the Ag(I) binding mode, the binding constant, and the polynucleotides' structural changes in the Ag-DNA and Ag-RNA complexes. The spectroscopic results showed that in the type I complex formed with DNA, Ag(I) binds to guanine N7 at low cation concentration (r = 1/80) and adenine N7 site at higher concentrations (r = 1/20 to 1/10), but not to the backbone phosphate group. At r = 1/2, type II complexes formed with DNA in which Ag(I) binds to the G-C and A-T base pairs. On the other hand, Ag(I) binds to the guanine N7 atom but not to the adenine and the backbone phosphate group in the Ag-RNA complexes. Although a minor alteration of the sugar-phosphate geometry was observed, DNA remained in the B-family structure, whereas RNA retained its A conformation. Scatchard analysis following capillary electrophoresis showed two binding sites for the Ag-DNA complexes with K(1) = 8.3 x 10(4) M(-1) for the guanine and K(2) = 1.5 x 10(4) M(-1) for the adenine bases. On the other hand, Ag-RNA adducts showed one binding site with K = 1.5 x 10(5) M(-1) for the guanine bases. PMID:11509371
Active-site monovalent cations revealed in a 1.55-Å-resolution hammerhead ribozyme structure.
Anderson, Michael; Schultz, Eric P; Martick, Monika; Scott, William G
2013-10-23
We have obtained a 1.55-Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni under conditions that permit detailed observations of Na(+) ion binding in the ribozyme's active site. At least two such Na(+) ions are observed. The first Na(+) ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical with that previously observed for divalent cations. A second Na(+) ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with that of previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na(+), but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na(+) directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active-site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest-resolution ribozyme structure in the Protein Data Bank. Copyright © 2013 Elsevier Ltd. All rights reserved.
Tsivion, Ehud; Mason, Jarad A.; Gonzalez, Miguel. I.; ...
2016-03-29
In order to store natural gas (NG) inexpensively at adequate densities for use as a fuel in the transportation sector, new porous materials are being developed. Our work uses computational methods to explore strategies for improving the usable methane storage capacity of adsorbents, including metal-organic frameworks (MOFs), that feature open-metal sites incorporated into their structure by postsynthetic modification. The adsorption of CH 4 on several open-metal sites is studied by calculating geometries and adsorption energies and analyzing the relevant interaction factors. Approximate site-specific adsorption isotherms are obtained, and the open-metal site contribution to the overall CH 4 usable capacity ismore » evaluated. It is found that sufficient ionic character is required, as exemplified by the strong CH 4 affinities of 2,2'-bipyridine-CaCl 2 and Mg, Ca-catecholate. In addition, it is found that the capacity of a single metal site depends not only on its affinity but also on its geometry, where trigonal or "bent" low-coordinate exposed sites can accommodate three or four methane molecules, as exemplified by Ca-decorated nitrilotriacetic acid. The effect of residual solvent molecules at the open-metal site is also explored, with some positive conclusions. Not only can residual solvent stabilize the open-metal site, surprisingly, solvent molecules do not necessarily reduce CH 4 affinity, but can contribute to increased usable capacity by modifying adsorption interactions.« less
Tlatli, Rym; Nozach, Hervé; Collet, Guillaume; Beau, Fabrice; Vera, Laura; Stura, Enrico; Dive, Vincent; Cuniasse, Philippe
2013-01-01
Artificial miniproteins that are able to target catalytic sites of matrix metalloproteinases (MMPs) were designed using a functional motif-grafting approach. The motif corresponded to the four N-terminal residues of TIMP-2, a broad-spectrum protein inhibitor of MMPs. Scaffolds that are able to reproduce the functional topology of this motif were obtained by exhaustive screening of the Protein Data Bank (PDB) using STAMPS software (search for three-dimensional atom motifs in protein structures). Ten artificial protein binders were produced. The designed proteins bind catalytic sites of MMPs with affinities ranging from 450 nm to 450 μm prior to optimization. The crystal structure of one artificial binder in complex with the catalytic domain of MMP-12 showed that the inter-molecular interactions established by the functional motif in the artificial binder corresponded to those found in the MMP-14-TIMP-2 complex, albeit with some differences in geometry. Molecular dynamics simulations of the ten binders in complex with MMP-14 suggested that these scaffolds may allow partial reproduction of native inter-molecular interactions, but differences in geometry and stability may contribute to the lower affinity of the artificial protein binders compared to the natural protein binder. Nevertheless, these results show that the in silico design method used provides sets of protein binders that target a specific binding site with a good rate of success. This approach may constitute the first step of an efficient hybrid computational/experimental approach to protein binder design. © 2012 The Authors Journal compilation © 2012 FEBS.
Solution NMR structure of a designed metalloprotein and complementary molecular dynamics refinement.
Calhoun, Jennifer R; Liu, Weixia; Spiegel, Katrin; Dal Peraro, Matteo; Klein, Michael L; Valentine, Kathleen G; Wand, A Joshua; DeGrado, William F
2008-02-01
We report the solution NMR structure of a designed dimetal-binding protein, di-Zn(II) DFsc, along with a secondary refinement step employing molecular dynamics techniques. Calculation of the initial NMR structural ensemble by standard methods led to distortions in the metal-ligand geometries at the active site. Unrestrained molecular dynamics using a nonbonded force field for the metal shell, followed by quantum mechanical/molecular mechanical dynamics of DFsc, were used to relax local frustrations at the dimetal site that were apparent in the initial NMR structure and provide a more realistic description of the structure. The MD model is consistent with NMR restraints, and in good agreement with the structural and functional properties expected for DF proteins. This work demonstrates that NMR structures of metalloproteins can be further refined using classical and first-principles molecular dynamics methods in the presence of explicit solvent to provide otherwise unavailable insight into the geometry of the metal center.
2010-01-01
Escherichia coli NikR regulates cellular nickel uptake by binding to the nik operon in the presence of nickel and blocking transcription of genes encoding the nickel uptake transporter. NikR has two binding affinities for the nik operon: a nanomolar dissociation constant with stoichiometric nickel and a picomolar dissociation constant with excess nickel [Bloom, S. L., and Zamble, D. B. (2004) Biochemistry 43, 10029−10038; Chivers, P. T., and Sauer, R. T. (2002) Chem. Biol. 9, 1141−1148]. While it is known that the stoichiometric nickel ions bind at the NikR tetrameric interface [Schreiter, E. R., et al. (2003) Nat. Struct. Biol. 10, 794−799; Schreiter, E. R., et al. (2006) Proc. Natl. Acad. Sci. U.S.A. 103, 13676−13681], the binding sites for excess nickel ions have not been fully described. Here we have determined the crystal structure of NikR in the presence of excess nickel to 2.6 Å resolution and have obtained nickel anomalous data (1.4845 Å) in the presence of excess nickel for both NikR alone and NikR cocrystallized with a 30-nucleotide piece of double-stranded DNA containing the nik operon. These anomalous data show that excess nickel ions do not bind to a single location on NikR but instead reveal a total of 22 possible low-affinity nickel sites on the NikR tetramer. These sites, for which there are six different types, are all on the surface of NikR, and most are found in both the NikR alone and NikR−DNA structures. Using a combination of crystallographic data and molecular dynamics simulations, the nickel sites can be described as preferring octahedral geometry, utilizing one to three protein ligands (typically histidine) and at least two water molecules. PMID:20704276
Whispering Gallery Mode Resonators for Rapid Label-Free Biosensing in Small Volume Droplets
Wildgen, Sarah M.; Dunn, Robert C.
2015-01-01
Rapid biosensing requires fast mass transport of the analyte to the surface of the sensing element. To optimize analysis times, both mass transport in solution and the geometry and size of the sensing element need to be considered. Small dielectric spheres, tens of microns in diameter, can act as label-free biosensors using whispering gallery mode (WGM) resonances. WGM resonances are sensitive to the effective refractive index, which changes upon analyte binding to recognition sites on functionalized resonators. The spherical geometry and tens of microns diameter of these resonators provides an efficient target for sensing while their compact size enables detection in limited volumes. Here, we explore conditions leading to rapid analyte detection using WGM resonators as label-free sensors in 10 μL sample droplets. Droplet evaporation leads to potentially useful convective mixing, but also limits the time over which analysis can be completed. We show that active droplet mixing combined with initial binding rate measurements is required for accurate nanomolar protein quantification within the first minute following injection. PMID:25806835
New insights into the molecular characteristics behind the function of Renilla luciferase.
Fanaei-Kahrani, Zahra; Ganjalikhany, Mohamad Reza; Rasa, Seyed Mohammad Mahdi; Emamzadeh, Rahman
2018-02-01
Renilla Luciferase (RLuc) is a blue light emitter protein which can be applied as a valuable tool in medical diagnosis. But due to lack of the crystal structure of RLuc-ligand complex, the functional motions and catalytic mechanism of this enzyme remain largely unknown. In the present study, the active site properties and the ligand-receptor interactions of the native RLuc and its red-shifted light emitting variant (Super RLuc 8) were investigated using molecular docking approach, molecular dynamics (MD) analysis, and MM-PBSA method. The detailed analysis of the main clusters led to identifying a lid-like structure and its functional motions. Furthermore, an induced-fit mechanism is proposed where ligand-binding induces conformational changes of the active site. Our findings give an insight into the deeper understanding of RLuc conformational changes during binding steps and ligand-receptor pattern. Moreover, our work broaden our understanding of how active site geometry is adjusted to support the catalytic activity and red-shifted light emission in Super RLuc 8. © 2017 Wiley Periodicals, Inc.
Adsorption of lactic acid on chiral Pt surfaces—A density functional theory study
NASA Astrophysics Data System (ADS)
Franke, J.-H.; Kosov, D. S.
2013-02-01
The adsorption of the chiral molecule lactic acid on chiral Pt surfaces is studied by density functional theory calculations. First, we study the adsorption of L-lactic acid on the flat Pt(111) surface. Using the optimed PBE - van der Waals (oPBE-vdW) functional, which includes van der Waals forces on an ab initio level, it is shown that the molecule has two binding sites, a carboxyl and the hydroxyl oxygen atoms. Since real chiral surfaces are (i) known to undergo thermal roughening that alters the distribution of kinks and step edges but not the overall chirality and (ii) kink sites and edge sites are usually the energetically most favored adsorption sites, we focus on two surfaces that allow qualitative sampling of the most probable adsorption sites. We hereby consider chiral surfaces exhibiting (111) facets, in particular, Pt(321) and Pt(643). The binding sites are either both on kink sites—which is the case for Pt(321) or on one kink site—as on Pt(643). The binding energy of the molecule on the chiral surfaces is much higher than on the Pt(111) surface. We show that the carboxyl group interacts more strongly than the hydroxyl group with the kink sites. The results indicate the possible existence of very small chiral selectivities of the order of 20 meV for the Pt(321) and Pt(643) surfaces. L-lactic acid is more stable on Pt(321)S than D-lactic acid, while the chiral selectivity is inverted on Pt(643)S. The most stable adsorption configurations of L- and D-lactic acid are similar for Pt(321) but differ for Pt(643). We explore the impact of the different adsorption geometries on the work function, which is important for field ion microscopy.
Cheng, Cheng; Kamiya, Motoshi; Uchida, Yoshihiro; Hayashi, Shigehiko
2015-10-21
Color variants of human cellular retinol binding protein II (hCRBPII) created by protein engineering were recently shown to exhibit anomalously wide photoabsorption spectral shifts over ∼200 nm across the visible region. The remarkable phenomenon provides a unique opportunity to gain insight into the molecular basis of the color tuning of retinal binding proteins for understanding of color vision as well as for engineering of novel color variants of retinal binding photoreceptor proteins employed in optogenetics. Here, we report a theoretical investigation of the molecular mechanism underlying the anomalously wide spectral shifts of the color variants of hCRBPII. Computational modeling of the color variants with hybrid molecular simulations of free energy geometry optimization succeeded in reproducing the experimentally observed wide spectral shifts, and revealed that protein flexibility, through which the active site structure of the protein and bound water molecules is altered by remote mutations, plays a significant role in inducing the large spectral shifts.
Dudev, Todor; Lin, Yen-lin; Dudev, Minko; Lim, Carmay
2003-03-12
The role of the second shell in the process of metal binding and selectivity in metalloproteins has been elucidated by combining Protein Data Bank (PDB) surveys of Mg, Mn, Ca, and Zn binding sites with density functional theory/continuum dielectric methods (DFT/CDM). Peptide backbone groups were found to be the most common second-shell ligand in Mg, Mn, Ca, and Zn binding sites, followed (in decreasing order) by Asp/Glu, Lys/Arg, Asn/Gln, and Ser/Thr side chains. Aromatic oxygen- or nitrogen-containing side chains (Tyr, His, and Trp) and sulfur-containing side chains (Cys and Met) are seldom found in the second coordination layer. The backbone and Asn/Gln side chain are ubiquitous in the metal second coordination layer as their carbonyl oxygen and amide hydrogen can act as a hydrogen-bond acceptor and donor, respectively, and can therefore partner practically every first-shell ligand. The second most common outer-shell ligand, Asp/Glu, predominantly hydrogen bonds to a metal-bound water or Zn-bound histidine and polarizes the H-O or H-N bond. In certain cases, a second-shell Asp/Glu could affect the protonation state of the metal ligand. It could also energetically stabilize a positively charged metal complex more than a neutral ligand such as the backbone and Asn/Gln side chain. As for the first shell, the second shell is predicted to contribute to the metal selectivity of the binding site by discriminating between metal cations of different ionic radii and coordination geometries. The first-shell-second-shell interaction energies decay rapidly with increasing solvent exposure of the metal binding site. They are less favorable but are of the same order of magnitude as compared to the respective metal-first-shell interaction energies. Altogether, the results indicate that the structure and properties of the second shell are dictated by those of the first layer. The outer shell is apparently designed to stabilize/protect the inner-shell and complement/enhance its properties.
NASA Astrophysics Data System (ADS)
Madhan, B.; Thanikaivelan, P.; Subramanian, V.; Raghava Rao, J.; Unni Nair, Balachandran; Ramasami, T.
2001-10-01
Molecular modelling approaches have been used to understand the interaction of collagen-like peptides with gallic acid, which mimic vegetable tanning processes involved in protein stabilization. Several interaction sites have been identified and the binding energies of the complexes have been calculated. The calculated binding energies for various geometries are in the range 6-13 kcal/mol. It is found that some complexes exhibit hydrogen bonding, and electrostatic interaction plays a dominant role in the stabilization of the peptide by gallic acid. The π-OH type of interaction is also observed in the peptide stabilization. Molecular dynamics (MD) simulation for 600 ps revealed the possibility of hydrogen bonding between the collagen-like peptide and gallic acid.
Impact of copper ligand mutations on a cupredoxin with a green copper center.
Roger, Magali; Sciara, Giuliano; Biaso, Frédéric; Lojou, Elisabeth; Wang, Xie; Bauzan, Marielle; Giudici-Orticoni, Marie-Thérèse; Vila, Alejandro J; Ilbert, Marianne
2017-05-01
Mononuclear cupredoxins contain a type 1 copper center with a trigonal or tetragonal geometry usually maintained by four ligands, a cystein, two histidines and a methionine. The recent discovery of new members of this family with unusual properties demonstrates, however, the versatility of this class of proteins. Changes in their ligand set lead to drastic variation in their metal site geometry and in the resulting spectroscopic and redox features. In our work, we report the identification of the copper ligands in the recently discovered cupredoxin AcoP. We show that even though AcoP possesses a classical copper ligand set, it has a highly perturbed copper center. In depth studies of mutant's properties suggest a high degree of constraint existing in the copper center of the wild type protein and even the addition of exogenous ligands does not lead to the reconstitution of the initial copper center. Not only the chemical nature of the axial ligand but also constraints brought by its covalent binding to the protein backbone might be critical to maintain a green copper site with high redox potential. This work illustrates the importance of experimentally dissecting the molecular diversity of cupredoxins to determine the molecular determinants responsible for their copper center geometry and redox potential. Copyright © 2017 Elsevier B.V. All rights reserved.
Catalytic mechanism of a retinoid isomerase essential for vertebrate vision
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen
Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive because of uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for the treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligandmore » positioned in an adjacent pocket. With the geometry of the RPE65–substrate complex clarified, we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. Finally, these data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules.« less
Catalytic mechanism of a retinoid isomerase essential for vertebrate vision
Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen; ...
2015-04-20
Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive because of uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for the treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligandmore » positioned in an adjacent pocket. With the geometry of the RPE65–substrate complex clarified, we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. Finally, these data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules.« less
Catalytic mechanism of a retinoid isomerase essential for vertebrate vision
Kiser, Philip D.; Zhang, Jianye; Badiee, Mohsen; Li, Qingjiang; Shi, Wuxian; Sui, Xuewu; Golczak, Marcin; Tochtrop, Gregory P.; Palczewski, Krzysztof
2015-01-01
Visual function in vertebrates is dependent on the membrane-bound retinoid isomerase, RPE65, an essential component of the retinoid cycle pathway that regenerates 11-cis-retinal for rod and cone opsins. The mechanism by which RPE65 catalyzes stereoselective retinoid isomerization has remained elusive due to uncertainty about how retinoids bind to its active site. Here we present crystal structures of RPE65 in complex with retinoid-mimetic compounds, one of which is in clinical trials for treatment of age-related macular degeneration. The structures reveal the active site retinoid-binding cavity located near the membrane-interacting surface of the enzyme as well as an Fe-bound palmitate ligand positioned in an adjacent pocket. With the geometry of the RPE65-substrate complex clarified we delineate a mechanism of catalysis that reconciles the extensive biochemical and structural research on this enzyme. These data provide molecular foundations for understanding a key process in vision and pharmacological inhibition of RPE65 with small molecules. PMID:25894083
Dowling, Daniel P; Gantt, Stephanie L; Gattis, Samuel G; Fierke, Carol A; Christianson, David W
2008-12-23
Metal-dependent histone deacetylases (HDACs) require Zn(2+) or Fe(2+) to regulate the acetylation of lysine residues in histones and other proteins in eukaryotic cells. Isozyme HDAC8 is perhaps the archetypical member of the class I HDAC family and serves as a paradigm for studying structure-function relationships. Here, we report the structures of HDAC8 complexes with trichostatin A and 3-(1-methyl-4-phenylacetyl-1H-2-pyrrolyl)-N-hydroxy-2-propenamide (APHA) in a new crystal form. The structure of the APHA complex reveals that the hydroxamate CO group accepts a hydrogen bond from Y306 but does not coordinate to Zn(2+) with favorable geometry, perhaps due to the constraints of its extended pi system. Additionally, since APHA binds to only two of the three protein molecules in the asymmetric unit of this complex, the structure of the third monomer represents the first structure of HDAC8 in the unliganded state. Comparison of unliganded and liganded structures illustrates ligand-induced conformational changes in the L2 loop that likely accompany substrate binding and catalysis. Furthermore, these structures, along with those of the D101N, D101E, D101A, and D101L variants, support the proposal that D101 is critical for the function of the L2 loop. However, amino acid substitutions for D101 can also trigger conformational changes of Y111 and W141 that perturb the substrate binding site. Finally, the structure of H143A HDAC8 complexed with an intact acetylated tetrapeptide substrate molecule confirms the importance of D101 for substrate binding and reveals how Y306 and the active site zinc ion together bind and activate the scissile amide linkage of acetyllysine.
Li, Zhimin; Liu, Zhengang; Cho, Dae Won; Zou, Jiwen; Gong, Maozhen; Breece, Robert M.; Galkin, Andrey; Li, Ling; Zhao, Hong; Maestas, Gabriel D.; Tierney, David L.; Herzberg, Osnat; Dunaway-Mariano, Debra; Mariano, Patrick S.
2011-01-01
Inhibitors of the Giardia lamblia fructose 1,6-bisphosphate aldolase (GlFBPA), which transforms fructose 1,6-bisphosphate (FBP) to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, were designed based on 3-hydroxy-2-pyridone and 1,2-dihydroxypyridine scaffolds that position two negatively charged tetrahedral groups for interaction with substrate phosphate binding residues, a hydrogen bond donor to the catalytic Asp83, and a Zn2+ binding group. The inhibition activities for the GlFBPA catalyzed reaction of FBP of the prepared alkyl phosphonate/phosphate substituted 3-hydroxy-2-pyridinones and a dihydroxypyridine were determined. The 3-hydroxy-2-pyridone inhibitor 8 was found to bind to GlFBPA with an affinity (Ki = 14 μM) that is comparable to that of FBP (Km = 2 μM) or its inert analog TBP (Ki = 1 μM). The X-ray structure of the GlFBPA-inhibitor 8 complex (2.3 Å) shows that 8 binds to the active site in the manner predicted by in silico docking with the exception of coordination with Zn2+. The observed distances and orientation of the pyridone ring O=C-C-OH relative to Zn2+ are not consistent with a strong interaction. To determine if Zn2+coordination occurs in the GlFBPA-inhibitor 8 complex in solution, EXAFS spectra were measured. A four coordinate geometry comprised of the three enzyme histidine ligands and an oxygen atom from the pyridone ring O=C-C-OH was indicated. Analysis of the Zn2+ coordination geometries in recently reported structures of class II FBPAs suggests that strong Zn2+ coordination is reserved for the enediolate-like transition state, accounting for minimal contribution of Zn2+ coordination to binding of 8 to GlFBPA. PMID:21333622
Strontium and barium in aqueous solution and a potassium channel binding site
NASA Astrophysics Data System (ADS)
Chaudhari, Mangesh I.; Rempe, Susan B.
2018-06-01
Ion hydration structure and free energy establish criteria for understanding selective ion binding in potassium (K+) ion channels and may be significant to understanding blocking mechanisms as well. Recently, we investigated the hydration properties of Ba2+, the most potent blocker of K+ channels among the simple metal ions. Here, we use a similar method of combining ab initio molecular dynamics simulations, statistical mechanical theory, and electronic structure calculations to probe the fundamental hydration properties of Sr2+, which does not block bacterial K+ channels. The radial distribution of water around Sr2+ suggests a stable 8-fold geometry in the local hydration environment, similar to Ba2+. While the predicted hydration free energy of -331.8 kcal/mol is comparable with the experimental result of -334 kcal/mol, the value is significantly more favorable than the -305 kcal/mol hydration free energy of Ba2+. When placed in the innermost K+ channel blocking site, the solvation free energies and lowest energy structures of both Sr2+ and Ba2+ are nearly unchanged compared with their respective hydration properties. This result suggests that the block is not attributable to ion trapping due to +2 charge, and differences in blocking behavior arise due to free energies associated with the exchange of water ligands for channel ligands instead of free energies of transfer from water to the binding site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jimenez-Orozco, Carlos; Florez, Elizabeth; Moreno, Andres
A systematic study of ethylene adsorption over δ-MoC(001), TiC(001), and ZrC(001) surfaces was conducted by means of calculations based on periodic density functional theory. The structure and electronic properties of each carbide pristine surface had a strong influence in the bonding of ethylene. It was found that the metal and carbon sites of the carbide could participate in the adsorption process. As a consequence of this, very different bonding mechanisms were seen on δ-MoC(001) and TiC(001). The bonding of the molecule on the TMC(001) systems showed only minor similarities to the type of bonding found on a typical metal likemore » Pt(111). In general, the ethylene binding energy follow the trend in stability: ZrC(001) < TiC(001) < δ-MoC(001) < Pt(111). The van der Waals correction to the energy produces large binding energy values, modifies the stability orders and drives the ethylene closer to the surface but the adsorbate geometry parameters remain unchanged. Ethylene was activated on clearly defined binding geometries, changing its hybridization from sp 2 to sp 3 with an elongation (0.16–0.31 Å) of the C=C bond. As a result, on the basis of this theoretical study, δ-MoC(001) is proposed as a potential catalyst for the hydrogenation of olefins, whereas TiC(001) could be useful for their hydrogenolysis.« less
Cang, Zixuan; Wei, Guo-Wei
2018-02-01
Protein-ligand binding is a fundamental biological process that is paramount to many other biological processes, such as signal transduction, metabolic pathways, enzyme construction, cell secretion, and gene expression. Accurate prediction of protein-ligand binding affinities is vital to rational drug design and the understanding of protein-ligand binding and binding induced function. Existing binding affinity prediction methods are inundated with geometric detail and involve excessively high dimensions, which undermines their predictive power for massive binding data. Topology provides the ultimate level of abstraction and thus incurs too much reduction in geometric information. Persistent homology embeds geometric information into topological invariants and bridges the gap between complex geometry and abstract topology. However, it oversimplifies biological information. This work introduces element specific persistent homology (ESPH) or multicomponent persistent homology to retain crucial biological information during topological simplification. The combination of ESPH and machine learning gives rise to a powerful paradigm for macromolecular analysis. Tests on 2 large data sets indicate that the proposed topology-based machine-learning paradigm outperforms other existing methods in protein-ligand binding affinity predictions. ESPH reveals protein-ligand binding mechanism that can not be attained from other conventional techniques. The present approach reveals that protein-ligand hydrophobic interactions are extended to 40Å away from the binding site, which has a significant ramification to drug and protein design. Copyright © 2017 John Wiley & Sons, Ltd.
NASA Astrophysics Data System (ADS)
Kalescky, Robert; Kraka, Elfi; Cremer, Dieter
2014-02-01
The formic acid dimer in its C2h-symmetrical cyclic form is stabilized by two equivalent H-bonds. The currently accepted interaction energy is 18.75 kcal/mol whereas the experimental binding energy D0 value is only 14.22 ±0.12 kcal/mol [F. Kollipost, R. W. Larsen, A. V. Domanskaya, M. Nörenberg, and M. A. Suhm, J. Chem. Phys. 136, 151101 (2012)]. Calculation of the binding energies De and D0 at the CCSD(T) (Coupled Cluster with Single and Double excitations and perturbative Triple excitations)/CBS (Complete Basis Set) level of theory, utilizing CCSD(T)/CBS geometries and the frequencies of the dimer and monomer, reveals that there is a 3.2 kcal/mol difference between interaction energy and binding energy De, which results from (i) not relaxing the geometry of the monomers upon dissociation of the dimer and (ii) approximating CCSD(T) correlation effects with MP2. The most accurate CCSD(T)/CBS values obtained in this work are De = 15.55 and D0 = 14.32 kcal/mol where the latter binding energy differs from the experimental value by 0.1 kcal/mol. The necessity of employing augmented VQZ and VPZ calculations and relaxing monomer geometries of H-bonded complexes upon dissociation to obtain reliable binding energies is emphasized.
DJ-1 Is a Copper Chaperone Acting on SOD1 Activation*
Girotto, Stefania; Cendron, Laura; Bisaglia, Marco; Tessari, Isabella; Mammi, Stefano; Zanotti, Giuseppe; Bubacco, Luigi
2014-01-01
Lack of oxidative stress control is a common and often prime feature observed in many neurodegenerative diseases. Both DJ-1 and SOD1, proteins involved in familial Parkinson disease and amyotrophic lateral sclerosis, respectively, play a protective role against oxidative stress. Impaired activity and modified expression of both proteins have been observed in different neurodegenerative diseases. A potential cooperative action of DJ-1 and SOD1 in the same oxidative stress response pathway may be suggested based on a copper-mediated interaction between the two proteins reported here. To investigate the mechanisms underlying the antioxidative function of DJ-1 in relation to SOD1 activity, we investigated the ability of DJ-1 to bind copper ions. We structurally characterized a novel copper binding site involving Cys-106, and we investigated, using different techniques, the kinetics of DJ-1 binding to copper ions. The copper transfer between the two proteins was also examined using both fluorescence spectroscopy and specific biochemical assays for SOD1 activity. The structural and functional analysis of the novel DJ-1 copper binding site led us to identify a putative role for DJ-1 as a copper chaperone. Alteration of the coordination geometry of the copper ion in DJ-1 may be correlated to the physiological role of the protein, to a potential failure in metal transfer to SOD1, and to successive implications in neurodegenerative etiopathogenesis. PMID:24567322
Liu, Huiping; Zhu, Yanyun; Yang, Xiaorong; Lin, Ying
2018-05-01
The multicopper oxidases catalyze 1-electron oxidation of four substrate molecules and concomitantly 4-electron reduction of dioxygen to water. The substrate loses the electrons at the type 1 copper (T1 Cu) site of the enzyme, while the dioxygen is reduced to water at the trinuclear copper center. A highly conserved Glu residue, which is at the dioxygen-entering channel, shuttles the proton to break the O-O bond of dioxygen. At the water-leaving channel, an Asp residue was found to be important in the protonation mechanism. In this study, laccase from Thermus thermophilus SG0.5JP17-16 (lacTT) was investigated to address how four second-sphere residues E356, E456, D106, and D423 affect the activity of the enzyme. Kinetic data indicate that catalytic activities of the enzyme are altered by site-directed mutagenesis on four second-sphere residues. The structural model of lacTT was generated by homology modeling. Structural and spectral data indicate that the E356 residue is situated at the substrate-binding site, responsible for the binding of the substrate and the geometry of the T1 Cu site by hydrogen-bonding networks; the E456 residue, located at the dioxygen-entering channel, plays a critical role in stabilizing the structure of all active copper centers and shuttling the proton to the trinuclear copper cluster (TNC) for the reductive reaction of dioxygen; the D106 and D423 residues are at the water-leaving channel, and they are important for the essential geometry of the TNC and the release of the water molecules. Altogether, this study contributes to the further understanding of the basic mechanism involving the oxidation of the substrate, electron transfer, and the reduction of dioxygen in lacTT.
DNA Knots: Theory and Experiments
NASA Astrophysics Data System (ADS)
Sumners, D. W.
Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.
Zhang, Fan; Ma, Wei; Jiao, Yang; Wang, Jingchuan; Shan, Xinyan; Li, Hui; Lu, Xinghua; Meng, Sheng
2014-12-24
Adsorption geometry of dye molecules on nanocrystalline TiO2 plays a central role in dye-sensitized solar cells, enabling effective sunlight absorption, fast electron injection, optimized interface band offsets, and stable photovoltaic performance. However, precise determination of dye binding geometry and proportion has been challenging due to complexity and sensitivity at interfaces. Here employing combined vibrational spectrometry and density functional calculations, we identify typical adsorption configurations of widely adopted cyanoacrylic donor-π bridge-acceptor dyes on nanocrystalline TiO2. Binding mode switching from bidentate bridging to hydrogen-bonded monodentate configuration with Ti-N bonding has been observed when dye-sensitizing solution becomes more basic. Raman and infrared spectroscopy measurements confirm this configuration switch and determine quantitatively the proportion of competing binding geometries, with vibration peaks assigned using density functional theory calculations. We further found that the proportion of dye-binding configurations can be manipulated by adjusting pH value of dye-sensitizing solutions. Controlling molecular adsorption density and configurations led to enhanced energy conversion efficiency from 2.4% to 6.1% for the fabricated dye-sensitized solar cells, providing a simple method to improve photovoltaic performance by suppressing unfavorable binding configurations in solar cell applications.
NASA Astrophysics Data System (ADS)
Mori, Toshifumi; Kato, Shigeki
2007-03-01
We present a method to evaluate the analytical gradient of reference interaction site model Møller-Plesset second order free energy with respect to solute nuclear coordinates. It is applied to calculate the geometries and energies in the equilibria of the Grignard reagent (CH 3MgCl) in dimethylether solvent. The Mg-Mg and Mg-Cl distances as well as the binding energies of solvents are largely affected by the dynamical electron correlation. The solvent effect on the Schlenk equilibrium is examined.
Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A
2017-07-05
Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.
Ohta, Takehiro; Chakrabarty, Sarmistha; Lipscomb, John D; Solomon, Edward I
2008-02-06
Near-IR MCD and variable temperature, variable field (VTVH) MCD have been applied to naphthalene 1,2-dioxygenase (NDO) to describe the coordination geometry and electronic structure of the mononuclear nonheme ferrous catalytic site in the resting and substrate-bound forms with the Rieske 2Fe2S cluster oxidized and reduced. The structural results are correlated with the crystallographic studies of NDO and other related Rieske nonheme iron oxygenases to develop molecular level insights into the structure/function correlation for this class of enzymes. The MCD data for resting NDO with the Rieske center oxidized indicate the presence of a six-coordinate high-spin ferrous site with a weak axial ligand which becomes more tightly coordinated when the Rieske center is reduced. Binding of naphthalene to resting NDO (Rieske oxidized and reduced) converts the six-coordinate sites into five-coordinate (5c) sites with elimination of a water ligand. In the Rieske oxidized form the 5c sites are square pyramidal but transform to a 1:2 mixture of trigonal bipyramial/square pyramidal sites when the Rieske center is reduced. Thus the geometric and electronic structure of the catalytic site in the presence of substrate can be significantly affected by the redox state of the Rieske center. The catalytic ferrous site is primed for the O2 reaction when substrate is bound in the active site in the presence of the reduced Rieske site. These structural changes ensure that two electrons and the substrate are present before the binding and activation of O2, which avoids the uncontrolled formation and release of reactive oxygen species.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.
DNA apurinic-apyrimidinic (AP) sites are prevalent noncoding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA-repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive, owing in part to limited structural information. Here we report multiple high-resolution human APE1-DNA structures that divulge new features of the APE1 reaction, including the metal-binding site, the nucleophile and the arginine clamps that mediate product release. We also report APE1-DNA structures with a T-G mismatch 5' to the AP site, representing a clustered lesion occurring in methylatedmore » CpG dinucleotides. Moreover, these structures reveal that APE1 molds the T-G mismatch into a unique Watson-Crick-like geometry that distorts the active site, thus reducing incision. Finally, these snapshots provide mechanistic clarity for APE1 while affording a rational framework to manipulate biological responses to DNA damage.« less
Capturing Snapshots of APE1 Processing DNA Damage
Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.; Dyrkheeva, Nadezhda S.; Wilson, Samuel H.
2015-01-01
DNA apurinic-apyrimidinic (AP) sites are prevalent non-coding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive due in part to limited structural information. We report multiple high-resolution human APE1:DNA structures that divulge novel features of the APE1 reaction, including the metal binding site, nucleophile, and arginine clamps that mediate product release. We also report APE1:DNA structures with a T:G mismatch 5′ to the AP-site, representing a clustered lesion occurring in methylated CpG dinucleotides. These reveal that APE1 molds the T:G mismatch into a unique Watson-Crick like geometry that distorts the active site reducing incision. These snapshots provide mechanistic clarity for APE1, while affording a rational framework to manipulate biological responses to DNA damage. PMID:26458045
Capturing snapshots of APE1 processing DNA damage
Freudenthal, Bret D.; Beard, William A.; Cuneo, Matthew J.; ...
2015-10-12
DNA apurinic-apyrimidinic (AP) sites are prevalent noncoding threats to genomic stability and are processed by AP endonuclease 1 (APE1). APE1 incises the AP-site phosphodiester backbone, generating a DNA-repair intermediate that is potentially cytotoxic. The molecular events of the incision reaction remain elusive, owing in part to limited structural information. Here we report multiple high-resolution human APE1-DNA structures that divulge new features of the APE1 reaction, including the metal-binding site, the nucleophile and the arginine clamps that mediate product release. We also report APE1-DNA structures with a T-G mismatch 5' to the AP site, representing a clustered lesion occurring in methylatedmore » CpG dinucleotides. Moreover, these structures reveal that APE1 molds the T-G mismatch into a unique Watson-Crick-like geometry that distorts the active site, thus reducing incision. Finally, these snapshots provide mechanistic clarity for APE1 while affording a rational framework to manipulate biological responses to DNA damage.« less
Keitel, T; Meldgaard, M; Heinemann, U
1994-05-15
The hybrid Bacillus (1,3-1,4)-beta-glucanase H(A16-M), consisting of 16 N-terminal amino acids derived from the mature form of the B. amyloliquefaciens enzyme and of 198 C-proximal amino acids from the B. macerans enzyme, binds a calcium ion at a site at its molecular surface remote from the active center [T. Keitel, O. Simon, R. Borriss & U. Heinemann (1993) Proc. Natl Acad. Sci. USA 90, 5287-5291]. X-ray diffraction analysis at 0.22-nm resolution of crystals grown in the absence of calcium and in the presence of EDTA shows this site to be occupied by a sodium ion. Whereas the calcium ion has six oxygen atoms in its coordination sphere, two of which are from water molecules, sodium is fivefold coordinated with a fifth ligand belonging to a symmetry-related protein molecule in the crystal lattice. The affinity of H(A16-M) for calcium over sodium has been determined calorimetrically. Calcium binding stabilizes the native three-dimensional structure of the protein as shown by guanidinium chloride unfolding and thermal inactivation experiments. The enhanced enzymic activity of Bacillus beta-glucanases at elevated temperatures in the presence of calcium ions is attributed to a general stabilizing effect by the cation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Streltsov, Victor A.; Titmuss, Stephen J.; Epa, V. Chandana
Neurodegeneration observed in Alzheimer disease (AD) is believed to be related to the toxicity from reactive oxygen species (ROS) produced in the brain by the amyloid-{beta} (A{beta}) protein bound primarily to copper ions. The evidence for an oxidative stress role of A{beta}-Cu redox chemistry is still incomplete. Details of the copper binding site in A{beta} may be critical to the etiology of AD. Here we present the structure determined by combining x-ray absorption spectroscopy (XAS) and density functional theory analysis of A{beta} peptides complexed with Cu{sup 2+} in solution under a range of buffer conditions. Phosphate-buffered saline buffer salt (NaCl)more » concentration does not affect the high-affinity copper binding mode but alters the second coordination sphere. The XAS spectra for truncated and full-length A{beta}-Cu{sup 2+} peptides are similar. The novel distorted six-coordinated (3N3O) geometry around copper in the A{beta}-Cu{sup 2+} complexes include three histidines: glutamic, or/and aspartic acid, and axial water. The structure of the high-affinity Cu{sup 2+} binding site is consistent with the hypothesis that the redox activity of the metal ion bound to A{beta} can lead to the formation of dityrosine-linked dimers found in AD.« less
A Quantitative Measure of Conformational Changes in Apo, Holo and Ligand-Bound Forms of Enzymes.
Singh, Satendra; Singh, Atul Kumar; Wadhwa, Gulshan; Singh, Dev Bukhsh; Dwivedi, Seema; Gautam, Budhayash; Ramteke, Pramod W
2016-06-01
Determination of the native geometry of the enzymes and ligand complexes is a key step in the process of structure-based drug designing. Enzymes and ligands show flexibility in structural behavior as they come in contact with each other. When ligand binds with active site of the enzyme, in the presence of cofactor some structural changes are expected to occur in the active site. Motivation behind this study is to determine the nature of conformational changes as well as regions where such changes are more pronounced. To measure the structural changes due to cofactor and ligand complex, enzyme in apo, holo and ligand-bound forms is selected. Enzyme data set was retrieved from protein data bank. Fifteen triplet groups were selected for the analysis of structural changes based on selection criteria. Structural features for selected enzymes were compared at the global as well as local region. Accessible surface area for the enzymes in entire triplet set was calculated, which describes the change in accessible surface area upon binding of cofactor and ligand with the enzyme. It was observed that some structural changes take place during binding of ligand in the presence of cofactor. This study will helps in understanding the level of flexibility in protein-ligand interaction for computer-aided drug designing.
Pairing tendencies in a two-orbital Hubbard model in one dimension
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patel, Niravkumar D.; Nocera, Adriana; Alvarez, Gonzalo
The recent discovery of superconductivity under high pressure in the ladder compound BaFe2S3 has opened a new field of research in iron-based superconductors with focus on quasi-one-dimensional geometries. In this publication, using the density matrix renormalization group technique, we study a two-orbital Hubbard model defined in one-dimensional chains. Our main result is the presence of hole binding tendencies at intermediate Hubbard U repulsion and robust Hund coupling JH / U = 0.25. Binding does not occur either in weak coupling or at very strong coupling. The pair-pair correlations that are dominant near half-filling, or of similar strength as the chargemore » and spin correlation channels, involve hole-pair operators that are spin singlets, use nearest-neighbor sites, and employ different orbitals for each hole. As a result, the Hund coupling strength, presence of robust magnetic moments, and antiferromagnetic correlations among them are important for the binding tendencies found here.« less
Solomon, Gemma C; Reimers, Jeffrey R; Hush, Noel S
2005-06-08
In the calculation of conduction through single molecule's approximations about the geometry and electronic structure of the system are usually made in order to simplify the problem. Previously [G. C. Solomon, J. R. Reimers, and N. S. Hush, J. Chem. Phys. 121, 6615 (2004)], we have shown that, in calculations employing cluster models for the electrodes, proper treatment of the open-shell nature of the clusters is the most important computational feature required to make the results sensitive to variations in the structural and chemical features of the system. Here, we expand this and establish a general hierarchy of requirements involving treatment of geometrical approximations. These approximations are categorized into two classes: those associated with finite-dimensional methods for representing the semi-infinite electrodes, and those associated with the chemisorption topology. We show that ca. 100 unique atoms are required in order to properly characterize each electrode: using fewer atoms leads to nonsystematic variations in conductivity that can overwhelm the subtler changes. The choice of binding site is shown to be the next most important feature, while some effects that are difficult to control experimentally concerning the orientations at each binding site are actually shown to be insignificant. Verification of this result provides a general test for the precision of computational procedures for molecular conductivity. Predictions concerning the dependence of conduction on substituent and other effects on the central molecule are found to be meaningful only when they exceed the uncertainties of the effects associated with binding-site variation.
NASA Astrophysics Data System (ADS)
Solomon, Gemma C.; Reimers, Jeffrey R.; Hush, Noel S.
2005-06-01
In the calculation of conduction through single molecule's approximations about the geometry and electronic structure of the system are usually made in order to simplify the problem. Previously [G. C. Solomon, J. R. Reimers, and N. S. Hush, J. Chem. Phys. 121, 6615 (2004)], we have shown that, in calculations employing cluster models for the electrodes, proper treatment of the open-shell nature of the clusters is the most important computational feature required to make the results sensitive to variations in the structural and chemical features of the system. Here, we expand this and establish a general hierarchy of requirements involving treatment of geometrical approximations. These approximations are categorized into two classes: those associated with finite-dimensional methods for representing the semi-infinite electrodes, and those associated with the chemisorption topology. We show that ca. 100 unique atoms are required in order to properly characterize each electrode: using fewer atoms leads to nonsystematic variations in conductivity that can overwhelm the subtler changes. The choice of binding site is shown to be the next most important feature, while some effects that are difficult to control experimentally concerning the orientations at each binding site are actually shown to be insignificant. Verification of this result provides a general test for the precision of computational procedures for molecular conductivity. Predictions concerning the dependence of conduction on substituent and other effects on the central molecule are found to be meaningful only when they exceed the uncertainties of the effects associated with binding-site variation.
Systematic theoretical study of ethylene adsorption on δ-MoC(001), TiC(001), and ZrC(001) surfaces
Jimenez-Orozco, Carlos; Florez, Elizabeth; Moreno, Andres; ...
2016-05-31
A systematic study of ethylene adsorption over δ-MoC(001), TiC(001), and ZrC(001) surfaces was conducted by means of calculations based on periodic density functional theory. The structure and electronic properties of each carbide pristine surface had a strong influence in the bonding of ethylene. It was found that the metal and carbon sites of the carbide could participate in the adsorption process. As a consequence of this, very different bonding mechanisms were seen on δ-MoC(001) and TiC(001). The bonding of the molecule on the TMC(001) systems showed only minor similarities to the type of bonding found on a typical metal likemore » Pt(111). In general, the ethylene binding energy follow the trend in stability: ZrC(001) < TiC(001) < δ-MoC(001) < Pt(111). The van der Waals correction to the energy produces large binding energy values, modifies the stability orders and drives the ethylene closer to the surface but the adsorbate geometry parameters remain unchanged. Ethylene was activated on clearly defined binding geometries, changing its hybridization from sp 2 to sp 3 with an elongation (0.16–0.31 Å) of the C=C bond. As a result, on the basis of this theoretical study, δ-MoC(001) is proposed as a potential catalyst for the hydrogenation of olefins, whereas TiC(001) could be useful for their hydrogenolysis.« less
Enz, Ralf
2012-01-01
Metabotropic glutamate receptors (mGluRs) regulate intracellular signal pathways that control several physiological tasks, including neuronal excitability, learning, and memory. This is achieved by the formation of synaptic signal complexes, in which mGluRs assemble with functionally related proteins such as enzymes, scaffolds, and cytoskeletal anchor proteins. Thus, mGluR associated proteins actively participate in the regulation of glutamatergic neurotransmission. Importantly, dysfunction of mGluRs and interacting proteins may lead to impaired signal transduction and finally result in neurological disorders, e.g., night blindness, addiction, epilepsy, schizophrenia, autism spectrum disorders and Parkinson's disease. In contrast to solved crystal structures of extracellular N-terminal domains of some mGluR types, only a few studies analyzed the conformation of intracellular receptor domains. Intracellular C-termini of most mGluR types are subject to alternative splicing and can be further modified by phosphorylation and SUMOylation. In this way, diverse interaction sites for intracellular proteins that bind to and regulate the glutamate receptors are generated. Indeed, most of the known mGluR binding partners interact with the receptors' C-terminal domains. Within the last years, different laboratories analyzed the structure of these domains and described the geometry of the contact surface between mGluR C-termini and interacting proteins. Here, I will review recent progress in the structure characterization of mGluR C-termini and provide an up-to-date summary of the geometry of these domains in contact with binding partners.
Conrad, Karen S; Jordan, Christopher D; Brown, Kenneth L; Brunold, Thomas C
2015-04-20
5'-deoxyadenosylcobalamin (coenzyme B12, AdoCbl) serves as the cofactor for several enzymes that play important roles in fermentation and catabolism. All of these enzymes initiate catalysis by promoting homolytic cleavage of the cofactor's Co-C bond in response to substrate binding to their active sites. Despite considerable research efforts, the role of the lower axial ligand in facilitating Co-C bond homolysis remains incompletely understood. In the present study, we characterized several derivatives of AdoCbl and its one-electron reduced form, Co(II)Cbl, by using electronic absorption and magnetic circular dichroism spectroscopies. To complement our experimental data, we performed computations on these species, as well as additional Co(II)Cbl analogues. The geometries of all species investigated were optimized using a quantum mechanics/molecular mechanics method, and the optimized geometries were used to compute absorption spectra with time-dependent density functional theory. Collectively, our results indicate that a reduction in the basicity of the lower axial ligand causes changes to the cofactor's electronic structure in the Co(II) state that replicate the effects seen upon binding of Co(II)Cbl to Class I isomerases, which replace the lower axial dimethylbenzimidazole ligand of AdoCbl with a protein-derived histidine (His) residue. Such a reduction of the basicity of the His ligand in the enzyme active site may be achieved through proton uptake by the catalytic triad of conserved residues, DXHXGXK, during Co-C bond homolysis.
The helical structure of DNA facilitates binding
NASA Astrophysics Data System (ADS)
Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan
2016-09-01
The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.
Enzymatic Transition States, Transition-State Analogs, Dynamics, Thermodynamics, and Lifetimes
Schramm, Vern L.
2017-01-01
Experimental analysis of enzymatic transition-state structures uses kinetic isotope effects (KIEs) to report on bonding and geometry differences between reactants and the transition state. Computational correlation of experimental values with chemical models permits three-dimensional geometric and electrostatic assignment of transition states formed at enzymatic catalytic sites. The combination of experimental and computational access to transition-state information permits (a) the design of transition-state analogs as powerful enzymatic inhibitors, (b) exploration of protein features linked to transition-state structure, (c) analysis of ensemble atomic motions involved in achieving the transition state, (d) transition-state lifetimes, and (e) separation of ground-state (Michaelis complexes) from transition-state effects. Transition-state analogs with picomolar dissociation constants have been achieved for several enzymatic targets. Transition states of closely related isozymes indicate that the protein’s dynamic architecture is linked to transition-state structure. Fast dynamic motions in catalytic sites are linked to transition-state generation. Enzymatic transition states have lifetimes of femtoseconds, the lifetime of bond vibrations. Binding isotope effects (BIEs) reveal relative reactant and transition-state analog binding distortion for comparison with actual transition states. PMID:21675920
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.
Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognatemore » tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.« less
Dey, Sanjay; Biswas, Maitree; Sen, Udayaditya; Dasgupta, Jhimli
2015-04-03
Bacterial enhancer-binding proteins (bEBPs) oligomerize through AAA(+) domains and use ATP hydrolysis-driven energy to isomerize the RNA polymerase-σ(54) complex during transcriptional initiation. Here, we describe the first structure of the central AAA(+) domain of the flagellar regulatory protein FlrC (FlrC(C)), a bEBP that controls flagellar synthesis in Vibrio cholerae. Our results showed that FlrC(C) forms heptamer both in nucleotide (Nt)-free and -bound states without ATP-dependent subunit remodeling. Unlike the bEBPs such as NtrC1 or PspF, a novel cis-mediated "all or none" ATP binding occurs in the heptameric FlrC(C), because constriction at the ATPase site, caused by loop L3 and helix α7, restricts the proximity of the trans-protomer required for Nt binding. A unique "closed to open" movement of Walker A, assisted by trans-acting "Glu switch" Glu-286, facilitates ATP binding and hydrolysis. Fluorescence quenching and ATPase assays on FlrC(C) and mutants revealed that although Arg-349 of sensor II, positioned by trans-acting Glu-286 and Tyr-290, acts as a key residue to bind and hydrolyze ATP, Arg-319 of α7 anchors ribose and controls the rate of ATP hydrolysis by retarding the expulsion of ADP. Heptameric state of FlrC(C) is restored in solution even with the transition state mimicking ADP·AlF3. Structural results and pulldown assays indicated that L3 renders an in-built geometry to L1 and L2 causing σ(54)-FlrC(C) interaction independent of Nt binding. Collectively, our results underscore a novel mechanism of ATP binding and σ(54) interaction that strives to understand the transcriptional mechanism of the bEBPs, which probably interact directly with the RNA polymerase-σ(54) complex without DNA looping. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Manzoni, Francesco; Wallerstein, Johan; Schrader, Tobias E; Ostermann, Andreas; Coates, Leighton; Akke, Mikael; Blakeley, Matthew P; Oksanen, Esko; Logan, Derek T
2018-05-24
The medically important drug target galectin-3 binds galactose-containing moieties on glycoproteins through an intricate pattern of hydrogen bonds to a largely polar surface-exposed binding site. All successful inhibitors of galectin-3 to date have been based on mono- or disaccharide cores closely resembling natural ligands. A detailed understanding of the H-bonding networks in these natural ligands will provide an improved foundation for the design of novel inhibitors. Neutron crystallography is an ideal technique to reveal the geometry of hydrogen bonds because the positions of hydrogen atoms are directly detected rather than being inferred from the positions of heavier atoms as in X-ray crystallography. We present three neutron crystal structures of the C-terminal carbohydrate recognition domain of galectin-3: the ligand-free form and the complexes with the natural substrate lactose and with glycerol, which mimics important interactions made by lactose. The neutron crystal structures reveal unambiguously the exquisite fine-tuning of the hydrogen bonding pattern in the binding site to the natural disaccharide ligand. The ligand-free structure shows that most of these hydrogen bonds are preserved even when the polar groups of the ligand are replaced by water molecules. The protonation states of all histidine residues in the protein are also revealed and correlate well with NMR observations. The structures give a solid starting point for molecular dynamics simulations and computational estimates of ligand binding affinity that will inform future drug design.
Subunit Dissociation and Metal Binding by Escherichia coli apo-Manganese Superoxide Dismutase
Whittaker, Mei M.; Lerch, Thomas F.; Kirillova, Olga; Chapman, Michael S.; Whittaker, James W.
2010-01-01
Metal binding by apo-manganese superoxide dismutase (apo-MnSOD) is essential for functional maturation of the enzyme. Previous studies have demonstrated that metal binding by apo-MnSOD is conformationally gated, requiring protein reorganization for the metal to bind. We have now solved the X-ray crystal structure of apo-MnSOD at 1.9 Å resolution. The organization of active site residues is independent of the presence of the metal cofactor, demonstrating that protein itself templates the unusual metal coordination geometry. Electrophoretic analysis of mixtures of apo- and (Mn2)-MnSOD, dye-conjugated protein, or C-terminal Strep-tag II fusion protein reveals a dynamic subunit exchange process associated with cooperative metal binding by the two subunits of the dimeric protein. In contrast, (S126C) (SS) apo-MnSOD, which contains an inter-subunit covalent disulfide crosslink, exhibits anticooperative metal binding. The protein concentration dependence of metal uptake kinetics implies that protein dissociation is involved in metal binding by the wild type apo-protein, although other processes may also contribute to gating metal uptake. Protein concentration dependent small-zone size exclusion chromatography is consistent with apo-MnSOD dimer dissociation at low protein concentration (KD = 1×10−6 M). Studies on metal uptake by apo-MnSOD in Escherichia coli cells show that the protein exhibits similar behavior in vivo and in vitro. PMID:21044611
Diphenylpyrazoles as Replication Protein A inhibitors
Waterson, Alex G.; Kennedy, J. Phillip; Patrone, James D.; ...
2014-11-11
Replication Protein A is the primary eukaryotic ssDNA binding protein that has a central role in initiating the cellular response to DNA damage. RPA recruits multiple proteins to sites of DNA damage via the N-terminal domain of the 70 kDa subunit (RPA70N). Here we describe the optimization of a diphenylpyrazole carboxylic acid series of inhibitors of these RPA–protein interactions. Lastly, we evaluated substituents on the aromatic rings as well as the type and geometry of the linkers used to combine fragments, ultimately leading to submicromolar inhibitors of RPA70N protein–protein interactions.
Searching target sites on DNA by proteins: Role of DNA dynamics under confinement
Mondal, Anupam; Bhattacherjee, Arnab
2015-01-01
DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158
DOE Office of Scientific and Technical Information (OSTI.GOV)
Z Li; Z Liu; D Cho
2011-12-31
Inhibitors of the Giardia lamblia fructose 1,6-bisphosphate aldolase (GlFBPA), which transforms fructose 1,6-bisphosphate (FBP) to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, were designed based on 3-hydroxy-2-pyridone and 1,2-dihydroxypyridine scaffolds that position two negatively charged tetrahedral groups for interaction with substrate phosphate binding residues, a hydrogen bond donor to the catalytic Asp83, and a Zn{sup 2+} binding group. The inhibition activities for the GlFBPA catalyzed reaction of FBP of the prepared alkyl phosphonate/phosphate substituted 3-hydroxy-2-pyridinones and a dihydroxypyridine were determined. The 3-hydroxy-2-pyridone inhibitor 8 was found to bind to GlFBPA with an affinity (K{sub i} = 14 {micro}M) that is comparable tomore » that of FBP (K{sub m} = 2 {micro}M) or its inert analog TBP (K{sub i} = 1 {micro}M). The X-ray structure of the GlFBPA-inhibitor 8 complex (2.3 {angstrom}) shows that 8 binds to the active site in the manner predicted by in silico docking with the exception of coordination with Zn{sup 2+}. The observed distances and orientation of the pyridone ring O=C-C-OH relative to Zn{sup 2+} are not consistent with a strong interaction. To determine if Zn{sup 2+} coordination occurs in the GlFBPA-inhibitor 8 complex in solution, EXAFS spectra were measured. A four coordinate geometry comprised of the three enzyme histidine ligands and an oxygen atom from the pyridone ring O=C-C-OH was indicated. Analysis of the Zn{sup 2+} coordination geometries in recently reported structures of class II FBPAs suggests that strong Zn{sup 2+} coordination is reserved for the enediolate-like transition state, accounting for minimal contribution of Zn{sup 2+} coordination to binding of 8 to GlFBPA.« less
Li, Zhimin; Liu, Zhengang; Cho, Dae Won; Zou, Jiwen; Gong, Maozhen; Breece, Robert M; Galkin, Andrey; Li, Ling; Zhao, Hong; Maestas, Gabriel D; Tierney, David L; Herzberg, Osnat; Dunaway-Mariano, Debra; Mariano, Patrick S
2011-04-01
Inhibitors of the Giardia lamblia fructose 1,6-bisphosphate aldolase (GlFBPA), which transforms fructose 1,6-bisphosphate (FBP) to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, were designed based on 3-hydroxy-2-pyridone and 1,2-dihydroxypyridine scaffolds that position two negatively charged tetrahedral groups for interaction with substrate phosphate binding residues, a hydrogen bond donor to the catalytic Asp83, and a Zn(2+) binding group. The inhibition activities for the GlFBPA catalyzed reaction of FBP of the prepared alkyl phosphonate/phosphate substituted 3-hydroxy-2-pyridinones and a dihydroxypyridine were determined. The 3-hydroxy-2-pyridone inhibitor 8 was found to bind to GlFBPA with an affinity (K(i)=14μM) that is comparable to that of FBP (K(m)=2μM) or its inert analog TBP (K(i)=1μM). The X-ray structure of the GlFBPA-inhibitor 8 complex (2.3Å) shows that 8 binds to the active site in the manner predicted by in silico docking with the exception of coordination with Zn(2+). The observed distances and orientation of the pyridone ring O=C-C-OH relative to Zn(2+) are not consistent with a strong interaction. To determine if Zn(2+)coordination occurs in the GlFBPA-inhibitor 8 complex in solution, EXAFS spectra were measured. A four coordinate geometry comprised of the three enzyme histidine ligands and an oxygen atom from the pyridone ring O=C-C-OH was indicated. Analysis of the Zn(2+) coordination geometries in recently reported structures of class II FBPAs suggests that strong Zn(2+) coordination is reserved for the enediolate-like transition state, accounting for minimal contribution of Zn(2+) coordination to binding of 8 to GlFBPA. Copyright © 2010 Elsevier Inc. All rights reserved.
Patra, Ayan; Bera, Manindranath
2014-01-30
In methanol, the reaction of stoichiometric amounts of Mn(OAc)(2)·4H(2)O and the ligand H(3)hpnbpda [H(3)hpnbpda=N,N'-bis(2-pyridylmethyl)-2-hydroxy-1,3-propanediamine-N,N'-diacetic acid] in the presence of NaOH, afforded a new water soluble dinuclear manganese(II) complex, [Mn2(hpnbpda)(μ-OAc)] (1). Similarly, the reaction of Mg(OAc)(2)·4H(2)O and the ligand H3hpnbpda in the presence of NaOH, in methanol, yielded a new water soluble dinuclear magnesium(II) complex, [Mg2(hpnbpda)(μ-OAc)(H2O)2] (2). DFT calculations have been performed for the structural optimization of complexes 1 and 2. The DFT optimized structure of complex 1 shows that two manganese(II) centers are in a distorted square pyramidal geometry, whereas the DFT optimized structure of complex 2 reveals that two magnesium(II) centers adopt a six-coordinate distorted octahedral geometry. To understand the mode of substrate binding and the mechanistic details of the active site metals in xylose/glucose isomerases (XGI), we have investigated the binding interactions of biologically important monosaccharides d-glucose and d-xylose with complexes 1 and 2, in aqueous alkaline solution by a combined approach of FTIR, UV-vis, fluorescence, and (13)C NMR spectroscopic techniques. Fluorescence spectra show the binding-induced gradual decrease in emission of complexes 1 and 2 accompanied by a significant blue shift upon increasing the concentration of sugar substrates. The binding modes of d-glucose and d-xylose with complex 2 are indicated by their characteristic coordination induced shift (CIS) values in (13)C NMR spectra for C1 and C2 carbon atoms. Copyright © 2013 Elsevier Ltd. All rights reserved.
Bowden, Thomas A.; Crispin, Max; Harvey, David J.; Jones, E. Yvonne; Stuart, David I.
2010-01-01
Hendra virus is a negative-sense single-stranded RNA virus within the Paramyxoviridae family which, together with Nipah virus, forms the Henipavirus genus. Infection with bat-borne Hendra virus leads to a disease with high mortality rates in humans. We determined the crystal structure of the unliganded six-bladed β-propeller domain and compared it to the previously reported structure of Hendra virus attachment glycoprotein (HeV-G) in complex with its cellular receptor, ephrin-B2. As observed for the related unliganded Nipah virus structure, there is plasticity in the Glu579-Pro590 and Lys236-Ala245 ephrin-binding loops prior to receptor engagement. These data reveal that henipaviral attachment glycoproteins undergo common structural transitions upon receptor binding and further define the structural template for antihenipaviral drug design. Our analysis also provides experimental evidence for a dimeric arrangement of HeV-G that exhibits striking similarity to those observed in crystal structures of related paramyxovirus receptor-binding glycoproteins. The biological relevance of this dimer is further supported by the positional analysis of glycosylation sites from across the paramyxoviruses. In HeV-G, the sites lie away from the putative dimer interface and remain accessible to α-mannosidase processing on oligomerization. We therefore propose that the overall mode of dimer assembly is conserved for all paramyxoviruses; however, while the geometry of dimerization is rather closely similar for those viruses that bind flexible glycan receptors, significant (up to 60°) and different reconfigurations of the subunit packing (associated with a significant decrease in the size of the dimer interface) have accompanied the independent switching to high-affinity protein receptor binding in Hendra and measles viruses. PMID:20375167
Carbon- versus sulphur-based zinc binding groups for carbonic anhydrase inhibitors?
Supuran, Claudiu T
2018-12-01
A set of compounds incorporating carbon-based zinc-binding groups (ZBGs), of the type PhX (X = COOH, CONH 2 , CONHNH 2 , CONHOH, CONHOMe), and the corresponding derivatives with sulphur(VI)-based ZBGs (X = SO 3 H, SO 2 NH 2 , SO 2 NHNH 2 , SO 2 NHOH, SO 2 NHOMe) were tested as inhibitors of all mammalian isoforms of carbonic anhydrase (CA, EC 4.2.1.1), CA I-XV. Three factors connected with the ZBG influenced the efficacy as CA inhibitor (CAI) of the investigated compounds: (i) the pKa of the ZBG; (ii) its geometry (tetrahedral, i.e. sulphur-based, versus trigonal, i.e. carbon-based ZBGs), and (iii) orientation of the organic scaffold induced by the nature of the ZBG. Benzenesulphonamide was the best inhibitor of all isoforms, but other ZBGs led to interesting inhibition profiles, although with an efficacy generally reduced when compared to the sulphonamide. The nature of the ZBG also influenced the CA inhibition mechanism. Most of these derivatives were zinc binders, but some of them (sulfonates, carboxylates) may interact with the enzyme by anchoring to the zinc-coordinated water molecule or by other inhibition mechanisms (occlusion of the active site entrance, out of the active site binding, etc.). Exploring structurally diverse ZBGs may lead to interesting new developments in the field of CAIs.
Zinc-binding structure of a catalytic amyloid from solid-state NMR.
Lee, Myungwoon; Wang, Tuo; Makhlynets, Olga V; Wu, Yibing; Polizzi, Nicholas F; Wu, Haifan; Gosavi, Pallavi M; Stöhr, Jan; Korendovych, Ivan V; DeGrado, William F; Hong, Mei
2017-06-13
Throughout biology, amyloids are key structures in both functional proteins and the end product of pathologic protein misfolding. Amyloids might also represent an early precursor in the evolution of life because of their small molecular size and their ability to self-purify and catalyze chemical reactions. They also provide attractive backbones for advanced materials. When β-strands of an amyloid are arranged parallel and in register, side chains from the same position of each chain align, facilitating metal chelation when the residues are good ligands such as histidine. High-resolution structures of metalloamyloids are needed to understand the molecular bases of metal-amyloid interactions. Here we combine solid-state NMR and structural bioinformatics to determine the structure of a zinc-bound metalloamyloid that catalyzes ester hydrolysis. The peptide forms amphiphilic parallel β-sheets that assemble into stacked bilayers with alternating hydrophobic and polar interfaces. The hydrophobic interface is stabilized by apolar side chains from adjacent sheets, whereas the hydrated polar interface houses the Zn 2+ -binding histidines with binding geometries unusual in proteins. Each Zn 2+ has two bis-coordinated histidine ligands, which bridge adjacent strands to form an infinite metal-ligand chain along the fibril axis. A third histidine completes the protein ligand environment, leaving a free site on the Zn 2+ for water activation. This structure defines a class of materials, which we call metal-peptide frameworks. The structure reveals a delicate interplay through which metal ions stabilize the amyloid structure, which in turn shapes the ligand geometry and catalytic reactivity of Zn 2 .
2015-01-01
A role for protein dynamics in enzymatic catalysis of hydrogen transfer has received substantial scientific support, but the connections between protein structure and catalysis remain to be established. Valine residues 203 and 207 are at the binding site for the nicotinamide ring of the coenzyme in liver alcohol dehydrogenase and have been suggested to facilitate catalysis with “protein-promoting vibrations” (PPV). We find that the V207A substitution has small effects on steady-state kinetic constants and the rate of hydrogen transfer; the introduced cavity is empty and is tolerated with minimal effects on structure (determined at 1.2 Å for the complex with NAD+ and 2,3,4,5,6-pentafluorobenzyl alcohol). Thus, no evidence is found to support a role for Val-207 in the dynamics of catalysis. The protein structures and ligand geometries (including donor–acceptor distances) in the V203A enzyme complexed with NAD+ and 2,3,4,5,6-pentafluorobenzyl alcohol or 2,2,2-trifluoroethanol (determined at 1.1 Å) are very similar to those for the wild-type enzyme, except that the introduced cavity accommodates a new water molecule that contacts the nicotinamide ring. The structures of the V203A enzyme complexes suggest, in contrast to previous studies, that the diminished tunneling and decreased rate of hydride transfer (16-fold, relative to that of the wild-type enzyme) are not due to differences in ground-state ligand geometries. The V203A substitution may alter the PPV and the reorganization energy for hydrogen transfer, but the protein scaffold and equilibrium thermal motions within the Michaelis complex may be more significant for enzyme catalysis. PMID:24437493
Fuller, Jonathan C.; Jackson, Richard M.; Edwards, Thomas A.; Wilson, Andrew J.; Shirts, Michael R.
2012-01-01
The design of novel α-helix mimetic inhibitors of protein-protein interactions is of interest to pharmaceuticals and chemical genetics researchers as these inhibitors provide a chemical scaffold presenting side chains in the same geometry as an α-helix. This conformational arrangement allows the design of high affinity inhibitors mimicking known peptide sequences binding specific protein substrates. We show that GAFF and AutoDock potentials do not properly capture the conformational preferences of α-helix mimetics based on arylamide oligomers and identify alternate parameters matching solution NMR data and suitable for molecular dynamics simulation of arylamide compounds. Results from both docking and molecular dynamics simulations are consistent with the arylamides binding in the p53 peptide binding pocket. Simulations of arylamides in the p53 binding pocket of hDM2 are consistent with binding, exhibiting similar structural dynamics in the pocket as simulations of known hDM2 binders Nutlin-2 and a benzodiazepinedione compound. Arylamide conformations converge towards the same region of the binding pocket on the 20 ns time scale, and most, though not all dihedrals in the binding pocket are well sampled on this timescale. We show that there are two putative classes of binding modes for arylamide compounds supported equally by the modeling evidence. In the first, the arylamide compound lies parallel to the observed p53 helix. In the second class, not previously identified or proposed, the arylamide compound lies anti-parallel to the p53 helix. PMID:22916232
Refined structure of dimeric diphtheria toxin at 2.0 A resolution.
Bennett, M. J.; Choe, S.; Eisenberg, D.
1994-01-01
The refined structure of dimeric diphtheria toxin (DT) at 2.0 A resolution, based on 37,727 unique reflections (F > 1 sigma (F)), yields a final R factor of 19.5% with a model obeying standard geometry. The refined model consists of 523 amino acid residues, 1 molecule of the bound dinucleotide inhibitor adenylyl 3'-5' uridine 3' monophosphate (ApUp), and 405 well-ordered water molecules. The 2.0-A refined model reveals that the binding motif for ApUp includes residues in the catalytic and receptor-binding domains and is different from the Rossmann dinucleotide-binding fold. ApUp is bound in part by a long loop (residues 34-52) that crosses the active site. Several residues in the active site were previously identified as NAD-binding residues. Glu 148, previously identified as playing a catalytic role in ADP-ribosylation of elongation factor 2 by DT, is about 5 A from uracil in ApUp. The trigger for insertion of the transmembrane domain of DT into the endosomal membrane at low pH may involve 3 intradomain and 4 interdomain salt bridges that will be weakened at low pH by protonation of their acidic residues. The refined model also reveals that each molecule in dimeric DT has an "open" structure unlike most globular proteins, which we call an open monomer. Two open monomers interact by "domain swapping" to form a compact, globular dimeric DT structure. The possibility that the open monomer resembles a membrane insertion intermediate is discussed. PMID:7833807
An Angular Overlap Model for Cu(II) Ion in the AMOEBA Polarizable Force Field
Xiang, Jin Yu; Ponder, Jay W.
2014-01-01
An extensible polarizable force field for transition metal ion was developed based on AMOEBA and the angular overlap model (AOM) with consistent treatment of electrostatics for all atoms. Parameters were obtained by fitting molecular mechanics (MM) energies to various ab initio gas-phase calculations. The results of parameterization were presented for copper (II) ion ligated to water and model fragments of amino acid residues involved in the copper binding sites of type 1 copper proteins. Molecular dynamics (MD) simulations were performed on aqueous copper (II) ion at various temperatures, as well as plastocyanin (1AG6) and azurin (1DYZ). Results demonstrated that the AMOEBA-AOM significantly improves the accuracy of classical MM in a number of test cases when compared to ab initio calculations. The Jahn-Teller distortion for hexa-aqua copper (II) complex was handled automatically without specifically designating axial and in-plane ligands. Analyses of MD trajectories resulted in a 6-coordination first solvation shell for aqueous copper (II) ion and a 1.8ns average residence time of water molecules. The ensemble average geometries of 1AG6 and 1DYZ copper binding sites were in general agreement with X-ray and previous computational studies. PMID:25045338
Tran, Hai L; Lexa, Katrina W; Julien, Olivier; Young, Travis S; Walsh, Christopher T; Jacobson, Matthew P; Wells, James A
2017-02-22
Macrocycles are appealing drug candidates due to their high affinity, specificity, and favorable pharmacological properties. In this study, we explored the effects of chemical modifications to a natural product macrocycle upon its activity, 3D geometry, and conformational entropy. We chose thiocillin as a model system, a thiopeptide in the ribosomally encoded family of natural products that exhibits potent antimicrobial effects against Gram-positive bacteria. Since thiocillin is derived from a genetically encoded peptide scaffold, site-directed mutagenesis allows for rapid generation of analogues. To understand thiocillin's structure-activity relationship, we generated a site-saturation mutagenesis library covering each position along thiocillin's macrocyclic ring. We report the identification of eight unique compounds more potent than wild-type thiocillin, the best having an 8-fold improvement in potency. Computational modeling of thiocillin's macrocyclic structure revealed a striking requirement for a low-entropy macrocycle for activity. The populated ensembles of the active mutants showed a rigid structure with few adoptable conformations while inactive mutants showed a more flexible macrocycle which is unfavorable for binding. This finding highlights the importance of macrocyclization in combination with rigidifying post-translational modifications to achieve high-potency binding.
Energy design for protein-protein interactions
Ravikant, D. V. S.; Elber, Ron
2011-01-01
Proteins bind to other proteins efficiently and specifically to carry on many cell functions such as signaling, activation, transport, enzymatic reactions, and more. To determine the geometry and strength of binding of a protein pair, an energy function is required. An algorithm to design an optimal energy function, based on empirical data of protein complexes, is proposed and applied. Emphasis is made on negative design in which incorrect geometries are presented to the algorithm that learns to avoid them. For the docking problem the search for plausible geometries can be performed exhaustively. The possible geometries of the complex are generated on a grid with the help of a fast Fourier transform algorithm. A novel formulation of negative design makes it possible to investigate iteratively hundreds of millions of negative examples while monotonically improving the quality of the potential. Experimental structures for 640 protein complexes are used to generate positive and negative examples for learning parameters. The algorithm designed in this work finds the correct binding structure as the lowest energy minimum in 318 cases of the 640 examples. Further benchmarks on independent sets confirm the significant capacity of the scoring function to recognize correct modes of interactions. PMID:21842951
Cacciarini, Martina; Nativi, Cristina; Norcini, Martina; Staderini, Samuele; Francesconi, Oscar; Roelens, Stefano
2011-02-21
The contribution from several H-bonding groups and the impact of geometric requirements on the binding ability of benzene-based tripodal receptors toward carbohydrates have been investigated by measuring the affinity of a set of structures toward octyl β-D-glucopyranoside, selected as a representative monosaccharide. The results reported in the present study demonstrate that a judicious choice of correct geometry and appropriate functional groups is critical to achieve the complementary hydrogen bonding interactions required for an effective carbohydrate recognition.
Harris, Lawrence D; Harijan, Rajesh K; Ducati, Rodrigo G; Evans, Gary B; Hirsch, Brett M; Schramm, Vern L
2018-01-19
Phosphoribosyl transferases (PRTs) are essential in nucleotide synthesis and salvage, amino acid, and vitamin synthesis. Transition state analysis of several PRTs has demonstrated ribocation-like transition states with a partial positive charge residing on the pentose ring. Core chemistry for synthesis of transition state analogues related to the 5-phospho-α-d-ribosyl 1-pyrophosphate (PRPP) reactant of these enzymes could be developed by stereospecific placement of bis-phosphate groups on an iminoaltritol ring. Cationic character is provided by the imino group and the bis-phosphates anchor both the 1- and 5-phosphate binding sites. We provide a facile synthetic path to these molecules. Cyclic-nitrone redox methodology was applied to the stereocontrolled synthesis of three stereoisomers of a selectively monoprotected diol relevant to the synthesis of transition-state analogue inhibitors. These polyhydroxylated pyrrolidine natural product analogues were bis-phosphorylated to generate analogues of the ribocationic form of 5-phosphoribosyl 1-phosphate. A safe, high yielding synthesis of the key intermediate represents a new route to these transition state mimics. An enantiomeric pair of iminoaltritol bis-phosphates (L-DIAB and D-DIAB) was prepared and shown to display inhibition of Plasmodium falciparum orotate phosphoribosyltransferase and Saccharomyces cerevisiae adenine phosphoribosyltransferase (ScAPRT). Crystallographic inhibitor binding analysis of L- and D-DIAB bound to the catalytic sites of ScAPRT demonstrates accommodation of both enantiomers by altered ring geometry and bis-phosphate catalytic site contacts.
Structural elements of the signal propagation pathway in squid rhodopsin and bovine rhodopsin.
Sugihara, Minoru; Fujibuchi, Wataru; Suwa, Makiko
2011-05-19
Squid and bovine rhodopsins are G-protein coupled receptors (GPCRs) that activate Gq- and Gt-type G-proteins, respectively. To understand the structural elements of the signal propagation pathway, we performed molecular dynamics (MD) simulations of squid and bovine rhodopsins plus a detailed sequence analysis of class A GPCRs. The computations indicate that although the geometry of the retinal is similar in bovine and squid rhodopsins, the important interhelical hydrogen bond networks are different. In squid rhodopsin, an extended hydrogen bond network that spans ∼13 Å to Tyr315 on the cytoplasmic site is present regardless of the protonation state of Asp80. In contrast, the extended hydrogen bond network is interrupted at Tyr306 in bovine rhodopsin. Those differences in the hydrogen bond network may play significant functional roles in the signal propagation from the retinal binding site to the cytoplasmic site, including transmembrane helix (TM) 6 to which the G-protein binds. The MD calculations demonstrate that the elongated conformation of TM6 in squid rhodopsin is stabilized by salt bridges formed with helix (H) 9. Together with the interhelical hydrogen bonds, the salt bridges between TM6 and H9 stabilize the protein conformation of squid rhodopsin and may hinder the occurrence of large conformational changes that are observed upon activation of bovine rhodopsin. © 2011 American Chemical Society
Vascular Targeting of Nanocarriers: Perplexing Aspects of the Seemingly Straightforward Paradigm
2015-01-01
Targeted nanomedicine holds promise to find clinical use in many medical areas. Endothelial cells that line the luminal surface of blood vessels represent a key target for treatment of inflammation, ischemia, thrombosis, stroke, and other neurological, cardiovascular, pulmonary, and oncological conditions. In other cases, the endothelium is a barrier for tissue penetration or a victim of adverse effects. Several endothelial surface markers including peptidases (e.g., ACE, APP, and APN) and adhesion molecules (e.g., ICAM-1 and PECAM) have been identified as key targets. Binding of nanocarriers to these molecules enables drug targeting and subsequent penetration into or across the endothelium, offering therapeutic effects that are unattainable by their nontargeted counterparts. We analyze diverse aspects of endothelial nanomedicine including (i) circulation and targeting of carriers with diverse geometries, (ii) multivalent interactions of carrier with endothelium, (iii) anchoring to multiple determinants, (iv) accessibility of binding sites and cellular response to their engagement, (v) role of cell phenotype and microenvironment in targeting, (vi) optimization of targeting by lowering carrier avidity, (vii) endocytosis of multivalent carriers via molecules not implicated in internalization of their ligands, and (viii) modulation of cellular uptake and trafficking by selection of specific epitopes on the target determinant, carrier geometry, and hydrodynamic factors. Refinement of these aspects and improving our understanding of vascular biology and pathology is likely to enable the clinical translation of vascular endothelial targeting of nanocarriers. PMID:24787360
NASA Astrophysics Data System (ADS)
Zhu, Xiao-he; Sun, Jin; Wang, Shan; Bu, Wei; Yao, Min-na; Gao, Kai; Song, Ying; Zhao, Jin-yi; Lu, Cheng-tao; Zhang, En-hu; Yang, Zhi-fu; Wen, Ai-dong
2016-03-01
A novel adamantyl nitroxide derivatives has been synthesized and characterized by IR, ESI-MS and elemental analysis. Quantum chemical calculations have also been performed to calculate the molecular geometry using density functional theory (B3LYP) with the 6-31G (d,p) basis set. The calculated results showed that the optimized geometry can well reproduce the crystal structure. The antioxidant and antiproliferative activity were evaluated by superoxide (NBT) and MTT assay. The adamantyl nitroxide derivatives exhibited stronger scavenging ability towards O2· - radicals when compared to Vitamin C, and demonstrated a remarked anticancer activity against all the tested cell lines, especially Bel-7404 cells with IC50 of 43.3 μM, compared to the positive control Sorafenib (IC50 = 92.0 μM). The results of molecular docking within EGFR using AutoDock confirmed that the titled compound favorably fitted into the ATP binding site of EGFR and would be a potential anticancer agent.
Pratter, Sarah M; Light, Kenneth M; Solomon, Edward I; Straganz, Grit D
2014-07-02
Mononuclear nonheme Fe(II) (MNH) and α-ketoglutarate (α-KG) dependent halogenases activate O2 to perform oxidative halogenations of activated and nonactivated carbon centers. While the mechanism of halide incorporation into a substrate has been investigated, the mechanism by which halogenases prevent oxidations in the absence of chloride is still obscure. Here, we characterize the impact of chloride on the metal center coordination and reactivity of the fatty acyl-halogenase HctB. Stopped-flow kinetic studies show that the oxidative transformation of the Fe(II)-α-KG-enzyme complex is >200-fold accelerated by saturating concentrations of chloride in both the absence and presence of a covalently bound substrate. By contrast, the presence of substrate, which generally brings about O2 activation at enzymatic MNH centers, only has an ∼10-fold effect in the absence of chloride. Circular dichroism (CD) and magnetic CD (MCD) studies demonstrate that chloride binding triggers changes in the metal center ligation: chloride binding induces the proper binding of the substrate as shown by variable-temperature, variable-field (VTVH) MCD studies of non-α-KG-containing forms and the conversion from six-coordinate (6C) to 5C/6C mixtures when α-KG is bound. In the presence of substrate, a site with square pyramidal five-coordinate (5C) geometry is observed, which is required for O2 activation at enzymatic MNH centers. In the absence of substrate an unusual trigonal bipyramidal site is formed, which accounts for the observed slow, uncoupled reactivity. Molecular dynamics simulations suggest that the binding of chloride to the metal center of HctB leads to a conformational change in the enzyme that makes the active site more accessible to the substrate and thus facilitates the formation of the catalytically competent enzyme-substrate complex. Results are discussed in relation to other MNH dependent halogenases.
Architecture of the 99 bp DNA-six-protein regulatory complex of the lambda att site.
Sun, Xingmin; Mierke, Dale F; Biswas, Tapan; Lee, Sang Yeol; Landy, Arthur; Radman-Livaja, Marta
2006-11-17
The highly directional and tightly regulated recombination reaction used to site-specifically excise the bacteriophage lambda chromosome out of its E. coli host chromosome requires the binding of six sequence-specific proteins to a 99 bp segment of the phage att site. To gain structural insights into this recombination pathway, we measured 27 FRET distances between eight points on the 99 bp regulatory DNA bound with all six proteins. Triangulation of these distances using a metric matrix distance-geometry algorithm provided coordinates for these eight points. The resulting path for the protein-bound regulatory DNA, which fits well with the genetics, biochemistry, and X-ray crystal structures describing the individual proteins and their interactions with DNA, provides a new structural perspective into the molecular mechanism and regulation of the recombination reaction and illustrates a design by which different families of higher-order complexes can be assembled from different numbers and combinations of the same few proteins.
POOL server: machine learning application for functional site prediction in proteins.
Somarowthu, Srinivas; Ondrechen, Mary Jo
2012-08-01
We present an automated web server for partial order optimum likelihood (POOL), a machine learning application that combines computed electrostatic and geometric information for high-performance prediction of catalytic residues from 3D structures. Input features consist of THEMATICS electrostatics data and pocket information from ConCavity. THEMATICS measures deviation from typical, sigmoidal titration behavior to identify functionally important residues and ConCavity identifies binding pockets by analyzing the surface geometry of protein structures. Both THEMATICS and ConCavity (structure only) do not require the query protein to have any sequence or structure similarity to other proteins. Hence, POOL is applicable to proteins with novel folds and engineered proteins. As an additional option for cases where sequence homologues are available, users can include evolutionary information from INTREPID for enhanced accuracy in site prediction. The web site is free and open to all users with no login requirements at http://www.pool.neu.edu. m.ondrechen@neu.edu Supplementary data are available at Bioinformatics online.
Hydrogen behaviour at twist {110} grain boundaries in α-Fe
NASA Astrophysics Data System (ADS)
McEniry, Eunan J.; Hickel, Tilmann; Neugebauer, Jörg
2017-06-01
The behaviour of hydrogen at structural defects such as grain boundaries plays a critical role in the phenomenon of hydrogen embrittlement. However, characterization of the energetics and diffusion of hydrogen in the vicinity of such extended defects using conventional ab initio techniques is challenging due to the relatively large system sizes required when dealing with realistic grain boundary geometries. In order to be able to access the required system sizes, as well as high-throughput testing of a large number of configurations, while remaining within a quantum-mechanical framework, an environmental tight-binding model for the iron-hydrogen system has been developed. The resulting model is applied to study the behaviour of hydrogen at a class of low-energy {110}-terminated twist grain boundaries in α-Fe. We find that, for particular Σ values within the coincidence site lattice description, the atomic geometry at the interface plane provides extremely favourable trap sites for H, which also possess high escape barriers for diffusion. By contrast, via simulated tensile testing, weakly trapped hydrogen at the interface plane of the bulk-like Σ3 boundary acts as a `glue' for the boundary, increasing both the energetic barrier and the elongation to rupture. This article is part of the themed issue 'The challenges of hydrogen and metals'.
Tchesnokov, Egor P.; Fellner, Matthias; Siakkou, Eleni; Kleffmann, Torsten; Martin, Lois W.; Aloi, Sekotilani; Lamont, Iain L.; Wilbanks, Sigurd M.; Jameson, Guy N. L.
2015-01-01
Thiol dioxygenation is the initial oxidation step that commits a thiol to important catabolic or biosynthetic pathways. The reaction is catalyzed by a family of specific non-heme mononuclear iron proteins each of which is reported to react efficiently with only one substrate. This family of enzymes includes cysteine dioxygenase, cysteamine dioxygenase, mercaptosuccinate dioxygenase, and 3-mercaptopropionate dioxygenase. Using sequence alignment to infer cysteine dioxygenase activity, a cysteine dioxygenase homologue from Pseudomonas aeruginosa (p3MDO) has been identified. Mass spectrometry of P. aeruginosa under standard growth conditions showed that p3MDO is expressed in low levels, suggesting that this metabolic pathway is available to the organism. Purified recombinant p3MDO is able to oxidize both cysteine and 3-mercaptopropionic acid in vitro, with a marked preference for 3-mercaptopropionic acid. We therefore describe this enzyme as a 3-mercaptopropionate dioxygenase. Mössbauer spectroscopy suggests that substrate binding to the ferrous iron is through the thiol but indicates that each substrate could adopt different coordination geometries. Crystallographic comparison with mammalian cysteine dioxygenase shows that the overall active site geometry is conserved but suggests that the different substrate specificity can be related to replacement of an arginine by a glutamine in the active site. PMID:26272617
Inhibition Kinetics and Emodin Cocrystal Structure of a Type II Polyketide Ketoreductase†,‡
Korman, Tyler Paz; Tan, Yuhong; Wong, Justin; Luo, Rui; Tsai, Shiou-Chuan
2008-01-01
Type II polyketides are a class of natural products that include pharmaceutically important aromatic compounds such as the antibiotic tetracycline and antitumor compound doxorubicin. The type II polyketide synthase (PKS) is a complex consisting of 5–10 standalone domains homologous to fatty acid synthase (FAS). Polyketide ketoreductase (KR) provides regio- and stereochemical diversity during the reduction. How the type II polyketide KR specifically reduces only the C9 carbonyl group is not well understood. The cocrystal structures of actinorhodin polyketide ketoreductase (actKR) bound with NADPH or NADP+ and the inhibitor emodin were solved with the wild type and P94L mutant of actKR, revealing the first observation of a bent p-quinone in an enzyme active site. Molecular dynamics simulation help explain the origin of the bent geometry. Extensive screening for in vitro substrates shows that unlike FAS KR, the actKR prefers bicyclic substrates. Inhibition kinetics indicate that actKR follows an ordered Bi Bi mechanism. Together with docking simulations that identified a potential phosphopantetheine binding groove, the structural and functional studies reveal that the C9 specificity is a result of active site geometry and substrate ring constraints. The results lay the foundation for the design of novel aromatic polyketide natural products with different reduction patterns. PMID:18205400
Inhibition Kinetics And Emodin Cocrystal Structure of a Type II Polyketide Ketoreductase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Korman, T.P.; Tan, Y.-H.; Wong, J.
Type II polyketides are a class of natural products that include pharmaceutically important aromatic compounds such as the antibiotic tetracycline and antitumor compound doxorubicin. The type II polyketide synthase (PKS) is a complex consisting of 5-10 standalone domains homologous to fatty acid synthase (FAS). Polyketide ketoreductase (KR) provides regio- and stereochemical diversity during the reduction. How the type II polyketide KR specifically reduces only the C9 carbonyl group is not well understood. The cocrystal structures of actinorhodin polyketide ketoreductase (actKR) bound with NADPH or NADP{sup +} and the inhibitor emodin were solved with the wild type and P94L mutant ofmore » actKR, revealing the first observation of a bent p-quinone in an enzyme active site. Molecular dynamics simulation help explain the origin of the bent geometry. Extensive screening for in vitro substrates shows that unlike FAS KR, the actKR prefers bicyclic substrates. Inhibition kinetics indicate that actKR follows an ordered Bi Bi mechanism. Together with docking simulations that identified a potential phosphopantetheine binding groove, the structural and functional studies reveal that the C9 specificity is a result of active site geometry and substrate ring constraints. The results lay the foundation for the design of novel aromatic polyketide natural products with different reduction patterns.« less
Hydrogen behaviour at twist {110} grain boundaries in α-Fe.
McEniry, Eunan J; Hickel, Tilmann; Neugebauer, Jörg
2017-07-28
The behaviour of hydrogen at structural defects such as grain boundaries plays a critical role in the phenomenon of hydrogen embrittlement. However, characterization of the energetics and diffusion of hydrogen in the vicinity of such extended defects using conventional ab initio techniques is challenging due to the relatively large system sizes required when dealing with realistic grain boundary geometries. In order to be able to access the required system sizes, as well as high-throughput testing of a large number of configurations, while remaining within a quantum-mechanical framework, an environmental tight-binding model for the iron-hydrogen system has been developed. The resulting model is applied to study the behaviour of hydrogen at a class of low-energy {110}-terminated twist grain boundaries in α -Fe. We find that, for particular Σ values within the coincidence site lattice description, the atomic geometry at the interface plane provides extremely favourable trap sites for H, which also possess high escape barriers for diffusion. By contrast, via simulated tensile testing, weakly trapped hydrogen at the interface plane of the bulk-like Σ3 boundary acts as a 'glue' for the boundary, increasing both the energetic barrier and the elongation to rupture.This article is part of the themed issue 'The challenges of hydrogen and metals'. © 2017 The Author(s).
Li, Xin; Yang, Zhong-Zhi
2005-05-12
We present a potential model for Li(+)-water clusters based on a combination of the atom-bond electronegativity equalization and molecular mechanics (ABEEM/MM) that is to take ABEEM charges of the cation and all atoms, bonds, and lone pairs of water molecules into the intermolecular electrostatic interaction term in molecular mechanics. The model allows point charges on cationic site and seven sites of an ABEEM-7P water molecule to fluctuate responding to the cluster geometry. The water molecules in the first sphere of Li(+) are strongly structured and there is obvious charge transfer between the cation and the water molecules; therefore, the charge constraint on the ionic cluster includes the charged constraint on the Li(+) and the first-shell water molecules and the charge neutrality constraint on each water molecule in the external hydration shells. The newly constructed potential model based on ABEEM/MM is first applied to ionic clusters and reproduces gas-phase state properties of Li(+)(H(2)O)(n) (n = 1-6 and 8) including optimized geometries, ABEEM charges, binding energies, frequencies, and so on, which are in fair agreement with those measured by available experiments and calculated by ab initio methods. Prospects and benefits introduced by this potential model are pointed out.
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less
NASA Astrophysics Data System (ADS)
Lengyel, Iván M.; Morelli, Luis G.
2017-04-01
Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.
Effect of geometry on the pressure induced donor binding energy in semiconductor nanostructures
NASA Astrophysics Data System (ADS)
Kalpana, P.; Jayakumar, K.; Nithiananthi, P.
2015-09-01
The effect of geometry on an on-center hydrogenic donor impurity in a GaAs/(Ga,Al)As quantum wire (QWW) and quantum dot (QD) under the influence of Γ-X band mixing due to an applied hydrostatic pressure is theoretically studied. Numerical calculations are performed in an effective mass approximation. The ground state impurity energy is obtained by variational procedure. Both the effects of pressure and geometry are to exert an additional confinement on the impurity inside the wire as well as dot. We found that the donor binding energy is modified by the geometrical effects as well as by the confining potential when it is subjected to external pressure. The results are presented and discussed.
Yang, Chi Ming
2011-03-28
Metal-site Trp/His interactions are crucial to diverse metalloprotein functions. This paper presents a study using metal-motif mimicry to capture and dissect the static and transient components of physicochemical properties underlying the Trp/His aromatic side-chain noncovalent interactions across the first- and second-coordination spheres of biometal ions. Modular biomimetic constructs, EDTA-(L-Trp, L-His) or EWH and DTPA-(L-Trp, L-His) or DWH, featuring a function-significant Trp/His pair, enabled extracting the putative hydrophobic/hydrophilic aromatic interactions surrounding metal centers. Fluorescence, circular dichroism (CD) spectroscopic titrations and ESI mass spectrometry demonstrated that both the constructs stoichiometrically bind to Ca(2+), Co(2+), Cu(2+), Ni(2+), Mn(2+), Zn(2+), Cd(2+), and Fe(2+), and such binding was strongly coupled to stereospecific side-chain structure reorientations of the Trp indole and His imidazole rings. A mechanistic dichotomy corresponding to the participation of the indole unit in the binding event was revealed by a scaffold-platform correlation of steady-state fluorescence-response landscape, illuminating that secondary-coordination-sphere ligand cation-π interactions were immediately followed by subsequent transient physicochemical processes including through-space energy transfer, charge transfer and/or electron transfer, depending on the type of metals. The fluorescence quenching of Trp side chain by 3d metal ions can be ascribed to through-space d-π interactions. While the fluorescence titration was capable of illuminating a two-component energetic model, clean isosbestic/isodichroic points in the CD titration spectra indicated that the metallo-constructs, such as Cu(2+)-EWH complex, fold thermodynamically by means of a two-state equilibrium. Further, the metal-ion dependence of Trp conformational variation in the modular architecture of metal-bound scaffolds was evidenced unambiguously by the CD spectra and supported by MMFF calculations; both were capable of distinguishing between the coordination geometry and the preference for metal binding mode. The study thus helps understand how aromatic rings around metal-sites have unique capabilities through the control of the spatiotemporal distribution of noncovalent interaction elements to achieve diverse chemical functionality.
The allosteric switching mechanism in bacteriophage MS2
NASA Astrophysics Data System (ADS)
Perkett, Matthew R.; Mirijanian, Dina T.; Hagan, Michael F.
2016-07-01
We use all-atom simulations to elucidate the mechanisms underlying conformational switching and allostery within the coat protein of the bacteriophage MS2. Assembly of most icosahedral virus capsids requires that the capsid protein adopts different conformations at precise locations within the capsid. It has been shown that a 19 nucleotide stem loop (TR) from the MS2 genome acts as an allosteric effector, guiding conformational switching of the coat protein during capsid assembly. Since the principal conformational changes occur far from the TR binding site, it is important to understand the molecular mechanism underlying this allosteric communication. To this end, we use all-atom simulations with explicit water combined with a path sampling technique to sample the MS2 coat protein conformational transition, in the presence and absence of TR-binding. The calculations find that TR binding strongly alters the transition free energy profile, leading to a switch in the favored conformation. We discuss changes in molecular interactions responsible for this shift. We then identify networks of amino acids with correlated motions to reveal the mechanism by which effects of TR binding span the protein. We find that TR binding strongly affects residues located at the 5-fold and quasi-sixfold interfaces in the assembled capsid, suggesting a mechanism by which the TR binding could direct formation of the native capsid geometry. The analysis predicts amino acids whose substitution by mutagenesis could alter populations of the conformational substates or their transition rates.
Tian, Ye; Huang, Xiaoqiang; Zhu, Yushan
2015-08-01
Enzyme amino-acid sequences at ligand-binding interfaces are evolutionarily optimized for reactions, and the natural conformation of an enzyme-ligand complex must have a low free energy relative to alternative conformations in native-like or non-native sequences. Based on this assumption, a combined energy function was developed for enzyme design and then evaluated by recapitulating native enzyme sequences at ligand-binding interfaces for 10 enzyme-ligand complexes. In this energy function, the electrostatic interaction between polar or charged atoms at buried interfaces is described by an explicitly orientation-dependent hydrogen-bonding potential and a pairwise-decomposable generalized Born model based on the general side chain in the protein design framework. The energy function is augmented with a pairwise surface-area based hydrophobic contribution for nonpolar atom burial. Using this function, on average, 78% of the amino acids at ligand-binding sites were predicted correctly in the minimum-energy sequences, whereas 84% were predicted correctly in the most-similar sequences, which were selected from the top 20 sequences for each enzyme-ligand complex. Hydrogen bonds at the enzyme-ligand binding interfaces in the 10 complexes were usually recovered with the correct geometries. The binding energies calculated using the combined energy function helped to discriminate the active sequences from a pool of alternative sequences that were generated by repeatedly solving a series of mixed-integer linear programming problems for sequence selection with increasing integer cuts.
The allosteric switching mechanism in bacteriophage MS2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Perkett, Matthew R.; Mirijanian, Dina T.; Hagan, Michael F., E-mail: hagan@brandeis.edu
2016-07-21
We use all-atom simulations to elucidate the mechanisms underlying conformational switching and allostery within the coat protein of the bacteriophage MS2. Assembly of most icosahedral virus capsids requires that the capsid protein adopts different conformations at precise locations within the capsid. It has been shown that a 19 nucleotide stem loop (TR) from the MS2 genome acts as an allosteric effector, guiding conformational switching of the coat protein during capsid assembly. Since the principal conformational changes occur far from the TR binding site, it is important to understand the molecular mechanism underlying this allosteric communication. To this end, we usemore » all-atom simulations with explicit water combined with a path sampling technique to sample the MS2 coat protein conformational transition, in the presence and absence of TR-binding. The calculations find that TR binding strongly alters the transition free energy profile, leading to a switch in the favored conformation. We discuss changes in molecular interactions responsible for this shift. We then identify networks of amino acids with correlated motions to reveal the mechanism by which effects of TR binding span the protein. We find that TR binding strongly affects residues located at the 5-fold and quasi-sixfold interfaces in the assembled capsid, suggesting a mechanism by which the TR binding could direct formation of the native capsid geometry. The analysis predicts amino acids whose substitution by mutagenesis could alter populations of the conformational substates or their transition rates.« less
The allosteric switching mechanism in bacteriophage MS2
Perkett, Matthew R.; Mirijanian, Dina T.
2016-01-01
We use all-atom simulations to elucidate the mechanisms underlying conformational switching and allostery within the coat protein of the bacteriophage MS2. Assembly of most icosahedral virus capsids requires that the capsid protein adopts different conformations at precise locations within the capsid. It has been shown that a 19 nucleotide stem loop (TR) from the MS2 genome acts as an allosteric effector, guiding conformational switching of the coat protein during capsid assembly. Since the principal conformational changes occur far from the TR binding site, it is important to understand the molecular mechanism underlying this allosteric communication. To this end, we use all-atom simulations with explicit water combined with a path sampling technique to sample the MS2 coat protein conformational transition, in the presence and absence of TR-binding. The calculations find that TR binding strongly alters the transition free energy profile, leading to a switch in the favored conformation. We discuss changes in molecular interactions responsible for this shift. We then identify networks of amino acids with correlated motions to reveal the mechanism by which effects of TR binding span the protein. We find that TR binding strongly affects residues located at the 5-fold and quasi-sixfold interfaces in the assembled capsid, suggesting a mechanism by which the TR binding could direct formation of the native capsid geometry. The analysis predicts amino acids whose substitution by mutagenesis could alter populations of the conformational substates or their transition rates. PMID:27448905
Maugeri, Pearson T; Griese, Julia J; Branca, Rui M; Miller, Effie K; Smith, Zachary R; Eirich, Jürgen; Högbom, Martin; Shafaat, Hannah S
2018-01-31
The heterobimetallic R2lox protein binds both manganese and iron ions in a site-selective fashion and activates oxygen, ultimately performing C-H bond oxidation to generate a tyrosine-valine cross-link near the active site. In this work, we demonstrate that, following assembly, R2lox undergoes photoinduced changes to the active site geometry and metal coordination motif. Through spectroscopic, structural, and mass spectrometric characterization, the photoconverted species is found to consist of a tyrosinate-bound iron center following light-induced decarboxylation of a coordinating glutamate residue and cleavage of the tyrosine-valine cross-link. This process occurs with high quantum efficiencies (Φ = 3%) using violet and near-ultraviolet light, suggesting that the photodecarboxylation is initiated via ligand-to-metal charge transfer excitation. Site-directed mutagenesis and structural analysis suggest that the cross-linked tyrosine-162 is the coordinating residue. One primary product is observed following irradiation, indicating potential use of this class of proteins, which contains a putative substrate channel, for controlled photoinduced decarboxylation processes, with relevance for in vivo functionality of R2lox as well as application in environmental remediation.
Guy, Jodie E; Abreu, Isabel A; Moche, Martin; Lindqvist, Ylva; Whittle, Edward; Shanklin, John
2006-11-14
Sequence analysis of the diiron cluster-containing soluble desaturases suggests they are unrelated to other diiron enzymes; however, structural alignment of the core four-helix bundle of desaturases to other diiron enzymes reveals a conserved iron binding motif with similar spacing in all enzymes of this structural class, implying a common evolutionary ancestry. Detailed structural comparison of the castor desaturase with that of a peroxidase, rubrerythrin, shows remarkable conservation of both identity and geometry of residues surrounding the diiron center, with the exception of residue 199. Position 199 is occupied by a threonine in the castor desaturase, but the equivalent position in rubrerythrin contains a glutamic acid. We previously hypothesized that a carboxylate in this location facilitates oxidase chemistry in rubrerythrin by the close apposition of a residue capable of facilitating proton transfer to the activated oxygen (in a hydrophobic cavity adjacent to the diiron center based on the crystal structure of the oxygen-binding mimic azide). Here we report that desaturase mutant T199D binds substrate but its desaturase activity decreases by approximately 2 x 10(3)-fold. However, it shows a >31-fold increase in peroxide-dependent oxidase activity with respect to WT desaturase, as monitored by single-turnover stopped-flow spectrometry. A 2.65-A crystal structure of T199D reveals active-site geometry remarkably similar to that of rubrerythrin, consistent with its enhanced function as an oxidase enzyme. That a single amino acid substitution can switch reactivity from desaturation to oxidation provides experimental support for the hypothesis that the desaturase evolved from an ancestral oxidase enzyme.
Guy, Jodie E.; Abreu, Isabel A.; Moche, Martin; Lindqvist, Ylva; Whittle, Edward; Shanklin, John
2006-01-01
Sequence analysis of the diiron cluster-containing soluble desaturases suggests they are unrelated to other diiron enzymes; however, structural alignment of the core four-helix bundle of desaturases to other diiron enzymes reveals a conserved iron binding motif with similar spacing in all enzymes of this structural class, implying a common evolutionary ancestry. Detailed structural comparison of the castor desaturase with that of a peroxidase, rubrerythrin, shows remarkable conservation of both identity and geometry of residues surrounding the diiron center, with the exception of residue 199. Position 199 is occupied by a threonine in the castor desaturase, but the equivalent position in rubrerythrin contains a glutamic acid. We previously hypothesized that a carboxylate in this location facilitates oxidase chemistry in rubrerythrin by the close apposition of a residue capable of facilitating proton transfer to the activated oxygen (in a hydrophobic cavity adjacent to the diiron center based on the crystal structure of the oxygen-binding mimic azide). Here we report that desaturase mutant T199D binds substrate but its desaturase activity decreases by ≈2 × 103-fold. However, it shows a >31-fold increase in peroxide-dependent oxidase activity with respect to WT desaturase, as monitored by single-turnover stopped-flow spectrometry. A 2.65-Å crystal structure of T199D reveals active-site geometry remarkably similar to that of rubrerythrin, consistent with its enhanced function as an oxidase enzyme. That a single amino acid substitution can switch reactivity from desaturation to oxidation provides experimental support for the hypothesis that the desaturase evolved from an ancestral oxidase enzyme. PMID:17088542
Excess electrons in methanol clusters: Beyond the one-electron picture
NASA Astrophysics Data System (ADS)
Pohl, Gábor; Mones, Letif; Turi, László
2016-10-01
We performed a series of comparative quantum chemical calculations on various size negatively charged methanol clusters, ("separators=" CH 3 OH ) n - . The clusters are examined in their optimized geometries (n = 2-4), and in geometries taken from mixed quantum-classical molecular dynamics simulations at finite temperature (n = 2-128). These latter structures model potential electron binding sites in methanol clusters and in bulk methanol. In particular, we compute the vertical detachment energy (VDE) of an excess electron from increasing size methanol cluster anions using quantum chemical computations at various levels of theory including a one-electron pseudopotential model, several density functional theory (DFT) based methods, MP2 and coupled-cluster CCSD(T) calculations. The results suggest that at least four methanol molecules are needed to bind an excess electron on a hydrogen bonded methanol chain in a dipole bound state. Larger methanol clusters are able to form stronger interactions with an excess electron. The two simulated excess electron binding motifs in methanol clusters, interior and surface states, correlate well with distinct, experimentally found VDE tendencies with size. Interior states in a solvent cavity are stabilized significantly stronger than electron states on cluster surfaces. Although we find that all the examined quantum chemistry methods more or less overestimate the strength of the experimental excess electron stabilization, MP2, LC-BLYP, and BHandHLYP methods with diffuse basis sets provide a significantly better estimate of the VDE than traditional DFT methods (BLYP, B3LYP, X3LYP, PBE0). A comparison to the better performing many electron methods indicates that the examined one-electron pseudopotential can be reasonably used in simulations for systems of larger size.
Excess electrons in methanol clusters: Beyond the one-electron picture.
Pohl, Gábor; Mones, Letif; Turi, László
2016-10-28
We performed a series of comparative quantum chemical calculations on various size negatively charged methanol clusters, CH 3 OH n - . The clusters are examined in their optimized geometries (n = 2-4), and in geometries taken from mixed quantum-classical molecular dynamics simulations at finite temperature (n = 2-128). These latter structures model potential electron binding sites in methanol clusters and in bulk methanol. In particular, we compute the vertical detachment energy (VDE) of an excess electron from increasing size methanol cluster anions using quantum chemical computations at various levels of theory including a one-electron pseudopotential model, several density functional theory (DFT) based methods, MP2 and coupled-cluster CCSD(T) calculations. The results suggest that at least four methanol molecules are needed to bind an excess electron on a hydrogen bonded methanol chain in a dipole bound state. Larger methanol clusters are able to form stronger interactions with an excess electron. The two simulated excess electron binding motifs in methanol clusters, interior and surface states, correlate well with distinct, experimentally found VDE tendencies with size. Interior states in a solvent cavity are stabilized significantly stronger than electron states on cluster surfaces. Although we find that all the examined quantum chemistry methods more or less overestimate the strength of the experimental excess electron stabilization, MP2, LC-BLYP, and BHandHLYP methods with diffuse basis sets provide a significantly better estimate of the VDE than traditional DFT methods (BLYP, B3LYP, X3LYP, PBE0). A comparison to the better performing many electron methods indicates that the examined one-electron pseudopotential can be reasonably used in simulations for systems of larger size.
Gresh, Nohad; El Hage, Krystel; Perahia, David; Piquemal, Jean-Philip; Berthomieu, Catherine; Berthomieu, Dorothée
2014-11-05
The existence of a network of structured waters in the vicinity of the bimetallic site of Cu/Zn-superoxide dismutase (SOD) has been inferred from high-resolution X-ray crystallography. Long-duration molecular dynamics (MD) simulations could enable to quantify the lifetimes and possible interchanges of these waters between themselves as well as with a ligand diffusing toward the bimetallic site. The presence of several charged or polar ligands makes it necessary to resort to second-generation polarizable potentials. As a first step toward such simulations, we benchmark in this article the accuracy of one such potential, sum of interactions between fragments Ab initio computed (SIBFA), by comparisons with quantum mechanics (QM) computations. We first consider the bimetallic binding site of a Cu/Zn-SOD, in which three histidines and a water molecule are bound to Cu(I) and three histidines and one aspartate are bound to Zn(II). The comparisons are made for different His6 complexes with either one or both cations, and either with or without Asp and water. The total net charges vary from zero to three. We subsequently perform preliminary short-duration MD simulations of 296 waters solvating Cu/Zn-SOD. Six representative geometries are selected and energy-minimized. Single-point SIBFA and QM computations are then performed in parallel on model binding sites extracted from these six structures, each of which totals 301 atoms including the closest 28 waters from the Cu metal site. The ranking of their relative stabilities as given by SIBFA is identical to the QM one, and the relative energy differences by both approaches are fully consistent. In addition, the lowest-energy structure, from SIBFA and QM, has a close overlap with the crystallographic one. The SIBFA calculations enable to quantify the impact of polarization and charge transfer in the ranking of the six structures. Five structural waters, which connect Arg141 and Glu131, are endowed with very high dipole moments (2.7-3.0 Debye), equal and larger than the one computed by SIBFA in ice-like arrangements (2.7 D). Copyright © 2014 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sloan, J.W.
1984-01-01
These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less
Milczek, Erika M.; Binda, Claudia; Rovida, Stefano; Mattevi, Andrea; Edmondson, Dale E.
2011-01-01
Summary The major structural difference between human monoamine oxidases A (MAO A) and B (MAO B) is that MAO A has a monopartite substrate cavity of ~550 Å3 volume and MAO B contains a dipartite cavity structure with volumes of ~290 Å3 (entrance cavity) and ~400 Å3 (substrate cavity). Ile199 and Tyr326 side chains separate these two cavities in MAO B. To probe the function of these gating residues, Ile199Ala and Ile199Ala Tyr326Ala mutant forms of MAO B were investigated. Structural data on the Ile199Ala MAO B mutant show no alterations in active site geometries compared to WT enzyme while the Ile199Ala-Tyr326Ala MAO B mutant exhibits alterations in residues 100–103 which are part of the loop gating the entrance to the active site. Both mutant enzymes exhibit catalytic properties with increased amine KM but unaltered kcat values. The altered KM values on mutation are attributed to the influence of the cavity structure in the binding and subsequent deprotonation of the amine substrate. Both mutant enzymes exhibit weaker binding affinities relative to WT enzyme for small reversible inhibitors. Ile199Ala MAO B exhibits an increase in binding affinity for reversible MAO B specific inhibitors which bridge both cavities. The Ile199Ala-Tyr326Ala double mutant exhibits inhibitor binding properties more similar to those of MAO A than to MAO B. These results demonstrate the bipartite cavity structure in MAO B plays an important role in substrate and inhibitor recognition to distinguish its specificities from those of MAO A and provides insights into specific reversible inhibitor design for these membrane-bound enzymes. PMID:21978362
Pham, Nguyet N T; Le, Hung M
2017-05-19
In this study, we examine the adsorptions of Ni, Pd, and Pt clusters on C 60 by using a computational approach. Our calculation results show that the base structure of C 60 can host Ni n /Pd n /Pt n (n=1-4) clusters with good adsorption stability and the complexes establish either two or no unpaired electrons. The binding energy of Pd and Pt clusters increases as the number of metal atoms increases, implying that the coverage of C 60 with Pd or Pt preferentially establishes a large-size metal cluster. A single metal atom favorably occupies the C-C bridge site. For dimer clusters, the three metals of interest share a similar binding fashion, in which two metal atoms establish direct interactions with the C-C bridge sites. For trimer adsorptions, the formation of linear and triangular structures is observed. Both Pt 3 and Ni 3 preferably constitute isosceles triangles on C 60 , whilst Pd 3 favorably establishes a linear shape. Finally, for each of the Ni 4 and Pd 4 adsorption cases, we observed three stable binding configurations: rhombus, tetrahedron, and Y-form. Whereas Ni 4 establishes a tetrahedral form, Pd 4 attains the most stable form with the Y-shape geometry on C 60 . Overall, we observe that the trend of Pd binding to C 60 tends to go beyond the fashion of Ni and Pt. In terms of magnetic alignment, the Pd n -C 60 systems seem to be non-magnetic in most cases, unlike the Ni and Pt cases, the structures of which possess magnetic moments of 2 μB in their most stable forms. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Diels-Alder active-template synthesis of rotaxanes and metal-ion-switchable molecular shuttles.
Crowley, James D; Hänni, Kevin D; Leigh, David A; Slawin, Alexandra M Z
2010-04-14
A synthesis of [2]rotaxanes in which Zn(II) or Cu(II) Lewis acids catalyze a Diels-Alder cycloaddition to form the axle while simultaneously acting as the template for the assembly of the interlocked molecules is described. Coordination of the Lewis acid to a multidentate endotopic 2,6-di(methyleneoxymethyl)pyridyl- or bipyridine-containing macrocycle orients a chelated dienophile through the macrocycle cavity. Lewis acid activation of the double bond causes it to react with an incoming "stoppered" diene, affording the [2]rotaxane in up to 91% yield. Unusually for an active-template synthesis, the metal binding site "lives on" in these rotaxanes. This was exploited in the synthesis of a molecular shuttle containing two different ligating sites in which the position of the macrocycle could be switched by complexation with metal ions [Zn(II) and Pd(II)] with different preferred coordination geometries.
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Eash, D.A.
1993-01-01
Procedures provided for applying the drainage-basin and channel-geometry regression equations depend on whether the design-flood discharge estimate is for a site on an ungaged stream, an ungaged site on a gaged stream, or a gaged site. When both a drainage-basin and a channel-geometry regression-equation estimate are available for a stream site, a procedure is presented for determining a weighted average of the two flood estimates. The drainage-basin regression equations are applicable to unregulated rural drainage areas less than 1,060 square miles, and the channel-geometry regression equations are applicable to unregulated rural streams in Iowa with stabilized channels.
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
An Electrostatic Funnel in the GABA-Binding Pathway
Lightstone, Felice C.
2016-01-01
The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Honegr, Jan; Dolezal, Rafael; Malinak, David; Benkova, Marketa; Soukup, Ondrej; Almeida, Joyce S F D de; Franca, Tanos C C; Kuca, Kamil; Prymula, Roman
2018-01-04
In order to identify novel lead structures for human toll-like receptor 4 ( h TLR4) modulation virtual high throughput screening by a peta-flops-scale supercomputer has been performed. Based on the in silico studies, a series of 12 compounds related to tryptamine was rationally designed to retain suitable molecular geometry for interaction with the h TLR4 binding site as well as to satisfy general principles of drug-likeness. The proposed compounds were synthesized, and tested by in vitro and ex vivo experiments, which revealed that several of them are capable to stimulate h TLR4 in vitro up to 25% activity of Monophosphoryl lipid A. The specific affinity of the in vitro most potent substance was confirmed by surface plasmon resonance direct-binding experiments. Moreover, two compounds from the series show also significant ability to elicit production of interleukin 6.
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
A tool for calculating binding-site residues on proteins from PDB structures.
Hu, Jing; Yan, Changhui
2009-08-03
In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.
Kilina, Svetlana; Yarotski, Dzmitry A.; Talin, A. Alec; ...
2011-01-01
We present a combined approach that relies on computational simulations and scanning tunneling microscopy (STM) measurements to reveal morphological properties and stability criteria of carbon nanotube-DNA (CNT-DNA) constructs. Application of STM allows direct observation of very stable CNT-DNA hybrid structures with the well-defined DNA wrapping angle of 63.4 ° and a coiling period of 3.3 nm. Using force field simulations, we determine how the DNA-CNT binding energy depends on the sequence and binding geometry of a single strand DNA. This dependence allows us to quantitatively characterize the stability of a hybrid structure with an optimal π-stacking between DNA nucleotides and themore » tube surface and better interpret STM data. Our simulations clearly demonstrate the existence of a very stable DNA binding geometry for (6,5) CNT as evidenced by the presence of a well-defined minimum in the binding energy as a function of an angle between DNA strand and the nanotube chiral vector. This novel approach demonstrates the feasibility of CNT-DNA geometry studies with subnanometer resolution and paves the way towards complete characterization of the structural and electronic properties of drug-delivering systems based on DNA-CNT hybrids as a function of DNA sequence and a nanotube chirality.« less
Ryden, T A; de Mars, M; Beemon, K
1993-01-01
Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280
The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.
Activation mechanism of a noncanonical RNA-dependent RNA polymerase.
Garriga, Damià; Navarro, Aitor; Querol-Audí, Jordi; Abaitua, Fernando; Rodríguez, José F; Verdaguer, Núria
2007-12-18
Two lineages of viral RNA-dependent RNA polymerases (RDRPs) differing in the organization (canonical vs. noncanonical) of the palm subdomain have been identified. Phylogenetic analyses indicate that both lineages diverged at a very early stage of the evolution of the enzyme [Gorbalenya AE, Pringle FM, Zeddam JL, Luke BT, Cameron CE, Kalmakoff J, Hanzlik TN, Gordon KH, Ward VK (2002) J Mol Biol 324:47-62]. Here, we report the x-ray structure of a noncanonical birnaviral RDRP, named VP1, in its free form, bound to Mg(2+) ions, and bound to a peptide representing the polymerase-binding motif of the regulatory viral protein VP3. The structure of VP1 reveals that the noncanonical connectivity of the palm subdomain maintains the geometry of the catalytic residues found in canonical polymerases but results in a partial blocking of the active site cavity. The VP1-VP3 peptide complex shows a mode of polymerase activation in which VP3 binding promotes a conformational change that removes the steric blockade of the VP1 active site, facilitating the accommodation of the template and incoming nucleotides for catalysis. The striking structural similarities between birnavirus (dsRNA) and the positive-stranded RNA picornavirus and calicivirus RDRPs provide evidence supporting the existence of functional and evolutionary relationships between these two virus groups.
Kaluarachchi, Harini; Altenstein, Matthias; Sugumar, Sonia R; Balbach, Jochen; Zamble, Deborah B; Haupt, Caroline
2012-03-16
SlyD (sensitive to lysis D) is a nickel metallochaperone involved in the maturation of [NiFe]-hydrogenases in Escherichia coli (E. coli) and specifically contributes to the nickel delivery step during enzyme biosynthesis. This protein contains a C-terminal metal-binding domain that is rich in potential metal-binding residues that enable SlyD to bind multiple nickel ions with high affinity. The SlyD homolog from Thermus thermophilus does not contain the extended cysteine- and histidine-rich C-terminal tail of the E. coli protein, yet it binds a single Ni(II) ion tightly. To investigate whether a single metal-binding motif can functionally replace the full-length domain, we generated a truncation of E. coli SlyD, SlyD155. Ni(II) binding to SlyD155 was investigated by using isothermal titration calorimetry, NMR and electrospray ionization mass spectrometry measurements. This in vitro characterization revealed that SlyD155 contains a single metal-binding motif with high affinity for nickel. Structural characterization by X-ray absorption spectroscopy and NMR indicated that nickel was coordinated in an octahedral geometry with at least two histidines as ligands. Heterodimerization between SlyD and another hydrogenase accessory protein, HypB, is essential for optimal hydrogenase maturation and was confirmed for SlyD155 via cross-linking experiments and NMR titrations, as were conserved chaperone and peptidyl-prolyl isomerase activities. Although these properties of SlyD are preserved in the truncated version, it does not modulate nickel binding to HypB in vitro or contribute to the maturation of [NiFe]-hydrogenases in vivo, unlike the full-length protein. This study highlights the importance of the unusual metal-binding domain of E. coli SlyD in hydrogenase biogenesis. Copyright © 2012 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.
2000-01-01
Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase
NASA Astrophysics Data System (ADS)
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-01
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-05
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
NASA Astrophysics Data System (ADS)
D'Aquino, J. Alejandro; Ringe, Dagmar
2006-08-01
The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.
Allosteric binding sites in Rab11 for potential drug candidates
2018-01-01
Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, A.M.; Vandesande, F.; Orban, G.A.
1991-03-08
The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less
X-Ray Crystallographic Studies of Electrostatic Effects in Cubic Insulin
NASA Astrophysics Data System (ADS)
Gursky, Olga
1992-09-01
Cubic crystals of bovine insulin were obtained at pH 9 from sodium phosphate buffer. Pathway dependence of crystallization was analysed and crystallization using controlled nucleation was developed. Crystal stability and solubility were surveyed by dialysing the crystals against salt solutions varying in salt composition and ionic strength. Crystals dialysed in 0.1-0.2M Li, Na, K, Rb, NH(4) or Tl salt solutions at pH 9 diffracted to beyond 2.8A, while crystals dialysed in Cs, Mg, Ca or La rapidly lost lattice order. Change in the solvent anion did not affect crystal stability. Electron density maps calculated from X-ray data to 2.8A resolution showed two specific cation binding sites which may be occupied by monovalent cations with ionic radii <1.5A. One site lies between insulin dimers near crystallographic two-fold axis without the close involvement of protein charged groups. Cation binding at this site is important for crystal stability. The other site is alternatively occupied by B10 His in one of its two conformations. At pH 7, the Tl occupancy at both sites was decreased, at pH 9.5 the Tl occupancy of the site near B10 His was increased. The structure was refined using the refined model of cubic porcine insulin and the X-ray data collected to 2A resolution from a bovine insulin crystal at pH 9, to R = 16.1% for the data extending from 10A to 2A. High -resolution data from crystals at pH 7 and pH 10 were collected and analysed. The weights of the two B10 His conformers and the cation occupancy near B10 vary in the pH range from 7 to 10, indicating histidine titration. Shifts in the positions of B1-B4 at pH 7 suggest titration of the B-chain terminal amino groups. Co-operative conformational changes in the surface charged residues A1, A4, B21, B29, B30 at pH 10.2 suggest titration of the A-chain terminal amino groups. In several crystals treated with dichloroethane, the syn-dichloroethane was bound in the niche across the two-fold axis connecting insulin monomers. Dichloroethane binding does not perturb the site geometry and probably leads to cubic insulin preparations of increased stability.
Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A
1999-01-01
A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
NASA Astrophysics Data System (ADS)
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Wang, Qin; Wei, Yang; Mottamal, Madhusoodanan; Roberts, Mary F.; Krilov, Goran
2011-01-01
PTEN is an important control element of PI3K/AKT signaling involved in controlling the processes of embryonic development, cell migration and apoptosis. While its dysfunction is implicated in a large fraction of cancers, PTEN activity in the same pathway may also contribute to metabolic syndromes such as diabetes. In those cases, selective inhibitors of PTEN may be useful. A new class of chiral PTEN inhibitors based on the 3-deoxy-phosphatidylinositol derivatives was recently identified [Wang et al. (2008) J. Am. Chem. Soc. 130, 7746]. However, lack of detailed understanding of protein-ligand interactions has hampered efforts to develop effective agonists or antagonists of PTEN. Here, we use computational modeling to characterize the interactions of the diverse 3-deoxyphosphatidylinositol inhibitors with the PTEN protein. We show that, while each of the compounds binds with the inositol headgroup inserting into the proposed active site of the PTEN phosphatase domain, hydrogen bonding restrictions lead to distinct binding geometries for ligand pairs of opposite chirality. We furthermore demonstrate that the binding modes differ primarily in the orientation of acyl tails of the ligands and that the activity of the compounds is primarily controlled by the effectiveness of tail-protein contacts. These findings are confirmed by binding affinity calculations which are in good agreement with experiment. Finally, we show that while more potent D-series ligands bind in a manner similar to that of the native substrate, an alternate hydrophobic pocket suitable for binding the opposite chirality L-series inhibitors exists, offering the possibility of designing highly selective PTEN- targeting compounds. PMID:20538496
Metal active site elasticity linked to activation of homocysteine in methionine synthases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koutmos, Markos; Pejchal, Robert; Bomer, Theresa M.
2008-04-02
Enzymes possessing catalytic zinc centers perform a variety of fundamental processes in nature, including methyl transfer to thiols. Cobalamin-independent (MetE) and cobalamin-dependent (MetH) methionine synthases are two such enzyme families. Although they perform the same net reaction, transfer of a methyl group from methyltetrahydrofolate to homocysteine (Hcy) to form methionine, they display markedly different catalytic strategies, modular organization, and active site zinc centers. Here we report crystal structures of zinc-replete MetE and MetH, both in the presence and absence of Hcy. Structural investigation of the catalytic zinc sites of these two methyltransferases reveals an unexpected inversion of zinc geometry uponmore » binding of Hcy and displacement of an endogenous ligand in both enzymes. In both cases a significant movement of the zinc relative to the protein scaffold accompanies inversion. These structures provide new information on the activation of thiols by zinc-containing enzymes and have led us to propose a paradigm for the mechanism of action of the catalytic zinc sites in these and related methyltransferases. Specifically, zinc is mobile in the active sites of MetE and MetH, and its dynamic nature helps facilitate the active site conformational changes necessary for thiol activation and methyl transfer.« less
Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.
2013-01-01
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386
Straganz, Grit D; Diebold, Adrienne R; Egger, Sigrid; Nidetzky, Bernd; Solomon, Edward I
2010-02-09
Diketone cleaving enzyme (Dke1) is a dioxygenase with an atypical, three-histidine-ligated, mononuclear non-heme Fe(2+) center. To assess the role in enzyme catalysis of the hydrophilic residues in the active site pocket, residues Glu98, Arg80, Tyr70, and Thr107 were subjected to mutational analysis. Steady state and pre-steady state kinetics indicated a role for Glu98 in promoting both substrate binding and O(2) reduction. Additionally, the Glu98 substitution eliminated the pH dependence of substrate binding (k(cat)(app)/K(M)(app)-pH profile) present in wild-type Dke1 (pK(a) = 6.3 +/- 0.4 and 8.4 +/- 0.4). MCD spectroscopy revealed that the Glu98 --> Gln mutation leads to the conversion of the six-coordinate (6C) resting Fe(2+) center present in the wild-type enzyme at pH 7.0 to a mixture of five-coordinate (5C) and 6C sites. The 6C geometry was restored with a pH shift to 9.5 which also resulted in ligand field (LF) energy splittings identical to that found for wild-type (WT) Dke1 at pH 9.5. In WT Dke1, these LF transitions are shifted up in energy by approximately 300 cm(-1) at pH 9.5 relative to pH 7.0. These data, combined with CD pH titrations which reveal a pK(a) of approximately 8.2 for resting WT Dke1 and the Glu98 --> Gln variant, indicate the deprotonation of a metal-ligated water. Together, the kinetic and spectroscopic data reveal a stabilizing effect of Glu98 on the 6C geometry of the metal center, priming it for substrate ligation. Arg80 and Tyr70 are shown to promote O(2) reduction, while Thr107 stabilizes the Fe(II) cofactor.
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.
Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L
1997-03-11
We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.
Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok
2017-07-01
Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Sudhi, Geethu; Rajina, S. R.; Praveen, S. G.; Xavier, T. S.; Kenny, Peter T. M.; Jaiswal-Nagar, D.; Binoy, J.
2017-10-01
The bioactivity of compounds is mainly dependent on molecular structure and the present work aims to explore the bonding features responsible for biological activity of novel anticancer drug N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid ethyl ester (FNGABEE). In the present study, we investigate the molecular structural properties of newly synthesized title compound through experimental and quantum chemical studies. The detailed vibrational analysis has been performed using FT IR and FT Raman spectrum, aided by DFT computed geometry, vibrational spectrum, Eigen vector distribution and PED, at B3LYP/6-311 ++G(d,p) level. The resonance structure of naphthalene, different from that of benzene, revealed by molecular structure has been investigated using Csbnd C and Cdbnd C stretching modes. The proton transfer in amide has been analyzed to obtain spectral distinction between different carbonyl and Csbnd N groups which point to the reactive sites responsible for binding with DNA and bovine serum albumin (BSA). The spectral distinction between eclipsed and staggered form of ferrocene has been analyzed. The molecular docking of FNGABEE with BSA and DNA has been performed to find the strength of binding and the moieties responsible for the interactions. The experimental binding studies of FNGABEE with BSA and DNA has been performed using UV absorption spectroscopy and fluorometric assay, to find the nature and strength of binding.
Dahms, Sven O.; Arciniega, Marcelino; Steinmetzer, Torsten; Huber, Robert; Than, Manuel E.
2016-01-01
Proprotein convertases (PCs) are highly specific proteases required for the proteolytic modification of many secreted proteins. An unbalanced activity of these enzymes is connected to pathologies like cancer, atherosclerosis, hypercholesterolaemia, and infectious diseases. Novel protein crystallographic structures of the prototypical PC family member furin in different functional states were determined to 1.8–2.0 Å. These, together with biochemical data and modeling by molecular dynamics calculations, suggest essential elements underlying its unusually high substrate specificity. Furin shows a complex activation mechanism and exists in at least four defined states: (i) the “off state,” incompatible with substrate binding as seen in the unliganded enzyme; (ii) the active “on state” seen in inhibitor-bound furin; and the respective (iii) calcium-free and (iv) calcium-bound forms. The transition from the off to the on state is triggered by ligand binding at subsites S1 to S4 and appears to underlie the preferential recognition of the four-residue sequence motif of furin. The molecular dynamics simulations of the four structural states reflect the experimental observations in general and provide approximations of the respective stabilities. Ligation by calcium at the PC-specific binding site II influences the active-site geometry and determines the rotamer state of the oxyanion hole-forming Asn295, and thus adds a second level of the activity modulation of furin. The described crystal forms and the observations of different defined functional states may foster the development of new tools and strategies for pharmacological intervention targeting furin. PMID:27647913
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.
2005-01-01
The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less
Zn(II) and Hg(II) binding to a designed peptide that accommodates different coordination geometries.
Szunyogh, Dániel; Gyurcsik, Béla; Larsen, Flemming H; Stachura, Monika; Thulstrup, Peter W; Hemmingsen, Lars; Jancsó, Attila
2015-07-28
Designed metal ion binding peptides offer a variety of applications in both basic science as model systems of more complex metalloproteins, and in biotechnology, e.g. in bioremediation of toxic metal ions, biomining or as artificial enzymes. In this work a peptide (HS: Ac-SCHGDQGSDCSI-NH2) has been specifically designed for binding of both Zn(II) and Hg(II), i.e. metal ions with different preferences in terms of coordination number, coordination geometry, and to some extent ligand composition. It is demonstrated that HS accommodates both metal ions, and the first coordination sphere, metal ion exchange between peptides, and speciation are characterized as a function of pH using UV-absorption-, synchrotron radiation CD-, (1)H-NMR-, and PAC-spectroscopy as well as potentiometry. Hg(II) binds to the peptide with very high affinity in a {HgS2} coordination geometry, bringing together the two cysteinates close to each end of the peptide in a loop structure. Despite the high affinity, Hg(II) is kinetically labile, exchanging between peptides on the subsecond timescale, as indicated by line broadening in (1)H-NMR. The Zn(II)-HS system displays more complex speciation, involving monomeric species with coordinating cysteinates, histidine, and a solvent water molecule, as well as HS-Zn(II)-HS complexes. In summary, the HS peptide displays conformational flexibility, contains many typical metal ion binding groups, and is able to accommodate metal ions with different structural and ligand preferences with high affinity. As such, the HS peptide may be a scaffold offering binding of a variety of metal ions, and potentially serve for metal ion sequestration in biotechnological applications.
Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*
Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei
2015-01-01
The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonez, E.; Thiyagarajan, S.; Cook, J.D.
2009-05-22
Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less
NASA Astrophysics Data System (ADS)
Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong
2013-08-01
The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Jacobson, A.E.; Rice, K.C.
1987-11-01
Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less
Structure and binding energy of the H2S dimer at the CCSD(T) complete basis set limit.
Lemke, Kono H
2017-06-21
This study presents results for the binding energy and geometry of the H 2 S dimer which have been computed using Møller-Plesset perturbation theory (MP2, MP4) and coupled cluster (CCSD, CCSD(T)) calculations with basis sets up to aug-cc-pV5Z. Estimates of D e , E ZPE , D o , and dimer geometry have been obtained at each level of theory by taking advantage of the systematic convergence behavior toward the complete basis set (CBS) limit. The CBS limit binding energy values of D e are 1.91 (MP2), 1.75 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD[T]). The most accurate values for the equilibrium S-S distance r SS (without counterpoise correction) are 4.080 (MP2/aug-cc-pV5Z), 4.131 (MP4/aug-cc-pVQZ), 4.225 (CCSD/aug-cc-pVQZ), and 4.146 Å (CCSD(T)/aug-cc-pVQZ). This study also evaluates the effect of counterpoise correction on the H 2 S dimer geometry and binding energy. As regards the structure of (H 2 S) 2 , MPn, CCSD, and CCSD(T) level values of r SS , obtained by performing geometry optimizations on the counterpoise-corrected potential energy surface, converge systematically to CBS limit values of 4.099 (MP2), 4.146 (MP4), 4.233 (CCSD), and 4.167 Å (CCSD(T)). The corresponding CBS limit values of the equilibrium binding energy D e are 1.88 (MP2), 1.76 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD(T)), the latter in excellent agreement with the measured binding energy value of 1.68 ± 0.02 kcal/mol reported by Ciaffoni et al. [Appl. Phys. B 92, 627 (2008)]. Combining CBS electronic binding energies D e with E ZPE predicted by CCSD(T) vibrational second-order perturbation theory calculations yields D o = 1.08 kcal/mol, which is around 0.6 kcal/mol smaller than the measured value of 1.7 ± 0.3 kcal/mol. Overall, the results presented here demonstrate that the application of high level calculations, in particular CCSD(T), in combination with augmented correlation consistent basis sets provides valuable insight into the structure and energetics of the hydrogen sulfide dimer.
Structure and binding energy of the H2S dimer at the CCSD(T) complete basis set limit
NASA Astrophysics Data System (ADS)
Lemke, Kono H.
2017-06-01
This study presents results for the binding energy and geometry of the H2S dimer which have been computed using Møller-Plesset perturbation theory (MP2, MP4) and coupled cluster (CCSD, CCSD(T)) calculations with basis sets up to aug-cc-pV5Z. Estimates of De, EZPE, Do, and dimer geometry have been obtained at each level of theory by taking advantage of the systematic convergence behavior toward the complete basis set (CBS) limit. The CBS limit binding energy values of De are 1.91 (MP2), 1.75 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD[T]). The most accurate values for the equilibrium S-S distance rSS (without counterpoise correction) are 4.080 (MP2/aug-cc-pV5Z), 4.131 (MP4/aug-cc-pVQZ), 4.225 (CCSD/aug-cc-pVQZ), and 4.146 Å (CCSD(T)/aug-cc-pVQZ). This study also evaluates the effect of counterpoise correction on the H2S dimer geometry and binding energy. As regards the structure of (H2S)2, MPn, CCSD, and CCSD(T) level values of rSS, obtained by performing geometry optimizations on the counterpoise-corrected potential energy surface, converge systematically to CBS limit values of 4.099 (MP2), 4.146 (MP4), 4.233 (CCSD), and 4.167 Å (CCSD(T)). The corresponding CBS limit values of the equilibrium binding energy De are 1.88 (MP2), 1.76 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD(T)), the latter in excellent agreement with the measured binding energy value of 1.68 ± 0.02 kcal/mol reported by Ciaffoni et al. [Appl. Phys. B 92, 627 (2008)]. Combining CBS electronic binding energies De with EZPE predicted by CCSD(T) vibrational second-order perturbation theory calculations yields Do = 1.08 kcal/mol, which is around 0.6 kcal/mol smaller than the measured value of 1.7 ± 0.3 kcal/mol. Overall, the results presented here demonstrate that the application of high level calculations, in particular CCSD(T), in combination with augmented correlation consistent basis sets provides valuable insight into the structure and energetics of the hydrogen sulfide dimer.
Abou-Zied, Osama K
2015-01-01
Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.
Pikler, G M; Webster, R A; Spelsberg, T C
1976-01-01
Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147
Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo
NASA Astrophysics Data System (ADS)
Schwartz, Rochelle D.; Kellar, Kenneth J.
1983-04-01
Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.
Substance P binding sites in the nucleus tractus solitarius of the cat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maley, B.E.; Sasek, C.A.; Seybold, V.S.
1988-11-01
Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less
NASA Astrophysics Data System (ADS)
Patwardhan, Anjali A.
The antibacterial activity of aminoglycosides stems from their high affinity binding to the 16S rRNA in bacteria resulting in inhibition of protein synthesis. Used to treat acute bacterial infections these antibiotics have limited applications due to their high dosage requirements and the emergence of resistant strains. We have synthesized and characterized Cu(II) derivatives of the aminoglycosides, kanamycin A, tobramycin, neamine, kanamycin B, neomycin B, and paromomycin. The first three exhibit preferential and tight binding to Cu(II) as against neomycin B and kanamycin B and paromomycin. EPR of frozen solutions and UV-visible spectroscopy suggest a change in geometry around the Cu(II) but the stabilities of the complexes in water differ. These copper derivatives efficiently cleave plasmid DNA at micromolar concentrations (hydrolytic) and at nanomolar concentrations in the presence co-reactants like hydrogen peroxide or ascorbic acid. Hydrolysis is multi turnover and exhibits Michelis-Menten kinetics with enzyme-like behavior whereas oxidative cleavage is highly specific with C-4' H abstraction resulting in characteristic base propenal and nucleotide base products. Hydroxyl radicals generated are copper based and are generated in close proximity of the substrate. Hammerhead ribozymes are selectively hydrolyzed in the presence of divalent ions with Mg2+ being the metal ion of choice in vivo . Our studies with complex ions like cobalt hexaammine and fac-triamminetriaquochromium(III) establish outer sphere interactions of Mg2+ with the hammerhead in the catalytic site. There are two sets of sites, one structural and one catalytic. Complex ions in the catalytic site and divalent ions in the structural site result in a slow but active hammerhead ribozyme suggesting that the complex ions are not inhibitory, contrary to what was suggested previously.
Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.
1991-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G
1992-05-05
Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.
Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
Kawasaki, Kazuyoshi; Ogawa, Seturou
2003-01-01
NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.
Preliminary Work in Obtaining Site-Directed Mutants of Hen Egg White Lysozyme
NASA Technical Reports Server (NTRS)
Holmes, Leonard D.
1996-01-01
Protein crystal growth studies are recognized as a critical endeavor in the field of molecular biotechnology. The scientific applications of this field include the understanding of how enzymes function and the accumulation of accurate information of atomic structures, a key factor in the process of rational drug design. NASA has committed substantial investment and resources to the field of protein crystal growth and has conducted many microgravity protein crystal growth experiments aboard shuttle flights. Crystals grown in space tend to be larger, denser and have a more perfect habit and geometry. These improved properties gained in the microgravity environment of space result largely from the reduction of solutal convection, and the elimination of sedimentation at the growing crystal surface. Shuttle experiments have yielded many large, high quality crystals that are suitable for high resolution X-ray diffraction analysis. Examples of biologically important macromolecules which have been successfully crystallized during shuttle missions include: lysozyme, isocitrate lyase, gamma-interferon, insulin, human serum albumin and canavalin. Numerous other examples are also available. In addition to obtaining high quality crystals, investigators are also interested in learning the mechanisms by which the growth events take place. Crystallization experiments indicate that for the enzyme HEWL, measured growth rates do not follow mathematical models for 2D nucleation and dislocation-led growth of tetragonal protein crystals. As has been suggested by the laboratory of Marc L. Pusey, a possible explanation for the disagreement between observation and data is that HEWL tetraconal crystals form by aggregated units of lysozyme in supersaturated solutions. Surface measurement data was shown to fit very well with a model using an octamer unit cell as the growth unit. According to this model, the aggregation pathway and subsequent crystal growth is described by: monomer < ------ > dimer < ------- > tetramer < ------ > octamer < ------ > higher order. It is believed that multimer aggregation of lysozyme occurs by interaction at specific binding sites on the surface of the protein crystals. If the presence of discrete binding sites and the aggregation hypothesis is true, then it follows that the alteration of the binding site(s) should have significant effect on the measurements obtained during growth experiments. Site-directed mutagenesis allows the specific alteration of proteins by replacement, deletion or addition of specific amino acid residues. This report outlines the approach for this strategy and the progress made thus far toward that end.
CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.
Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar
2017-09-01
Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine
Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.
2015-01-01
Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-05-01
Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCann, D.J.; Su, T.P.
1991-05-01
The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less
Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.
Suzuki, N; Mihashi, K
1991-01-01
The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.
The interactions of several PAHs, and some of their possible metabolites, with the ligand binding domain of the estrogen receptor have been examined using molecular docking and quantum mechanical methods. The geometries of the PAHs were optimized at the Hartree-Fock level and the...
Distinct Functional Domains of Ubc9 Dictate Cell Survival and Resistance to Genotoxic Stress
van Waardenburg, Robert C. A. M.; Duda, David M.; Lancaster, Cynthia S.; Schulman, Brenda A.; Bjornsti, Mary-Ann
2006-01-01
Covalent modification with SUMO alters protein function, intracellular localization, or protein-protein interactions. Target recognition is determined, in part, by the SUMO E2 enzyme, Ubc9, while Siz/Pias E3 ligases may facilitate select interactions by acting as substrate adaptors. A yeast conditional Ubc9P123L mutant was viable at 36°C yet exhibited enhanced sensitivity to DNA damage. To define functional domains in Ubc9 that dictate cellular responses to genotoxic stress versus those necessary for cell viability, a 1.75-Å structure of yeast Ubc9 that demonstrated considerable conservation of backbone architecture with human Ubc9 was solved. Nevertheless, differences in side chain geometry/charge guided the design of human/yeast chimeras, where swapping domains implicated in (i) binding residues within substrates that flank canonical SUMOylation sites, (ii) interactions with the RanBP2 E3 ligase, and (iii) binding of the heterodimeric E1 and SUMO had distinct effects on cell growth and resistance to DNA-damaging agents. Our findings establish a functional interaction between N-terminal and substrate-binding domains of Ubc9 and distinguish the activities of E3 ligases Siz1 and Siz2 in regulating cellular responses to genotoxic stress. PMID:16782883
Cho, Eun-Min; Singh, Dheeraj K; Ganbold, Erdene-Ochir; Dembereldorj, Uuriintuya; Jang, Seok-Won; Kim, Doseok; Choo, Jaebum; Kim, Sehun; Lee, Cheol Min; Yang, Sung Ik; Joo, Sang-Woo
2014-01-01
Surface-enhanced Raman scattering (SERS) of an antifungal reagent, myclobutanil (MCB), was performed on Au and Ag nanoparticles (NPs) to estimate the drug-release behaviors in fungal cells. A density functional theory (DFT) calculation was introduced to predict a favorable binding site of MCB to either the Ag or Au atom. Myclobutanil was presumed to bind more strongly to Au than to Ag in their most stable, optimized geometries of the N4 atom in its 1,2,4-triazole unit binding to the metal atom. Strong intensities were observed in the Ag SERS spectra only at acidic pH values, whereas the most prominent peaks in the Au SERS spectra of MCB matched quite well with those of 1,2,4-triazole regardless of pH conditions. The Raman spectral intensities of the MCB-assembled Ag and Au NPs decreased after treatment with either potato dextrose agar (PDA) or glutathione (GSH). Darkfield microscopy and confocal SERS were performed to analyze the MCB-assembled metal NPs inside Penicillium digitatum fungal cells. The results suggested that MCB was released from the metal NPs in the intracellular GSH in the fungi because we observed only fungal cell peaks.
Calculations of proton-binding thermodynamics in proteins.
Beroza, P; Case, D A
1998-01-01
Computational models of proton binding can range from the chemically complex and statistically simple (as in the quantum calculations) to the chemically simple and statistically complex. Much progress has been made in the multiple-site titration problem. Calculations have improved with the inclusion of more flexibility in regard to both the geometry of the proton binding and the larger scale protein motions associated with titration. This article concentrated on the principles of current calculations, but did not attempt to survey their quantitative performance. This is (1) because such comparisons are given in the cited papers and (2) because continued developments in understanding conformational flexibility and interaction energies will be needed to develop robust methods with strong predictive power. Nevertheless, the advances achieved over the past few years should not be underestimated: serious calculations of protonation behavior and its coupling to conformational change can now be confidently pursued against a backdrop of increasing understanding of the strengths and limitations of such models. It is hoped that such theoretical advances will also spur renewed experimental interest in measuring both overall titration curves and individual pKa values or pKa shifts. Exploration of the shapes of individual titration curves (as measured by Hill coefficients and other parameters) would also be useful in assessing the accuracy of computations and in drawing connections to functional behavior.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luthin, G.R.; Wolfe, B.B.
The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less
Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H
1997-02-28
The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Existence of three subtypes of bradykinin B2 receptors in guinea pig.
Seguin, L; Widdowson, P S; Giesen-Crouse, E
1992-12-01
We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Locking mechanisms in degree-4 vertex origami structures
NASA Astrophysics Data System (ADS)
Fang, Hongbin; Li, Suyi; Xu, Jian; Wang, K. W.
2016-04-01
Origami has emerged as a potential tool for the design of mechanical metamaterials and metastructures whose novel properties originate from their crease patterns. Most of the attention in origami engineering has focused on the wellknown Miura-Ori, a folded tessellation that is flat-foldable for folded sheet and stacked blocks. This study advances the state of the art and expands the research field to investigate generic degree-4 vertex (4-vertex) origami, with a focus on facet-binding. In order to understand how facet-binding attributes to the mechanical properties of 4-vertex origami structures, geometries of the 4-vertex origami cells are analyzed and analytically expressed. Through repeating and stacking 4-vertex cells, origami sheets and stacked origami blocks can be constructed. Geometry analyses discover four mechanisms that will lead to the self-locking of 4-vertex origami cells, sheets, and stacked blocks: in-cell facet-binding, inlayer facet-binding, inter-layer facet binding, and in-layer and inter-layer facet-bindings. These mechanisms and the predicted self-locking phenomena are verified through 3D simulations and prototype experiments. Finally, this paper briefly introduces the unusual mechanical properties caused by the locking of 4-vertex origami structures. The research reported in this paper could foster a new breed of self-locking structures with various engineering applications.
Nguyen, T V; Juorio, A V
1989-10-01
The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.
Pyranopterin conformation defines the function of molybdenum and tungsten enzymes.
Rothery, Richard A; Stein, Benjamin; Solomonson, Matthew; Kirk, Martin L; Weiner, Joel H
2012-09-11
We have analyzed the conformations of 319 pyranopterins in 102 protein structures of mononuclear molybdenum and tungsten enzymes. These span a continuum between geometries anticipated for quinonoid dihydro, tetrahydro, and dihydro oxidation states. We demonstrate that pyranopterin conformation is correlated with the protein folds defining the three major mononuclear molybdenum and tungsten enzyme families, and that binding-site micro-tuning controls pyranopterin oxidation state. Enzymes belonging to the bacterial dimethyl sulfoxide reductase (DMSOR) family contain a metal-bis-pyranopterin cofactor, the two pyranopterins of which have distinct conformations, with one similar to the predicted tetrahydro form, and the other similar to the predicted dihydro form. Enzymes containing a single pyranopterin belong to either the xanthine dehydrogenase (XDH) or sulfite oxidase (SUOX) families, and these have pyranopterin conformations similar to those predicted for tetrahydro and dihydro forms, respectively. This work provides keen insight into the roles of pyranopterin conformation and oxidation state in catalysis, redox potential modulation of the metal site, and catalytic function.
Co(II) Coordination in Prokaryotic Zinc Finger Domains as Revealed by UV-Vis Spectroscopy
Sivo, Valeria; D'Abrosca, Gianluca; Russo, Luigi; Iacovino, Rosa; Pedone, Paolo Vincenzo; Fattorusso, Roberto
2017-01-01
Co(II) electronic configuration allows its use as a spectroscopic probe in UV-Vis experiments to characterize the metal coordination sphere that is an essential component of the functional structure of zinc-binding proteins and to evaluate the metal ion affinities of these proteins. Here, exploiting the capability of the prokaryotic zinc finger to use different combinations of residues to properly coordinate the structural metal ion, we provide the UV-Vis characterization of Co(II) addition to Ros87 and its mutant Ros87_C27D which bears an unusual CysAspHis2 coordination sphere. Zinc finger sites containing only one cysteine have been infrequently characterized. We show for the CysAspHis2 coordination an intense d-d transition band, blue-shifted with respect to the Cys2His2 sphere. These data complemented by NMR and CD data demonstrate that the tetrahedral geometry of the metal site is retained also in the case of a single-cysteine coordination sphere. PMID:29386985
NASA Astrophysics Data System (ADS)
Neyman, K. M.; Rösch, N.
1993-11-01
First principles density functional cluster investigations of adsorption at the (001) surface of pure and doped magnesium oxide are carried out to characterize and compare the interaction of CO molecules with main group (Mg 2+) and d metal (Co 2+, Ni 2+, Cu 2+) surface cationic centers of the ionic substrate. The geometry of the adsorption complexes, the binding mechanism and spectroscopic manifestations of the surface species are analyzed. Special attention is payed to vibrational frequencies and intensities. The calculations qualitatively reproduce observed trends in the adsorption-induced frequency shifts for the series of the surface aggregates Mg 5cCO→Ni 5cCO→CO 5cCO and the corresponding change of the infrared intensities of the CO vibrational mode. For the transition metal impurity sites these results are rationalized in terms of a small, but notable Md πCOπ interaction.
Co(II) Coordination in Prokaryotic Zinc Finger Domains as Revealed by UV-Vis Spectroscopy.
Sivo, Valeria; D'Abrosca, Gianluca; Russo, Luigi; Iacovino, Rosa; Pedone, Paolo Vincenzo; Fattorusso, Roberto; Isernia, Carla; Malgieri, Gaetano
2017-01-01
Co(II) electronic configuration allows its use as a spectroscopic probe in UV-Vis experiments to characterize the metal coordination sphere that is an essential component of the functional structure of zinc-binding proteins and to evaluate the metal ion affinities of these proteins. Here, exploiting the capability of the prokaryotic zinc finger to use different combinations of residues to properly coordinate the structural metal ion, we provide the UV-Vis characterization of Co(II) addition to Ros87 and its mutant Ros87_C27D which bears an unusual CysAspHis 2 coordination sphere. Zinc finger sites containing only one cysteine have been infrequently characterized. We show for the CysAspHis 2 coordination an intense d - d transition band, blue-shifted with respect to the Cys 2 His 2 sphere. These data complemented by NMR and CD data demonstrate that the tetrahedral geometry of the metal site is retained also in the case of a single-cysteine coordination sphere.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.
2013-01-01
The ability to interact with different partners is one of the most important features in proteins. Proteins that bind a large number of partners (hubs) have been often associated with intrinsic disorder. However, many examples exist of hubs with an ordered structure, and evidence of a general mechanism promoting promiscuity in ordered proteins is still elusive. An intriguing hypothesis is that promiscuous binding sites have specific dynamical properties, distinct from the rest of the interface and pre-existing in the protein isolated state. Here, we present the first comprehensive study of the intrinsic dynamics of promiscuous residues in a large protein data set. Different computational methods, from coarse-grained elastic models to geometry-based sampling methods and to full-atom Molecular Dynamics simulations, were used to generate conformational ensembles for the isolated proteins. The flexibility and dynamic correlations of interface residues with a different degree of binding promiscuity were calculated and compared considering side chain and backbone motions, the latter both on a local and on a global scale. The study revealed that (a) promiscuous residues tend to be more flexible than nonpromiscuous ones, (b) this additional flexibility has a higher degree of organization, and (c) evolutionary conservation and binding promiscuity have opposite effects on intrinsic dynamics. Findings on simulated ensembles were also validated on ensembles of experimental structures extracted from the Protein Data Bank (PDB). Additionally, the low occurrence of single nucleotide polymorphisms observed for promiscuous residues indicated a tendency to preserve binding diversity at these positions. A case study on two ubiquitin-like proteins exemplifies how binding promiscuity in evolutionary related proteins can be modulated by the fine-tuning of the interface dynamics. The interplay between promiscuity and flexibility highlighted here can inspire new directions in protein–protein interaction prediction and design methods. PMID:24250278
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Protein social behavior makes a stronger signal for partner identification than surface geometry
Laine, Elodie
2016-01-01
ABSTRACT Cells are interactive living systems where proteins movements, interactions and regulation are substantially free from centralized management. How protein physico‐chemical and geometrical properties determine who interact with whom remains far from fully understood. We show that characterizing how a protein behaves with many potential interactors in a complete cross‐docking study leads to a sharp identification of its cellular/true/native partner(s). We define a sociability index, or S‐index, reflecting whether a protein likes or not to pair with other proteins. Formally, we propose a suitable normalization function that accounts for protein sociability and we combine it with a simple interface‐based (ranking) score to discriminate partners from non‐interactors. We show that sociability is an important factor and that the normalization permits to reach a much higher discriminative power than shape complementarity docking scores. The social effect is also observed with more sophisticated docking algorithms. Docking conformations are evaluated using experimental binding sites. These latter approximate in the best possible way binding sites predictions, which have reached high accuracy in recent years. This makes our analysis helpful for a global understanding of partner identification and for suggesting discriminating strategies. These results contradict previous findings claiming the partner identification problem being solvable solely with geometrical docking. Proteins 2016; 85:137–154. © 2016 Wiley Periodicals, Inc. PMID:27802579
Protein social behavior makes a stronger signal for partner identification than surface geometry.
Laine, Elodie; Carbone, Alessandra
2017-01-01
Cells are interactive living systems where proteins movements, interactions and regulation are substantially free from centralized management. How protein physico-chemical and geometrical properties determine who interact with whom remains far from fully understood. We show that characterizing how a protein behaves with many potential interactors in a complete cross-docking study leads to a sharp identification of its cellular/true/native partner(s). We define a sociability index, or S-index, reflecting whether a protein likes or not to pair with other proteins. Formally, we propose a suitable normalization function that accounts for protein sociability and we combine it with a simple interface-based (ranking) score to discriminate partners from non-interactors. We show that sociability is an important factor and that the normalization permits to reach a much higher discriminative power than shape complementarity docking scores. The social effect is also observed with more sophisticated docking algorithms. Docking conformations are evaluated using experimental binding sites. These latter approximate in the best possible way binding sites predictions, which have reached high accuracy in recent years. This makes our analysis helpful for a global understanding of partner identification and for suggesting discriminating strategies. These results contradict previous findings claiming the partner identification problem being solvable solely with geometrical docking. Proteins 2016; 85:137-154. © 2016 Wiley Periodicals, Inc. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.
Chemical and structural characterization of copper adsorbed on mosses (Bryophyta).
González, Aridane G; Jimenez-Villacorta, Felix; Beike, Anna K; Reski, Ralf; Adamo, Paola; Pokrovsky, Oleg S
2016-05-05
The adsorption of copper on passive biomonitors (devitalized mosses Hypnum sp., Sphagnum denticulatum, Pseudoscleropodium purum and Brachythecium rutabulum) was studied under different experimental conditions such as a function of pH and Cu concentration in solution. Cu assimilation by living Physcomitrella patents was also investigated. Molecular structure of surface adsorbed and incorporated Cu was studied by X-ray Absorption Spectroscopy (XAS). Devitalized mosses exhibited the universal adsorption pattern of Cu as a function of pH, with a total binding sites number 0.05-0.06 mmolg(dry)(-1) and a maximal adsorption capacity of 0.93-1.25 mmolg(dry)(-1) for these devitalized species. The Extended X-ray Absorption Fine Structure (EXAFS) fit of the first neighbor demonstrated that for all studied mosses there are ∼4.5 O/N atoms around Cu at ∼1.95 Å likely in a pseudo-square geometry. The X-ray Absorption Near Edge Structure (XANES) analysis demonstrated that Cu(II)-cellulose (representing carboxylate groups) and Cu(II)-phosphate are the main moss surface binding moieties, and the percentage of these sites varies as a function of solution pH. P. patens exposed during one month to Cu(2+) yielded ∼20% of Cu(I) in the form of Cu-S(CN) complexes, suggesting metabolically-controlled reduction of adsorbed and assimilated Cu(2+). Copyright © 2016 Elsevier B.V. All rights reserved.
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.
Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A
2011-05-31
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C.
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
McCorkle, Sean R; McCombie, WR; Dunn, John J
2011-01-01
Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205
Ethylene binding site affinity in ripening apples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blankenship, S.M.; Sisler, E.C.
1993-09-01
Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less
NASA Technical Reports Server (NTRS)
D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.
2002-01-01
Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.
Functional identification and characterization of sodium binding sites in Na symporters
Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.
2013-01-01
Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006
Navé, Jean-François; Benveniste, Pierre
1984-01-01
The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499
Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris
2015-01-01
The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415
Benyhe, S; Márki, A; Nachtsheim, Corina; Holzgrabe, Ulrike; Borsodi, Anna
2003-01-01
Previous pharmacological results have suggested that members of the heterocyclic bicyclo[3.3.1]nonan-9-one-like compounds are potent kappa-opioid receptor specific agonists. One lead molecule of this series. called compound 1 (dimethyl 7-methyl-2,4-di-2-pyridyl-3.7-diazabicyclo[3.3.1]nonan-9-one-1,5-dicarboxylate) exhibited high affinity for [3H]ethylketocyclazocine and [3H]U-69.593 binding sites in guinea pig cerebellar membranes which known to be a good source for kappa1 receptors. It was shown by molecular modelling that heterocyclic bicyclo[3.3.1]nonan-9-ones fit very well with the structure of ketazocine, a prototypic kappa-selective benzomorphan compound; when compared to the arylacetamide structure of U-69.593, a specific kappa1-receptor agonist, a similar geometry was found with a slightly different distribution of the charges. It is postulated, that the essential structural skeleton involved in the opioid activity is an aryl-propyl-amine element distributed along the N7-C6-C5-C4-aryl bonds.
Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.
The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less
Autoradiographic localization of endothelin-1 binding sites in porcine skin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Y.D.; Springall, D.R.; Wharton, J.
Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei
2012-01-01
Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Amato, R.J.; Largent, B.L.; Snowman, A.M.
1987-07-01
Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less
Jiang, Peng; Singh, Mona; Coller, Hilary A
2013-01-01
Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.
Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M
2013-03-19
Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.
Tam, S W; Cook, L
1984-01-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851
Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.
Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M
2007-05-01
The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu
2012-02-05
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S.
2012-05-24
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Location of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.
Locations of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.
Discovering amino acid patterns on binding sites in protein complexes
Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng
2011-01-01
Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838
Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P
2005-04-01
Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ho, M.; Shi, W; Rinaldo-Mathis, A
Inhibition of human purine nucleoside phosphorylase (PNP) stops growth of activated T-cells and the formation of 6-oxypurine bases, making it a target for leukemia, autoimmune disorders, and gout. Four generations of ribocation transition-state mimics bound to PNP are structurally characterized. Immucillin-H (K*{sub i} = 58 pM, first-generation) contains an iminoribitol cation with four asymmetric carbons. DADMe-Immucillin-H (K*{sub i} = 9 pM, second-generation), uses a methylene-bridged dihydroxypyrrolidine cation with two asymmetric centers. DATMe-Immucillin-H (K*{sub i} = 9 pM, third-generation) contains an open-chain amino alcohol cation with two asymmetric carbons. SerMe-ImmH (K*{sub i} = 5 pM, fourth-generation) uses achiral dihydroxyaminoalcohol seramide asmore » the ribocation mimic. Crystal structures of PNPs establish features of tight binding to be; (1) ion-pair formation between bound phosphate (or its mimic) and inhibitor cation, (2) leaving-group interactions to N1, O6, and N7 of 9-deazahypoxanthine, (3) interaction between phosphate and inhibitor hydroxyl groups, and (4) His257 interacting with the 5{prime}-hydroxyl group. The first generation analogue is an imperfect fit to the catalytic site with a long ion pair distance between the iminoribitol and bound phosphate and weaker interactions to the leaving group. Increasing the ribocation to leaving-group distance in the second- to fourth-generation analogues provides powerful binding interactions and a facile synthetic route to powerful inhibitors. Despite chemical diversity in the four generations of transition-state analogues, the catalytic site geometry is almost the same for all analogues. Multiple solutions in transition-state analogue design are available to convert the energy of catalytic rate enhancement to binding energy in human PNP.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kohler, Amanda C.; Mills, Matthew J. L.; Adams, Paul D.
Some strains of soil and marine bacteria have evolved intricate metabolic pathways for using environmentally derived aromatics as a carbon source. Many of these metabolic pathways go through intermediates such as vanillate, 3-O-methylgallate, and syringate. Demethylation of these compounds is essential for downstream aryl modification, ring opening, and subsequent assimilation of these compounds into the tricarboxylic acid (TCA) cycle, and, correspondingly, there are a variety of associated aryl demethylase systems that vary in complexity. Intriguingly, only a basic understanding of the least complex system, the tetrahydrofolate-dependent aryl demethylase LigM from Sphingomonas paucimobilis, a bacterial strain that metabolizes lignin-derived aromatics, wasmore » previously available. LigM-catalyzed demethylation enables further modification and rin g opening of the single-ring aromatics vanillate and 3-Omethylgallate, which are common byproducts of biofuel production. We characterize aryl O-demethylation by LigM and report its 1.81-Å crystal structure, revealing a unique demethylase fold and a canonical folate-binding domain. Structural homology and geometry optimization calculations enabled the identification of LigM's tetrahydrofolate-binding site and protein-folate interactions. Computationally guided mutagenesis and kinetic analyses allowed the identification of the enzyme's aryl-binding site location and determination of its unique, catalytic tyrosine-dependent reaction mechanism. This work defines LigM as a distinct demethylase, both structurally and functionally, and provides insight into demethylation and its reaction requirements. Our results afford the mechanistic details required for efficient utilization of LigM as a tool for aryl O-demethylation and as a component of synthetic biology efforts to valorize previously underused aromatic compounds.« less
Kohler, Amanda C.; Mills, Matthew J. L.; Adams, Paul D.; ...
2017-04-03
Some strains of soil and marine bacteria have evolved intricate metabolic pathways for using environmentally derived aromatics as a carbon source. Many of these metabolic pathways go through intermediates such as vanillate, 3-O-methylgallate, and syringate. Demethylation of these compounds is essential for downstream aryl modification, ring opening, and subsequent assimilation of these compounds into the tricarboxylic acid (TCA) cycle, and, correspondingly, there are a variety of associated aryl demethylase systems that vary in complexity. Intriguingly, only a basic understanding of the least complex system, the tetrahydrofolate-dependent aryl demethylase LigM from Sphingomonas paucimobilis, a bacterial strain that metabolizes lignin-derived aromatics, wasmore » previously available. LigM-catalyzed demethylation enables further modification and rin g opening of the single-ring aromatics vanillate and 3-Omethylgallate, which are common byproducts of biofuel production. We characterize aryl O-demethylation by LigM and report its 1.81-Å crystal structure, revealing a unique demethylase fold and a canonical folate-binding domain. Structural homology and geometry optimization calculations enabled the identification of LigM's tetrahydrofolate-binding site and protein-folate interactions. Computationally guided mutagenesis and kinetic analyses allowed the identification of the enzyme's aryl-binding site location and determination of its unique, catalytic tyrosine-dependent reaction mechanism. This work defines LigM as a distinct demethylase, both structurally and functionally, and provides insight into demethylation and its reaction requirements. Our results afford the mechanistic details required for efficient utilization of LigM as a tool for aryl O-demethylation and as a component of synthetic biology efforts to valorize previously underused aromatic compounds.« less
NASA Astrophysics Data System (ADS)
Leleyter, M.; Olivi-Tran, N.
2008-12-01
We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.
Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa
2013-01-01
Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin
Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.
2011-01-01
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.
Dubois, B W; Cherian, S F; Evers, A S
1993-01-01
There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biegon, A.; Rainbow, T.C.
1983-05-01
The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less
ERIC Educational Resources Information Center
House, Peggy A.
1994-01-01
Describes some mathematical investigations of the necktie which includes applications of geometry, statistics, data analysis, sampling, probability, symmetry, proportion, problem solving, and business. (MKR)
NASA Astrophysics Data System (ADS)
Boudouris, Bryan; Weidman, Jacob; Mulvenna, Ryan; Phillip, William
The efficient removal of metal ions from aqueous streams is of significant import in applications ranging from industrial waste treatment to the purification of drinking water. An emerging paradigm associated with this separation is one that utilizes membrane adsorbers as a means by which to bind metal salt contaminants. Here, we demonstrate that the casting of an A-B-C triblock polymer using the self-assembly and non-solvent induced phase separation (SNIPS) methodology results in a nanoporous membrane geometry. The nature of the triblock polymer affords an extremely high density of binding sites within the membrane. As such, we demonstrate that the membranes with binding capacities equal to that of state-of-the-art packed bed columns. Moreover, because the affinity of the C moiety can be tuned, highly selective binding events can occur based solely on the chemistry of the block polymer and the metal ions in solution (i.e., in a manner that is independent of the size of the metal ions). Due to these combined facts, these membranes efficiently remove heavy metal (e.g., lead- and cadmium-based) salts from contaminated water streams with greater than 95% efficiency. Finally, we show that the membranes can be regenerated through a simple treatment in order to provide long-lasting adsorber systems as well. Thus, it is anticipated that these nanostructured triblock polymer membranes are a platform by which to obtain next-generation water purification processes.
Role of Conserved Glycine in Zinc-dependent Medium Chain Dehydrogenase/Reductase Superfamily*
Tiwari, Manish Kumar; Singh, Raushan Kumar; Singh, Ranjitha; Jeya, Marimuthu; Zhao, Huimin; Lee, Jung-Kul
2012-01-01
The medium-chain dehydrogenase/reductase (MDR) superfamily consists of a large group of enzymes with a broad range of activities. Members of this superfamily are currently the subject of intensive investigation, but many aspects, including the zinc dependence of MDR superfamily proteins, have not yet have been adequately investigated. Using a density functional theory-based screening strategy, we have identified a strictly conserved glycine residue (Gly) in the zinc-dependent MDR superfamily. To elucidate the role of this conserved Gly in MDR, we carried out a comprehensive structural, functional, and computational analysis of four MDR enzymes through a series of studies including site-directed mutagenesis, isothermal titration calorimetry, electron paramagnetic resonance (EPR), quantum mechanics, and molecular mechanics analysis. Gly substitution by other amino acids posed a significant threat to the metal binding affinity and activity of MDR superfamily enzymes. Mutagenesis at the conserved Gly resulted in alterations in the coordination of the catalytic zinc ion, with concomitant changes in metal-ligand bond length, bond angle, and the affinity (Kd) toward the zinc ion. The Gly mutants also showed different spectroscopic properties in EPR compared with those of the wild type, indicating that the binding geometries of the zinc to the zinc binding ligands were changed by the mutation. The present results demonstrate that the conserved Gly in the GHE motif plays a role in maintaining the metal binding affinity and the electronic state of the catalytic zinc ion during catalysis of the MDR superfamily enzymes. PMID:22500022
Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael
2017-01-01
The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023
Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
NASA Astrophysics Data System (ADS)
Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír
2017-01-01
Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.
STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY
Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.
2008-01-01
The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palacios, J.M.; Chinaglia, G.; Rigo, M.
1991-02-01
Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less
n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.
Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu
2014-01-01
We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R
1996-10-11
In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Binding Leverage as a Molecular Basis for Allosteric Regulation
Mitternacht, Simon; Berezovsky, Igor N.
2011-01-01
Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347
Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi
2016-12-15
The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.
2011-01-01
Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Position specific variation in the rate of evolution in transcription factor binding sites
Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B
2003-01-01
Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R
2003-01-01
Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471
Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.
Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F
1986-08-15
The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.
Dissociation of sarin on a cement analogue surface: Effects of humidity and confined geometry
O’Brien, Christopher J.; Greathouse, Jeffery A.; Tenney, Craig M.
2016-11-22
Here, first-principles molecular dynamics simulations were used to investigate the dissociation of sarin (GB) on the calcium silicate hydrate (CSH) mineral tobermorite (TBM), a surrogate for cement. CSH minerals (including TBM) and amorphous materials of similar composition are the major components of Portland cement, the binding agent of concrete. Metadynamics simulations were used to investigate the effect of the TBM surface and confinement in a microscale pore on the mechanism and free energy of dissociation of GB. Our results indicate that both the adsorption site and the humidity of the local environment significantly affect the sarin dissociation energy. In particular,more » sarin dissociation in a low-water environment occurs via a dealkylation mechanism, which is consistent with previous experimental studies.« less
Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude
2017-10-01
While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
RBind: computational network method to predict RNA binding sites.
Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie
2018-04-26
Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.
Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten
2017-04-01
BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.
A novel substance P binding site in bovine adrenal medulla.
Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E
1990-05-04
Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tam, S.W.; Cook, L.
1984-09-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less
Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A
1996-01-04
In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul
2012-01-01
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259
Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U
2014-06-02
The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.
Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu
2014-01-01
Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422
DNA looping by FokI: the impact of synapse geometry on loop topology at varied site orientations
Rusling, David A.; Laurens, Niels; Pernstich, Christian; Wuite, Gijs J. L.; Halford, Stephen E.
2012-01-01
Most restriction endonucleases, including FokI, interact with two copies of their recognition sequence before cutting DNA. On DNA with two sites they act in cis looping out the intervening DNA. While many restriction enzymes operate symmetrically at palindromic sites, FokI acts asymmetrically at a non-palindromic site. The directionality of its sequence means that two FokI sites can be bridged in either parallel or anti-parallel alignments. Here we show by biochemical and single-molecule biophysical methods that FokI aligns two recognition sites on separate DNA molecules in parallel and that the parallel arrangement holds for sites in the same DNA regardless of whether they are in inverted or repeated orientations. The parallel arrangement dictates the topology of the loop trapped between sites in cis: the loop from inverted sites has a simple 180° bend, while that with repeated sites has a convoluted 360° turn. The ability of FokI to act at asymmetric sites thus enabled us to identify the synapse geometry for sites in trans and in cis, which in turn revealed the relationship between synapse geometry and loop topology. PMID:22362745
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bailey, Lucas J.; Acheson, Justin F.; McCoy, Jason G.
Crystal structures of toluene 4-monooxygenase hydroxylase in complex with reaction products and effector protein reveal active site interactions leading to regiospecificity. Complexes with phenolic products yield an asymmetric {mu}-phenoxo-bridged diiron center and a shift of diiron ligand E231 into a hydrogen bonding position with conserved T201. In contrast, complexes with inhibitors p-NH{sub 2}-benzoate and p-Br-benzoate showed a {mu}-1,1 coordination of carboxylate oxygen between the iron atoms and only a partial shift in the position of E231. Among active site residues, F176 trapped the aromatic ring of products against a surface of the active site cavity formed by G103, E104 andmore » A107, while F196 positioned the aromatic ring against this surface via a {pi}-stacking interaction. The proximity of G103 and F176 to the para substituent of the substrate aromatic ring and the structure of G103L T4moHD suggest how changes in regiospecificity arise from mutations at G103. Although effector protein binding produced significant shifts in the positions of residues along the outer portion of the active site (T201, N202, and Q228) and in some iron ligands (E231 and E197), surprisingly minor shifts (<1 {angstrom}) were produced in F176, F196, and other interior residues of the active site. Likewise, products bound to the diiron center in either the presence or absence of effector protein did not significantly shift the position of the interior residues, suggesting that positioning of the cognate substrates will not be strongly influenced by effector protein binding. Thus, changes in product distributions in the absence of the effector protein are proposed to arise from differences in rates of chemical steps of the reaction relative to motion of substrates within the active site channel of the uncomplexed, less efficient enzyme, while structural changes in diiron ligand geometry associated with cycling between diferrous and diferric states are discussed for their potential contribution to product release.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less
Warfield, Becka M.
2017-01-01
RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473
Study of degenerate four-quark states with SU(2) lattice Monte Carlo techniques
NASA Astrophysics Data System (ADS)
Green, A. M.; Lukkarinen, J.; Pennanen, P.; Michael, C.
1996-01-01
The energies of four-quark states are calculated for geometries in which the quarks are situated on the corners of a series of tetrahedra and also for geometries that correspond to gradually distorting these tetrahedra into a plane. The interest in tetrahedra arises because they are composed of three degenerate partitions of the four quarks into two two-quark color singlets. This is an extension of earlier work showing that geometries with two degenerate partitions (e.g., squares) experience a large binding energy. It is now found that even larger binding energies do not result, but that for the tetrahedra the ground and first excited states become degenerate in energy. The calculation is carried out using SU(2) for static quarks in the quenched approximation with β=2.4 on a 163×32 lattice. The results are analyzed using the correlation matrix between different Euclidean times and the implications of these results are discussed for a model based on two-quark potentials.
Case, S S; Huber, P; Lloyd, J A
1999-11-01
A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.
Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A
2013-01-01
Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.
Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph
2018-01-23
Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.
NASA Astrophysics Data System (ADS)
Poornima, C. S.; Dean, P. M.
1995-12-01
Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sultatos, L.G.; Kaushik, R.
2008-08-01
The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less
The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.
Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki
2017-01-01
Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boyd, S.K.
1987-01-01
Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less
Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther
2011-05-01
The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
B Akabayov; A Kulczyk; S Akabayov
2011-12-31
DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-Vmore » distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.« less
Evidence for W=0 pairing in repulsive Hubbard square and hexagonal geometries
NASA Astrophysics Data System (ADS)
Perfetto, Enrico; Stefanucci, Gianluca; Callegari, Agnese; Cini, Michele
2004-08-01
Square and hexagonal lattices with purely repulsive on-site interactions on all sites and appropriate fillings show W=0 pairing, and the effective attractive interaction is due to a symmetry driven correlation effect; the W=0 pairs are two-body singlet eigenstates of the Hamiltonian with vanishing on-site repulsion. We can set up gedanken experiments with these bound pairs. Chains of CuO 4 units connected by weak links provide a test case which displays bound pair hopping and superconducting flux quantization (SFQ). Focusing on the low-energy sector, one obtains an accurate description in terms of an effective hard-core boson Hamiltonian which naturally describes itinerant pairs and SFQ in mesoscopic rings. For the numerical calculations, we take advantage of a recently proposed exact spin-disentangled diagonalization technique which can be generally applied to many-fermion problems and drastically reduces the size of the matrices to be handled. Remarkably, the very same pairing mechanism also works neatly with the wrapped honeycomb lattice, suitable for armchair carbon nanotubes; the binding energy of W=0 pairs depends strongly on the filling and decreases towards a small but non-zero value in the graphite limit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cosman, M; Zeller, L; Lightstone, F C
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Influence of sulfhydryl sites on metal binding by bacteria
NASA Astrophysics Data System (ADS)
Nell, Ryan M.; Fein, Jeremy B.
2017-02-01
The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.
Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.
Liaw, S. H.; Kuo, I.; Eisenberg, D.
1995-01-01
Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen P.
2006-10-17
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen
2000-01-01
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Arokiyanathan, Agnes Lincy; Lakshmipathi, Senthilkumar
2017-11-18
A computational study of metal difluorides (MF 2 ; M = Ca to Zn) and their interactions with carbon dioxide and water molecules was performed. The structural parameter values obtained and the results of AIM analysis and energy decomposition analysis indicated that the Ca-F bond is weaker and less ionic than the bonds in the transition metal difluorides. A deformation density plot revealed the stablizing influence of the Jahn-Teller effect in nonlinear MF 2 molecules (e.g., where M= Sc, Ti, Cr). An anaysis of the metal K-edge peaks of the difluorides showed that shifts in the edge energy were due to the combined effects of the ionicity, effective nuclear charge, and the spin state of the metal. The interactions of CO 2 with ScF 2 (Scc3 geometry) and TiF 2 (Tic2 geometry) caused CO 2 to shift from its usual linear geometry to a bent geometry (η 2 (C=O) binding mode), while it retained its linear geometry (η 1 (O) binding mode) when it interacted with the other metal difluorides. Energy decomposition analysis showed that, among the various geometries considered, the Scc3 and Tic2 geometries possessed the highest interaction energies and orbital interaction energies. Heavier transition metal difluorides showed stronger affinities for H 2 O, whereas the lighter transition metal (Sc and Ti) difluorides preferred CO 2 . Overall, the results of this study suggest that fluorides of lighter transition metals with partially filled d orbitals (e.g., Sc and Ti) could be used for CO 2 capture under moist conditions. Graphical abstract Interaction of metal difluorides with carbon dioxide and water.
Acceleration of Binding Site Comparisons by Graph Partitioning.
Krotzky, Timo; Klebe, Gerhard
2015-08-01
The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
GenProBiS: web server for mapping of sequence variants to protein binding sites.
Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka
2017-07-03
Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Numerical simulation of particle transport and deposition in the pulmonary vasculature.
Sohrabi, Salman; Zheng, Junda; Finol, Ender A; Liu, Yaling
2014-12-01
To quantify the transport and adhesion of drug particles in a complex vascular environment, computational fluid particle dynamics (CFPD) simulations of blood flow and drug particulate were conducted in three different geometries representing the human lung vasculature for steady and pulsatile flow conditions. A fully developed flow profile was assumed as the inlet velocity, and a lumped mathematical model was used for the calculation of the outlet pressure boundary condition. A receptor-ligand model was used to simulate the particle binding probability. The results indicate that bigger particles have lower deposition fraction due to less chance of successful binding. Realistic unsteady flow significantly accelerates the binding activity over a wide range of particle sizes and also improves the particle deposition fraction in bifurcation regions when comparing with steady flow condition. Furthermore, surface imperfections and geometrical complexity coupled with the pulsatility effect can enhance fluid mixing and accordingly particle binding efficiency. The particle binding density at bifurcation regions increases with generation order and drug carriers are washed away faster in steady flow. Thus, when studying drug delivery mechanism in vitro and in vivo, it is important to take into account blood flow pulsatility in realistic geometry. Moreover, tissues close to bifurcations are more susceptible to deterioration due to higher uptake.
Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe
2011-01-01
Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967
Interaction between phloretin and the red blood cell membrane
1976-01-01
Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575
A peek into tropomyosin binding and unfolding on the actin filament.
Singh, Abhishek; Hitchcock-Degregori, Sarah E
2009-07-24
Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.
sc-PDB: a 3D-database of ligandable binding sites--10 years on.
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ahmed, Ahmed H; Oswald, Robert E
2010-03-11
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.
Ahmed, Ahmed H.; Oswald, Robert E.
2010-01-01
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115
Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.
Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta
2013-07-01
Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.
Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.
Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin
2017-09-14
U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.
Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng
2018-05-10
CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.
Marshall, J C; Shakespear, R A; Odell, W D
1976-11-01
Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.
An alternate binding site for PPARγ ligands
Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2014-01-01
PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew
2015-11-01
Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.
Oligomycin frames a common drug-binding site in the ATP synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less
Nisius, Britta; Gohlke, Holger
2012-09-24
Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.
Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L
2008-12-09
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.
Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.
2009-01-01
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330
Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.
Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael
2013-01-01
Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
[3H]MK-801 binding sites in post-mortem human frontal cortex.
Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P
1989-03-29
The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.
Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J
1999-09-24
We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.
Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T
2018-09-01
Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Sagert, I.; Fann, G. I.; Fattoyev, F. J.; Postnikov, S.; Horowitz, C. J.
2016-05-01
Background: Neutron star and supernova matter at densities just below the nuclear matter saturation density is expected to form a lattice of exotic shapes. These so-called nuclear pasta phases are caused by Coulomb frustration. Their elastic and transport properties are believed to play an important role for thermal and magnetic field evolution, rotation, and oscillation of neutron stars. Furthermore, they can impact neutrino opacities in core-collapse supernovae. Purpose: In this work, we present proof-of-principle three-dimensional (3D) Skyrme Hartree-Fock (SHF) simulations of nuclear pasta with the Multi-resolution ADaptive Numerical Environment for Scientific Simulations (MADNESS). Methods: We perform benchmark studies of 16O, 208Pb, and 238U nuclear ground states and calculate binding energies via 3D SHF simulations. Results are compared with experimentally measured binding energies as well as with theoretically predicted values from an established SHF code. The nuclear pasta simulation is initialized in the so-called waffle geometry as obtained by the Indiana University Molecular Dynamics (IUMD) code. The size of the unit cell is 24 fm with an average density of about ρ =0.05 fm-3 , proton fraction of Yp=0.3 , and temperature of T =0 MeV. Results: Our calculations reproduce the binding energies and shapes of light and heavy nuclei with different geometries. For the pasta simulation, we find that the final geometry is very similar to the initial waffle state. We compare calculations with and without spin-orbit forces. We find that while subtle differences are present, the pasta phase remains in the waffle geometry. Conclusions: Within the MADNESS framework, we can successfully perform calculations of inhomogeneous nuclear matter. By using pasta configurations from IUMD it is possible to explore different geometries and test the impact of self-consistent calculations on the latter.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-03-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-01-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513
Time scale of diffusion in molecular and cellular biology
NASA Astrophysics Data System (ADS)
Holcman, D.; Schuss, Z.
2014-05-01
Diffusion is the driver of critical biological processes in cellular and molecular biology. The diverse temporal scales of cellular function are determined by vastly diverse spatial scales in most biophysical processes. The latter are due, among others, to small binding sites inside or on the cell membrane or to narrow passages between large cellular compartments. The great disparity in scales is at the root of the difficulty in quantifying cell function from molecular dynamics and from simulations. The coarse-grained time scale of cellular function is determined from molecular diffusion by the mean first passage time of molecular Brownian motion to a small targets or through narrow passages. The narrow escape theory (NET) concerns this issue. The NET is ubiquitous in molecular and cellular biology and is manifested, among others, in chemical reactions, in the calculation of the effective diffusion coefficient of receptors diffusing on a neuronal cell membrane strewn with obstacles, in the quantification of the early steps of viral trafficking, in the regulation of diffusion between the mother and daughter cells during cell division, and many other cases. Brownian trajectories can represent the motion of a molecule, a protein, an ion in solution, a receptor in a cell or on its membrane, and many other biochemical processes. The small target can represent a binding site or an ionic channel, a hidden active site embedded in a complex protein structure, a receptor for a neurotransmitter on the membrane of a neuron, and so on. The mean time to attach to a receptor or activator determines diffusion fluxes that are key regulators of cell function. This review describes physical models of various subcellular microdomains, in which the NET coarse-grains the molecular scale to a higher cellular-level, thus clarifying the role of cell geometry in determining subcellular function.
sc-PDB: a 3D-database of ligandable binding sites—10 years on
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483
Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A
2018-05-29
Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.
2008-01-01
The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.
Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry
2014-01-01
We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.
Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando
2018-03-23
The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.
Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay
2018-02-01
Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.
Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M
2011-01-01
Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less
NASA Astrophysics Data System (ADS)
Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh
2017-06-01
In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.
A deep learning framework for modeling structural features of RNA-binding protein targets
Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang
2016-01-01
RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480
Hoffmann, Jana; Altenbuchner, Josef
2015-01-01
A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762
Middendorf, Thomas R.
2017-01-01
A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951
Structural organization of G-protein-coupled receptors
NASA Astrophysics Data System (ADS)
Lomize, Andrei L.; Pogozheva, Irina D.; Mosberg, Henry I.
1999-07-01
Atomic-resolution structures of the transmembrane 7-α-helical domains of 26 G-protein-coupled receptors (GPCRs) (including opsins, cationic amine, melatonin, purine, chemokine, opioid, and glycoprotein hormone receptors and two related proteins, retinochrome and Duffy erythrocyte antigen) were calculated by distance geometry using interhelical hydrogen bonds formed by various proteins from the family and collectively applied as distance constraints, as described previously [Pogozheva et al., Biophys. J., 70 (1997) 1963]. The main structural features of the calculated GPCR models are described and illustrated by examples. Some of the features reflect physical interactions that are responsible for the structural stability of the transmembrane α-bundle: the formation of extensive networks of interhelical H-bonds and sulfur-aromatic clusters that are spatially organized as 'polarity gradients' the close packing of side-chains throughout the transmembrane domain; and the formation of interhelical disulfide bonds in some receptors and a plausible Zn2+ binding center in retinochrome. Other features of the models are related to biological function and evolution of GPCRs: the formation of a common 'minicore' of 43 evolutionarily conserved residues; a multitude of correlated replacements throughout the transmembrane domain; an Na+-binding site in some receptors, and excellent complementarity of receptor binding pockets to many structurally dissimilar, conformationally constrained ligands, such as retinal, cyclic opioid peptides, and cationic amine ligands. The calculated models are in good agreement with numerous experimental data.
Mollica, Luca; Conti, Gianluca; Pollegioni, Loredano; Cavalli, Andrea; Rosini, Elena
2015-10-26
The industrial production of higher-generation semisynthetic cephalosporins starts from 7-aminocephalosporanic acid (7-ACA), which is obtained by deacylation of the naturally occurring antibiotic cephalosporin C (CephC). The enzymatic process in which CephC is directly converted into 7-ACA by a cephalosporin C acylase has attracted industrial interest because of the prospects of simplifying the process and reducing costs. We recently enhanced the catalytic efficiency on CephC of a glutaryl acylase from Pseudomonas N176 (named VAC) by a protein engineering approach and solved the crystal structures of wild-type VAC and the H57βS-H70βS VAC double variant. In the present work, experimental measurements on several CephC derivatives and six VAC variants were carried out, and the binding of ligands into the VAC active site was investigated at an atomistic level by means of molecular docking and molecular dynamics simulations and analyzed on the basis of the molecular geometry of encounter complex formation and protein-ligand potential of mean force profiles. The observed significant correlation between the experimental data and estimated binding energies highlights the predictive power of our computational method to identify the ligand binding mode. The present experimental-computational study is well-suited both to provide deep insight into the reaction mechanism of cephalosporin C acylase and to improve the efficiency of the corresponding industrial process.
Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.
Mizuno, S; Ogawa, N; Mori, A
1982-12-01
Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.
Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.
Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda
2008-05-01
The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.
Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng
2014-03-01
Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.
Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.
Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry
2006-07-01
High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.
Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-01-01
The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860
Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard
2017-07-05
Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.
Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.
Streiff, John H; Jones, Keith A
2008-10-01
The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
Analysis of functional importance of binding sites in the Drosophila gap gene network model.
Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria
2015-01-01
The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.
Dudev, Todor; Chang, Li-Ying; Lim, Carmay
2005-03-23
Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.
Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M
2005-04-19
The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
Menon, Binuraj R K; Hardman, Samantha J O; Scrutton, Nigel S; Heyes, Derren J
2016-08-01
Protochlorophyllide oxidoreductase (POR) catalyzes the light-driven reduction of protochlorophyllide (Pchlide), an essential, regulatory step in chlorophyll biosynthesis. The unique requirement of the enzyme for light has provided the opportunity to investigate how light energy can be harnessed to power biological catalysis and enzyme dynamics. Excited state interactions between the Pchlide molecule and the protein are known to drive the subsequent reaction chemistry. However, the structural features of POR and active site residues that are important for photochemistry and catalysis are currently unknown, because there is no crystal structure for POR. Here, we have used static and time-resolved spectroscopic measurements of a number of active site variants to study the role of a number of residues, which are located in the proposed NADPH/Pchlide binding site based on previous homology models, in the reaction mechanism of POR. Our findings, which are interpreted in the context of a new improved structural model, have identified several residues that are predicted to interact with the coenzyme or substrate. Several of the POR variants have a profound effect on the photochemistry, suggesting that multiple residues are important in stabilizing the excited state required for catalysis. Our work offers insight into how the POR active site geometry is finely tuned by multiple active site residues to support enzyme-mediated photochemistry and reduction of Pchlide, both of which are crucial to the existence of life on Earth. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giannopoulos, G.; Jackson, K.; Kredentser, J.
The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less
Free-energy analysis of spin models on hyperbolic lattice geometries.
Serina, Marcel; Genzor, Jozef; Lee, Yoju; Gendiar, Andrej
2016-04-01
We investigate relations between spatial properties of the free energy and the radius of Gaussian curvature of the underlying curved lattice geometries. For this purpose we derive recurrence relations for the analysis of the free energy normalized per lattice site of various multistate spin models in the thermal equilibrium on distinct non-Euclidean surface lattices of the infinite sizes. Whereas the free energy is calculated numerically by means of the corner transfer matrix renormalization group algorithm, the radius of curvature has an analytic expression. Two tasks are considered in this work. First, we search for such a lattice geometry, which minimizes the free energy per site. We conjecture that the only Euclidean flat geometry results in the minimal free energy per site regardless of the spin model. Second, the relations among the free energy, the radius of curvature, and the phase transition temperatures are analyzed. We found out that both the free energy and the phase transition temperature inherit the structure of the lattice geometry and asymptotically approach the profile of the Gaussian radius of curvature. This achievement opens new perspectives in the AdS-CFT correspondence theories.
Optimal Area Use in Orb Webs of the Spider Araneus diadematus
NASA Astrophysics Data System (ADS)
Krink, T.; Vollrath, F.
We studied the abilities of the garden cross spider Araneus diadematus regarding adaptation of web geometry to spatial constraints. Spiders reacted to a spatial reduction in their building site from a square-shaped frame to a slimmer, rectangular frame (side ratio 1 : 2) by maintaining overall web geometry while reducing the web area covered by the sticky capture spiral. However, when the frames were changed further to a rectangular side ratio of 1 : 3, the spiders changed specific web properties in such a way that a further reduction in the capture spiral area was prevented. Construction of the threads making up the web frame and the auxiliary spiral requires that the spider explores the spatial constraints of its building site. The geometry of both frame and auxiliary spiral threads in turn determine the geometry of the capture threads. Since in very narrow frames the spider adjusted the auxiliary to suit the subsequent capture spiral, we suggest that an initial spatial survey led to the final adaptation of overall web geometry to a web site.
Optimal area use in orb webs of the spider Araneus diadematus.
Krink, T; Vollrath, F
2000-02-01
We studied the abilities of the garden cross spider Araneus diadematus regarding adaptation of web geometry to spatial constraints. Spiders reacted to a spatial reduction in their building site from a square-shaped frame to a slimmer, rectangular frame (side ratio 1 : 2) by maintaining overall web geometry while reducing the web area covered by the sticky capture spiral. However, when the frames were changed further to a rectangular side ratio of 1 : 3, the spiders changed specific web properties in such a way that a further reduction in the capture spiral area was prevented. Construction of the threads making up the web frame and the auxiliary spiral requires that the spider explores the spatial constraints of its building site. The geometry of both frame and auxiliary spiral threads in turn determine the geometry of the capture threads. Since in very narrow frames the spider adjusted the auxiliary to suit the subsequent capture spiral, we suggest that an initial spatial survey led to the final adaptation of overall web geometry to a web site.
Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.
Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain
2014-11-18
Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.
Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies
NASA Astrophysics Data System (ADS)
Pang, Yuan-Ping; Kozikowski, Alan P.
1994-12-01
We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.
The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Energetics and kinetics of cooperative cofilin-actin filament interactions.
Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M
2006-08-11
We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.
Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.
2008-08-19
Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less
Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC
Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei
2010-01-01
Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424
Role of internal motions and molecular geometry on the NMR relaxation of hydrocarbons
NASA Astrophysics Data System (ADS)
Singer, P. M.; Asthagiri, D.; Chen, Z.; Valiya Parambathu, A.; Hirasaki, G. J.; Chapman, W. G.
2018-04-01
The role of internal motions and molecular geometry on 1H NMR relaxation rates in liquid-state hydrocarbons is investigated using MD (molecular dynamics) simulations of the autocorrelation functions for intramolecular and intermolecular 1H-1H dipole-dipole interactions. The effects of molecular geometry and internal motions on the functional form of the autocorrelation functions are studied by comparing symmetric molecules such as neopentane and benzene to corresponding straight-chain alkanes n-pentane and n-hexane, respectively. Comparison of rigid versus flexible molecules shows that internal motions cause the intramolecular and intermolecular correlation-times to get significantly shorter, and the corresponding relaxation rates to get significantly smaller, especially for longer-chain n-alkanes. Site-by-site simulations of 1H's across the chains indicate significant variations in correlation times and relaxation rates across the molecule, and comparison with measurements reveals insights into cross-relaxation effects. Furthermore, the simulations reveal new insights into the relative strength of intramolecular versus intermolecular relaxation as a function of internal motions, as a function of molecular geometry, and on a site-by-site basis across the chain.
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trong, I.Le; Stenkamp, R.E.; Ibarra, C.
2005-08-22
Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less
Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing
Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav
2007-01-01
In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418
Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.
Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F
1994-10-27
Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.
Anisotropic energy flow and allosteric ligand binding in albumin
NASA Astrophysics Data System (ADS)
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin.
Li, Guifeng; Magana, Donny; Dyer, R Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265
Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.
2012-01-01
An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049
Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E
2017-01-01
Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.
Morley, B J; Garner, L L
1990-06-11
Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.
NASA Astrophysics Data System (ADS)
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.
Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose
Jalak, Jürgen; Väljamäe, Priit
2014-01-01
Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511
Gibbons, R. J.; Moreno, E. C.; Etherden, I.
1983-01-01
The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416
DOE Office of Scientific and Technical Information (OSTI.GOV)
Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.
1990-01-01
Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less
The Structural Basis of ATP as an Allosteric Modulator
Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian
2014-01-01
Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773
Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy
Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming
2014-01-01
A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.
Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E
2018-02-01
Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.
Elimination of a ligand gating site generates a supersensitive olfactory receptor.
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I
2016-06-21
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.
Elimination of a ligand gating site generates a supersensitive olfactory receptor
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.
2016-01-01
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less
Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart
1999-01-01
Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456
Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants
Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander
2013-01-01
Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254
Directed self-assembly of virus particles at nanoscale chemical templates
NASA Astrophysics Data System (ADS)
Chung, Sung-Wook; Cheung, Chin Li; Chatterji, Anju; Lin, Tianwei; Johnson, Jack; de Yoreo, Jim
2006-03-01
Because viruses can be site-specifically engineered to present catalytic, electronic, and optical moieties, they are attractive as building blocks for hierarchical nanostructures. We report results using scanned probe nanolithography to direct virus organization into 1D and 2D patterns and in situ AFM investigations of organization dynamics as pattern geometry, inter-viral potential, virus flux, and virus-pattern interaction are varied. Cowpea Mosaic Virus was modified to present surface sites with histidine (His) or cysteine (Cys) groups. Flat gold substrates were patterned with 10-100nm features of alkyl thiols terminated by Ni-NTA or meleimide groups to reversibly and irreversibly bind to the Hys and Cys groups, respectively. We show how assembly kinetics, degree of ordering and cluster-size distribution at these templates depend on the control parameters and present a physical picture of virus assembly at templates that incorporates growth dynamics of small-molecule epitaxial systems and condensation dynamics of colloidal systems. This work was performed under the auspices of the U. S. Department of Energy by the University of California, Lawrence Livermore National Laboratory under Contract No. W-7405-Eng-48.
Human topoisomerase I poisoning: docking protoberberines into a structure-based binding site model
NASA Astrophysics Data System (ADS)
Kettmann, Viktor; Košt'álová, Daniela; Höltje, Hans-Dieter
2004-12-01
Using the X-ray crystal structure of the human topoisomerase I (top1) - DNA cleavable complex and the Sybyl software package, we have developed a general model for the ternary cleavable complex formed with four protoberberine alkaloids differing in the substitution on the terminal phenyl rings and covering a broad range of the top1-poisoning activities. This model has the drug intercalated with its planar chromophore between the -1 and +1 base pairs flanking the cleavage site, with the nonplanar portion pointing into the minor groove. The ternary complexes were geometry-optimized and relative interaction energies, computed by using the Tripos force field, were found to rank in correct order the biological potency of the compounds; in addition, the model is also consistent with the top1-poisoning inactivity of berberine, a major prototype of the protoberberine alkaloids. The model might serve as a rational basis for elaboration of the most active compound as a lead structure, in order to develop more potent top1 poisons as next generation anti-cancer drugs.
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.
1988-05-01
Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less
Purification of L-( sup 3 H) Nicotine eliminates low affinity binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romm, E.; Marks, M.J.; Collins, A.C.
1990-01-01
Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
NASA Astrophysics Data System (ADS)
Tabassum, Sartaj; Sharma, Girish Chandra; Arjmand, Farukh; Azam, Ameer
2010-05-01
A new nano dimensional heterobimetallic Cu-Sn containing complex as a potential drug candidate was designed, synthesized and characterized by analytical and spectral methods. The electronic absorption and electron paramagnetic resonance parameters of the complex revealed that the Cu(II) ion exhibits a square pyramidal geometry with the two pyrazole nitrogen atoms, the amine nitrogen atom and the carboxylate oxygen of the phenyl glycine chloride ligand located at the equatorial sites and the coordinated chloride ion occupying an apical position. 119Sn NMR spectral data showed a hexa-coordinated environment around the Sn(IV) metal ion. TEM, AFM and XRD measurements illustrate that the complex could induce the condensation of CT-DNA to a particulate nanostructure. The interaction of the Cu-Sn complex with CT-DNA was investigated by UV-vis absorption and emission spectroscopy, as well as cyclic voltammetric measurements. The results indicated that the complex interacts with DNA through an electrostatic mode of binding with an intrinsic binding constant Kb = 8.42 × 104 M - 1. The Cu-Sn complex exhibits effective cleavage of pBR322 plasmid DNA by an oxidative cleavage mechanism, monitored at different concentrations both in the absence and in the presence of reducing agents.
Vezzu, Dileep A. k.; Lu, Qun; Chen, Yan-Hua; Huo, Shouquan
2014-01-01
A series of cyclometalated platinum complexes with diverse coordination patterns and geometries were screened for their anticancer activity. It was discovered that the NʌCʌN-coordinated platinum complex based on 1,3-di(pyridyl)benzene displayed much higher cytotoxicity against human lung cancer cells NCI-H522, HCC827, and NCI-H1299, and human prostate cancer cell RV1 than cisplatin. In a sharp contrast, the CʌNʌN-coordinated platinum complex based on 6-phenyl-2,2′-bipyridine was ineffective on these cancer cells. This remarkable difference in cytotoxicity displayed by NʌCʌN- and CʌNʌN-coordinated platinum complexes was related to the trans effect of the carbon donor in the cyclometalated platinum complexes, which played a crucial role in facilitating the dissociation of the chloride ligand to create an active binding site. The DNA binding was studied for the NʌCʌN-coordinated platinum complex using electrophoresis and emission titration. The cellular uptake observed by fluorescent microscope showed the complex is largely concentrated in the cytoplasm. The possible pathways for the cell apoptosis was studied by western blot analysis and the activation of PARP via caspase 7 was observed. PMID:24531534
Solution structure and thermodynamics of 2',5' RNA intercalation.
Horowitz, Eric D; Lilavivat, Seth; Holladay, Benjamin W; Germann, Markus W; Hud, Nicholas V
2009-04-29
As a means to explore the influence of the nucleic acid backbone on the intercalative binding of ligands to DNA and RNA, we have determined the solution structure of a proflavine-bound 2',5'-linked octamer duplex with the sequence GCCGCGGC. This structure represents the first NMR structure of an intercalated RNA duplex, of either backbone structural isomer. By comparison with X-ray crystal structures, we have identified similarities and differences between intercalated 3',5' and 2',5'-linked RNA duplexes. First, the two forms of RNA have different sugar pucker geometries at the intercalated nucleotide steps, yet have the same interphosphate distances. Second, as in intercalated 3',5' RNA, the phosphate backbone angle zeta at the 2',5' RNA intercalation site prefers to be in the trans conformation, whereas unintercalated 2',5' and 3',5' RNA prefer the -gauche conformation. These observations provide new insights regarding the transitions required for intercalation of a phosphodiester-ribose backbone and suggest a possible contribution of the backbone to the origin of the nearest-neighbor exclusion principle. Thermodynamic studies presented for intercalation of both structural RNA isomers also reveal a surprising sensitivity of intercalator binding enthalpy and entropy to the details of RNA backbone structure.
Biophysical Fitness Landscapes for Transcription Factor Binding Sites
Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.
2014-01-01
Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228
Yokoyama, Ken Daigoro; Pollock, David D
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
Nucleotide-dependent bisANS binding to tubulin.
Chakraborty, S; Sarkar, N; Bhattacharyya, B
1999-07-13
Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldman, M.E.; Mallorga, P.; Pettibone, D.J.
1988-01-01
(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less
Impact of disruption of secondary binding site S2 on dopamine transporter function.
Zhen, Juan; Reith, Maarten E A
2016-09-01
The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.
Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis
2011-11-14
The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.
Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter
2001-01-01
Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nye, J.S.
The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less
Gillard, Michel; Chatelain, Pierre; Fuks, Bruno
2006-04-24
A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.
The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.
positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP
Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas
2010-01-01
Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca
2011-01-01
The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714
Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis
2017-03-16
Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gundlach, A.L.; Largent, B.L.; Snyder, S.H.
1986-06-01
(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less
DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P
2008-06-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.
Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.
Salter, Jason D; Smith, Harold C
2018-05-23
The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
NASA Astrophysics Data System (ADS)
Carey, Christina; Cheng, Yuen-Kit; Rossky, Peter J.
2000-08-01
The concave substrate binding pocket of α-chymotrypsin binds specifically hydrophobic side chains. In order to understand the hydration structure present in the absence of substrate, and elucidate the character of the solvent displaced on binding, molecular dynamics computer simulation of the solvent in a fully hydrated protein has been carried out and analyzed. The pocket is found to be characterized in terms of a mixed polar and apolar macromolecular surface. It is shown that the simulated solvent structure within it is spatially consistent with that seen via crystallography. The solvent structure is energetically characterized by large losses in hydrogen bonding among solvent molecules except at the mouth of the pocket where exposure to bulk-like solvent is possible. The loss in hydrogen bonding is attributed to the highly constrained geometry available to the solvent, preventing formation of a hydrogen bonding network, with only partial compensation by interactions with the macromolecular surface. The solvent displacement concomitant with substrate binding will therefore be associated with a large enthalpic driving force. This result is at the extreme of a continuum of variable cases of "hydrophobic" hydration, which differ most basically in surface curvature. These range from convex solute surfaces, inducing clathrate-like structures, with negligible hydrogen bond loss, to flat surfaces with significant interfacial loss, to the present concave case with hydrogen bonding losses exceeding 50%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.
The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, M.W.; Chen, J.P.; Wallis, C.
1992-02-26
({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less
Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.
2015-01-01
Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613
Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M
1998-01-01
The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514
Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N
1991-11-01
The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.
Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua
2016-07-19
The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.
Barnert, R H; Zeichhardt, H; Habermehl, K O
1992-02-01
Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.
Cooperative interplay of let-7 mimic and HuR with MYC RNA.
Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A
2015-01-01
Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.
Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen
2018-06-06
Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary
2015-12-01
CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.
FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1
Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.
2007-01-01
Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863
Investigation of glucose binding sites on insulin.
Zoete, Vincent; Meuwly, Markus; Karplus, Martin
2004-05-15
Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.
James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha
2015-01-01
Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488
Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen
2017-01-01
Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946
Rational design of alpha-helical tandem repeat proteins with closed architectures
Doyle, Lindsey; Hallinan, Jazmine; Bolduc, Jill; Parmeggiani, Fabio; Baker, David; Stoddard, Barry L.; Bradley, Philip
2015-01-01
Tandem repeat proteins, which are formed by repetition of modular units of protein sequence and structure, play important biological roles as macromolecular binding and scaffolding domains, enzymes, and building blocks for the assembly of fibrous materials1,2. The modular nature of repeat proteins enables the rapid construction and diversification of extended binding surfaces by duplication and recombination of simple building blocks3,4. The overall architecture of tandem repeat protein structures – which is dictated by the internal geometry and local packing of the repeat building blocks – is highly diverse, ranging from extended, super-helical folds that bind peptide, DNA, and RNA partners5–9, to closed and compact conformations with internal cavities suitable for small molecule binding and catalysis10. Here we report the development and validation of computational methods for de novo design of tandem repeat protein architectures driven purely by geometric criteria defining the inter-repeat geometry, without reference to the sequences and structures of existing repeat protein families. We have applied these methods to design a series of closed alpha-solenoid11 repeat structures (alpha-toroids) in which the inter-repeat packing geometry is constrained so as to juxtapose the N- and C-termini; several of these designed structures have been validated by X-ray crystallography. Unlike previous approaches to tandem repeat protein engineering12–20, our design procedure does not rely on template sequence or structural information taken from natural repeat proteins and hence can produce structures unlike those seen in nature. As an example, we have successfully designed and validated closed alpha-solenoid repeats with a left-handed helical architecture that – to our knowledge – is not yet present in the protein structure database21. PMID:26675735
SABER: A computational method for identifying active sites for new reactions
Nosrati, Geoffrey R; Houk, K N
2012-01-01
A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644–1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were l-Ala d/l-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. PMID:22492397
Saravanan, Kandasamy; Kalaiarasi, Chinnasamy; Kumaradhas, Poomani
2017-12-01
Acetylcholinesterase (AChE) is an important enzyme responsible for Alzheimer's disease, as per report, keto-enol form of curcumin inhibits this enzyme. The present study aims to understand the binding mechanism of keto-enol curcumin with the recombinant human Acetylcholinesterase (rhAChE) from its conformational flexibility, intermolecular interactions, charge density distribution, and the electrostatic properties at the active site of rhAChE. To accomplish this, a molecular docking analysis of curcumin with the rhAChE was performed, which gives the structure and conformation of curcumin in the active site of rhAChE. Further, the charge density distribution and the electrostatic properties of curcumin molecule (lifted from the active site of rhAChE) were determined from the high level density functional theory (DFT) calculations coupled with the charge density analysis. On the other hand, the curcumin molecule was optimized (gas phase) using DFT method and further, the structure and charge density analysis were also carried out. On comparing the conformation, charge density distribution and the electrostatic potential of the active site form of curcumin with the corresponding gas phase form reveals that the above said properties are significantly altered when curcumin is present in the active site of rhAChE. The conformational stability and the interaction of curcumin in the active site are also studied using molecular dynamics simulation, which shows a large variation in the conformational geometry of curcumin as well as the intermolecular interactions.
Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.
Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J
1988-01-01
The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.
Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K
2017-03-17
Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.
2008-01-01
Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991