Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

NASA Astrophysics Data System (ADS)

Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

2013-08-01

The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

Identification of metal ion binding sites based on amino acid sequences

PubMed Central

Cao, Xiaoyong; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

2017-01-01

The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html. PMID:28854211

Identification of metal ion binding sites based on amino acid sequences.

PubMed

Cao, Xiaoyong; Hu, Xiuzhen; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

2017-01-01

The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html.

Identification of Conserved Water Sites in Protein Structures for Drug Design.

PubMed

Jukič, Marko; Konc, Janez; Gobec, Stanislav; Janežič, Dušanka

2017-12-26

Identification of conserved waters in protein structures is a challenging task with applications in molecular docking and protein stability prediction. As an alternative to computationally demanding simulations of proteins in water, experimental cocrystallized waters in the Protein Data Bank (PDB) in combination with a local structure alignment algorithm can be used for reliable prediction of conserved water sites. We developed the ProBiS H2O approach based on the previously developed ProBiS algorithm, which enables identification of conserved water sites in proteins using experimental protein structures from the PDB or a set of custom protein structures available to the user. With a protein structure, a binding site, or an individual water molecule as a query, ProBiS H2O collects similar proteins from the PDB and performs local or binding site-specific superimpositions of the query structure with similar proteins using the ProBiS algorithm. It collects the experimental water molecules from the similar proteins and transposes them to the query protein. Transposed waters are clustered by their mutual proximity, which enables identification of discrete sites in the query protein with high water conservation. ProBiS H2O is a robust and fast new approach that uses existing experimental structural data to identify conserved water sites on the interfaces of protein complexes, for example protein-small molecule interfaces, and elsewhere on the protein structures. It has been successfully validated in several reported proteins in which conserved water molecules were found to play an important role in ligand binding with applications in drug design.

The identification of hydrophobic sites on the surface of proteins using absorption difference spectroscopy of bromophenol blue.

PubMed

Bertsch, M; Mayburd, A L; Kassner, R J

2003-02-15

Hydrophobic sites on the surface of protein molecules are thought to have important functional roles. The identification of such sites can provide information about the function and mode of interaction with other cellular components. While the fluorescence enhancement of polarity-sensitive dyes has been useful in identifying hydrophobic sites on a number of targets, strong intrinsic quenching of Nile red and ANSA dye fluorescence is observed on binding to a cytochrome c('). Fluorescence quenching is also observed to take place in the presence of a variety of other biologically important molecules which can compromise the quantitative determination of binding constants. Absorption difference spectroscopy is shown not to be sensitive to the presence of fluorescence quenchers but sensitive enough to measure binding constants. The dye BPB is shown to bind to the same hydrophobic sites on proteins as polarity-sensitive fluorescence probes. The absorption spectrum of BPB is also observed to be polarity sensitive. A binding constant of 3x10(6)M(-1) for BPB to BSA has been measured by absorption difference spectroscopy. An empirical correlation is observed between the shape of the absorption difference spectrum of BPB and the polarity of the environment. The results indicate that absorption difference spectroscopy of BPB provides a valuable supplement to fluorescence for determining the presence of hydrophobic sites on the surface of proteins as well as a method for measuring binding constants.

Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

PubMed Central

Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

2015-01-01

The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

Searching for transcription factor binding sites in vector spaces

PubMed Central

2012-01-01

Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338

Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

2004-08-06

Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

Genetics Home Reference: mannose-binding lectin deficiency

MedlinePlus

... Nobelprize.org: The Immune System - In More Detail Patient Support and Advocacy Resources (1 link) ... Sources for This Page Arora M, Munoz E, Tenner AJ. Identification of a site on mannan-binding lectin critical ...

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

PubMed

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

PubMed

Barnert, R H; Zeichhardt, H; Habermehl, K O

1992-02-01

Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

Computational Tools for Allosteric Drug Discovery: Site Identification and Focus Library Design.

PubMed

Huang, Wenkang; Nussinov, Ruth; Zhang, Jian

2017-01-01

Allostery is an intrinsic phenomenon of biological macromolecules involving regulation and/or signal transduction induced by a ligand binding to an allosteric site distinct from a molecule's active site. Allosteric drugs are currently receiving increased attention in drug discovery because drugs that target allosteric sites can provide important advantages over the corresponding orthosteric drugs including specific subtype selectivity within receptor families. Consequently, targeting allosteric sites, instead of orthosteric sites, can reduce drug-related side effects and toxicity. On the down side, allosteric drug discovery can be more challenging than traditional orthosteric drug discovery due to difficulties associated with determining the locations of allosteric sites and designing drugs based on these sites and the need for the allosteric effects to propagate through the structure, reach the ligand binding site and elicit a conformational change. In this study, we present computational tools ranging from the identification of potential allosteric sites to the design of "allosteric-like" modulator libraries. These tools may be particularly useful for allosteric drug discovery.

An efficient method to transcription factor binding sites imputation via simultaneous completion of multiple matrices with positional consistency.

PubMed

Guo, Wei-Li; Huang, De-Shuang

2017-08-22

Transcription factors (TFs) are DNA-binding proteins that have a central role in regulating gene expression. Identification of DNA-binding sites of TFs is a key task in understanding transcriptional regulation, cellular processes and disease. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) enables genome-wide identification of in vivo TF binding sites. However, it is still difficult to map every TF in every cell line owing to cost and biological material availability, which poses an enormous obstacle for integrated analysis of gene regulation. To address this problem, we propose a novel computational approach, TFBSImpute, for predicting additional TF binding profiles by leveraging information from available ChIP-seq TF binding data. TFBSImpute fuses the dataset to a 3-mode tensor and imputes missing TF binding signals via simultaneous completion of multiple TF binding matrices with positional consistency. We show that signals predicted by our method achieve overall similarity with experimental data and that TFBSImpute significantly outperforms baseline approaches, by assessing the performance of imputation methods against observed ChIP-seq TF binding profiles. Besides, motif analysis shows that TFBSImpute preforms better in capturing binding motifs enriched in observed data compared with baselines, indicating that the higher performance of TFBSImpute is not simply due to averaging related samples. We anticipate that our approach will constitute a useful complement to experimental mapping of TF binding, which is beneficial for further study of regulation mechanisms and disease.

Recognizing metal and acid radical ion-binding sites by integrating ab initio modeling with template-based transferals.

PubMed

Hu, Xiuzhen; Dong, Qiwen; Yang, Jianyi; Zhang, Yang

2016-11-01

More than half of proteins require binding of metal and acid radical ions for their structure and function. Identification of the ion-binding locations is important for understanding the biological functions of proteins. Due to the small size and high versatility of the metal and acid radical ions, however, computational prediction of their binding sites remains difficult. We proposed a new ligand-specific approach devoted to the binding site prediction of 13 metal ions (Zn 2+ , Cu 2+ , Fe 2+ , Fe 3+ , Ca 2+ , Mg 2+ , Mn 2+ , Na + , K + ) and acid radical ion ligands (CO3 2- , NO2 - , SO4 2- , PO4 3- ) that are most frequently seen in protein databases. A sequence-based ab initio model is first trained on sequence profiles, where a modified AdaBoost algorithm is extended to balance binding and non-binding residue samples. A composite method IonCom is then developed to combine the ab initio model with multiple threading alignments for further improving the robustness of the binding site predictions. The pipeline was tested using 5-fold cross validations on a comprehensive set of 2,100 non-redundant proteins bound with 3,075 small ion ligands. Significant advantage was demonstrated compared with the state of the art ligand-binding methods including COACH and TargetS for high-accuracy ion-binding site identification. Detailed data analyses show that the major advantage of IonCom lies at the integration of complementary ab initio and template-based components. Ion-specific feature design and binding library selection also contribute to the improvement of small ion ligand binding predictions. http://zhanglab.ccmb.med.umich.edu/IonCom CONTACT: hxz@imut.edu.cn or zhng@umich.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context

PubMed Central

Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing

2016-01-01

Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor (http://hlt.hitsz.edu.cn:8080/PDNAsite/) is made available for free public accessible to the biological research community. PMID:27282833

Analogs of methyllycaconitine as novel noncompetitive inhibitors of nicotinic receptors: pharmacological characterization, computational modeling, and pharmacophore development.

PubMed

McKay, Dennis B; Chang, Cheng; González-Cestari, Tatiana F; McKay, Susan B; El-Hajj, Raed A; Bryant, Darrell L; Zhu, Michael X; Swaan, Peter W; Arason, Kristjan M; Pulipaka, Aravinda B; Orac, Crina M; Bergmeier, Stephen C

2007-05-01

As a novel approach to drug discovery involving neuronal nicotinic acetylcholine receptors (nAChRs), our laboratory targeted nonagonist binding sites (i.e., noncompetitive binding sites, negative allosteric binding sites) located on nAChRs. Cultured bovine adrenal cells were used as neuronal models to investigate interactions of 67 analogs of methyllycaconitine (MLA) on native alpha3beta4* nAChRs. The availability of large numbers of structurally related molecules presents a unique opportunity for the development of pharmacophore models for noncompetitive binding sites. Our MLA analogs inhibited nicotine-mediated functional activation of both native and recombinant alpha3beta4* nAChRs with a wide range of IC(50) values (0.9-115 microM). These analogs had little or no inhibitory effects on agonist binding to native or recombinant nAChRs, supporting noncompetitive inhibitory activity. Based on these data, two highly predictive 3D quantitative structure-activity relationship (comparative molecular field analysis and comparative molecular similarity index analysis) models were generated. These computational models were successfully validated and provided insights into the molecular interactions of MLA analogs with nAChRs. In addition, a pharmacophore model was constructed to analyze and visualize the binding requirements to the analog binding site. The pharmacophore model was subsequently applied to search structurally diverse molecular databases to prospectively identify novel inhibitors. The rapid identification of eight molecules from database mining and our successful demonstration of in vitro inhibitory activity support the utility of these computational models as novel tools for the efficient retrieval of inhibitors. These results demonstrate the effectiveness of computational modeling and pharmacophore development, which may lead to the identification of new therapeutic drugs that target novel sites on nAChRs.

Identification of neuronal target genes for CCAAT/Enhancer Binding Proteins

PubMed Central

Kfoury, N.; Kapatos, G.

2009-01-01

CCAAT/Enhancer Binding Proteins (C/EBPs) play pivotal roles in development and plasticity of the nervous system. Identification of the physiological targets of C/EBPs (C/EBP target genes) should therefore provide insight into the underlying biology of these processes. We used unbiased genome-wide mapping to identify 115 C/EBPβ target genes in PC12 cells that include transcription factors, neurotransmitter receptors, ion channels, protein kinases and synaptic vesicle proteins. C/EBPβ binding sites were located primarily within introns, suggesting novel regulatory functions, and were associated with binding sites for other developmentally important transcription factors. Experiments using dominant negatives showed C/EBPβ to repress transcription of a subset of target genes. Target genes in rat brain were subsequently found to preferentially bind C/EBPα, β and δ. Analysis of the hippocampal transcriptome of C/EBPβ knockout mice revealed dysregulation of a high percentage of transcripts identified as C/EBP target genes. These results support the hypothesis that C/EBPs play non-redundant roles in the brain. PMID:19103292

Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sloan, J.W.

1984-01-01

These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

Identification of high-confidence RNA regulatory elements by combinatorial classification of RNA-protein binding sites.

PubMed

Li, Yang Eric; Xiao, Mu; Shi, Binbin; Yang, Yu-Cheng T; Wang, Dong; Wang, Fei; Marcia, Marco; Lu, Zhi John

2017-09-08

Crosslinking immunoprecipitation sequencing (CLIP-seq) technologies have enabled researchers to characterize transcriptome-wide binding sites of RNA-binding protein (RBP) with high resolution. We apply a soft-clustering method, RBPgroup, to various CLIP-seq datasets to group together RBPs that specifically bind the same RNA sites. Such combinatorial clustering of RBPs helps interpret CLIP-seq data and suggests functional RNA regulatory elements. Furthermore, we validate two RBP-RBP interactions in cell lines. Our approach links proteins and RNA motifs known to possess similar biochemical and cellular properties and can, when used in conjunction with additional experimental data, identify high-confidence RBP groups and their associated RNA regulatory elements.

CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

PubMed Central

Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

2008-01-01

Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

Cryptic binding sites on proteins: definition, detection, and druggability.

PubMed

Vajda, Sandor; Beglov, Dmitri; Wakefield, Amanda E; Egbert, Megan; Whitty, Adrian

2018-05-22

Many proteins in their unbound structures lack surface pockets appropriately sized for drug binding. Hence, a variety of experimental and computational tools have been developed for the identification of cryptic sites that are not evident in the unbound protein but form upon ligand binding, and can provide tractable drug target sites. The goal of this review is to discuss the definition, detection, and druggability of such sites, and their potential value for drug discovery. Novel methods based on molecular dynamics simulations are particularly promising and yield a large number of transient pockets, but it has been shown that only a minority of such sites are generally capable of binding ligands with substantial affinity. Based on recent studies, current methodology can be improved by combining molecular dynamics with fragment docking and machine learning approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.

Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase

PubMed Central

Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel

2012-01-01

The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308

Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

PubMed Central

Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

2010-01-01

Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

Pharmacophore screening of the protein data bank for specific binding site chemistry.

PubMed

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Identification of Small Molecules against Botulinum Neurotoxin B Binding to Neuronal Cells at Ganglioside GT1b Binding Site with Low to Moderate Affinity

DTIC Science & Technology

2014-10-01

BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the BoNT/B/trisaccharide (GT1b) complex ( PDB ...trisaccharide and all the water from the structure and identified four potential binding pockets (Pocket-1, Pocket-2, and Pocket-4) as shown in...four potential binding sites or pockets on BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data

PubMed Central

2010-01-01

Background Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) or ChIP followed by genome tiling array analysis (ChIP-chip) have become standard technologies for genome-wide identification of DNA-binding protein target sites. A number of algorithms have been developed in parallel that allow identification of binding sites from ChIP-seq or ChIP-chip datasets and subsequent visualization in the University of California Santa Cruz (UCSC) Genome Browser as custom annotation tracks. However, summarizing these tracks can be a daunting task, particularly if there are a large number of binding sites or the binding sites are distributed widely across the genome. Results We have developed ChIPpeakAnno as a Bioconductor package within the statistical programming environment R to facilitate batch annotation of enriched peaks identified from ChIP-seq, ChIP-chip, cap analysis of gene expression (CAGE) or any experiments resulting in a large number of enriched genomic regions. The binding sites annotated with ChIPpeakAnno can be viewed easily as a table, a pie chart or plotted in histogram form, i.e., the distribution of distances to the nearest genes for each set of peaks. In addition, we have implemented functionalities for determining the significance of overlap between replicates or binding sites among transcription factors within a complex, and for drawing Venn diagrams to visualize the extent of the overlap between replicates. Furthermore, the package includes functionalities to retrieve sequences flanking putative binding sites for PCR amplification, cloning, or motif discovery, and to identify Gene Ontology (GO) terms associated with adjacent genes. Conclusions ChIPpeakAnno enables batch annotation of the binding sites identified from ChIP-seq, ChIP-chip, CAGE or any technology that results in a large number of enriched genomic regions within the statistical programming environment R. Allowing users to pass their own annotation data such as a different Chromatin immunoprecipitation (ChIP) preparation and a dataset from literature, or existing annotation packages, such as GenomicFeatures and BSgenome, provides flexibility. Tight integration to the biomaRt package enables up-to-date annotation retrieval from the BioMart database. PMID:20459804

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

A Bioinformatics Approach to the Identification of Variants Associated with Type 1 and Type 2 Diabetes Mellitus that Reside in Functionally Validated miRNAs Binding Sites.

PubMed

Ghaedi, Hamid; Bastami, Milad; Jahani, Mohammad Mehdi; Alipoor, Behnam; Tabasinezhad, Maryam; Ghaderi, Omar; Nariman-Saleh-Fam, Ziba; Mirfakhraie, Reza; Movafagh, Abolfazl; Omrani, Mir Davood; Masotti, Andrea

2016-06-01

The present work is aimed at finding variants associated with Type 1 and Type 2 diabetes mellitus (DM) that reside in functionally validated miRNAs binding sites and that can have a functional role in determining diabetes and related pathologies. Using bioinformatics analyses we obtained a database of validated polymorphic miRNA binding sites which has been intersected with genes related to DM or to variants associated and/or in linkage disequilibrium (LD) with it and is reported in genome-wide association studies (GWAS). The workflow we followed allowed us to find variants associated with DM that also reside in functional miRNA binding sites. These data have been demonstrated to have a functional role by impairing the functions of genes implicated in biological processes linked to DM. In conclusion, our work emphasized the importance of SNPs located in miRNA binding sites. The results discussed in this work may constitute the basis of further works aimed at finding functional candidates and variants affecting protein structure and function, transcription factor binding sites, and non-coding epigenetic variants, contributing to widen the knowledge about the pathogenesis of this important disease.

oPOSSUM: identification of over-represented transcription factor binding sites in co-expressed genes

PubMed Central

Ho Sui, Shannan J.; Mortimer, James R.; Arenillas, David J.; Brumm, Jochen; Walsh, Christopher J.; Kennedy, Brian P.; Wasserman, Wyeth W.

2005-01-01

Targeted transcript profiling studies can identify sets of co-expressed genes; however, identification of the underlying functional mechanism(s) is a significant challenge. Established methods for the analysis of gene annotations, particularly those based on the Gene Ontology, can identify functional linkages between genes. Similar methods for the identification of over-represented transcription factor binding sites (TFBSs) have been successful in yeast, but extension to human genomics has largely proved ineffective. Creation of a system for the efficient identification of common regulatory mechanisms in a subset of co-expressed human genes promises to break a roadblock in functional genomics research. We have developed an integrated system that searches for evidence of co-regulation by one or more transcription factors (TFs). oPOSSUM combines a pre-computed database of conserved TFBSs in human and mouse promoters with statistical methods for identification of sites over-represented in a set of co-expressed genes. The algorithm successfully identified mediating TFs in control sets of tissue-specific genes and in sets of co-expressed genes from three transcript profiling studies. Simulation studies indicate that oPOSSUM produces few false positives using empirically defined thresholds and can tolerate up to 50% noise in a set of co-expressed genes. PMID:15933209

Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

PubMed

Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

2014-11-18

Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

Site Identification by Ligand Competitive Saturation (SILCS) simulations for fragment-based drug design.

PubMed

Faller, Christina E; Raman, E Prabhu; MacKerell, Alexander D; Guvench, Olgun

2015-01-01

Fragment-based drug design (FBDD) involves screening low molecular weight molecules ("fragments") that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind nonoverlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy.The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is "soaked" in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called "FragMaps" can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine "Grid Free Energies (GFEs)," which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities.

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

A combination of 19F NMR and surface plasmon resonance for site-specific hit selection and validation of fragment molecules that bind to the ATP-binding site of a kinase.

PubMed

Nagatoishi, Satoru; Yamaguchi, Sou; Katoh, Etsuko; Kajita, Keita; Yokotagawa, Takane; Kanai, Satoru; Furuya, Toshio; Tsumoto, Kouhei

2018-05-01

19 F NMR has recently emerged as an efficient, sensitive tool for analyzing protein binding to small molecules, and surface plasmon resonance (SPR) is also a popular tool for this purpose. Herein a combination of 19 F NMR and SPR was used to find novel binders to the ATP-binding pocket of MAP kinase extracellular regulated kinase 2 (ERK2) by fragment screening with an original fluorinated-fragment library. The 19 F NMR screening yielded a high primary hit rate of binders to the ERK2 ATP-binding pocket compared with the rate for the SPR screening. Hit compounds were evaluated and categorized according to their ability to bind to different binding sites in the ATP-binding pocket. The binding manner was characterized by using isothermal titration calorimetry and docking simulation. Combining 19 F NMR with other biophysical methods allows the identification of multiple types of hit compounds, thereby increasing opportunities for drug design using preferred fragments. Copyright © 2018 Elsevier Ltd. All rights reserved.

Transcription Factor Information System (TFIS): A Tool for Detection of Transcription Factor Binding Sites.

PubMed

Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C

2017-09-01

Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).

Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions

NASA Astrophysics Data System (ADS)

Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

2016-11-01

Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

Determinants of RNA binding and translational repression by the Bicaudal-C regulatory protein.

PubMed

Zhang, Yan; Park, Sookhee; Blaser, Susanne; Sheets, Michael D

2014-03-14

Bicaudal-C (Bic-C) RNA binding proteins function as important translational repressors in multiple biological contexts within metazoans. However, their RNA binding sites are unknown. We recently demonstrated that Bic-C functions in spatially regulated translational repression of the xCR1 mRNA during Xenopus development. This repression contributes to normal development by confining the xCR1 protein, a regulator of key signaling pathways, to specific cells of the embryo. In this report, we combined biochemical approaches with in vivo mRNA reporter assays to define the minimal Bic-C target site within the xCR1 mRNA. This 32-nucleotide Bic-C target site is predicted to fold into a stem-loop secondary structure. Mutational analyses provided evidence that this stem-loop structure is important for Bic-C binding. The Bic-C target site was sufficient for Bic-C mediated repression in vivo. Thus, we describe the first RNA binding site for a Bic-C protein. This identification provides an important step toward understanding the mechanisms by which evolutionarily conserved Bic-C proteins control cellular function in metazoans.

Modulation of the NMDA receptor by polyamines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, K.; Romano, C.; Dichter, M.A.

1991-01-01

Results of recent biochemical and electrophysiological studies have suggested that a recognition site for polyamines exists as part of the NMDA receptor complex. The endogenous polyamines spermine and spermidine increase the binding of open-channel blockers and increase NMDA-elicited currents in cultured neutrons. These polyamines have been termed agonists at the polyamine recognition site. Studies of the effects of natural and synthetic polyamines on the binding of ({sup 3}H)MK-801 and on NMDA-elicited currents in cultured neurons have led to the identification of compounds classified as partial agonists, antagonists, and inverse agonists at the polyamine recognition site. Polyamines have also been foundmore » to affect the binding of ligands to the recognition sites for glutamate and glycine. However, these effects may be mediated at a site distinct from that at which polyamines act to modulate the binding of open-channel blockers. Endogenous polyamines may modulate excitatory synaptic transmission by acting at the polyamine recognition site of the NMDA receptor. This site could represent a novel therapeutic target for the treatment of ischemia-induced neurotoxicity, epilepsy, and neurodegenerative diseases.« less

Interaction between phloretin and the red blood cell membrane

PubMed Central

1976-01-01

Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

Identification of an allosteric binding site for RORγt inhibition

PubMed Central

Scheepstra, Marcel; Leysen, Seppe; van Almen, Geert C.; Miller, J. Richard; Piesvaux, Jennifer; Kutilek, Victoria; van Eenennaam, Hans; Zhang, Hongjun; Barr, Kenneth; Nagpal, Sunil; Soisson, Stephen M.; Kornienko, Maria; Wiley, Kristen; Elsen, Nathaniel; Sharma, Sujata; Correll, Craig C.; Trotter, B. Wesley; van der Stelt, Mario; Oubrie, Arthur; Ottmann, Christian; Parthasarathy, Gopal; Brunsveld, Luc

2015-01-01

RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of small-molecule antagonists demonstrates occupancy of a previously unreported allosteric binding pocket. Binding at this non-canonical site induces an unprecedented conformational reorientation of helix 12 in the RORγt LBD, which blocks cofactor binding. The functional consequence of this allosteric ligand-mediated conformation is inhibition of function as evidenced by both biochemical and cellular studies. RORγt function is thus antagonized in a manner molecularly distinct from that of previously described orthosteric RORγt ligands. This brings forward an approach to target RORγt for the treatment of Th17-mediated autoimmune diseases. The elucidation of an unprecedented modality of pharmacological antagonism establishes a mechanism for modulation of nuclear receptors. PMID:26640126

Genome-Wide Cell Type-Specific Mapping of In Vivo Chromatin Protein Binding Using an FLP-Inducible DamID System in Drosophila.

PubMed

Pindyurin, Alexey V

2017-01-01

A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.

Retro-binding thrombin active site inhibitors: identification of an orally active inhibitor of thrombin catalytic activity.

PubMed

Iwanowicz, Edwin J; Kimball, S David; Lin, James; Lau, Wan; Han, W-C; Wang, Tammy C; Roberts, Daniel G M; Schumacher, W A; Ogletree, Martin L; Seiler, Steven M

2002-11-04

A series of retro-binding inhibitors of human alpha-thrombin was prepared to elucidate structure-activity relationships (SAR) and optimize in vivo performance. Compounds 9 and 11, orally active inhibitors of thrombin catalytic activity, were identified to be efficacious in a thrombin-induced lethality model in mice.

Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

PubMed Central

Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

2014-01-01

Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

Melatonin receptors: Current status, facts, and hypothesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stankov, B.; Reiter, R.J.

Great progress has been made in the identification of melatonin binding sites, commonly identified as melatonin receptors by many authors, in recent years. The bulk of these studies have investigated the sites using either autoradiographic and biochemical techniques with the majority of the experiments being done on the rat, Djungarian and Syrian hamster, and sheep, although human tissue has also been employed. Many of the studies have identified melatonin binding in the central nervous system with either tritium- or iodine-labelled ligands. The latter ligand seems to provide the most reproducible and consistent data. Of the central neural tissues examined, themore » suprachiasmatic nuclei are most frequently mentioned as a location for melatonin binding sites although binding seems to be widespread in the brain. The other tissue that has been prominently mentioned as a site for melatonin binding is the pars tuberalis of the anterior pituitary gland. There may be time-dependent variations in melatonin binding densities in both neural and pituitary gland tissue. Very few attempts have been made to identify melatonin binding outside of the central nervous system despite the widespread actions of melatonin. Preliminary experiments have been carried out on the intracellular second messengers which mediate the actions of melatonin.« less

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

Site Identification by Ligand Competitive Saturation (SILCS) Simulations for Fragment-Based Drug Design

PubMed Central

Faller, Christina E.; Raman, E. Prabhu; MacKerell, Alexander D.; Guvench, Olgun

2015-01-01

Fragment-based drug design (FBDD) involves screening low molecular weight molecules (“fragments”) that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind non-overlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy. The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is “soaked” in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called “FragMaps” can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine “Grid Free Energies (GFEs),” which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities. PMID:25709034

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

PubMed

Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

2017-11-01

Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

Impact of germline and somatic missense variations on drug binding sites.

PubMed

Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

2017-03-01

Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

Catalytic site identification--a web server to identify catalytic site structural matches throughout PDB.

PubMed

Kirshner, Daniel A; Nilmeier, Jerome P; Lightstone, Felice C

2013-07-01

The catalytic site identification web server provides the innovative capability to find structural matches to a user-specified catalytic site among all Protein Data Bank proteins rapidly (in less than a minute). The server also can examine a user-specified protein structure or model to identify structural matches to a library of catalytic sites. Finally, the server provides a database of pre-calculated matches between all Protein Data Bank proteins and the library of catalytic sites. The database has been used to derive a set of hypothesized novel enzymatic function annotations. In all cases, matches and putative binding sites (protein structure and surfaces) can be visualized interactively online. The website can be accessed at http://catsid.llnl.gov.

Identification of cation-binding sites on actin that drive polymerization and modulate bending stiffness

PubMed Central

Kang, Hyeran; Bradley, Michael J.; McCullough, Brannon R.; Pierre, Anaëlle; Grintsevich, Elena E.; Reisler, Emil; De La Cruz, Enrique M.

2012-01-01

The assembly of actin monomers into filaments and networks plays vital roles throughout eukaryotic biology, including intracellular transport, cell motility, cell division, determining cellular shape, and providing cells with mechanical strength. The regulation of actin assembly and modulation of filament mechanical properties are critical for proper actin function. It is well established that physiological salt concentrations promote actin assembly and alter the overall bending mechanics of assembled filaments and networks. However, the molecular origins of these salt-dependent effects, particularly if they involve nonspecific ionic strength effects or specific ion-binding interactions, are unknown. Here, we demonstrate that specific cation binding at two discrete sites situated between adjacent subunits along the long-pitch helix drive actin polymerization and determine the filament bending rigidity. We classify the two sites as “polymerization” and “stiffness” sites based on the effects that mutations at the sites have on salt-dependent filament assembly and bending mechanics, respectively. These results establish the existence and location of the cation-binding sites that confer salt dependence to the assembly and mechanics of actin filaments. PMID:23027950

Identification on Membrane and Characterization of Phosphoproteins Using an Alkoxide-Bridged Dinuclear Metal Complex as a Phosphate-Binding Tag Molecule

PubMed Central

Nakanishi, Tsuyoshi; Ando, Eiji; Furuta, Masaru; Kinoshita, Eiji; Kinoshita-Kikuta, Emiko; Koike, Tohru; Tsunasawa, Susumu; Nishimura, Osamu

2007-01-01

We have developed a method for on-membrane direct identification of phosphoproteins, which are detected by a phosphate-binding tag (Phos-tag) that has an affinity to phosphate groups with a chelated Zn2+ ion. This rapid profiling approach for phosphoproteins combines chemical inkjet technology for microdispensing of reagents onto a tiny region of target proteins with mass spectrometry for on-membrane digested peptides. Using this method, we analyzed human epidermoid carcinoma cell lysates of A-431 cells stimulated with epidermal growth factor, and identified six proteins with intense signals upon affinity staining with the phosphate-binding tag. It was already known that these proteins are phosphorylated, and our new approach proved to be effective at rapid profiling of phosphoproteins. Furthermore, we tried to determine their phosphorylation sites by MS/MS analysis after in-gel digestion of the corresponding spots on the 2DE gel to the rapid on-membrane identifications. As one example of use of information gained from the rapid-profiling approach, we successfully characterized a phosphorylation site at Ser-113 on prostaglandin E synthase 3. PMID:18166671

Human germline and pan-cancer variomes and their distinct functional profiles

PubMed Central

Pan, Yang; Karagiannis, Konstantinos; Zhang, Haichen; Dingerdissen, Hayley; Shamsaddini, Amirhossein; Wan, Quan; Simonyan, Vahan; Mazumder, Raja

2014-01-01

Identification of non-synonymous single nucleotide variations (nsSNVs) has exponentially increased due to advances in Next-Generation Sequencing technologies. The functional impacts of these variations have been difficult to ascertain because the corresponding knowledge about sequence functional sites is quite fragmented. It is clear that mapping of variations to sequence functional features can help us better understand the pathophysiological role of variations. In this study, we investigated the effect of nsSNVs on more than 17 common types of post-translational modification (PTM) sites, active sites and binding sites. Out of 1 705 285 distinct nsSNVs on 259 216 functional sites we identified 38 549 variations that significantly affect 10 major functional sites. Furthermore, we found distinct patterns of site disruptions due to germline and somatic nsSNVs. Pan-cancer analysis across 12 different cancer types led to the identification of 51 genes with 106 nsSNV affected functional sites found in 3 or more cancer types. 13 of the 51 genes overlap with previously identified Significantly Mutated Genes (Nature. 2013 Oct 17;502(7471)). 62 mutations in these 13 genes affecting functional sites such as DNA, ATP binding and various PTM sites occur across several cancers and can be prioritized for additional validation and investigations. PMID:25232094

Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

PubMed Central

Pierce, M L; Ruffner, D E

1998-01-01

Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

Mass spectrometry for identification of proteins that specifically bind to a distal enhancer of the Oct4 gene

NASA Astrophysics Data System (ADS)

Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.

2017-11-01

Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.

Identification of the bile acid-binding site of the ileal lipid-binding protein by photoaffinity labeling, matrix-assisted laser desorption ionization-mass spectrometry, and NMR structure.

PubMed

Kramer, W; Sauber, K; Baringhaus, K H; Kurz, M; Stengelin, S; Lange, G; Corsiero, D; Girbig, F; König, W; Weyland, C

2001-03-09

The ileal lipid-binding protein (ILBP) is the only physiologically relevant bile acid-binding protein in the cytosol of ileocytes. To identify the bile acid-binding site(s) of ILBP, recombinant rabbit ILBP photolabeled with 3-azi- and 7-azi-derivatives of cholyltaurine was analyzed by a combination of enzymatic fragmentation, gel electrophoresis, and matrix-assisted laser desorption ionization (MALDI)-mass spectrometry. The attachment site of the 3-position of cholyltaurine was localized to the amino acid triplet His(100)-Thr(101)-Ser(102) using the photoreactive 3,3-azo-derivative of cholyltaurine. With the corresponding 7,7-azo-derivative, the attachment point of the 7-position could be localized to the C-terminal part (position 112-128) as well as to the N-terminal part suggesting more than one binding site for bile acids. By chemical modification and NMR structure of ILBP, arginine residue 122 was identified as the probable contact point for the negatively charged side chain of cholyltaurine. Consequently, bile acids bind to ILBP with the steroid nucleus deep inside the protein cavity and the negatively charged side chain near the entry portal. The combination of photoaffinity labeling, enzymatic fragmentation, MALDI-mass spectrometry, and NMR structure was successfully used to determine the topology of bile acid binding to ILBP.

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny

PubMed Central

Orengo, Dorcas J.; Aguadé, Montserrat

2017-01-01

The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426

Photoaffinity labeling in target- and binding-site identification

PubMed Central

Smith, Ewan; Collins, Ian

2015-01-01

Photoaffinity labeling (PAL) using a chemical probe to covalently bind its target in response to activation by light has become a frequently used tool in drug discovery for identifying new drug targets and molecular interactions, and for probing the location and structure of binding sites. Methods to identify the specific target proteins of hit molecules from phenotypic screens are highly valuable in early drug discovery. In this review, we summarize the principles of PAL including probe design and experimental techniques for in vitro and live cell investigations. We emphasize the need to optimize and validate probes and highlight examples of the successful application of PAL across multiple disease areas. PMID:25686004

Identification of an hexapeptide that binds to a surface pocket in cyclin A and inhibits the catalytic activity of the complex cyclin-dependent kinase 2-cyclin A.

PubMed

Canela, Núria; Orzáez, Mar; Fucho, Raquel; Mateo, Francesca; Gutierrez, Ricardo; Pineda-Lucena, Antonio; Bachs, Oriol; Pérez-Payá, Enrique

2006-11-24

The protein-protein complexes formed between different cyclins and cyclin-dependent kinases (CDKs) are central to cell cycle regulation. These complexes represent interesting points of chemical intervention for the development of antineoplastic molecules. Here we describe the identification of an all d-amino acid hexapeptide, termed NBI1, that inhibits the kinase activity of the cyclin-dependent kinase 2 (cdk2)-cyclin A complex through selective binding to cyclin A. The mechanism of inhibition is non-competitive for ATP and non-competitive for protein substrates. In contrast to the existing CDKs peptide inhibitors, the hexapeptide NBI1 interferes with the formation of the cdk2-cyclin A complex. Furthermore, a cell-permeable derivative of NBI1 induces apoptosis and inhibits proliferation of tumor cell lines. Thus, the NBI1-binding site on cyclin A may represent a new target site for the selective inhibition of activity cdk2-cyclin A complex.

Discovery of d-amino acid oxidase inhibitors based on virtual screening against the lid-open enzyme conformation.

PubMed

Szilágyi, Bence; Skok, Žiga; Rácz, Anita; Frlan, Rok; Ferenczy, György G; Ilaš, Janez; Keserű, György M

2018-06-01

d-Amino acid oxidase (DAAO) inhibitors are typically small polar compounds with often suboptimal pharmacokinetic properties. Features of the native binding site limit the operational freedom of further medicinal chemistry efforts. We therefore initiated a structure based virtual screening campaign based on the X-ray structures of DAAO complexes where larger ligands shifted the loop (lid opening) covering the native binding site. The virtual screening of our in-house collection followed by the in vitro test of the best ranked compounds led to the identification of a new scaffold with micromolar IC 50 . Subsequent SAR explorations enabled us to identify submicromolar inhibitors. Docking studies supported by in vitro activity measurements suggest that compounds bind to the active site with a salt-bridge characteristic to DAAO inhibitor binding. In addition, displacement of and interaction with the loop covering the active site contributes significantly to the activity of the most potent compounds. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.

PubMed

Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A

2012-07-01

Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

Rapid experimental SAD phasing and hot-spot identification with halogenated fragments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bauman, Joseph D.; Harrison, Jerry Joe E. K.; Arnold, Eddy

2016-01-01

Through X-ray crystallographic fragment screening, 4-bromopyrazole was discovered to be a `magic bullet' that is capable of binding at many of the ligand `hot spots' found in HIV-1 reverse transcriptase (RT). The binding locations can be in pockets that are `hidden' in the unliganded crystal form, allowing rapid identification of these sites forin silicoscreening. In addition to hot-spot identification, this ubiquitous yet specific binding provides an avenue for X-ray crystallographic phase determination, which can be a significant bottleneck in the determination of the structures of novel proteins. The anomalous signal from 4-bromopyrazole or 4-iodopyrazole was sufficient to determine the structuresmore » of three proteins (HIV-1 RT, influenza A endonuclease and proteinase K) by single-wavelength anomalous dispersion (SAD) from single crystals. Both compounds are inexpensive, readily available, safe and very soluble in DMSO or water, allowing efficient soaking into crystals.« less

Identification and Characterization of a Secondary Sodium-Binding Site and the Main Selectivity Determinants in the Human Concentrative Nucleoside Transporter 3.

PubMed

Arimany-Nardi, C; Claudio-Montero, A; Viel-Oliva, A; Schmidtke, P; Estarellas, C; Barril, X; Bidon-Chanal, A; Pastor-Anglada, M

2017-06-05

The family of concentrative Na + /nucleoside cotransporters in humans is constituted by three subtypes, namely, hCNT1, hCNT2, and hCNT3. Besides their different nucleoside selectivity, hCNT1 and hCNT2 have a Na + /nucleoside stoichiometry of 1:1, while for hCNT3 it is 2:1. This distinct stoichiometry of subtype 3 might hint the existence of a secondary sodium-binding site that is not present in the other two subtypes, but to date their three-dimensional structures remain unknown and the residues implicated in Na + binding are unclear. In this work, we have identified and characterized the Na + binding sites of hCNT3 by combining molecular modeling and mutagenesis studies. A model of the transporter was obtained by homology modeling, and key residues of two sodium-binding sites were identified and verified with a mutagenesis strategy. The structural model explains the altered sodium-binding properties of the hCNT3C602R polymorphic variant and supports previously generated data identifying the determinant residues of nucleoside selectivity, paving the way to understand how drugs can target this plasma membrane transporter.

Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

PubMed Central

Gupta, Gagan Deep; Kumar, Vinay

2012-01-01

Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

PubMed Central

Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

PubMed

Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

PubMed

Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

2009-01-01

Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

Identification and characterization of Hoxa9 binding sites in hematopoietic cells

PubMed Central

Huang, Yongsheng; Sitwala, Kajal; Bronstein, Joel; Sanders, Daniel; Dandekar, Monisha; Collins, Cailin; Robertson, Gordon; MacDonald, James; Cezard, Timothee; Bilenky, Misha; Thiessen, Nina; Zhao, Yongjun; Zeng, Thomas; Hirst, Martin; Hero, Alfred; Jones, Steven

2012-01-01

The clustered homeobox proteins play crucial roles in development, hematopoiesis, and leukemia, yet the targets they regulate and their mechanisms of action are poorly understood. Here, we identified the binding sites for Hoxa9 and the Hox cofactor Meis1 on a genome-wide level and profiled their associated epigenetic modifications and transcriptional targets. Hoxa9 and the Hox cofactor Meis1 cobind at hundreds of highly evolutionarily conserved sites, most of which are distant from transcription start sites. These sites show high levels of histone H3K4 monomethylation and CBP/P300 binding characteristic of enhancers. Furthermore, a subset of these sites shows enhancer activity in transient transfection assays. Many Hoxa9 and Meis1 binding sites are also bound by PU.1 and other lineage-restricted transcription factors previously implicated in establishment of myeloid enhancers. Conditional Hoxa9 activation is associated with CBP/P300 recruitment, histone acetylation, and transcriptional activation of a network of proto-oncogenes, including Erg, Flt3, Lmo2, Myb, and Sox4. Collectively, this work suggests that Hoxa9 regulates transcription by interacting with enhancers of genes important for hematopoiesis and leukemia. PMID:22072553

High Resolution Features from Low Affinity Interactions: Photoactive Analogs of the Haloether Anesthetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xi,J.; Liu, R.; Rossi, M.

2006-01-01

The difficulty in obtaining binding target and site information for low-affinity drugs, like the inhaled anesthetics, has limited identification of their molecular effectors. Because such information can be provided by photoactive analogues, we designed, synthesized, and characterized a novel diazirnyl haloether that closely mimics isoflurane, the most widely used clinical general anesthetic. This compound, H-diaziflurane, is a nontoxic, potent anesthetic that potentiates GABA-gated ion channels in primary cultures of hippocampal neurons. Calorimetric and structural characterizations show that H-diaziflurane binds a model anesthetic host protein with similar energetics as isoflurane and forms photoadducts with residues lining the isoflurane binding site. H-diazifluranemore » will be immediately useful for identifying targets and sites important for the molecular pharmacology of the inhaled haloether anesthetics.« less

Identification and characterization of the sodium-binding site of activated protein C.

PubMed

He, X; Rezaie, A R

1999-02-19

Activated protein C (APC) requires both Ca2+ and Na+ for its optimal catalytic function. In contrast to the Ca2+-binding sites, the Na+-binding site(s) of APC has not been identified. Based on a recent study with thrombin, the 221-225 loop is predicted to be a potential Na+-binding site in APC. The sequence of this loop is not conserved in trypsin. We engineered a Gla domainless form of protein C (GDPC) in which the 221-225 loop was replaced with the corresponding loop of trypsin. We found that activated GDPC (aGDPC) required Na+ (or other alkali cations) for its amidolytic activity with dissociation constant (Kd(app)) = 44.1 +/- 8.6 mM. In the presence of Ca2+, however, the requirement for Na+ by aGDPC was eliminated, and Na+ stimulated the cleavage rate 5-6-fold with Kd(app) = 2.3 +/- 0.3 mM. Both cations were required for efficient factor Va inactivation by aGDPC. In the presence of Ca2+, the catalytic function of the mutant was independent of Na+. Unlike aGDPC, the mutant did not discriminate among monovalent cations. We conclude that the 221-225 loop is a Na+-binding site in APC and that an allosteric link between the Na+ and Ca2+ binding loops modulates the structure and function of this anticoagulant enzyme.

Identification of new ligands for the methionine biosynthesis transcriptional regulator (MetJ) by FAC-MS.

PubMed

Martí-Arbona, Ricardo; Teshima, Munehiro; Anderson, Penelope S; Nowak-Lovato, Kristy L; Hong-Geller, Elizabeth; Unkefer, Clifford J; Unkefer, Pat J

2012-01-01

We have developed a high-throughput approach using frontal affinity chromatography coupled to mass spectrometry (FAC-MS) for the identification and characterization of the small molecules that modulate transcriptional regulator (TR) binding to TR targets. We tested this approach using the methionine biosynthesis regulator (MetJ). We used effector mixtures containing S-adenosyl-L-methionine (SAM) and S-adenosyl derivatives as potential ligands for MetJ binding. The differences in the elution time of different compounds allowed us to rank the binding affinity of each compound. Consistent with previous results, FAC-MS showed that SAM binds to MetJ with the highest affinity. In addition, adenine and 5'-deoxy-5'-(methylthio)adenosine bind to the effector binding site on MetJ. Our experiments with MetJ demonstrate that FAC-MS is capable of screening complex mixtures of molecules and identifying high-affinity binders to TRs. In addition, FAC-MS experiments can be used to discriminate between specific and nonspecific binding of the effectors as well as to estimate the dissociation constant (K(d)) for effector-TR binding. Copyright © 2012 S. Karger AG, Basel.

An integrated workflow for analysis of ChIP-chip data.

PubMed

Weigelt, Karin; Moehle, Christoph; Stempfl, Thomas; Weber, Bernhard; Langmann, Thomas

2008-08-01

Although ChIP-chip is a powerful tool for genome-wide discovery of transcription factor target genes, the steps involving raw data analysis, identification of promoters, and correlation with binding sites are still laborious processes. Therefore, we report an integrated workflow for the analysis of promoter tiling arrays with the Genomatix ChipInspector system. We compare this tool with open-source software packages to identify PU.1 regulated genes in mouse macrophages. Our results suggest that ChipInspector data analysis, comparative genomics for binding site prediction, and pathway/network modeling significantly facilitate and enhance whole-genome promoter profiling to reveal in vivo sites of transcription factor-DNA interactions.

Studies on the regulation of the human E1 subunit of the 2-oxoglutarate dehydrogenase complex, including the identification of a novel calcium-binding site.

PubMed

Armstrong, Craig T; Anderson, J L Ross; Denton, Richard M

2014-04-15

The regulation of the 2-oxoglutarate dehydrogenase complex is central to intramitochondrial energy metabolism. In the present study, the active full-length E1 subunit of the human complex has been expressed and shown to be regulated by Ca2+, adenine nucleotides and NADH, with NADH exerting a major influence on the K0.5 value for Ca2+. We investigated two potential Ca2+-binding sites on E1, which we term site 1 (D114ADLD) and site 2 (E139SDLD). Comparison of sequences from vertebrates with those from Ca2+-insensitive non-vertebrate complexes suggest that site 1 may be the more important. Consistent with this view, a mutated form of E1, D114A, shows a 6-fold decrease in sensitivity for Ca2+, whereas variant ∆site1 (in which the sequence of site 1 is replaced by A114AALA) exhibits an almost complete loss of Ca2+ activation. Variant ∆site2 (in which the sequence is replaced with A139SALA) shows no measurable change in Ca2+ sensitivity. We conclude that site 1, but not site 2, forms part of a regulatory Ca2+-binding site, which is distinct from other previously described Ca2+-binding sites.

Reprogramming cell fate with a genome-scale library of artificial transcription factors.

PubMed

Eguchi, Asuka; Wleklinski, Matthew J; Spurgat, Mackenzie C; Heiderscheit, Evan A; Kropornicka, Anna S; Vu, Catherine K; Bhimsaria, Devesh; Swanson, Scott A; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J; Slukvin, Igor; Thomson, James A; Dutton, James R; Ansari, Aseem Z

2016-12-20

Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices.

Preparation and high-resolution microscopy of gold cluster labeled nucleic acid conjugates and nanodevices

PubMed Central

Powell, Richard D.; Hainfeld, James F.

2013-01-01

Nanogold and undecagold are covalently linked gold cluster labels which enable the identification and localization of biological components with molecular precision and resolution. They can be prepared with different reactivities, which means they can be conjugated to a wide variety of molecules, including nucleic acids, at specific, unique sites. The location of these sites can be synthetically programmed in order to preserve the binding affinity of the conjugate and impart novel characteristics and useful functionality. Methods for the conjugation of undecagold and Nanogold to DNA and RNA are discussed, and applications of labeled conjugates to the high-resolution microscopic identification of binding sites and characterization of biological macromolecular assemblies are described. In addition to providing insights into their molecular structure and function, high-resolution microscopic methods also show how Nanogold and undecagold conjugates can be synthetically assembled, or self-assemble, into supramolecular materials to which the gold cluster labels impart useful functionality. PMID:20869258

Reprogramming cell fate with a genome-scale library of artificial transcription factors

PubMed Central

Eguchi, Asuka; Wleklinski, Matthew J.; Spurgat, Mackenzie C.; Heiderscheit, Evan A.; Kropornicka, Anna S.; Vu, Catherine K.; Bhimsaria, Devesh; Swanson, Scott A.; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J.; Slukvin, Igor; Thomson, James A.; Dutton, James R.; Ansari, Aseem Z.

2016-01-01

Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices. PMID:27930301

GingisKHAN™ protease cleavage allows a high-throughput antibody to Fab conversion enabling direct functional assessment during lead identification of human monoclonal and bispecific IgG1 antibodies

PubMed Central

Moelleken, Jörg; Gassner, Christian; Lingke, Sabine; Tomaschek, Simone; Tyshchuk, Oksana; Lorenz, Stefan; Mølhøj, Michael

2017-01-01

ABSTRACT The determination of the binding strength of immunoglobulins (IgGs) to targets can be influenced by avidity when the targets are soluble di- or multimeric proteins, or associated to cell surfaces, including surfaces introduced from heterogeneous assays. However, for the understanding of the contribution of a second drug-to-target binding site in molecular design, or for ranking of monovalent binders during lead identification, affinity-based assessment of the binding strength is required. Typically, monovalent binders like antigen-binding fragments (Fabs) are generated by proteolytic cleavage with papain, which often results in a combination of under- and over-digestion, and requires specific optimization and chromatographic purification of the desired Fabs. Alternatively, the Fabs are produced by recombinant approaches. Here, we report a lean approach for the functional assessment of human IgG1s during lead identification based on an in-solution digestion with the GingisKHAN™ protease, generating a homogenous pool of intact Fabs and Fcs and enabling direct assaying of the Fab in the digestion mixture. The digest with GingisKHAN™ is highly specific and quantitative, does not require much optimization, and the protease does not interfere with methods typically applied for lead identification, such as surface plasmon resonance or cell-based assays. GingisKHAN™ is highly suited to differentiate between affinity and avidity driven binding of human IgG1 monoclonal and bispecific antibodies during lead identification. PMID:28805498

Use of 2-(/sup 125/I)iodomelatonin to characterize melatonin binding sites in chicken retina

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dubocovich, M.L.; Takahashi, J.S.

2-(/sup 125/I)Iodomelatonin binds with high affinity to a site possessing the pharmacological characteristics of a melatonin receptor in chicken retinal membranes. The specific binding of 2-(/sup 125/I)iodomelatonin is stable, saturable, and reversible. Saturation experiments indicated that 2-(/sup 125/I)iodomelatonin labeled a single class of sites with an affinity constant (Kd) of 434 +/- 56 pM and a total number of binding sites (Bmax) of 74.0 +/- 13.6 fmol/mg of protein. The affinity constant obtained from kinetic analysis was in close agreement with that obtained in saturation experiments. Competition experiments showed a monophasic reduction of 2-(/sup 125/I)iodomelatonin binding with a pharmacological ordermore » of indole amine affinities characteristic of a melatonin receptor: 2-iodomelatonin greater than 6-chloromelatonin greater than or equal to melatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 6-hydroxymelatonin greater than or equal to 6-methoxymelatonin much greater than N-acetyltryptamine greater than N-acetyl-5-hydroxytryptamine greater than 5-methoxytryptamine greater than 5-hydroxytryptamine (inactive). The affinities of these melatonin analogs in competing for 2-(/sup 125/I)iodomelatonin binding sites were correlated closely with their potencies for inhibition of the calcium-dependent release of (3H)dopamine from chicken and rabbit retinas, indicating association of the binding site with a functional response regulated by melatonin. The results indicate that 2-(/sup 125/I)iodomelatonin is a selective, high-affinity radioligand for the identification and characterization of melatonin receptor sites.« less

Carbohydrate binding sites in a pancreatic alpha-amylase-substrate complex, derived from X-ray structure analysis at 2.1 A resolution.

PubMed Central

Qian, M.; Haser, R.; Payan, F.

1995-01-01

The X-ray structure analysis of a crystal of pig pancreatic alpha-amylase (PPA, EC 3.2.1.1.) that was soaked with the substrate maltopentaose showed electron density corresponding to two independent carbohydrate recognition sites on the surface of the molecule. Both binding sites are distinct from the active site described in detail in our previous high-resolution study of a complex between PPA and a carbohydrate inhibitor (Qian M, Buisson G, Duée E, Haser H, Payan F, 1994, Biochemistry 33:6284-6294). One of the binding sites previously identified in a 5-A-resolution electron density map, lies at a distance of 20 A from the active site cleft and can accommodate two glucose units. The second affinity site for sugar units is located close to the calcium binding site. The crystal structure of the maltopentaose complex was refined at 2.1 A resolution, to an R-factor of 17.5%, with an RMS deviation in bond distances of 0.007 A. The model includes all 496 residues of the enzyme, 1 calcium ion, 1 chloride ion, 425 water molecules, and 3 bound sugar rings. The binding sites are characterized and described in detail. The present complex structure provides the evidence of an increased stability of the structure upon interaction with the substrate and allows identification of an N-terminal pyrrolidonecarboxylic acid in PPA. PMID:7613472

Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.

PubMed

Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart

2014-01-15

High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter

Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carra,J.; McHugh, C.; Mulligan, S.

2007-01-01

We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding tomore » a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.« less

Identification of high-specificity H-NS binding site in LEE5 promoter of enteropathogenic Esherichia coli (EPEC).

PubMed

Bhat, Abhay Prasad; Shin, Minsang; Choy, Hyon E

2014-07-01

Histone-like nucleoid structuring protein (H-NS) is a small but abundant protein present in enteric bacteria and is involved in compaction of the DNA and regulation of the transcription. Recent reports have suggested that H-NS binds to a specific AT rich DNA sequence than to intrinsically curved DNA in sequence independent manner. We detected two high-specificity H-NS binding sites in LEE5 promoter of EPEC centered at -110 and -138, which were close to the proposed consensus H-NS binding motif. To identify H-NS binding sequence in LEE5 promoter, we took a random mutagenesis approach and found the mutations at around -138 were specifically defective in the regulation by H-NS. It was concluded that H-NS exerts maximum repression via the specific sequence at around -138 and subsequently contacts a subunit of RNAP through oligomerization.

Barbiturates Bind in the GLIC Ion Channel Pore and Cause Inhibition by Stabilizing a Closed State*♦

PubMed Central

Fourati, Zaineb; Ruza, Reinis Reinholds; Laverty, Duncan; Drège, Emmanuelle; Delarue-Cochin, Sandrine; Joseph, Delphine; Koehl, Patrice; Smart, Trevor; Delarue, Marc

2017-01-01

Barbiturates induce anesthesia by modulating the activity of anionic and cationic pentameric ligand-gated ion channels (pLGICs). Despite more than a century of use in clinical practice, the prototypic binding site for this class of drugs within pLGICs is yet to be described. In this study, we present the first X-ray structures of barbiturates bound to GLIC, a cationic prokaryotic pLGIC with excellent structural homology to other relevant channels sensitive to general anesthetics and, as shown here, to barbiturates, at clinically relevant concentrations. Several derivatives of barbiturates containing anomalous scatterers were synthesized, and these derivatives helped us unambiguously identify a unique barbiturate binding site within the central ion channel pore in a closed conformation. In addition, docking calculations around the observed binding site for all three states of the receptor, including a model of the desensitized state, showed that barbiturates preferentially stabilize the closed state. The identification of this pore binding site sheds light on the mechanism of barbiturate inhibition of cationic pLGICs and allows the rationalization of several structural and functional features previously observed for barbiturates. PMID:27986812

Epitope Structure of the Carbohydrate Recognition Domain of Asialoglycoprotein Receptor to a Monoclonal Antibody Revealed by High-Resolution Proteolytic Excision Mass Spectrometry

NASA Astrophysics Data System (ADS)

Stefanescu, Raluca; Born, Rita; Moise, Adrian; Ernst, Beat; Przybylski, Michael

2011-01-01

Recent studies suggest that the H1 subunit of the carbohydrate recognition domain (H1CRD) of the asialoglycoprotein receptor is used as an entry site into hepatocytes by hepatitis A and B viruses and Marburg virus. Thus, molecules binding specifically to the CRD might exert inhibition towards these diseases by blocking the virus entry site. We report here the identification of the epitope structure of H1CRD to a monoclonal antibody by proteolytic epitope excision of the immune complex and high-resolution MALDI-FTICR mass spectrometry. As a prerequisite of the epitope determination, the primary structure of the H1CRD antigen was characterised by ESI-FTICR-MS of the intact protein and by LC-MS/MS of tryptic digest mixtures. Molecular mass determination and proteolytic fragments provided the identification of two intramolecular disulfide bridges (seven Cys residues), and a Cys-mercaptoethanol adduct formed by treatment with β-mercaptoethanol during protein extraction. The H1CRD antigen binds to the monoclonal antibody in both native and Cys-alkylated form. For identification of the epitope, the antibody was immobilized on N-hydroxysuccinimide (NHS)-activated Sepharose. Epitope excision and epitope extraction with trypsin and FTICR-MS of affinity-bound peptides provided the identification of two specific epitope peptides (5-16) and (17-23) that showed high affinity to the antibody. Affinity studies of the synthetic epitope peptides revealed independent binding of each peptide to the antibody.

Investigation and identification of functional post-translational modification sites associated with drug binding and protein-protein interactions.

PubMed

Su, Min-Gang; Weng, Julia Tzu-Ya; Hsu, Justin Bo-Kai; Huang, Kai-Yao; Chi, Yu-Hsiang; Lee, Tzong-Yi

2017-12-21

Protein post-translational modification (PTM) plays an essential role in various cellular processes that modulates the physical and chemical properties, folding, conformation, stability and activity of proteins, thereby modifying the functions of proteins. The improved throughput of mass spectrometry (MS) or MS/MS technology has not only brought about a surge in proteome-scale studies, but also contributed to a fruitful list of identified PTMs. However, with the increase in the number of identified PTMs, perhaps the more crucial question is what kind of biological mechanisms these PTMs are involved in. This is particularly important in light of the fact that most protein-based pharmaceuticals deliver their therapeutic effects through some form of PTM. Yet, our understanding is still limited with respect to the local effects and frequency of PTM sites near pharmaceutical binding sites and the interfaces of protein-protein interaction (PPI). Understanding PTM's function is critical to our ability to manipulate the biological mechanisms of protein. In this study, to understand the regulation of protein functions by PTMs, we mapped 25,835 PTM sites to proteins with available three-dimensional (3D) structural information in the Protein Data Bank (PDB), including 1785 modified PTM sites on the 3D structure. Based on the acquired structural PTM sites, we proposed to use five properties for the structural characterization of PTM substrate sites: the spatial composition of amino acids, residues and side-chain orientations surrounding the PTM substrate sites, as well as the secondary structure, division of acidity and alkaline residues, and solvent-accessible surface area. We further mapped the structural PTM sites to the structures of drug binding and PPI sites, identifying a total of 1917 PTM sites that may affect PPI and 3951 PTM sites associated with drug-target binding. An integrated analytical platform (CruxPTM), with a variety of methods and online molecular docking tools for exploring the structural characteristics of PTMs, is presented. In addition, all tertiary structures of PTM sites on proteins can be visualized using the JSmol program. Resolving the function of PTM sites is important for understanding the role that proteins play in biological mechanisms. Our work attempted to delineate the structural correlation between PTM sites and PPI or drug-target binding. CurxPTM could help scientists narrow the scope of their PTM research and enhance the efficiency of PTM identification in the face of big proteome data. CruxPTM is now available at http://csb.cse.yzu.edu.tw/CruxPTM/ .

ProMateus—an open research approach to protein-binding sites analysis

PubMed Central

Neuvirth, Hani; Heinemann, Uri; Birnbaum, David; Tishby, Naftali; Schreiber, Gideon

2007-01-01

The development of bioinformatic tools by individual labs results in the abundance of parallel programs for the same task. For example, identification of binding site regions between interacting proteins is done using: ProMate, WHISCY, PPI-Pred, PINUP and others. All servers first identify unique properties of binding sites and then incorporate them into a predictor. Obviously, the resulting prediction would improve if the most suitable parameters from each of those predictors would be incorporated into one server. However, because of the variation in methods and databases, this is currently not feasible. Here, the protein-binding site prediction server is extended into a general protein-binding sites research tool, ProMateus. This web tool, based on ProMate's infrastructure enables the easy exploration and incorporation of new features and databases by the user, providing an evaluation of the benefit of individual features and their combination within a set framework. This transforms the individual research into a community exercise, bringing out the best from all users for optimized predictions. The analysis is demonstrated on a database of protein protein and protein-DNA interactions. This approach is basically different from that used in generating meta-servers. The implications of the open-research approach are discussed. ProMateus is available at http://bip.weizmann.ac.il/promate. PMID:17488838

Molecular modeling and identification of novel glucokinase activators through stepwise virtual screening.

PubMed

Behera, Pabitra Mohan; Behera, Deepak Kumar; Satpati, Suresh; Agnihotri, Geetanjali; Nayak, Sanghamitra; Padhi, Payodhar; Dixit, Anshuman

2015-04-01

The glucose phosphorylating enzyme glucokinase (GK) is a 50kD monomeric protein having 465 amino acids. It maintains glucose homeostasis inside cells, acts as a glucose sensor in pancreatic β-cells and as a rate controlling enzyme for hepatic glucose clearance and glycogen synthesis. It has two binding sites, one for binding d-glucose and the other for a putative allosteric activator named glucokinase activator (GKA). The GKAs interact with the same region of the GK enzyme that is commonly affected by naturally occurring mutations in humans. However, many GKAs do not bind to GK in the absence of glucose. Recently, it has been reported that GKAs are highly effective in patients with type 2 diabetes mellitus. In this milieu a molecular modeling study has been carried out on three natural variants of GK that lie in the GKA binding site and are known to cause maturity onset diabetes of young (MODY). Additionally, a 10ns molecular dynamics simulation was done on each of the modeled variant in order to explore the flexibility of this site. Subsequently, a systematic virtual screening study was done to identify compounds which can bind with high affinity at GKA binding site of mutant GK. Copyright © 2015 Elsevier Inc. All rights reserved.

Differential Mechanisms of Activation of the Ang Peptide Receptors AT1, AT2, and MAS: Using In Silico Techniques to Differentiate the Three Receptors

PubMed Central

Prokop, Jeremy W.; Santos, Robson A. S.; Milsted, Amy

2013-01-01

The renin-angiotensin system is involved in multiple conditions ranging from cardiovascular disorders to cancer. Components of the pathway, including ACE, renin and angiotensin receptors are targets for disease treatment. This study addresses three receptors of the pathway: AT1, AT2, and MAS and how the receptors are similar and differ in activation by angiotensin peptides. Combining biochemical and amino acid variation data with multiple species sequence alignments, structural models, and docking site predictions allows for visualization of how angiotensin peptides may bind and activate the receptors; allowing identification of conserved and variant mechanisms in the receptors. MAS differs from AT1 favoring Ang-(1–7) and not Ang II binding, while AT2 recently has been suggested to preferentially bind Ang III. A new model of Ang peptide binding to AT1 and AT2 is proposed that correlates data from site directed mutagenesis and photolabled experiments that were previously considered conflicting. Ang II binds AT1 and AT2 through a conserved initial binding mode involving amino acids 111 (consensus 325) of AT1 (Asn) interacting with Tyr (4) of Ang II and 199 and 256 (consensus 512 and 621, a Lys and His respectively) interacting with Phe (8) of Ang II. In MAS these sites are not conserved, leading to differential binding and activation by Ang-(1–7). In both AT1 and AT2, the Ang II peptide may internalize through Phe (8) of Ang II propagating through the receptors’ conserved aromatic amino acids to the final photolabled positioning relative to either AT1 (amino acid 294, Asn, consensus 725) or AT2 (138, Leu, consensus 336). Understanding receptor activation provides valuable information for drug design and identification of other receptors that can potentially bind Ang peptides. PMID:23755216

Mojo Hand, a TALEN design tool for genome editing applications.

PubMed

Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C

2013-01-16

Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.

Using the QCM Biosensor-Based T7 Phage Display Combined with Bioinformatics Analysis for Target Identification of Bioactive Small Molecule.

PubMed

Takakusagi, Yoichi; Takakusagi, Kaori; Sugawara, Fumio; Sakaguchi, Kengo

2018-01-01

Identification of target proteins that directly bind to bioactive small molecule is of great interest in terms of clarifying the mode of action of the small molecule as well as elucidating the biological phenomena at the molecular level. Of the experimental technologies available, T7 phage display allows comprehensive screening of small molecule-recognizing amino acid sequence from the peptide libraries displayed on the T7 phage capsid. Here, we describe the T7 phage display strategy that is combined with quartz-crystal microbalance (QCM) biosensor for affinity selection platform and bioinformatics analysis for small molecule-recognizing short peptides. This method dramatically enhances efficacy and throughput of the screening for small molecule-recognizing amino acid sequences without repeated rounds of selection. Subsequent execution of bioinformatics programs allows combinatorial and comprehensive target protein discovery of small molecules with its binding site, regardless of protein sample insolubility, instability, or inaccessibility of the fixed small molecules to internally located binding site on larger target proteins when conventional proteomics approaches are used.

Determination of the affinity of drugs toward serum albumin by measurement of the quenching of the intrinsic tryptophan fluorescence of the protein.

PubMed

Epps, D E; Raub, T J; Caiolfa, V; Chiari, A; Zamai, M

1999-01-01

Binding of new chemical entities to serum proteins is an issue confronting pharmaceutical companies during development of potential therapeutic agents. Most drugs bind to the most abundant plasma protein, human serum albumin (HSA), at two major binding sites. Excepting fluorescence spectroscopy, existing methods for assaying drug binding to serum albumin are insensitive to higher-affinity compounds and can be labour-intensive, time-consuming, and usually require compound-specific assays. This led us to examine alternative ways to measure drug-albumin interaction. One method described here uses fluorescence quenching of the single tryptophan (Trp) residue in HSA excited at 295 nm to measure drug-binding affinity. Unfortunately, many compounds absorb, fluoresce, or both, in this UV wavelength region of the spectrum. Several types of binding phenomenon and spectral interference were identified by use of six structurally unrelated compounds and the equations necessary to make corrections mathematically were derived and applied to calculate binding constants accurately. The general cases were: direct quenching of Trp fluorescence by optically transparent ligands with low or high affinities; binding of optically transparent, non-fluorescent ligands to two specific sites where both sites or only one site result in Trp fluorescence quenching; and chromophores whose absorption either overlaps the Trp emission and quenches by energy transfer or absorbs light at the Trp fluorescence excitation wavelength producing absorptive screening as well as fluorescence quenching. Unless identification of the site specificity of drug binding to serum albumin is desired, quenching of the Trp fluorescence of albumin by titration with ligand is a rapid and facile method for determining the binding affinities of drugs for serum albumin.

Identification of cisplatin-binding sites on the large cytoplasmic loop of the Na+/K+-ATPase.

PubMed

Šeflová, Jaroslava; Čechová, Petra; Štenclová, Tereza; Šebela, Marek; Kubala, Martin

2018-12-01

Cisplatin is the most widely used chemotherapeutic drug for the treatment of various types of cancer; however, its administration brings also numerous side effects. It was demonstrated that cisplatin can inhibit the Na + /K + -ATPase (NKA), which can explain a large part of the adverse effects. In this study, we have identified five cysteinyl residues (C452, C456, C457, C577, and C656) as the cisplatin binding sites on the cytoplasmic loop connecting transmembrane helices 4 and 5 (C45), using site-directed mutagenesis and mass spectrometry experiments. The identified residues are known to be susceptible to glutathionylation indicating their involvement in a common regulatory mechanism.

Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

PubMed

Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

2015-01-01

Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome

PubMed Central

Bickhart, Derek M.; Liu, George E.

2013-01-01

A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959

Application of NMR Methods to Identify Detection Reagents for Use in the Development of Robust Nanosensors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Krishnan, V V; Balhorn, R

2004-04-29

Nuclear Magnetic Resonance (NMR) spectroscopy is a powerful technique for studying bi-molecular interactions at the atomic scale. Our NMR lab is involved in the identification of small molecules, or ligands that bind to target protein receptors, such as tetanus (TeNT) and botulinum (BoNT) neurotoxins, anthrax proteins and HLA-DR10 receptors on non-Hodgkin's lymphoma cancer cells. Once low affinity binders are identified, they can be linked together to produce multidentate synthetic high affinity ligands (SHALs) that have very high specificity for their target protein receptors. An important nanotechnology application for SHALs is their use in the development of robust chemical sensors ormore » biochips for the detection of pathogen proteins in environmental samples or body fluids. Here, we describe a recently developed NMR competition assay based on transferred nuclear Overhauser effect spectroscopy (trNOESY) that enables the identification of sets of ligands that bind to the same site, or a different site, on the surface of TeNT fragment C (TetC) than a known ''marker'' ligand, doxorubicin. Using this assay, we can identify the optimal pairs of ligands to be linked together for creating detection reagents, as well as estimate the relative binding constants for ligands competing for the same site.« less

In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

PubMed

Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

2012-05-01

Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.

Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

PubMed Central

Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

2012-01-01

The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

PubMed Central

Bigler, J; Eisenman, R N

1994-01-01

Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

PubMed

Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

2014-01-01

Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances ChIP-seq data analysis and allows the identification of multiple SUMOylated TF binding sites simultaneously, which can then be utilized for other functional PTM binding site prediction in future.

Identification of a Lacosamide Binding Protein Using an Affinity Bait and Chemical Reporter Strategy: 14-3-3 ζ

PubMed Central

Park, Ki Duk; Kim, Dong Wook; Reamtong, Onrapak; Eyers, Claire; Gaskell, Simon J.; Liu, Rihe; Kohn, Harold

2011-01-01

We have advanced a useful strategy to elucidate binding partners of ligands (drugs) with modest binding affinity. Key to this strategy is attaching to the ligand an affinity bait (AB) and a chemical reporter (CR) group, where the AB irreversibly attaches the ligand to the receptor upon binding and the CR group is employed for receptor detection and isolation. We have tested this AB&CR strategy using lacosamide ((R)-1), a low-molecular-weight antiepileptic drug. We demonstrate that using a (R)-lacosamide AB&CR agent ((R)-2) 14-3-3 ζ in rodent brain soluble lysates is preferentially adducted, adduction is stereospecific with respect to the AB&CR agent, and adduction depends upon the presence of endogenous levels of the small molecule metabolite xanthine. Substitution of lacosamide AB agent ((R)- 5) for (R)-2 led to the identification of the 14-3-3 ζ adduction site (K120) by mass spectrometry. Competition experiments using increasing amounts of (R)-1 in the presence of (R)-2 demonstrated that (R)-1 binds at or near the (R)-2 modification site on 14-3-3 ζ. Structure-activity studies of xanthine derivatives provided information concerning the likely binding interaction between this metabolite and recombinant 14-3-3 ζ. Documentation of the 14-3-3 ζ-xanthine interaction was obtained with isothermal calorimetry using xanthine and the xanthine analogue 1,7-dimethylxanthine. PMID:21692503

Identification of a New Interaction Mode between the Src Homology 2 Domain of C-terminal Src Kinase (Csk) and Csk-binding Protein/Phosphoprotein Associated with Glycosphingolipid Microdomains♦

PubMed Central

Tanaka, Hiroaki; Akagi, Ken-ichi; Oneyama, Chitose; Tanaka, Masakazu; Sasaki, Yuichi; Kanou, Takashi; Lee, Young-Ho; Yokogawa, Daisuke; Dobenecker, Marc-Werner; Nakagawa, Atsushi; Okada, Masato; Ikegami, Takahisa

2013-01-01

Proteins with Src homology 2 (SH2) domains play major roles in tyrosine kinase signaling. Structures of many SH2 domains have been studied, and the regions involved in their interactions with ligands have been elucidated. However, these analyses have been performed using short peptides consisting of phosphotyrosine followed by a few amino acids, which are described as the canonical recognition sites. Here, we report the solution structure of the SH2 domain of C-terminal Src kinase (Csk) in complex with a longer phosphopeptide from the Csk-binding protein (Cbp). This structure, together with biochemical experiments, revealed the existence of a novel binding region in addition to the canonical phosphotyrosine 314-binding site of Cbp. Mutational analysis of this second region in cells showed that both canonical and novel binding sites are required for tumor suppression through the Cbp-Csk interaction. Furthermore, the data indicate an allosteric connection between Cbp binding and Csk activation that arises from residues in the βB/βC loop of the SH2 domain. PMID:23548896

Towards the elucidation of molecular determinants of cooperativity in the liver bile acid binding protein.

PubMed

Pedò, Massimo; D'Onofrio, Mariapina; Ferranti, Pasquale; Molinari, Henriette; Assfalg, Michael

2009-11-15

Bile acid binding proteins (BABPs) are cytosolic lipid chaperones contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Liver BABPs act in parallel with ileal transporters to ensure vectorial transport of bile salts in hepatocytes and enterocytes, respectively. We describe the investigation of ligand binding to liver BABP, an essential step in the understanding of intracellular bile salt transport. Binding site occupancies were monitored in NMR titration experiments using (15)N-labelled ligand, while the relative populations of differently bound BABP forms were assessed by mass spectrometry. This site-specific information allowed the determination of intrinsic thermodynamic parameters and the identification of an extremely high cooperativity between two binding sites. Protein-observed NMR experiments revealed a global structural rearrangement which suggests an allosteric mechanism at the basis of the observed cooperativity. The view of a molecular tool capable of buffering against significant concentrations of free bile salts in a large range of solution conditions emerges from the observed pH-dependence of binding. We set to determine the molecular determinants of cooperativity by analysing the binding properties of a protein containing a mutated internal histidine. Both mass spectrometry and NMR experiments are consistent with an overall decreased binding affinity of the mutant, while the measured diffusion coefficients of ligand species reveal that the affinity loss concerns essentially one of the two binding sites. We therefore identified a mutation able to disrupt energetic communication functional to efficient binding and conclude that the buried histidine establishes contacts that stabilize the ternary complex. 2009 Wiley-Liss, Inc.

SH2 Binding Site Protection Assay: A Method for Identification of SH2 Domain Interaction Partners by Exploiting SH2 Mediated Phosphosite Protection.

PubMed

Jadwin, Joshua A

2017-01-01

Over the last two decades there has been a significant effort in the field to characterize the phosphosite binding specificities of SH2 domains with the goal of deciphering the pY signaling code. Although high throughput studies in various formats using most SH2 domains have collectively provided a rich resource of in vitro SH2-pTyr site specificity maps, this data can only be used approximate what is happening in the cell where protein concentrations and localization are not homogenous, as they are for in vitro experiments. Here we describe an in vivo approach, SH2 site protection assay, which can capture the pTyr binding specificity of SH2 domains in the cell. The basis of this approach is SH2-pY site protection, the ability of SH2 domains to prevent the PTP-dependent dephosphorylation of their pY site binding partners. We overexpress a tracer SH2 domain in cells and quantify the change in abundance of tyrosine phosphorylated sites using MS. Since the method is performed in vivo, it has the advantage of identifying SH2-pY interactions as they occur within in the cell.

High-throughput Screening Identification of Poliovirus RNA-dependent RNA Polymerase Inhibitors

PubMed Central

Campagnola, Grace; Gong, Peng; Peersen, Olve B.

2011-01-01

Viral RNA-dependent RNA polymerase (RdRP) enzymes are essential for the replication of positive-strand RNA viruses and established targets for the development of selective antiviral therapeutics. In this work we have carried out a high-throughput screen of 154,267 compounds to identify poliovirus polymerase inhibitors using a fluorescence based RNA elongation assay. Screening and subsequent validation experiments using kinetic methods and RNA product analysis resulted in the identification of seven inhibitors that affect the RNA binding, initiation, or elongation activity of the polymerase. X-ray crystallography data show clear density for five of the compounds in the active site of the poliovirus polymerase elongation complex. The inhibitors occupy the NTP binding site by stacking on the priming nucleotide and interacting with the templating base, yet competition studies show fairly weak IC50 values in the low μM range. A comparison with nucleotide bound structures suggests that weak binding is likely due to the lack of a triphosphate group on the inhibitors. Consequently, the inhibitors are primarily effective at blocking polymerase initiation and do not effectively compete with NTP binding during processive elongation. These findings are discussed in the context of the polymerase elongation complex structure and allosteric control of the viral RdRP catalytic cycle. PMID:21722674

Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages

NASA Astrophysics Data System (ADS)

Djordjevic, Marko

2005-11-01

Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely resembles temperate phages, such as lambda. It, however, encodes its own T7-like RNA polymerase (characteristic of virulent phages), whose role in gene expression was unclear. Our analysis resulted in quantitative understanding of the role of both host and phage RNA polymerase, and in the identification of the previously unknown promoter sequence for Xp10 RNA polymerase. More generally, an increasing number of phage genomes are being sequenced every year, and we expect that methods of quantitative data analysis that we introduced will provide an efficient way to study gene expression strategies of novel bacterial viruses.

Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2.

PubMed

Subramanian, Nandhitha; Scopelitti, Amanda J; Carland, Jane E; Ryan, Renae M; O'Mara, Megan L; Vandenberg, Robert J

2016-01-01

The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10.

Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2

PubMed Central

Subramanian, Nandhitha; Scopelitti, Amanda J.; Carland, Jane E.; Ryan, Renae M.; O’Mara, Megan L.; Vandenberg, Robert J.

2016-01-01

The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10. PMID:27337045

A targeted mass spectrometry-based approach for the identification and characterization of proteins containing α-aminoadipic and γ-glutamic semialdehyde residues

PubMed Central

Chavez, Juan D.; Bisson, William H.

2011-01-01

The site-specific identification of α-aminoadipic semialdehyde (AAS) and γ-glutamic semialdehyde (GGS) residues in proteins is reported. Semialdehydic protein modifications result from the metal-catalyzed oxidation of Lys or Arg and Pro residues, respectively. Most of the analytical methods for the analysis of protein carbonylation measure change to the global level of carbonylation and fail to provide details regarding protein identity, site, and chemical nature of the carbonylation. In this work, we used a targeted approach, which combines chemical labeling, enrichment, and tandem mass spectrometric analysis, for the site-specific identification of AAS and GGS sites in proteins. The approach is applied to in vitro oxidized glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and an untreated biological sample, namely cardiac mitochondrial proteins. The analysis of GAPDH resulted in the site-specific identification of two AAA and four GGS residues. Computational evaluation of the identified AAS and GGS sites in GAPDH indicated that these sites are located in flexible regions, show high solvent accessibility values, and are in proximity with possible metal ion binding sites. The targeted proteomic analysis of semialdehydic modifications in cardiac mitochondria yielded nine AAS modification sites which were unambiguously assigned to distinct lysine residues in the following proteins: ATP/ATP translocase isoforms 1 and 2, ubiquinol cytochrome-c reductase core protein 2, and ATP synthase α-subunit. PMID:20957471

The PUF binding landscape in metazoan germ cells

PubMed Central

Prasad, Aman; Porter, Douglas F.; Kroll-Conner, Peggy L.; Mohanty, Ipsita; Ryan, Anne R.; Crittenden, Sarah L.; Wickens, Marvin; Kimble, Judith

2016-01-01

PUF (Pumilio/FBF) proteins are RNA-binding proteins and conserved stem cell regulators. The Caenorhabditis elegans PUF proteins FBF-1 and FBF-2 (collectively FBF) regulate mRNAs in germ cells. Without FBF, adult germlines lose all stem cells. A major gap in our understanding of PUF proteins, including FBF, is a global view of their binding sites in their native context (i.e., their “binding landscape”). To understand the interactions underlying FBF function, we used iCLIP (individual-nucleotide resolution UV crosslinking and immunoprecipitation) to determine binding landscapes of C. elegans FBF-1 and FBF-2 in the germline tissue of intact animals. Multiple iCLIP peak-calling methods were compared to maximize identification of both established FBF binding sites and positive control target mRNAs in our iCLIP data. We discovered that FBF-1 and FBF-2 bind to RNAs through canonical as well as alternate motifs. We also analyzed crosslinking-induced mutations to map binding sites precisely and to identify key nucleotides that may be critical for FBF–RNA interactions. FBF-1 and FBF-2 can bind sites in the 5′UTR, coding region, or 3′UTR, but have a strong bias for the 3′ end of transcripts. FBF-1 and FBF-2 have strongly overlapping target profiles, including mRNAs and noncoding RNAs. From a statistically robust list of 1404 common FBF targets, 847 were previously unknown, 154 were related to cell cycle regulation, three were lincRNAs, and 335 were shared with the human PUF protein PUM2. PMID:27165521

A membrane-embedded pathway delivers general anesthetics to two interacting binding sites in the Gloeobacter violaceus ion channel.

PubMed

Arcario, Mark J; Mayne, Christopher G; Tajkhorshid, Emad

2017-06-09

General anesthetics exert their effects on the central nervous system by acting on ion channels, most notably pentameric ligand-gated ion channels. Although numerous studies have focused on pentameric ligand-gated ion channels, the details of anesthetic binding and channel modulation are still debated. A better understanding of the anesthetic mechanism of action is necessary for the development of safer and more efficacious drugs. Herein, we present a computational study identifying two anesthetic binding sites in the transmembrane domain of the Gloeobacter violaceus ligand-gated ion channel (GLIC) channel, characterize the putative binding pathway, and observe structural changes associated with channel function. Molecular simulations of desflurane reveal a binding pathway to GLIC via a membrane-embedded tunnel using an intrasubunit protein lumen as the conduit, an observation that explains the Meyer-Overton hypothesis, or why the lipophilicity of an anesthetic and its potency are generally proportional. Moreover, employing high concentrations of ligand led to the identification of a second transmembrane site (TM2) that inhibits dissociation of anesthetic from the TM1 site and is consistent with the high concentrations of anesthetics required to achieve clinical effects. Finally, asymmetric binding patterns of anesthetic to the channel were found to promote an iris-like conformational change that constricts and dehydrates the ion pore, creating a 13.5 kcal/mol barrier to ion translocation. Together with previous studies, the simulations presented herein demonstrate a novel anesthetic binding site in GLIC that is accessed through a membrane-embedded tunnel and interacts with a previously known site, resulting in conformational changes that produce a non-conductive state of the channel. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Crystal structure of glucose isomerase in complex with xylitol inhibitor in one metal binding mode.

PubMed

Bae, Ji-Eun; Kim, In Jung; Nam, Ki Hyun

2017-11-04

Glucose isomerase (GI) is an intramolecular oxidoreductase that interconverts aldoses and ketoses. These characteristics are widely used in the food, detergent, and pharmaceutical industries. In order to obtain an efficient GI, identification of novel GI genes and substrate binding/inhibition have been studied. Xylitol is a well-known inhibitor of GI. In Streptomyces rubiginosus, two crystal structures have been reported for GI in complex with xylitol inhibitor. However, a structural comparison showed that xylitol can have variable conformation at the substrate binding site, e.g., a nonspecific binding mode. In this study, we report the crystal structure of S. rubiginosus GI in a complex with xylitol and glycerol. Our crystal structure showed one metal binding mode in GI, which we presumed to represent the inactive form of the GI. The metal ion was found only at the M1 site, which was involved in substrate binding, and was not present at the M2 site, which was involved in catalytic function. The O 2 and O 4 atoms of xylitol molecules contributed to the stable octahedral coordination of the metal in M1. Although there was no metal at the M2 site, no large conformational change was observed for the conserved residues coordinating M2. Our structural analysis showed that the metal at the M2 site was not important when a xylitol inhibitor was bound to the M1 site in GI. Thus, these findings provided important information for elucidation or engineering of GI functions. Copyright © 2017 Elsevier Inc. All rights reserved.

Magnesium-binding architectures in RNA crystal structures: validation, binding preferences, classification and motif detection

PubMed Central

Zheng, Heping; Shabalin, Ivan G.; Handing, Katarzyna B.; Bujnicki, Janusz M.; Minor, Wladek

2015-01-01

The ubiquitous presence of magnesium ions in RNA has long been recognized as a key factor governing RNA folding, and is crucial for many diverse functions of RNA molecules. In this work, Mg2+-binding architectures in RNA were systematically studied using a database of RNA crystal structures from the Protein Data Bank (PDB). Due to the abundance of poorly modeled or incorrectly identified Mg2+ ions, the set of all sites was comprehensively validated and filtered to identify a benchmark dataset of 15 334 ‘reliable’ RNA-bound Mg2+ sites. The normalized frequencies by which specific RNA atoms coordinate Mg2+ were derived for both the inner and outer coordination spheres. A hierarchical classification system of Mg2+ sites in RNA structures was designed and applied to the benchmark dataset, yielding a set of 41 types of inner-sphere and 95 types of outer-sphere coordinating patterns. This classification system has also been applied to describe six previously reported Mg2+-binding motifs and detect them in new RNA structures. Investigation of the most populous site types resulted in the identification of seven novel Mg2+-binding motifs, and all RNA structures in the PDB were screened for the presence of these motifs. PMID:25800744

Computational analysis of EBNA1 ``druggability'' suggests novel insights for Epstein-Barr virus inhibitor design

NASA Astrophysics Data System (ADS)

Gianti, Eleonora; Messick, Troy E.; Lieberman, Paul M.; Zauhar, Randy J.

2016-04-01

The Epstein-Barr Nuclear Antigen 1 (EBNA1) is a critical protein encoded by the Epstein-Barr Virus (EBV). During latent infection, EBNA1 is essential for DNA replication and transcription initiation of viral and cellular genes and is necessary to immortalize primary B-lymphocytes. Nonetheless, the concept of EBNA1 as drug target is novel. Two EBNA1 crystal structures are publicly available and the first small-molecule EBNA1 inhibitors were recently discovered. However, no systematic studies have been reported on the structural details of EBNA1 "druggable" binding sites. We conducted computational identification and structural characterization of EBNA1 binding pockets, likely to accommodate ligand molecules (i.e. "druggable" binding sites). Then, we validated our predictions by docking against a set of compounds previously tested in vitro for EBNA1 inhibition (PubChem AID-2381). Finally, we supported assessments of pocket druggability by performing induced fit docking and molecular dynamics simulations paired with binding affinity predictions by Molecular Mechanics Generalized Born Surface Area calculations for a number of hits belonging to druggable binding sites. Our results establish EBNA1 as a target for drug discovery, and provide the computational evidence that active AID-2381 hits disrupt EBNA1:DNA binding upon interacting at individual sites. Lastly, structural properties of top scoring hits are proposed to support the rational design of the next generation of EBNA1 inhibitors.

Molecular Insights into the Potential Toxicological Interaction of 2-Mercaptothiazoline with the Antioxidant Enzyme—Catalase

PubMed Central

Huang, Zhenxing; Huang, Ming; Mi, Chenyu; Wang, Tao; Chen, Dong; Teng, Yue

2016-01-01

2-mercaptothiazoline (2-MT) is widely used in many industrial fields, but its residue is potentially harmful to the environment. In this study, to evaluate the biological toxicity of 2-MT at protein level, the interaction between 2-MT and the pivotal antioxidant enzyme—catalase (CAT) was investigated using multiple spectroscopic techniques and molecular modeling. The results indicated that the CAT fluorescence quenching caused by 2-MT should be dominated by a static quenching mechanism through formation of a 2-MT/CAT complex. Furthermore, the identifications of the binding constant, binding forces, and the number of binding sites demonstrated that 2-MT could spontaneously interact with CAT at one binding site mainly via Van der Waals’ forces and hydrogen bonding. Based on the molecular docking simulation and conformation dynamic characterization, it was found that 2-MT could bind into the junctional region of CAT subdomains and that the binding site was close to enzyme active sites, which induced secondary structural and micro-environmental changes in CAT. The experiments on 2-MT toxicity verified that 2-MT significantly inhibited CAT activity via its molecular interaction, where 2-MT concentration and exposure time both affected the inhibitory action. Therefore, the present investigation provides useful information for understanding the toxicological mechanism of 2-MT at the molecular level. PMID:27537873

Identification of a novel cell culture adaptation site on the capsid of foot-and-mouth disease virus.

PubMed

Chamberlain, Kyle; Fowler, Veronica L; Barnett, Paul V; Gold, Sarah; Wadsworth, Jemma; Knowles, Nick J; Jackson, Terry

2015-09-01

Vaccination remains the most effective tool for control of foot-and-mouth disease both in endemic countries and as an emergency preparedness for new outbreaks. Foot-and-mouth disease vaccines are chemically inactivated virus preparations and the production of new vaccines is critically dependent upon cell culture adaptation of field viruses, which can prove problematic. A major driver of cell culture adaptation is receptor availability. Field isolates of foot-and-mouth disease virus (FMDV) use RGD-dependent integrins as receptors, whereas cell culture adaptation often selects for variants with altered receptor preferences. Previously, two independent sites on the capsid have been identified where mutations are associated with improved cell culture growth. One is a shallow depression formed by the three major structural proteins (VP1-VP3) where mutations create a heparan sulphate (HS)-binding site (the canonical HS-binding site). The other involves residues of VP1 and is located at the fivefold symmetry axis. For some viruses, changes at this site result in HS binding; for others, the receptors are unknown. Here, we report the identification of a novel site on VP2 where mutations resulted in an expanded cell tropism of a vaccine variant of A/IRN/87 (called A - ). Furthermore, we show that introducing the same mutations into a different type A field virus (A/TUR/2/2006) resulted in the same expanded cell culture tropism as the A/IRN/87 A -  vaccine variant. These observations add to the evidence for multiple cell attachment mechanisms for FMDV and may be useful for vaccine manufacture when cell culture adaptation proves difficult.

Identification of a novel cell culture adaptation site on the capsid of foot-and-mouth disease virus

PubMed Central

Chamberlain, Kyle; Fowler, Veronica L.; Barnett, Paul V.; Gold, Sarah; Wadsworth, Jemma; Knowles, Nick J.

2015-01-01

Vaccination remains the most effective tool for control of foot-and-mouth disease both in endemic countries and as an emergency preparedness for new outbreaks. Foot-and-mouth disease vaccines are chemically inactivated virus preparations and the production of new vaccines is critically dependent upon cell culture adaptation of field viruses, which can prove problematic. A major driver of cell culture adaptation is receptor availability. Field isolates of foot-and-mouth disease virus (FMDV) use RGD-dependent integrins as receptors, whereas cell culture adaptation often selects for variants with altered receptor preferences. Previously, two independent sites on the capsid have been identified where mutations are associated with improved cell culture growth. One is a shallow depression formed by the three major structural proteins (VP1–VP3) where mutations create a heparan sulphate (HS)-binding site (the canonical HS-binding site). The other involves residues of VP1 and is located at the fivefold symmetry axis. For some viruses, changes at this site result in HS binding; for others, the receptors are unknown. Here, we report the identification of a novel site on VP2 where mutations resulted in an expanded cell tropism of a vaccine variant of A/IRN/87 (called A − ). Furthermore, we show that introducing the same mutations into a different type A field virus (A/TUR/2/2006) resulted in the same expanded cell culture tropism as the A/IRN/87 A −  vaccine variant. These observations add to the evidence for multiple cell attachment mechanisms for FMDV and may be useful for vaccine manufacture when cell culture adaptation proves difficult. PMID:26296881

Covalent Chemical Ligation Strategy for Mono- and Polyclonal Immunoglobulins at Their Nucleotide Binding Sites.

PubMed

Lac, Diana; Feng, Chun; Bhardwaj, Gaurav; Le, Huong; Tran, Jimmy; Xing, Li; Fung, Gabriel; Liu, Ruiwu; Cheng, Holland; Lam, Kit S

2016-01-20

Nonspecific ligation methods have been traditionally used to chemically modify immunoglobulins. Site-specific ligation of compounds (toxins or ligands) to antibodies has become increasingly important in the fields of therapeutic antibody-drug conjugates and bispecific antibodies. In this present study, we took advantage of the reported nucleotide-binding pocket (NBP) in the Fab arms of immunoglobulins by developing indole-based, 5-fluoro-2,4-dinitrobenzene-derivatized OBOC peptide libraries for the identification of affinity elements that can be used as site-specific derivatization agents against both mono- and polyclonal antibodies. Ligation can occur at any one of the few lysine residues located at the NBP. Immunoconjugates resulting from such affinity elements can be used as therapeutics against cancer or infectious agents.

Identification of sucrose synthase as an actin-binding protein

NASA Technical Reports Server (NTRS)

Winter, H.; Huber, J. L.; Huber, S. C.; Davies, E. (Principal Investigator)

1998-01-01

Several lines of evidence indicate that sucrose synthase (SuSy) binds both G- and F-actin: (i) presence of SuSy in the Triton X-100-insoluble fraction of microsomal membranes (i.e. crude cytoskeleton fraction); (ii) co-immunoprecipitation of actin with anti-SuSy monoclonal antibodies; (iii) association of SuSy with in situ phalloidin-stabilized F-actin filaments; and (iv) direct binding to F-actin, polymerized in vitro. Aldolase, well known to interact with F-actin, interfered with binding of SuSy, suggesting that a common or overlapping binding site may be involved. We postulate that some of the soluble SuSy in the cytosol may be associated with the actin cytoskeleton in vivo.

Identification of the Catalytic Ubiquinone-binding Site of Vibrio cholerae Sodium-dependent NADH Dehydrogenase

PubMed Central

Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar

2017-01-01

The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088

Development of gastrointestinal surface. VIII. Lectin identification of carbohydrate differences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pang, K.Y.; Bresson, J.L.; Walker, W.A.

Binding of microvillus membranes (MVM) from newborn and adult rats by concanavalin A (Con A), Ulex europaeus (UEA I), Dolichos bifluorus (DBA), and Triticum vulgaris (WGA) was examined to determine the availability of carbohydrate-containing sites for these lectins on the intestinal surface during development. Consistent patterns of differences in the reaction of MVM with these lectins were found. Con A and UEA had much higher reactivities to MVM of adult than newborn rats. /sup 125/I-labeled-UEA gel overlay experiments revealed the abundance of UEA-binding sites in MVM of adult rat in contrast to the two binding sites in MVM of amore » newborn rat. DBA bound only to MVM of the adults, and very few binding sites were found in immature MVM. In contrast to these lectins, WGA binding was much higher in MVM of the newborns and decreased with maturation. Additional experiments on the age dependence of UEA and DBA reactivities revealed that the most striking changes occur in animals from 2 to 2 wk of age. In MVM from 2-wk-old rats, there were only 13.9% and < 0.2% of the adult binding capacities for UEA and DBA, respectively. By the time the animals were 4 wk old, the binding capacity for UEA had attained close to the level of the adults, whereas for DBA it reached 71.3% of the adult value. These results provide definite evidence of changes in the intestinal surface during perinatal development.« less

Molecular Basis for Modulation of Metabotropic Glutamate Receptors and Their Drug Actions by Extracellular Ca2+

PubMed Central

Zou, Juan; Jiang, Jason Y.; Yang, Jenny J.

2017-01-01

Metabotropic glutamate receptors (mGluRs) associated with the slow phase of the glutamatergic signaling pathway in neurons of the central nervous system have gained importance as drug targets for chronic neurodegenerative diseases. While extracellular Ca2+ was reported to exhibit direct activation and modulation via an allosteric site, the identification of those binding sites was challenged by weak binding. Herein, we review the discovery of extracellular Ca2+ in regulation of mGluRs, summarize the recent developments in probing Ca2+ binding and its co-regulation of the receptor based on structural and biochemical analysis, and discuss the molecular basis for Ca2+ to regulate various classes of drug action as well as its importance as an allosteric modulator in mGluRs. PMID:28335551

STARD6 on steroids: solution structure, multiple timescale backbone dynamics and ligand binding mechanism

NASA Astrophysics Data System (ADS)

Létourneau, Danny; Bédard, Mikaël; Cabana, Jérôme; Lefebvre, Andrée; Lehoux, Jean-Guy; Lavigne, Pierre

2016-06-01

START domain proteins are conserved α/β helix-grip fold that play a role in the non-vesicular and intracellular transport of lipids and sterols. The mechanism and conformational changes permitting the entry of the ligand into their buried binding sites is not well understood. Moreover, their functions and the identification of cognate ligands is still an active area of research. Here, we report the solution structure of STARD6 and the characterization of its backbone dynamics on multiple time-scales through 15N spin-relaxation and amide exchange studies. We reveal for the first time the presence of concerted fluctuations in the Ω1 loop and the C-terminal helix on the microsecond-millisecond time-scale that allows for the opening of the binding site and ligand entry. We also report that STARD6 binds specifically testosterone. Our work represents a milestone for the study of ligand binding mechanism by other START domains and the elucidation of the biological function of STARD6.

Dissecting Orthosteric Contacts for a Reverse-Fragment-Based Ligand Design.

PubMed

Chandramohan, Arun; Tulsian, Nikhil K; Anand, Ganesh S

2017-08-01

Orthosteric sites on proteins are formed typically from noncontiguous interacting sites in three-dimensional space where the composite binding interaction of a biological ligand is mediated by multiple synergistic interactions of its constituent functional groups. Through these multiple interactions, ligands stabilize both the ligand binding site and the local secondary structure. However, relative energetic contributions of the individual contacts in these protein-ligand interactions are difficult to resolve. Deconvolution of the contributions of these various functional groups in natural inhibitors/ligand would greatly aid in iterative fragment-based drug discovery (FBDD). In this study, we describe an approach of progressive unfolding of a target protein using a gradient of denaturant urea to reveal the individual energetic contributions of various ligand-functional groups to the affinity of the entire ligand. Through calibrated unfolding of two protein-ligand systems: cAMP-bound regulatory subunit of Protein Kinase A (RIα) and IBMX-bound phosphodiesterase8 (PDE8), monitored by amide hydrogen-deuterium exchange mass spectrometry, we show progressive disruption of individual orthosteric contacts in the ligand binding sites, allowing us to rank the energetic contributions of these individual interactions. In the two cAMP-binding sites of RIα, exocyclic phosphate oxygens of cAMP were identified to mediate stronger interactions than ribose 2'-OH in both the RIα-cAMP binding interfaces. Further, we have also ranked the relative contributions of the different functional groups of IBMX based on their interactions with the orthosteric residues of PDE8. This strategy for deconstruction of individual binding sites and identification of the strongest functional group interaction in enzyme orthosteric sites offers a rational starting point for FBDD.

Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method.

PubMed

Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

2014-08-01

Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method

NASA Astrophysics Data System (ADS)

Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

2014-08-01

Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

Molecular Mechanism Underlying the Entomotoxic Effect of Colocasia esculenta Tuber Agglutinin against Dysdercus cingulatus

PubMed Central

Roy, Amit; Das, Sampa

2015-01-01

Colocasia esculenta tuber agglutinin (CEA), a mannose binding lectin, exhibits insecticidal efficacy against different hemipteran pests. Dysdercus cingulatus, red cotton bug (RCB), has also shown significant susceptibility to CEA intoxication. However, the molecular basis behind such entomotoxicity of CEA has not been addressed adequately. The present study elucidates the mechanism of insecticidal efficacy of CEA against RCB. Confocal and scanning electron microscopic analyses documented CEA binding to insect midgut tissue, resulting in an alteration of perimicrovillar membrane (PMM) morphology. Internalization of CEA into insect haemolymph and ovary was documented by western blotting analyses. Ligand blot followed by mass spectrometric identification revealed the cognate binding partners of CEA as actin, ATPase and cytochrome P450. Deglycosylation and mannose inhibition assays indicated the interaction to probably be mannose mediated. Bioinformatic identification of putative glycosylation or mannosylation sites in the binding partners further supports the sugar mediated interaction. Correlating entomotoxicity of CEA with immune histological and binding assays to the insect gut contributes to a better understanding of the insecticidal potential of CEA and endorses its future biotechnological application.

Identification and functional characterization of an Src homology domain 3 domain-binding site on Cbl.

PubMed

Sanjay, Archana; Miyazaki, Tsuyoshi; Itzstein, Cecile; Purev, Enkhtsetseg; Horne, William C; Baron, Roland

2006-12-01

Cbl is an adaptor protein and ubiquitin ligase that binds and is phosphorylated by the nonreceptor tyrosine kinase Src. We previously showed that the primary interaction between Src and Cbl is mediated by the Src homology domain 3 (SH3) of Src binding to proline-rich sequences of Cbl. The peptide Cbl RDLPPPPPPDRP(540-551), which corresponds to residues 540-551 of Cbl, inhibited the binding of a GST-Src SH3 fusion protein to Cbl, whereas RDLAPPAPPPDR(540-551) did not, suggesting that Src binds to this site on Cbl in a class I orientation. Mutating prolines 543-548 reduced Src binding to the Cbl 479-636 fragment significantly more than mutating the prolines in the PPVPPR(494-499) motif, which was previously reported to bind Src SH3. Mutating Cbl prolines 543-548 to alanines substantially reduced Src binding to Cbl, Src-induced phosphorylation of Cbl, and the inhibition of Src kinase activity by Cbl. Expressing the mutated Cbl in osteoclasts induced a moderate reduction in bone-resorbing activity and increased amounts of Src protein. In contrast, disabling the tyrosine kinase-binding domain of full-length Cbl by mutating glycine 306 to glutamic acid, and thereby preventing the previously described binding of the tyrosine kinase-binding domain to the Src phosphotyrosine 416, had no effect on Cbl phosphorylation, the inhibition of Src activity by full-length Cbl, or bone resorption. These data indicate that the Cbl RDLPPPP(540-546) sequence is a functionally important binding site for Src.

Fragment-Linking Approach Using (19)F NMR Spectroscopy To Obtain Highly Potent and Selective Inhibitors of β-Secretase.

PubMed

Jordan, John B; Whittington, Douglas A; Bartberger, Michael D; Sickmier, E Allen; Chen, Kui; Cheng, Yuan; Judd, Ted

2016-04-28

Fragment-based drug discovery (FBDD) has become a widely used tool in small-molecule drug discovery efforts. One of the most commonly used biophysical methods in detecting weak binding of fragments is nuclear magnetic resonance (NMR) spectroscopy. In particular, FBDD performed with (19)F NMR-based methods has been shown to provide several advantages over (1)H NMR using traditional magnetization-transfer and/or two-dimensional methods. Here, we demonstrate the utility and power of (19)F-based fragment screening by detailing the identification of a second-site fragment through (19)F NMR screening that binds to a specific pocket of the aspartic acid protease, β-secretase (BACE-1). The identification of this second-site fragment allowed the undertaking of a fragment-linking approach, which ultimately yielded a molecule exhibiting a more than 360-fold increase in potency while maintaining reasonable ligand efficiency and gaining much improved selectivity over cathepsin-D (CatD). X-ray crystallographic studies of the molecules demonstrated that the linked fragments exhibited binding modes consistent with those predicted from the targeted screening approach, through-space NMR data, and molecular modeling.

Druggable orthosteric and allosteric hot spots to target protein-protein interactions.

PubMed

Ma, Buyong; Nussinov, Ruth

2014-01-01

Drug designing targeting protein-protein interactions is challenging. Because structural elucidation and computational analysis have revealed the importance of hot spot residues in stabilizing these interactions, there have been on-going efforts to develop drugs which bind the hot spots and out-compete the native protein partners. The question arises as to what are the key 'druggable' properties of hot spots in protein-protein interactions and whether these mimic the general hot spot definition. Identification of orthosteric (at the protein- protein interaction site) and allosteric (elsewhere) druggable hot spots is expected to help in discovering compounds that can more effectively modulate protein-protein interactions. For example, are there any other significant features beyond their location in pockets in the interface? The interactions of protein-protein hot spots are coupled with conformational dynamics of protein complexes. Currently increasing efforts focus on the allosteric drug discovery. Allosteric drugs bind away from the native binding site and can modulate the native interactions. We propose that identification of allosteric hot spots could similarly help in more effective allosteric drug discovery. While detection of allosteric hot spots is challenging, targeting drugs to these residues has the potential of greatly increasing the hot spot and protein druggability.

Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

PubMed

Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

2017-05-02

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

Identification of small molecular ligands as potent inhibitors of fatty acid metabolism in Mycobacterium tuberculosis

NASA Astrophysics Data System (ADS)

Malikanti, Ramesh; Vadija, Rajender; Veeravarapu, Hymavathi; Mustyala, Kiran Kumar; Malkhed, Vasavi; Vuruputuri, Uma

2017-12-01

Tuberculosis (Tb) is one of the major health challenges for the global scientific community. The 3-hydroxy butyryl-CoA dehydrogenase (Fad B2) protein belongs to 3-hydroxyl acetyl-CoA dehydrogenase family, which plays a key role in the fatty acid metabolism and β-oxidation in the cell membrane of Mycobacterium tuberculosis (Mtb). In the present study the Fad B2 protein is targeted for the identification of potential drug candidates for tuberculosis. The 3D model of the target protein Fad B2, was generated using homology modeling approach and was validated. The plausible binding site of the Fad B2 protein was identified from computational binding pocket prediction tools, which ranges from ASN120 to VAL150 amino acid residues. Virtual screening was carried out with the databases, Ligand box UOS and hit definder, at the binding site region. 133 docked complex structures were generated as an output. The identified ligands show good glide scores and glide energies. All the ligand molecules contain benzyl amine pharmacophore in common, which show specific and selective binding interactions with the SER122 and ASN146 residues of the Fad B2 protein. The ADME properties of all the ligand molecules were observed to be within the acceptable range. It is suggested from the result of the present study that the docked molecular structures with a benzyl amine pharmacophore act as potential ligands for Fad B2 protein binding and as leads in Tb drug discovery.

2-Aryl-5-carboxytetrazole as a New Photoaffinity Label for Drug Target Identification.

PubMed

Herner, András; Marjanovic, Jasmina; Lewandowski, Tracey M; Marin, Violeta; Patterson, Melanie; Miesbauer, Laura; Ready, Damien; Williams, Jon; Vasudevan, Anil; Lin, Qing

2016-11-09

Photoaffinity labels are powerful tools for dissecting ligand-protein interactions, and they have a broad utility in medicinal chemistry and drug discovery. Traditional photoaffinity labels work through nonspecific C-H/X-H bond insertion reactions with the protein of interest by the highly reactive photogenerated intermediate. Herein, we report a new photoaffinity label, 2-aryl-5-carboxytetrazole (ACT), that interacts with the target protein via a unique mechanism in which the photogenerated carboxynitrile imine reacts with a proximal nucleophile near the target active site. In two distinct case studies, we demonstrate that the attachment of ACT to a ligand does not significantly alter the binding affinity and specificity of the parent drug. Compared with diazirine and benzophenone, two commonly used photoaffinity labels, in two case studies ACT showed higher photo-cross-linking yields toward their protein targets in vitro based on mass spectrometry analysis. In the in situ target identification studies, ACT successfully captured the desired targets with an efficiency comparable to the diazirine. We expect that further development of this class of photoaffinity labels will lead to a broad range of applications across target identification, and validation and elucidation of the binding site in drug discovery.

2-Aryl-5-carboxytetrazole as a New Photoaffinity Label for Drug Target Identification

PubMed Central

2016-01-01

Photoaffinity labels are powerful tools for dissecting ligand–protein interactions, and they have a broad utility in medicinal chemistry and drug discovery. Traditional photoaffinity labels work through nonspecific C–H/X–H bond insertion reactions with the protein of interest by the highly reactive photogenerated intermediate. Herein, we report a new photoaffinity label, 2-aryl-5-carboxytetrazole (ACT), that interacts with the target protein via a unique mechanism in which the photogenerated carboxynitrile imine reacts with a proximal nucleophile near the target active site. In two distinct case studies, we demonstrate that the attachment of ACT to a ligand does not significantly alter the binding affinity and specificity of the parent drug. Compared with diazirine and benzophenone, two commonly used photoaffinity labels, in two case studies ACT showed higher photo-cross-linking yields toward their protein targets in vitro based on mass spectrometry analysis. In the in situ target identification studies, ACT successfully captured the desired targets with an efficiency comparable to the diazirine. We expect that further development of this class of photoaffinity labels will lead to a broad range of applications across target identification, and validation and elucidation of the binding site in drug discovery. PMID:27740749

Identification of Bacillus thuringiensis Cry3Aa toxin domain II loop 1 as the binding site of Tenebrio molitor cadherin repeat CR12.

PubMed

Zúñiga-Navarrete, Fernando; Gómez, Isabel; Peña, Guadalupe; Amaro, Itzel; Ortíz, Ernesto; Becerril, Baltazar; Ibarra, Jorge E; Bravo, Alejandra; Soberón, Mario

2015-04-01

Bacillus thuringiensis Cry toxins exert their toxic effect by specific recognition of larval midgut proteins leading to oligomerization of the toxin, membrane insertion and pore formation. The exposed domain II loop regions of Cry toxins have been shown to be involved in receptor binding. Insect cadherins have shown to be functionally involved in toxin binding facilitating toxin oligomerization. Here, we isolated a VHH (VHHA5) antibody by phage display that binds Cry3Aa loop 1 and competed with the binding of Cry3Aa to Tenebrio molitor brush border membranes. VHHA5 also competed with the binding of Cry3Aa to a cadherin fragment (CR12) that was previously shown to be involved in binding and toxicity of Cry3Aa, indicating that Cry3Aa binds CR12 through domain II loop 1. Moreover, we show that a loop 1 mutant, previously characterized to have increased toxicity to T. molitor, displayed a correlative enhanced binding affinity to T. molitor CR12 and to VHHA5. These results show that Cry3Aa domain II loop 1 is a binding site of CR12 T. molitor cadherin. Copyright © 2015 Elsevier Ltd. All rights reserved.

Protein-Protein Interactions in a Crowded Environment: An Analysis via Cross-Docking Simulations and Evolutionary Information

PubMed Central

Lopes, Anne; Sacquin-Mora, Sophie; Dimitrova, Viktoriya; Laine, Elodie; Ponty, Yann; Carbone, Alessandra

2013-01-01

Large-scale analyses of protein-protein interactions based on coarse-grain molecular docking simulations and binding site predictions resulting from evolutionary sequence analysis, are possible and realizable on hundreds of proteins with variate structures and interfaces. We demonstrated this on the 168 proteins of the Mintseris Benchmark 2.0. On the one hand, we evaluated the quality of the interaction signal and the contribution of docking information compared to evolutionary information showing that the combination of the two improves partner identification. On the other hand, since protein interactions usually occur in crowded environments with several competing partners, we realized a thorough analysis of the interactions of proteins with true partners but also with non-partners to evaluate whether proteins in the environment, competing with the true partner, affect its identification. We found three populations of proteins: strongly competing, never competing, and interacting with different levels of strength. Populations and levels of strength are numerically characterized and provide a signature for the behavior of a protein in the crowded environment. We showed that partner identification, to some extent, does not depend on the competing partners present in the environment, that certain biochemical classes of proteins are intrinsically easier to analyze than others, and that small proteins are not more promiscuous than large ones. Our approach brings to light that the knowledge of the binding site can be used to reduce the high computational cost of docking simulations with no consequence in the quality of the results, demonstrating the possibility to apply coarse-grain docking to datasets made of thousands of proteins. Comparison with all available large-scale analyses aimed to partner predictions is realized. We release the complete decoys set issued by coarse-grain docking simulations of both true and false interacting partners, and their evolutionary sequence analysis leading to binding site predictions. Download site: http://www.lgm.upmc.fr/CCDMintseris/ PMID:24339765

Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

2016-06-01

The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

Identification of the residues involved in stabilization of the semiquinone radical in the high-affinity ubiquinone binding site in cytochrome bo(3) from Escherichia coli by site-directed mutagenesis and EPR spectroscopy.

PubMed

Hellwig, Petra; Yano, Takahiro; Ohnishi, Tomoko; Gennis, Robert B

2002-08-27

During turnover of cytochrome bo(3) from Escherichia coli, a semiquinone radical is stabilized in a high-affinity binding site. To identify binding partners of this radical, site-directed mutants have been designed on the basis of a recently modeled quinone binding site (Abramson et al., 2000). The R71H, H98F, D75H, and I102W mutant enzymes were found to show very little or no quinol oxidase activity. The thermodynamic and EPR spectroscopic properties of semiquinone radicals in these mutants were characterized. For the H98F and the R71H mutants, no EPR signal of the semiquinone radical was observed in the redox potential range from -100 to 250 mV. During potentiometric titration of the D75H mutant enzyme, a semiquinone signal was detected in the same potential range as that of the wild-type enzyme. However, the EPR spectrum of the D75H mutant lacks the characteristic hyperfine structure of the semiquinone radical signal observed in the wild-type oxidase, indicating that D75 or the introduced His, interacts with the semiquinone radical. For the I102W mutant, a free radical signal was observed with a redox midpoint potential downshifted by about 200 mV. On the basis of these observations, it is suggested that R71, D75, and H98 residues are involved in the stabilization of the semiquinone state in the high-affinity binding site. Details of the possible binding motif and mechanistic implications are discussed.

Identification of amino acids in the nicotinic acetylcholine receptor agonist binding site and ion channel photolabeled by 4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine, a novel photoaffinity antagonist.

PubMed

Chiara, David C; Trinidad, Jonathan C; Wang, Dong; Ziebell, Michael R; Sullivan, Deirdre; Cohen, Jonathan B

2003-01-21

[(3)H]4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine (TDBzcholine) was synthesized and used as a photoaffinity probe to map the orientation of an aromatic choline ester within the agonist binding sites of the Torpedo nicotinic acetylcholine receptor (nAChR). TDBzcholine acts as a nAChR competitive antagonist that binds at equilibrium with equal affinity to both agonist sites (K(D) approximately 10 microM). Upon UV irradiation (350 nm), nAChR-rich membranes equilibrated with [(3)H]TDBzcholine incorporate (3)H into the alpha, gamma, and delta subunits in an agonist-inhibitable manner. The specific residues labeled by [(3)H]TDBzcholine were determined by N-terminal sequence analysis of subunit fragments produced by enzymatic cleavage and purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and/or reversed-phase high-performance liquid chromatography. For the alpha subunit, [(3)H]TDBzcholine photoincorporated into alphaCys-192, alphaCys-193, and alphaPro-194. For the gamma and delta subunits, [(3)H]TDBzcholine incorporated into homologous leucine residues, gammaLeu-109 and deltaLeu-111. The photolabeling of these amino acids suggests that when the antagonist TDBzcholine occupies the agonist binding sites, the Cys-192-193 disulfide and Pro-194 from the alpha subunit Segment C are oriented toward the agonist site and are in proximity to gammaLeu-109/deltaLeu-111 in Segment E, a conclusion consistent with the structure of the binding site in the molluscan acetylcholine binding protein, a soluble protein that is homologous to the nAChR extracellular domain.

Design and Synthesis of a Pan-Janus Kinase Inhibitor Clinical Candidate (PF-06263276) Suitable for Inhaled and Topical Delivery for the Treatment of Inflammatory Diseases of the Lungs and Skin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jones, Peter; Storer, R. Ian; Sabnis, Yogesh A.

By use of a structure-based computational method for identification of structurally novel Janus kinase (JAK) inhibitors predicted to bind beyond the ATP binding site, a potent series of indazoles was identified as selective pan-JAK inhibitors with a type 1.5 binding mode. Optimization of the series for potency and increased duration of action commensurate with inhaled or topical delivery resulted in potent pan-JAK inhibitor 2 (PF-06263276), which was advanced into clinical studies.

Identification of an inhibitory Zn2+ binding site on the human glycine receptor α1 subunit

PubMed Central

Harvey, Robert J; Thomas, Philip; James, Colin H; Wilderspin, Andrew; Smart, Trevor G

1999-01-01

Whole-cell glycine-activated currents were recorded from human embryonic kidney (HEK) cells expressing wild-type and mutant recombinant homomeric glycine receptors (GlyRs) to locate the inhibitory binding site for Zn2+ ions on the human α1 subunit. Glycine-activated currents were potentiated by low concentrations of Zn2+ (<10 μm) and inhibited by higher concentrations (>100 μm) on wild-type α1 subunit GlyRs. Lowering the external pH from 7.4 to 5.4 inhibited the glycine responses in a competitive manner. The inhibition caused by Zn2+ was abolished leaving an overt potentiating effect at 10 μm Zn2+ that was exacerbated at 100 μm Zn2+. The identification of residues involved in the formation of the inhibitory binding site was also assessed using diethylpyrocarbonate (DEPC), which modifies histidines. DEPC (1 mm) abolished Zn2+-induced inhibition and also the potentiation of glycine-activated currents by Zn2+. The reduction in glycine-induced whole-cell currents in the presence of high (100 μm) concentrations of Zn2+ did not increase the rate of glycine receptor desensitisation. Systematic mutation of extracellular histidine residues in the GlyR α1 subunit revealed that mutations H107A or H109A completely abolished inhibition of glycine-gated currents by Zn2+. However, mutation of other external histidines, H210, H215 and H419, failed to prevent inhibition by Zn2+ of glycine-gated currents. Thus, H107 and H109 in the extracellular domain of the human GlyR α1 subunit are major determinants of the inhibitory Zn2+ binding site. An examination of Zn2+ co-ordination in metalloenzymes revealed that the histidine- hydrophobic residue-histidine motif found to be responsible for binding Zn2+ in the human GlyR α1 subunit is also shared by some of these enzymes. Further comparison of the structure and location of this motif with a generic model of the GlyR α1 subunit suggests that H107 and H109 participate in the formation of the inhibitory Zn2+ binding site at the apex of a β sheet in the N-terminal extracellular domain. PMID:10517800

Diversity of Cyclic Di-GMP-Binding Proteins and Mechanisms

PubMed Central

2015-01-01

ABSTRACT Cyclic di-GMP (c-di-GMP) synthetases and hydrolases (GGDEF, EAL, and HD-GYP domains) can be readily identified in bacterial genome sequences by using standard bioinformatic tools. In contrast, identification of c-di-GMP receptors remains a difficult task, and the current list of experimentally characterized c-di-GMP-binding proteins is likely incomplete. Several classes of c-di-GMP-binding proteins have been structurally characterized; for some others, the binding sites have been identified; and for several potential c-di-GMP receptors, the binding sites remain to be determined. We present here a comparative structural analysis of c-di-GMP-protein complexes that aims to discern the common themes in the binding mechanisms that allow c-di-GMP receptors to bind it with (sub)micromolar affinities despite the 1,000-fold excess of GTP. The available structures show that most receptors use their Arg and Asp/Glu residues to bind c-di-GMP monomers, dimers, or tetramers with stacked guanine bases. The only exception is the EAL domains that bind c-di-GMP monomers in an extended conformation. We show that in c-di-GMP-binding signature motifs, Arg residues bind to the O-6 and N-7 atoms at the Hoogsteen edge of the guanine base, while Asp/Glu residues bind the N-1 and N-2 atoms at its Watson-Crick edge. In addition, Arg residues participate in stacking interactions with the guanine bases of c-di-GMP and the aromatic rings of Tyr and Phe residues. This may account for the presence of Arg residues in the active sites of every receptor protein that binds stacked c-di-GMP. We also discuss the implications of these structural data for the improved understanding of the c-di-GMP signaling mechanisms. PMID:26055114

Identification and Characterization of Novel Catalytic Bioscavengers of Organophosphorus Nerve Agents

DTIC Science & Technology

2013-01-01

hydrolase activity . These strains are Ammoniphilus oxalaticus, Haloarcula sp., and Micromonospora aurantiaca. Lysates from A. oxalaticus had...warfare agents [1–3]. OP nerve agents readily bind covalently to the active site serine in acetylcho- linesterase (AChE), thereby inhibiting the ability...muscarinic receptors, whereas 2-pralidoxime chloride, an oxime nucleophile, reactivates AChE by displacing the phospho- nyl group left on the active site

Joint Services Electronics Program.

DTIC Science & Technology

1987-03-31

58 (no previous unit) Unit 18 Adaptive Algorithms for Identification. Filtering. Control. and S ignal P rocessin g...two new faculty. Professors Arun and Wah. Finally. a total of six new faculty in the areas of adaptive and nonlinear systems. communication systems. and...previously), we observed an additional higher binding energy site at 2.6 eV The Sb coverage in the E, site increased ,xith ion dose and a model was developed

Incorporating evolution of transcription factor binding sites into annotated alignments.

PubMed

Bais, Abha S; Grossmann, Stefen; Vingron, Martin

2007-08-01

Identifying transcription factor binding sites (TFBSs) is essential to elucidate putative regulatory mechanisms. A common strategy is to combine cross-species conservation with single sequence TFBS annotation to yield "conserved TFBSs". Most current methods in this field adopt a multi-step approach that segregates the two aspects. Again, it is widely accepted that the evolutionary dynamics of binding sites differ from those of the surrounding sequence. Hence, it is desirable to have an approach that explicitly takes this factor into account. Although a plethora of approaches have been proposed for the prediction of conserved TFBSs, very few explicitly model TFBS evolutionary properties, while additionally being multi-step. Recently, we introduced a novel approach to simultaneously align and annotate conserved TFBSs in a pair of sequences. Building upon the standard Smith-Waterman algorithm for local alignments, SimAnn introduces additional states for profiles to output extended alignments or annotated alignments. That is, alignments with parts annotated as gaplessly aligned TFBSs (pair-profile hits)are generated. Moreover,the pair- profile related parameters are derived in a sound statistical framework. In this article, we extend this approach to explicitly incorporate evolution of binding sites in the SimAnn framework. We demonstrate the extension in the theoretical derivations through two position-specific evolutionary models, previously used for modelling TFBS evolution. In a simulated setting, we provide a proof of concept that the approach works given the underlying assumptions,as compared to the original work. Finally, using a real dataset of experimentally verified binding sites in human-mouse sequence pairs,we compare the new approach (eSimAnn) to an existing multi-step tool that also considers TFBS evolution. Although it is widely accepted that binding sites evolve differently from the surrounding sequences, most comparative TFBS identification methods do not explicitly consider this.Additionally, prediction of conserved binding sites is carried out in a multi-step approach that segregates alignment from TFBS annotation. In this paper, we demonstrate how the simultaneous alignment and annotation approach of SimAnn can be further extended to incorporate TFBS evolutionary relationships. We study how alignments and binding site predictions interplay at varying evolutionary distances and for various profile qualities.

Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

PubMed Central

Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

2013-01-01

Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

PubMed

Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

2013-08-01

Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

PubMed Central

Augustin, Regina; Lichtenthaler, Stefan F.; Greeff, Michael; Hansen, Jens; Wurst, Wolfgang; Trümbach, Dietrich

2011-01-01

The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD) pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases. PMID:21559189

oPOSSUM: integrated tools for analysis of regulatory motif over-representation

PubMed Central

Ho Sui, Shannan J.; Fulton, Debra L.; Arenillas, David J.; Kwon, Andrew T.; Wasserman, Wyeth W.

2007-01-01

The identification of over-represented transcription factor binding sites from sets of co-expressed genes provides insights into the mechanisms of regulation for diverse biological contexts. oPOSSUM, an internet-based system for such studies of regulation, has been improved and expanded in this new release. New features include a worm-specific version for investigating binding sites conserved between Caenorhabditis elegans and C. briggsae, as well as a yeast-specific version for the analysis of co-expressed sets of Saccharomyces cerevisiae genes. The human and mouse applications feature improvements in ortholog mapping, sequence alignments and the delineation of multiple alternative promoters. oPOSSUM2, introduced for the analysis of over-represented combinations of motifs in human and mouse genes, has been integrated with the original oPOSSUM system. Analysis using user-defined background gene sets is now supported. The transcription factor binding site models have been updated to include new profiles from the JASPAR database. oPOSSUM is available at http://www.cisreg.ca/oPOSSUM/ PMID:17576675

Identification of spinal 5-HT sub 3 receptors and their role in the modulation of nociceptive responses in the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Glaum, S.R.

1988-01-01

The project consisted of two related studies: (1) the characterization of serotonin binding sites in crude and purified synaptic membranes prepared from the rat spinal cord, and (2) the association of serotonin binding sites with functional 5-HT receptor responses in the modulation of nociceptive information at the level of the spinal cord. The first series of experiments involved the preparation of membranes from the dorsal and ventral halves of the rat spinal cord and the demonstration of specific ({sup 3}H)serotonin binding to these membranes. High affinity binding sites which conformed to the 5-HT{sub 3} subtype were identified in dorsal, butmore » not ventral spinal cord synaptic membranes. These experiments also confirmed the presence of high affinity ({sup 3}H)5-HT binding sites in dorsal spinal cord synaptic membranes of the 5-HT{sub 1} subtype. The second group of studies demonstrated the ability of selective 5-HT{sub 3} antagonists to inhibit the antinociceptive response to intrathecally administered 5-HT, as measured by a change in tail flick and hot plate latencies. Intrathecal pretreatment with the selective 5-HT{sub 3} antagonists ICS 205-930 or MDL 72222 abolished the antinociceptive effects of 5-HT. Furthermore, the selective 5-HT{sub 3} agonist 2-methyl-5-HT mimicked the antinociceptive effects of 5-HT.« less

Identification of B. anthracis N(5)-carboxyaminoimidazole ribonucleotide mutase (PurE) active site binding compounds via fragment library screening.

PubMed

Lei, Hao; Jones, Christopher; Zhu, Tian; Patel, Kavankumar; Wolf, Nina M; Fung, Leslie W-M; Lee, Hyun; Johnson, Michael E

2016-02-15

The de novo purine biosynthesis pathway is an attractive target for antibacterial drug design, and PurE from this pathway has been identified to be crucial for Bacillus anthracis survival in serum. In this study we adopted a fragment-based hit discovery approach, using three screening methods-saturation transfer difference nucleus magnetic resonance (STD-NMR), water-ligand observed via gradient spectroscopy (WaterLOGSY) NMR, and surface plasmon resonance (SPR), against B. anthracis PurE (BaPurE) to identify active site binding fragments by initially testing 352 compounds in a Zenobia fragment library. Competition STD NMR with the BaPurE product effectively eliminated non-active site binding hits from the primary hits, selecting active site binders only. Binding affinities (dissociation constant, KD) of these compounds varied between 234 and 301μM. Based on test results from the Zenobia compounds, we subsequently developed and applied a streamlined fragment screening strategy to screen a much larger library consisting of 3000 computationally pre-selected fragments. Thirteen final fragment hits were confirmed to exhibit binding affinities varying from 14μM to 700μM, which were categorized into five different basic scaffolds. All thirteen fragment hits have ligand efficiencies higher than 0.30. We demonstrated that at least two fragments from two different scaffolds exhibit inhibitory activity against the BaPurE enzyme. Published by Elsevier Ltd.

Sensitive and accurate identification of protein–DNA binding events in ChIP-chip assays using higher order derivative analysis

PubMed Central

Barrett, Christian L.; Cho, Byung-Kwan

2011-01-01

Immuno-precipitation of protein–DNA complexes followed by microarray hybridization is a powerful and cost-effective technology for discovering protein–DNA binding events at the genome scale. It is still an unresolved challenge to comprehensively, accurately and sensitively extract binding event information from the produced data. We have developed a novel strategy composed of an information-preserving signal-smoothing procedure, higher order derivative analysis and application of the principle of maximum entropy to address this challenge. Importantly, our method does not require any input parameters to be specified by the user. Using genome-scale binding data of two Escherichia coli global transcription regulators for which a relatively large number of experimentally supported sites are known, we show that ∼90% of known sites were resolved to within four probes, or ∼88 bp. Over half of the sites were resolved to within two probes, or ∼38 bp. Furthermore, we demonstrate that our strategy delivers significant quantitative and qualitative performance gains over available methods. Such accurate and sensitive binding site resolution has important consequences for accurately reconstructing transcriptional regulatory networks, for motif discovery, for furthering our understanding of local and non-local factors in protein–DNA interactions and for extending the usefulness horizon of the ChIP-chip platform. PMID:21051353

Novel synthesis and structural characterization of a high-affinity paramagnetic kinase probe for the identification of non-ATP site binders by nuclear magnetic resonance.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moy, Franklin J.; Lee, Arthur; Gavrin, Lori Krim

2010-07-23

To aid in the pursuit of selective kinase inhibitors, we have developed a unique ATP site binder tool for the detection of binders outside the ATP site by nuclear magnetic resonance (NMR). We report here the novel synthesis that led to this paramagnetic spin-labeled pyrazolopyrimidine probe (1), which exhibits nanomolar inhibitory activity against multiple kinases. We demonstrate the application of this probe by performing NMR binding experiments with Lck and Src kinases and utilize it to detect the binding of two compounds proximal to the ATP site. The complex structure of the probe with Lck is also presented, revealing howmore » the probe fits in the ATP site and the specific interactions it has with the protein. We believe that this spin-labeled probe is a valuable tool that holds broad applicability in a screen for non-ATP site binders.« less

Identification and grafting of a unique peptide-binding site in the Fab framework of monoclonal antibodies

DOE PAGES

Donaldson, Joshua M.; Zer, Cindy; Avery, Kendra N.; ...

2013-10-07

Capitalizing on their extraordinary specificity, monoclonal antibodies (mAbs) have become one of the most reengineered classes of biological molecules. A major goal in many of these engineering efforts is to add new functionality to the parental mAb, including the addition of cytotoxins and imaging agents for medical applications. Herein, we present a unique peptide-binding site within the central cavity of the fragment antigen binding framework region of the chimeric, anti-epidermal growth factor receptor mAb cetuximab. We demonstrate through diffraction methods, biophysical studies, and sequence analysis that this peptide, a meditope, has moderate affinity for the Fab, is specific to cetuximabmore » (i.e., does not bind to human IgGs), and has no significant effect on antigen binding. We further demonstrate by diffraction studies and biophysical methods that the meditope binding site can be grafted onto the anti-human epidermal growth factor receptor 2 mAb trastuzumab, and that the antigen binding affinity of the grafted trastuzumab is indistinguishable from the parental mAb. Lastly, we demonstrate a bivalent meditope variant binds specifically and stably to antigen-bearing cells only in the presence of the meditope-enabled mAbs. Collectively, this finding and the subsequent characterization and engineering efforts indicate that this unique interface could serve as a noncovalent “linker” for any meditope-enabled mAb with applications in multiple mAb-based technologies including diagnostics, imaging, and therapeutic delivery.« less

Protein social behavior makes a stronger signal for partner identification than surface geometry

PubMed Central

Laine, Elodie

2016-01-01

ABSTRACT Cells are interactive living systems where proteins movements, interactions and regulation are substantially free from centralized management. How protein physico‐chemical and geometrical properties determine who interact with whom remains far from fully understood. We show that characterizing how a protein behaves with many potential interactors in a complete cross‐docking study leads to a sharp identification of its cellular/true/native partner(s). We define a sociability index, or S‐index, reflecting whether a protein likes or not to pair with other proteins. Formally, we propose a suitable normalization function that accounts for protein sociability and we combine it with a simple interface‐based (ranking) score to discriminate partners from non‐interactors. We show that sociability is an important factor and that the normalization permits to reach a much higher discriminative power than shape complementarity docking scores. The social effect is also observed with more sophisticated docking algorithms. Docking conformations are evaluated using experimental binding sites. These latter approximate in the best possible way binding sites predictions, which have reached high accuracy in recent years. This makes our analysis helpful for a global understanding of partner identification and for suggesting discriminating strategies. These results contradict previous findings claiming the partner identification problem being solvable solely with geometrical docking. Proteins 2016; 85:137–154. © 2016 Wiley Periodicals, Inc. PMID:27802579

Protein social behavior makes a stronger signal for partner identification than surface geometry.

PubMed

Laine, Elodie; Carbone, Alessandra

2017-01-01

Cells are interactive living systems where proteins movements, interactions and regulation are substantially free from centralized management. How protein physico-chemical and geometrical properties determine who interact with whom remains far from fully understood. We show that characterizing how a protein behaves with many potential interactors in a complete cross-docking study leads to a sharp identification of its cellular/true/native partner(s). We define a sociability index, or S-index, reflecting whether a protein likes or not to pair with other proteins. Formally, we propose a suitable normalization function that accounts for protein sociability and we combine it with a simple interface-based (ranking) score to discriminate partners from non-interactors. We show that sociability is an important factor and that the normalization permits to reach a much higher discriminative power than shape complementarity docking scores. The social effect is also observed with more sophisticated docking algorithms. Docking conformations are evaluated using experimental binding sites. These latter approximate in the best possible way binding sites predictions, which have reached high accuracy in recent years. This makes our analysis helpful for a global understanding of partner identification and for suggesting discriminating strategies. These results contradict previous findings claiming the partner identification problem being solvable solely with geometrical docking. Proteins 2016; 85:137-154. © 2016 Wiley Periodicals, Inc. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.

Evidence of a potential receptor-binding site on the Nipah virus G protein (NiV-G): identification of globular head residues with a role in fusion promotion and their localization on an NiV-G structural model.

PubMed

Guillaume, Vanessa; Aslan, Hamide; Ainouze, Michelle; Guerbois, Mathilde; Wild, T Fabian; Buckland, Robin; Langedijk, Johannes P M

2006-08-01

As a preliminary to the localization of the receptor-binding site(s) on the Nipah virus (NiV) glycoprotein (NiV-G), we have undertaken the identification of NiV-G residues that play a role in fusion promotion. To achieve this, we have used two strategies. First, as NiV and Hendra virus (HeV) share a common receptor and their cellular tropism is similar, we hypothesized that residues functioning in receptor attachment could be conserved between their respective G proteins. Our initial strategy was to target charged residues (which can be expected to be at the surface of the protein) conserved between the NiV-G and HeV-G globular heads. Second, we generated NiV variants that escaped neutralization by anti-NiV-G monoclonal antibodies (MAbs) that neutralize NiV both in vitro and in vivo, likely by blocking receptor attachment. The sequencing of such "escape mutants" identified NiV-G residues present in the epitopes to which the neutralizing MAbs are directed. Residues identified via these two strategies whose mutation had an effect on fusion promotion were localized on a new structural model for the NiV-G protein. Our results suggest that seven NiV-G residues, including one (E533) that was identified using both strategies, form a contiguous site on the top of the globular head that is implicated in ephrinB2 binding. This site commences near the shallow depression in the center of the top surface of the globular head and extends to the rim of the barrel-like structure on the top loops of beta-sheet 5. The topology of this site is strikingly similar to that proposed to form the SLAM receptor site on another paramyxovirus attachment protein, that of the measles virus hemagglutinin.

Evidence of a Potential Receptor-Binding Site on the Nipah Virus G Protein (NiV-G): Identification of Globular Head Residues with a Role in Fusion Promotion and Their Localization on an NiV-G Structural Model

PubMed Central

Guillaume, Vanessa; Aslan, Hamide; Ainouze, Michelle; Guerbois, Mathilde; Fabian Wild, T.; Buckland, Robin; Langedijk, Johannes P. M.

2006-01-01

As a preliminary to the localization of the receptor-binding site(s) on the Nipah virus (NiV) glycoprotein (NiV-G), we have undertaken the identification of NiV-G residues that play a role in fusion promotion. To achieve this, we have used two strategies. First, as NiV and Hendra virus (HeV) share a common receptor and their cellular tropism is similar, we hypothesized that residues functioning in receptor attachment could be conserved between their respective G proteins. Our initial strategy was to target charged residues (which can be expected to be at the surface of the protein) conserved between the NiV-G and HeV-G globular heads. Second, we generated NiV variants that escaped neutralization by anti-NiV-G monoclonal antibodies (MAbs) that neutralize NiV both in vitro and in vivo, likely by blocking receptor attachment. The sequencing of such “escape mutants” identified NiV-G residues present in the epitopes to which the neutralizing MAbs are directed. Residues identified via these two strategies whose mutation had an effect on fusion promotion were localized on a new structural model for the NiV-G protein. Our results suggest that seven NiV-G residues, including one (E533) that was identified using both strategies, form a contiguous site on the top of the globular head that is implicated in ephrinB2 binding. This site commences near the shallow depression in the center of the top surface of the globular head and extends to the rim of the barrel-like structure on the top loops of β-sheet 5. The topology of this site is strikingly similar to that proposed to form the SLAM receptor site on another paramyxovirus attachment protein, that of the measles virus hemagglutinin. PMID:16840334

Calcium-stimulated autophosphorylation site of plant chimeric calcium/calmodulin-dependent protein kinase

NASA Technical Reports Server (NTRS)

Sathyanarayanan, P. V.; Siems, W. F.; Jones, J. P.; Poovaiah, B. W.

2001-01-01

The existence of two molecular switches regulating plant chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK), namely the C-terminal visinin-like domain acting as Ca(2+)-sensitive molecular switch and calmodulin binding domain acting as Ca(2+)-stimulated autophosphorylation-sensitive molecular switch, has been described (Sathyanarayanan, P. V., Cremo, C. R., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 30417-30422). Here we report the identification of Ca(2+)-stimulated autophosphorylation site of CCaMK by matrix-assisted laser desorption ionization time of flight-mass spectrometry. Thr(267) was confirmed as the Ca(2+)-stimulated autophosphorylation site by post-source decay experiments and by site-directed mutagenesis. The purified T267A mutant form of CCaMK did not show Ca(2+)-stimulated autophosphorylation, autophosphorylation-dependent variable calmodulin affinity, or Ca(2+)/calmodulin stimulation of kinase activity. Sequence comparison of CCaMK from monocotyledonous plant (lily) and dicotyledonous plant (tobacco) suggests that the autophosphorylation site is conserved. This is the first identification of a phosphorylation site specifically responding to activation by second messenger system (Ca(2+) messenger system) in plants. Homology modeling of the kinase and calmodulin binding domain of CCaMK with the crystal structure of calcium/calmodulin-dependent protein kinase 1 suggests that the Ca(2+)-stimulated autophosphorylation site is located on the surface of the kinase and far from the catalytic site. Analysis of Ca(2+)-stimulated autophosphorylation with increasing concentration of CCaMK indicates the possibility that the Ca(2+)-stimulated phosphorylation occurs by an intermolecular mechanism.

Crystal structures of two novel dye-decolorizing peroxidases reveal a beta-barrel fold with a conserved heme-binding motif.

PubMed

Zubieta, Chloe; Krishna, S Sri; Kapoor, Mili; Kozbial, Piotr; McMullan, Daniel; Axelrod, Herbert L; Miller, Mitchell D; Abdubek, Polat; Ambing, Eileen; Astakhova, Tamara; Carlton, Dennis; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C; Duan, Lian; Elsliger, Marc-André; Feuerhelm, Julie; Grzechnik, Slawomir K; Hale, Joanna; Hampton, Eric; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kumar, Abhinav; Marciano, David; Morse, Andrew T; Nigoghossian, Edward; Okach, Linda; Oommachen, Silvya; Reyes, Ron; Rife, Christopher L; Schimmel, Paul; van den Bedem, Henry; Weekes, Dana; White, Aprilfawn; Xu, Qingping; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

2007-11-01

BtDyP from Bacteroides thetaiotaomicron (strain VPI-5482) and TyrA from Shewanella oneidensis are dye-decolorizing peroxidases (DyPs), members of a new family of heme-dependent peroxidases recently identified in fungi and bacteria. Here, we report the crystal structures of BtDyP and TyrA at 1.6 and 2.7 A, respectively. BtDyP assembles into a hexamer, while TyrA assembles into a dimer; the dimerization interface is conserved between the two proteins. Each monomer exhibits a two-domain, alpha+beta ferredoxin-like fold. A site for heme binding was identified computationally, and modeling of a heme into the proposed active site allowed for identification of residues likely to be functionally important. Structural and sequence comparisons with other DyPs demonstrate a conservation of putative heme-binding residues, including an absolutely conserved histidine. Isothermal titration calorimetry experiments confirm heme binding, but with a stoichiometry of 0.3:1 (heme:protein). (c) 2007 Wiley-Liss, Inc.

Identification of the functional binding pocket for compounds targeting small-conductance Ca2+-activated potassium channels

PubMed Central

Zhang, Miao; Pascal, John M.; Schumann, Marcel; Armen, Roger S.; Zhang, Ji-fang

2012-01-01

Small- and intermediate-conductance Ca2+-activated potassium channels, activated by Ca2+-bound calmodulin, play an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potentials for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-EBIO class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class. PMID:22929778

Identification of the functional binding pocket for compounds targeting small-conductance Ca²⁺-activated potassium channels.

PubMed

Zhang, Miao; Pascal, John M; Schumann, Marcel; Armen, Roger S; Zhang, Ji-Fang

2012-01-01

Small- and intermediate-conductance Ca(2+)-activated potassium channels, activated by Ca(2+)-bound calmodulin, have an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potential for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-ethyl-2-benzimidazolinone (1-EBIO) class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class.

Identification of residues of CXCR4 critical for human immunodeficiency virus coreceptor and chemokine receptor activities.

PubMed

Brelot, A; Heveker, N; Montes, M; Alizon, M

2000-08-04

CXCR4 is a G-coupled receptor for the stromal cell-derived factor (SDF-1) chemokine, and a CD4-associated human immunodeficiency virus type 1 (HIV-1) coreceptor. These functions were studied in a panel of CXCR4 mutants bearing deletions in the NH(2)-terminal extracellular domain (NT) or substitutions in the NT, the extracellular loops (ECL), or the transmembrane domains (TMs). The coreceptor activity of CXCR4 was markedly impaired by mutations of two Tyr residues in NT (Y7A/Y12A) or at a single Asp residue in ECL2 (D193A), ECL3 (D262A), or TMII (D97N). These acidic residues could engage electrostatical interactions with basic residues of the HIV-1 envelope protein gp120, known to contribute to the selectivity for CXCR4. The ability of CXCR4 mutants to bind SDF-1 and mediate cell signal was consistent with the two-site model of chemokine-receptor interaction. Site I involved in SDF-1 binding but not signaling was located in NT with particular importance of Glu(14) and/or Glu(15) and Tyr(21). Residues required for both SDF-1 binding and signaling, and thus probably part of site II, were identified in ECL2 (Asp(187)), TMII (Asp(97)), and TMVII (Glu(288)). The first residues () of NT also seem required for SDF-1 binding and signaling. A deletion in the third intracellular loop abolished signaling, probably by disrupting the coupling with G proteins. The identification of CXCR4 residues involved in the interaction with both SDF-1 and HIV-1 may account for the signaling activity of gp120 and has implications for the development of antiviral compounds.

Exploiting conformational dynamics in drug discovery: design of C-terminal inhibitors of Hsp90 with improved activities

PubMed Central

Moroni, Elisabetta; Zhao, Huiping; Blagg, Brian S.J.; Colombo, Giorgio

2014-01-01

The interaction that occurs between molecules is a dynamic process that impacts both structural and conformational properties of the ligand and the ligand binding site. Herein, we investigate the dynamic cross-talk between a protein and the ligand as a source for new opportunities in ligand design. Analysis of the formation/disappearance of protein pockets produced in response to a first-generation inhibitor assisted in the identification of functional groups that could be introduced onto scaffolds to facilitate optimal binding, which allowed for increased binding with previously uncharacterized regions. MD simulations were used to elucidate primary changes that occur in the Hsp90 C-terminal binding pocket in the presence of first-generation ligands. This data was then used to design ligands that adapt to these receptor conformations, which provides access to an energy landscape that is not visible in a static model. The newly synthesized compounds demonstrated anti-proliferative activity at ~150 nanomolar concentration. The method identified herein may be used to design chemical probes that provide additional information on structural variations of Hsp90 C-terminal binding site. PMID:24397468

Atrial natriuretic peptide receptor heterogeneity and effects on cyclic GMP accumulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leitman, D.C.

1988-01-01

The effects of atrial natriuretic peptide (ANP), oxytocin (OT) and vasopressin (AVP) on guanylate cyclase activity and cyclic GMP accumulation were examined, since these hormones appear to be intimately associated with blood pressure and intravascular volume homeostasis. ANP was found to increase cyclic GMP accumulation in ten cell culture systems, which were derived from blood vessels, adrenal cortex, kidney, lung, testes and mammary gland. ANP receptors were characterized in intact cultured cells using {sup 125}I-ANP{sub 8-33}. Specific {sup 125}I-ANP binding was saturable and of high affinity. Scratchard analysis of the binding data for all cell types exhibited a straight line,more » indicating that these cells possessed a single class of binding sites. Despite the presence of linear Scatchard plots, these studies demonstrated that cultured cells possess two functionally and physically distinct ANP-binding sites. Most of the ANP-binding sites in cultured cells have a molecular size of 66,000 daltons under reducing conditions. The identification of cultured cell types in which hormones (ANP and oxytocin) regulate guanylate cyclase activity and increase cyclic GMP synthesis will provide valuable systems to determine the mechanisms of hormone-receptor coupling to guanylate cyclase and the cellular processes regulated by cyclic GMP.« less

Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

PubMed Central

Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

2013-01-01

DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

Simultaneous fluorescence light-up and selective multicolor nucleobase recognition based on sequence-dependent strong binding of berberine to DNA abasic site.

PubMed

Wu, Fei; Shao, Yong; Ma, Kun; Cui, Qinghua; Liu, Guiying; Xu, Shujuan

2012-04-28

Label-free DNA nucleobase recognition by fluorescent small molecules has received much attention due to its simplicity in mutation identification and drug screening. However, sequence-dependent fluorescence light-up nucleobase recognition and multicolor emission with individual emission energy for individual nucleobases have been seldom realized. Herein, an abasic site (AP site) in a DNA duplex was employed as a binding field for berberine, one of isoquinoline alkaloids. Unlike weak binding of berberine to the fully matched DNAs without the AP site, strong binding of berberine to the AP site occurs and the berberine's fluorescence light-up behaviors are highly dependent on the target nucleobases opposite the AP site in which the targets thymine and cytosine produce dual emission bands, while the targets guanine and adenine only give a single emission band. Furthermore, more intense emissions are observed for the target pyrimidines than purines. The flanking bases of the AP site also produce some modifications of the berberine's emission behavior. The binding selectivity of berberine at the AP site is also confirmed by measurements of fluorescence resonance energy transfer, excited-state lifetime, DNA melting and fluorescence quenching by ferrocyanide and sodium chloride. It is expected that the target pyrimidines cause berberine to be stacked well within DNA base pairs near the AP site, which results in a strong resonance coupling of the electronic transitions to the particular vibration mode to produce the dual emissions. The fluorescent signal-on and emission energy-modulated sensing for nucleobases based on this fluorophore is substantially advantageous over the previously used fluorophores. We expect that this approach will be developed as a practical device for differentiating pyrimidines from purines by positioning an AP site toward a target that is available for readout by this alkaloid probe. This journal is © The Royal Society of Chemistry 2012

Substrate and Substrate-Mimetic Chaperone Binding Sites in Human α-Galactosidase A Revealed by Affinity-Mass Spectrometry

NASA Astrophysics Data System (ADS)

Moise, Adrian; Maeser, Stefan; Rawer, Stephan; Eggers, Frederike; Murphy, Mary; Bornheim, Jeff; Przybylski, Michael

2016-06-01

Fabry disease (FD) is a rare metabolic disorder of a group of lysosomal storage diseases, caused by deficiency or reduced activity of the enzyme α-galactosidase. Human α-galactosidase A (hαGAL) hydrolyses the terminal α-galactosyl moiety from glycosphingolipids, predominantly globotriaosylceramide (Gb3). Enzyme deficiency leads to incomplete or blocked breakdown and progressive accumulation of Gb3, with detrimental effects on normal organ functions. FD is successfully treated by enzyme replacement therapy (ERT) with purified recombinant hαGAL. An emerging treatment strategy, pharmacologic chaperone therapy (PCT), employs small molecules that can increase and/or reconstitute the activity of lysosomal enzyme trafficking by stabilizing misfolded isoforms. One such chaperone, 1-deoxygalactonojirimycin (DGJ), is a structural galactose analogue currently validated in clinical trials. DGJ is an active-site-chaperone that binds at the same or similar location as galactose; however, the molecular determination of chaperone binding sites in lysosomal enzymes represents a considerable challenge. Here we report the identification of the galactose and DGJ binding sites in recombinant α-galactosidase through a new affinity-mass spectrometry-based approach that employs selective proteolytic digestion of the enzyme-galactose or -inhibitor complex. Binding site peptides identified by mass spectrometry, [39-49], [83-100], and [141-168], contain the essential ligand-contacting amino acids, in agreement with the known X-ray crystal structures. The inhibitory effect of DGJ on galactose recognition was directly characterized through competitive binding experiments and mass spectrometry. The methods successfully employed in this study should have high potential for the characterization of (mutated) enzyme-substrate and -chaperone interactions, and for identifying chaperones without inhibitory effects.

Structural Basis for the Recognition of Tyrosine-based Sorting Signals by the μ3A Subunit of the AP-3 Adaptor Complex*

PubMed Central

Mardones, Gonzalo A.; Burgos, Patricia V.; Lin, Yimo; Kloer, Daniel P.; Magadán, Javier G.; Hurley, James H.; Bonifacino, Juan S.

2013-01-01

Tyrosine-based signals fitting the YXXØ motif mediate sorting of transmembrane proteins to endosomes, lysosomes, the basolateral plasma membrane of polarized epithelial cells, and the somatodendritic domain of neurons through interactions with the homologous μ1, μ2, μ3, and μ4 subunits of the corresponding AP-1, AP-2, AP-3, and AP-4 complexes. Previous x-ray crystallographic analyses identified distinct binding sites for YXXØ signals on μ2 and μ4, which were located on opposite faces of the proteins. To elucidate the mode of recognition of YXXØ signals by other members of the μ family, we solved the crystal structure at 1.85 Å resolution of the C-terminal domain of the μ3 subunit of AP-3 (isoform A) in complex with a peptide encoding a YXXØ signal (SDYQRL) from the trans-Golgi network protein TGN38. The μ3A C-terminal domain consists of an immunoglobulin-like β-sandwich organized into two subdomains, A and B. The YXXØ signal binds in an extended conformation to a site on μ3A subdomain A, at a location similar to the YXXØ-binding site on μ2 but not μ4. The binding sites on μ3A and μ2 exhibit similarities and differences that account for the ability of both proteins to bind distinct sets of YXXØ signals. Biochemical analyses confirm the identification of the μ3A site and show that this protein binds YXXØ signals with 14–19 μm affinity. The surface electrostatic potential of μ3A is less basic than that of μ2, in part explaining the association of AP-3 with intracellular membranes having less acidic phosphoinositides. PMID:23404500

Structural basis for the recognition of tyrosine-based sorting signals by the μ3A subunit of the AP-3 adaptor complex.

PubMed

Mardones, Gonzalo A; Burgos, Patricia V; Lin, Yimo; Kloer, Daniel P; Magadán, Javier G; Hurley, James H; Bonifacino, Juan S

2013-03-29

Tyrosine-based signals fitting the YXXØ motif mediate sorting of transmembrane proteins to endosomes, lysosomes, the basolateral plasma membrane of polarized epithelial cells, and the somatodendritic domain of neurons through interactions with the homologous μ1, μ2, μ3, and μ4 subunits of the corresponding AP-1, AP-2, AP-3, and AP-4 complexes. Previous x-ray crystallographic analyses identified distinct binding sites for YXXØ signals on μ2 and μ4, which were located on opposite faces of the proteins. To elucidate the mode of recognition of YXXØ signals by other members of the μ family, we solved the crystal structure at 1.85 Å resolution of the C-terminal domain of the μ3 subunit of AP-3 (isoform A) in complex with a peptide encoding a YXXØ signal (SDYQRL) from the trans-Golgi network protein TGN38. The μ3A C-terminal domain consists of an immunoglobulin-like β-sandwich organized into two subdomains, A and B. The YXXØ signal binds in an extended conformation to a site on μ3A subdomain A, at a location similar to the YXXØ-binding site on μ2 but not μ4. The binding sites on μ3A and μ2 exhibit similarities and differences that account for the ability of both proteins to bind distinct sets of YXXØ signals. Biochemical analyses confirm the identification of the μ3A site and show that this protein binds YXXØ signals with 14-19 μm affinity. The surface electrostatic potential of μ3A is less basic than that of μ2, in part explaining the association of AP-3 with intracellular membranes having less acidic phosphoinositides.

SSMART: Sequence-structure motif identification for RNA-binding proteins.

PubMed

Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

2018-06-11

RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

Highly accessible AU-rich regions in 3' untranslated regions are hotspots for binding of regulatory factors.

PubMed

Plass, Mireya; Rasmussen, Simon H; Krogh, Anders

2017-04-01

Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3'UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing "free" target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of regulation of post-transcriptional regulatory networks.

Highly accessible AU-rich regions in 3’ untranslated regions are hotspots for binding of regulatory factors

PubMed Central

2017-01-01

Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3’UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing “free” target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of regulation of post-transcriptional regulatory networks. PMID:28410363

Identification of a unique Ca2+-binding site in rat acid-sensing ion channel 3.

PubMed

Zuo, Zhicheng; Smith, Rachel N; Chen, Zhenglan; Agharkar, Amruta S; Snell, Heather D; Huang, Renqi; Liu, Jin; Gonzales, Eric B

2018-05-25

Acid-sensing ion channels (ASICs) evolved to sense changes in extracellular acidity with the divalent cation calcium (Ca 2+ ) as an allosteric modulator and channel blocker. The channel-blocking activity is most apparent in ASIC3, as removing Ca 2+ results in channel opening, with the site's location remaining unresolved. Here we show that a ring of rat ASIC3 (rASIC3) glutamates (Glu435), located above the channel gate, modulates proton sensitivity and contributes to the formation of the elusive Ca 2+ block site. Mutation of this residue to glycine, the equivalent residue in chicken ASIC1, diminished the rASIC3 Ca 2+ block effect. Atomistic molecular dynamic simulations corroborate the involvement of this acidic residue in forming a high-affinity Ca 2+ site atop the channel pore. Furthermore, the reported observations provide clarity for past controversies regarding ASIC channel gating. Our findings enhance understanding of ASIC gating mechanisms and provide structural and energetic insights into this unique calcium-binding site.

Evidence for specific annexin I-binding proteins on human monocytes.

PubMed Central

Goulding, N J; Pan, L; Wardwell, K; Guyre, V C; Guyre, P M

1996-01-01

Recombinant human annexin I and a monoclonal antibody specific for this protein (mAb 1B) were used to investigate surface binding of this member of the annexin family of proteins to peripheral blood monocytes. Flow cytometric analysis demonstrated trypsin-sensitive, saturable binding of annexin I to human peripheral blood monocytes but not to admixed lymphocytes. A monoclonal antibody that blocks the anti-phospholipase activity of annexin I also blocked its binding to monocytes. These findings suggest the presence of specific binding sites on monocytes. Furthermore, surface iodination, immunoprecipitation and SDS/PAGE analysis were used to identify two annexin I-binding proteins on the surface of monocytes with molecular masses of 15 kDa and 18 kDa respectively. The identification and characterization of these annexin I-binding molecules should help us to better understand the specific interactions of annexin I with monocytes that lead to down-regulation of pro-inflammatory cell functions. PMID:8687405

Mass Spectrometric Determination of ILPR G-quadruplex Binding Sites in Insulin and IGF-2

PubMed Central

Xiao, JunFeng

2009-01-01

The insulin-linked polymorphic region (ILPR) of the human insulin gene promoter region forms G-quadruplex structures in vitro. Previous studies show that insulin and insulin-like growth factor-2 (IGF-2) exhibit high affinity binding in vitro to 2-repeat sequences of ILPR variants a and h, but negligible binding to variant i. Two-repeat sequences of variants a and h form intramolecular G-quadruplex structures that are not evidenced for variant i. Here we report on the use of protein digestion combined with affinity capture and MALDI-MS detection to pinpoint ILPR binding sites in insulin and IGF-2. Peptides captured by ILPR variants a and h were sequenced by MALDI-MS/MS, LC-MS and in silico digestion. On-bead digestion of insulin-ILPR variant a complexes supported the conclusions. The results indicate that the sequence VCG(N)RGF is generally present in the captured peptides and is likely involved in the affinity binding interactions of the proteins with the ILPR G-quadruplexes. The significance of arginine in the interactions was studied by comparing the affinities of synthesized peptides VCGERGF and VCGEAGF with ILPR variant a. Peptides from other regions of the proteins that are connected through disulfide linkages were also detected in some capture experiments. Identification of binding sites could facilitate design of DNA binding ligands for capture and detection of insulin and IGF-2. The interactions may have biological significance as well. PMID:19747845

Electrostatic interactions guide the active site face of a structure-specific ribonuclease to its RNA substrate.

PubMed

Plantinga, Matthew J; Korennykh, Alexei V; Piccirilli, Joseph A; Correll, Carl C

2008-08-26

Restrictocin, a member of the alpha-sarcin family of site-specific endoribonucleases, uses electrostatic interactions to bind to the ribosome and to RNA oligonucleotides, including the minimal specific substrate, the sarcin/ricin loop (SRL) of 23S-28S rRNA. Restrictocin binds to the SRL by forming a ground-state E:S complex that is stabilized predominantly by Coulomb interactions and depends on neither the sequence nor structure of the RNA, suggesting a nonspecific complex. The 22 cationic residues of restrictocin are dispersed throughout this protein surface, complicating a priori identification of a Coulomb interacting surface. Structural studies have identified an enzyme-substrate interface, which is expected to overlap with the electrostatic E:S interface. Here, we identified restrictocin residues that contribute to binding in the E:S complex by determining the salt dependence [partial differential log(k 2/ K 1/2)/ partial differential log[KCl

Ligand-Assisted Protein Structure (LAPS): An Experimental Paradigm for Characterizing Cannabinoid-Receptor Ligand-Binding Domains.

PubMed

Janero, David R; Korde, Anisha; Makriyannis, Alexandros

2017-01-01

Detailed characterization of the ligand-binding motifs and structure-function correlates of the principal GPCRs of the endocannabinoid-signaling system, the cannabinoid 1 (CB1R) and cannabinoid 2 (CB2R) receptors, is essential to inform the rational design of drugs that modulate CB1R- and CB2R-dependent biosignaling for therapeutic gain. We discuss herein an experimental paradigm termed "ligand-assisted protein structure" (LAPS) that affords a means of characterizing, at the amino acid level, CB1R and CB2R structural features key to ligand engagement and receptor-dependent information transmission. For this purpose, LAPS integrates three key disciplines and methodologies: (a) medicinal chemistry: design and synthesis of high-affinity, pharmacologically active probes as reporters capable of reacting irreversibly with particular amino acids at (or in the immediate vicinity of) the ligand-binding domain of the functionally active receptor; (b) molecular and cellular biology: introduction of discrete, conservative point mutations into the target GPCR and determination of their effect on probe binding and pharmacological activity; (c) analytical chemistry: identification of the site(s) of probe-GPCR interaction through focused, bottom-up, amino acid-level proteomic identification of the probe-receptor complex using liquid chromatography tandem mass spectrometry. Subsequent in silico methods including ligand docking and computational modeling provide supplementary data on the probe-receptor interaction as defined by LAPS. Examples of LAPS as applied to human CB2R orthosteric binding site characterization for a biarylpyrazole antagonist/inverse agonist and a classical cannabinoid agonist belonging to distinct chemical classes of cannabinergic compounds are given as paradigms for further application of this methodology to other therapeutic protein targets. LAPS is well positioned to complement other experimental and in silico methods in contemporary structural biology such as X-ray crystallography. © 2017 Elsevier Inc. All rights reserved.

Analysis of a two-domain binding site for the urokinase-type plasminogen activator-plasminogen activator inhibitor-1 complex in low-density-lipoprotein-receptor-related protein.

PubMed

Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C

2001-07-01

The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.

Identification and Development of 2,3-Dihydropyrrolo[1,2-a]quinazolin-5(1H)-one Inhibitors Targeting Bromodomains within the Switch/Sucrose Nonfermenting Complex

PubMed Central

2016-01-01

Bromodomain containing proteins PB1, SMARCA4, and SMARCA2 are important components of SWI/SNF chromatin remodeling complexes. We identified bromodomain inhibitors that target these proteins and display unusual binding modes involving water displacement from the KAc binding site. The best compound binds the fifth bromodomain of PB1 with a KD of 124 nM, SMARCA2B and SMARCA4 with KD values of 262 and 417 nM, respectively, and displays excellent selectivity over bromodomains other than PB1, SMARCA2, and SMARCA4. PMID:27119626

Distribution of Non-AT1, Non-AT2 Binding of 125I-Sarcosine1, Isoleucine8 Angiotensin II in Neurolysin Knockout Mouse Brains

PubMed Central

Speth, Robert C.; Carrera, Eduardo J.; Bretón, Catalina; Linares, Andrea; Gonzalez-Reiley, Luz; Swindle, Jamala D.; Santos, Kira L.; Schadock, Ines; Bader, Michael; Karamyan, Vardan T.

2014-01-01

The recent identification of a novel binding site for angiotensin (Ang) II as the peptidase neurolysin (E.C. 3.4.24.16) has implications for the renin-angiotensin system (RAS). This report describes the distribution of specific binding of 125I-Sarcosine1, Isoleucine8 Ang II (125I-SI Ang II) in neurolysin knockout mouse brains compared to wild-type mouse brains using quantitative receptor autoradiography. In the presence of p-chloromercuribenzoic acid (PCMB), which unmasks the novel binding site, widespread distribution of specific (3 µM Ang II displaceable) 125I-SI Ang II binding in 32 mouse brain regions was observed. Highest levels of binding >700 fmol/g initial wet weight were seen in hypothalamic, thalamic and septal regions, while the lowest level of binding <300 fmol/g initial wet weight was in the mediolateral medulla. 125I-SI Ang II binding was substantially higher by an average of 85% in wild-type mouse brains compared to neurolysin knockout brains, suggesting the presence of an additional non-AT1, non-AT2, non-neurolysin Ang II binding site in the mouse brain. Binding of 125I-SI Ang II to neurolysin in the presence of PCMB was highest in hypothalamic and ventral cortical brain regions, but broadly distributed across all regions surveyed. Non-AT1, non-AT2, non-neurolysin binding was also highest in the hypothalamus but had a different distribution than neurolysin. There was a significant reduction in AT2 receptor binding in the neurolysin knockout brain and a trend towards decreased AT1 receptor binding. In the neurolysin knockout brains, the size of the lateral ventricles was increased by 56% and the size of the mid forebrain (−2.72 to +1.48 relative to Bregma) was increased by 12%. These results confirm the identity of neurolysin as a novel Ang II binding site, suggesting that neurolysin may play a significant role in opposing the pathophysiological actions of the brain RAS and influencing brain morphology. PMID:25147932

Identification of a DNA-binding site for the transcription factor Haa1, required for Saccharomyces cerevisiae response to acetic acid stress

PubMed Central

Mira, Nuno P.; Henriques, Sílvia F.; Keller, Greg; Teixeira, Miguel C.; Matos, Rute G.; Arraiano, Cecília M.; Winge, Dennis R.; Sá-Correia, Isabel

2011-01-01

The transcription factor Haa1 is the main player in reprogramming yeast genomic expression in response to acetic acid stress. Mapping of the promoter region of one of the Haa1-activated genes, TPO3, allowed the identification of an acetic acid responsive element (ACRE) to which Haa1 binds in vivo. The in silico analysis of the promoter regions of the genes of the Haa1-regulon led to the identification of an Haa1-responsive element (HRE) 5′-GNN(G/C)(A/C)(A/G)G(A/G/C)G-3′. Using surface plasmon resonance experiments and electrophoretic mobility shift assays it is demonstrated that Haa1 interacts with high affinity (KD of 2 nM) with the HRE motif present in the ACRE region of TPO3 promoter. No significant interaction was found between Haa1 and HRE motifs having adenine nucleotides at positions 6 and 8 (KD of 396 and 6780 nM, respectively) suggesting that Haa1p does not recognize these motifs in vivo. A lower affinity of Haa1 toward HRE motifs having mutations in the guanine nucleotides at position 7 and 9 (KD of 21 and 119 nM, respectively) was also observed. Altogether, the results obtained indicate that the minimal functional binding site of Haa1 is 5′-(G/C)(A/C)GG(G/C)G-3′. The Haa1-dependent transcriptional regulatory network active in yeast response to acetic acid stress is proposed. PMID:21586585

Murine and human CFTR exhibit different sensitivities to CFTR potentiators

PubMed Central

Cui, Guiying

2015-01-01

Development of therapeutic molecules with clinical efficacy as modulators of defective CFTR includes efforts to identify potentiators that can overcome or repair the gating defect in mutant CFTR channels. This has taken a great leap forward with the identification of the potentiator VX-770, now available to patients as “Kalydeco.” Other small molecules with different chemical structure also are capable of potentiating the activity of either wild-type or mutant CFTR, suggesting that there are features of the protein that may be targeted to achieve stimulation of channel activity by structurally diverse compounds. However, neither the mechanisms by which these compounds potentiate mutant CFTR nor the site(s) where these compounds bind have been identified. This knowledge gap partly reflects the lack of appropriate experimental models to provide clues toward the identification of binding sites. Here, we have compared the channel behavior and response to novel and known potentiators of human CFTR (hCFTR) and murine (mCFTR) expressed in Xenopus oocytes. Both hCFTR and mCFTR were blocked by GlyH-101 from the extracellular side, but mCFTR activity was increased with GlyH-101 applied directly to the cytoplasmic side. Similarly, glibenclamide only exhibited a blocking effect on hCFTR but both blocked and potentiated mCFTR in excised membrane patches and in intact oocytes. The clinically used CFTR potentiator VX-770 transiently increased hCFTR by ∼13% but potentiated mCFTR significantly more strongly. Our results suggest that mCFTR pharmacological sensitivities differ from hCFTR, which will provide a useful tool for identifying the binding sites and mechanism for these potentiators. PMID:26209275

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

PubMed

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Relationship between Hot Spot Residues and Ligand Binding Hot Spots in Protein-Protein Interfaces

PubMed Central

Zerbe, Brandon S.; Hall, David R.

2013-01-01

In the context of protein-protein interactions, the term “hot spot” refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening. PMID:22770357

Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces.

PubMed

Zerbe, Brandon S; Hall, David R; Vajda, Sandor; Whitty, Adrian; Kozakov, Dima

2012-08-27

In the context of protein-protein interactions, the term "hot spot" refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research, a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening.

Identification of the antiepileptic racetam binding site in the synaptic vesicle protein 2A by molecular dynamics and docking simulations.

PubMed

Correa-Basurto, José; Cuevas-Hernández, Roberto I; Phillips-Farfán, Bryan V; Martínez-Archundia, Marlet; Romo-Mancillas, Antonio; Ramírez-Salinas, Gema L; Pérez-González, Óscar A; Trujillo-Ferrara, José; Mendoza-Torreblanca, Julieta G

2015-01-01

Synaptic vesicle protein 2A (SV2A) is an integral membrane protein necessary for the proper function of the central nervous system and is associated to the physiopathology of epilepsy. SV2A is the molecular target of the anti-epileptic drug levetiracetam and its racetam analogs. The racetam binding site in SV2A and the non-covalent interactions between racetams and SV2A are currently unknown; therefore, an in silico study was performed to explore these issues. Since SV2A has not been structurally characterized with X-ray crystallography or nuclear magnetic resonance, a three-dimensional (3D) model was built. The model was refined by performing a molecular dynamics simulation (MDS) and the interactions of SV2A with the racetams were determined by docking studies. A reliable 3D model of SV2A was obtained; it reached structural equilibrium during the last 15 ns of the MDS (50 ns) with remaining structural motions in the N-terminus and long cytoplasmic loop. The docking studies revealed that hydrophobic interactions and hydrogen bonds participate importantly in ligand recognition within the binding site. Residues T456, S665, W666, D670 and L689 were important for racetam binding within the trans-membrane hydrophilic core of SV2A. Identifying the racetam binding site within SV2A should facilitate the synthesis of suitable radio-ligands to study treatment response and possibly epilepsy progression.

Identification of the antiepileptic racetam binding site in the synaptic vesicle protein 2A by molecular dynamics and docking simulations

PubMed Central

Correa-Basurto, José; Cuevas-Hernández, Roberto I.; Phillips-Farfán, Bryan V.; Martínez-Archundia, Marlet; Romo-Mancillas, Antonio; Ramírez-Salinas, Gema L.; Pérez-González, Óscar A.; Trujillo-Ferrara, José; Mendoza-Torreblanca, Julieta G.

2015-01-01

Synaptic vesicle protein 2A (SV2A) is an integral membrane protein necessary for the proper function of the central nervous system and is associated to the physiopathology of epilepsy. SV2A is the molecular target of the anti-epileptic drug levetiracetam and its racetam analogs. The racetam binding site in SV2A and the non-covalent interactions between racetams and SV2A are currently unknown; therefore, an in silico study was performed to explore these issues. Since SV2A has not been structurally characterized with X-ray crystallography or nuclear magnetic resonance, a three-dimensional (3D) model was built. The model was refined by performing a molecular dynamics simulation (MDS) and the interactions of SV2A with the racetams were determined by docking studies. A reliable 3D model of SV2A was obtained; it reached structural equilibrium during the last 15 ns of the MDS (50 ns) with remaining structural motions in the N-terminus and long cytoplasmic loop. The docking studies revealed that hydrophobic interactions and hydrogen bonds participate importantly in ligand recognition within the binding site. Residues T456, S665, W666, D670 and L689 were important for racetam binding within the trans-membrane hydrophilic core of SV2A. Identifying the racetam binding site within SV2A should facilitate the synthesis of suitable radio-ligands to study treatment response and possibly epilepsy progression. PMID:25914622

Open challenges in structure-based virtual screening: Receptor modeling, target flexibility consideration and active site water molecules description.

PubMed

Spyrakis, Francesca; Cavasotto, Claudio N

2015-10-01

Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification of the High-affinity Substrate-binding Site of the Multidrug and Toxic Compound Extrusion (MATE) Family Transporter from Pseudomonas stutzeri*

PubMed Central

Nie, Laiyin; Grell, Ernst; Malviya, Viveka Nand; Xie, Hao; Wang, Jingkang; Michel, Hartmut

2016-01-01

Multidrug and toxic compound extrusion (MATE) transporters exist in all three domains of life. They confer multidrug resistance by utilizing H+ or Na+ electrochemical gradients to extrude various drugs across the cell membranes. The substrate binding and the transport mechanism of MATE transporters is a fundamental process but so far not fully understood. Here we report a detailed substrate binding study of NorM_PS, a representative MATE transporter from Pseudomonas stutzeri. Our results indicate that NorM_PS is a proton-dependent multidrug efflux transporter. Detailed binding studies between NorM_PS and 4′,6-diamidino-2-phenylindole (DAPI) were performed by isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectrofluorometry. Two exothermic binding events were observed from ITC data, and the high-affinity event was directly correlated with the extrusion of DAPI. The affinities are about 1 μm and 0.1 mm for the high and low affinity binding, respectively. Based on our homology model of NorM_PS, variants with mutations of amino acids that are potentially involved in substrate binding, were constructed. By carrying out the functional characterization of these variants, the critical amino acid residues (Glu-257 and Asp-373) for high-affinity DAPI binding were determined. Taken together, our results suggest a new substrate-binding site for MATE transporters. PMID:27235402

Identification of novel phosphatidic acid binding domain on sphingosine kinase 1 of Arabidopsis thaliana.

PubMed

Pandit, Shatakshi; Dalal, Vikram; Mishra, Girish

2018-07-01

Phosphatidic acid (PA) is an important lipid signaling molecule which interacts with Arabidopsis thaliana Sphingosine kinase1 (AtSPHK1) during several abiotic stresses particularly drought stress as a result of Abscisic acid (ABA) signaling in guard cells. PA molecules respond by generating lipid signal and/or by binding and translocating target proteins to membrane. However, site of interaction and role of PA binding to AtSPHK1 is not clear yet. Owing to the importance of AtSPHK1 during stress signaling it is imperative to decipher the site of PA interaction with AtSPHK1. To identify the PA binding region of AtSPHK1, various deletion fragments from N-terminal and C-terminal region were prepared. Results from protein lipid overlay assay using various truncated proteins of AtSPHK1 suggested the involvement of N-terminal region, between 110 and 205 amino acids, in binding with PA. In-silico analyses performed to build homologous structure of AtSPHK1 revealed that PA docking occurs in the hydrophobic cavity of DAG-Kinase domain. Deletion of amino acids 182 VSGDGI 187 perturbed PA-AtSPHK1 binding, indicating an essential role of these six amino acids in PA-AtSPHK1 binding. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

HIP1 and HIP12 display differential binding to F-actin, AP2, and clathrin. Identification of a novel interaction with clathrin light chain.

PubMed

Legendre-Guillemin, Valerie; Metzler, Martina; Charbonneau, Martine; Gan, Lu; Chopra, Vikramjit; Philie, Jacynthe; Hayden, Michael R; McPherson, Peter S

2002-05-31

Huntingtin-interacting protein 1 (HIP1) and HIP12 are orthologues of Sla2p, a yeast protein with essential functions in endocytosis and regulation of the actin cytoskeleton. We now report that HIP1 and HIP12 are major components of the clathrin coat that interact but differ in their ability to bind clathrin and the clathrin adaptor AP2. HIP1 contains a clathrin-box and AP2 consensus-binding sites that display high affinity binding to the terminal domain of the clathrin heavy chain and the ear domain of the AP2 alpha subunit, respectively. These consensus sites are poorly conserved in HIP12 and correspondingly, HIP12 does not bind to AP2 nor does it demonstrate high affinity clathrin binding. Moreover, HIP12 co-sediments with F-actin in contrast to HIP1, which exhibits no interaction with actin in vitro. Despite these differences, both proteins efficiently stimulate clathrin assembly through their central helical domain. Interestingly, in both HIP1 and HIP12, this domain binds directly to the clathrin light chain. Our data suggest that HIP1 and HIP12 play related yet distinct functional roles in clathrin-mediated endocytosis.

Identification, characterization, and gene expression analysis of nucleotide binding site (NB)-type resistance gene homologues in switchgrass

USDA-ARS?s Scientific Manuscript database

Background: Switchgrass (Panicum virgatum L.) is a warm-season perennial grass that can be used as a second generation bioenergy crop. However, foliar fungal pathogens, like switchgrass rust, have the potential to significantly reduce switchgrass biomass yield. Despite its importance as a prominent ...

Identification and distribution of the NBS-LRR gene family in the cassava genome

USDA-ARS?s Scientific Manuscript database

Plant resistance genes (R genes) exist in large families and usually contain both a nucleotide-binding site domain and a leucine-rich repeat domain, denoted NBS-LRR. The genome sequence of cassava (Manihot esculenta) is a valuable resource for analyzing the genomic organization of resistance genes i...

Structure- and Modeling-based Identification of the Adenovirus E4orf4 Binding Site in the Protein Phosphatase 2A B55α Subunit*

PubMed Central

Horowitz, Ben; Sharf, Rakefet; Avital-Shacham, Meirav; Pechkovsky, Antonina; Kleinberger, Tamar

2013-01-01

The adenovirus E4orf4 protein regulates the progression of viral infection and when expressed outside the context of the virus it induces nonclassical, cancer cell-specific apoptosis. All E4orf4 functions known to date require an interaction between E4orf4 and protein phosphatase 2A (PP2A), which is mediated through PP2A regulatory B subunits. Specifically, an interaction with the B55α subunit is required for induction of cell death by E4orf4. To gain a better insight into the E4orf4-PP2A interaction, mapping of the E4orf4 interaction site in PP2A-B55α has been undertaken. To this end we used a combination of bioinformatics analyses of PP2A-B55α and of E4orf4, which led to the prediction of E4orf4 binding sites on the surface of PP2A-B55α. Mutation analysis, immunoprecipitation, and GST pulldown assays based on the theoretical predictions revealed that the E4orf4 binding site included the α1 and α2 helices described in the B55α structure and involved at least three residues located in these helices facing each other. Loss of E4orf4 binding was accompanied by reduced contribution of the B55α mutants to E4orf4-induced cell death. The identified E4orf4 binding domain lies above the previously described substrate binding site and does not overlap it, although its location could be consistent with direct or indirect effects on substrate binding. This work assigns for the first time a functional significance to the α1,α2 helices of B55α, and we suggest that the binding site defined by these helices could also contribute to interactions between PP2A and some of its cellular regulators. PMID:23530045

The increased flexibility of CDR loops generated in antibodies by Congo red complexation favors antigen binding.

PubMed

Krol, Marcin; Roterman, Irena; Drozd, Anna; Konieczny, Leszek; Piekarska, Barbara; Rybarska, Janina; Spolnik, Paweł; Stopa, Barbara

2006-02-01

The dye Congo red and related self-assembling compounds were found to stabilize immune complexes by binding to antibodies currently engaged in complexation to antigen. In our simulations, it was shown that the site that becomes accessible for binding the supramolecular dye ligand is located in the V domain, and is normally occupied by the N-terminal polypeptide chain fragment. The binding of the ligand disrupts the beta-structure in the domain, increasing the plasticity of the antigen-binding site. The higher fluctuation of CDR-bearing loops enhances antigen binding, and allows even low-affinity antibodies to be engaged in immune complexes. Experimental observations of the enhancement effect were supported by theoretical studies using L lambda chain (4BJL-PDB identification) and the L chain from the complex of IgM-rheumatoid factor bound to the CH3 domain of the Fc fragment (1ADQ-PDB identification) as the initial structures for theoretical studies of dye-induced changes. Commercial IgM-type rheumatoid factor (human) and sheep red blood cells with coupled IgG (human) were used for experimental tests aimed to reveal the dye-enhancement effect in this system. The specificity of antigen-antibody interaction enhanced by dye binding was studied using rabbit anti-sheep red cell antibodies to agglutinate red cells of different species. Red blood cells of hoofed mammals (horse, goat) showed weak enhancement of agglutination in the presence of Congo red. Neither agglutination nor enhancement were observed in the case of human red cells. The dye-enhancement capability in the SRBC-antiSRBC system was lost after pepsin-digestion of antibodies producing (Fab)2 fragments still agglutinating red cells. Monoclonal (myeloma) IgG, L lambda chain and ovoalbumin failed to agglutinate red cells, as expected, and showed no enhancement effect. This indicates that the enhancement effect is specific.

Identification and Characterization of a Broadly Cross-Reactive HIV-1 Human Monoclonal Antibody That Binds to Both gp120 and gp41

PubMed Central

Zhang, Mei-Yun; Yuan, Tingting; Li, Jingjing; Rosa Borges, Andrew; Watkins, Jennifer D.; Guenaga, Javier; Yang, Zheng; Wang, Yanping; Wilson, Richard; Li, Yuxing; Polonis, Victoria R.; Pincus, Seth H.; Ruprecht, Ruth M.; Dimitrov, Dimiter S.

2012-01-01

Identification of broadly cross-reactive HIV-1-neutralizing antibodies (bnAbs) may assist vaccine immunogen design. Here we report a novel human monoclonal antibody (mAb), designated m43, which co-targets the gp120 and gp41 subunits of the HIV-1 envelope glycoprotein (Env). M43 bound to recombinant gp140 s from various primary isolates, to membrane-associated Envs on transfected cells and HIV-1 infected cells, as well as to recombinant gp120 s and gp41 fusion intermediate structures containing N-trimer structure, but did not bind to denatured recombinant gp140 s and the CD4 binding site (CD4bs) mutant, gp120 D368R, suggesting that the m43 epitope is conformational and overlaps the CD4bs on gp120 and the N-trimer structure on gp41. M43 neutralized 34% of the HIV-1 primary isolates from different clades and all the SHIVs tested in assays based on infection of peripheral blood mononuclear cells (PBMCs) by replication-competent virus, but was less potent in cell line-based pseudovirus assays. In contrast to CD4, m43 did not induce Env conformational changes upon binding leading to exposure of the coreceptor binding site, enhanced binding of mAbs 2F5 and 4E10 specific for the membrane proximal external region (MPER) of gp41 Envs, or increased gp120 shedding. The overall modest neutralization activity of m43 is likely due to the limited binding of m43 to functional Envs which could be increased by antibody engineering if needed. M43 may represent a new class of bnAbs targeting conformational epitopes overlapping structures on both gp120 and gp41. Its novel epitope and possibly new mechanism(s) of neutralization could helpdesign improved vaccine immunogens and candidate therapeutics. PMID:22970187

Synergism of virtual screening and medicinal chemistry: identification and optimization of allosteric antagonists of metabotropic glutamate receptor 1.

PubMed

Noeske, Tobias; Trifanova, Dina; Kauss, Valerjans; Renner, Steffen; Parsons, Christopher G; Schneider, Gisbert; Weil, Tanja

2009-08-01

We report the identification of novel potent and selective metabotropic glutamate receptor 1 (mGluR1) antagonists by virtual screening and subsequent hit optimization. For ligand-based virtual screening, molecules were represented by a topological pharmacophore descriptor (CATS-2D) and clustered by a self-organizing map (SOM). The most promising compounds were tested in mGluR1 functional and binding assays. We identified a potent chemotype exhibiting selective antagonistic activity at mGluR1 (functional IC(50)=0.74+/-0.29 microM). Hit optimization yielded lead structure 16 with an affinity of K(i)=0.024+/-0.001 microM and greater than 1000-fold selectivity for mGluR1 versus mGluR5. Homology-based receptor modelling suggests a binding site compatible with previously reported mutation studies. Our study demonstrates the usefulness of ligand-based virtual screening for scaffold-hopping and rapid lead structure identification in early drug discovery projects.

Genome-Wide Identification of Chromatin Transitional Regions Reveals Diverse Mechanisms Defining the Boundary of Facultative Heterochromatin

PubMed Central

Li, Guangyao; Zhou, Lei

2013-01-01

Due to the self-propagating nature of the heterochromatic modification H3K27me3, chromatin barrier activities are required to demarcate the boundary and prevent it from encroaching into euchromatic regions. Studies in Drosophila and vertebrate systems have revealed several important chromatin barrier elements and their respective binding factors. However, epigenomic data indicate that the binding of these factors are not exclusive to chromatin boundaries. To gain a comprehensive understanding of facultative heterochromatin boundaries, we developed a two-tiered method to identify the Chromatin Transitional Region (CTR), i.e. the nucleosomal region that shows the greatest transition rate of the H3K27me3 modification as revealed by ChIP-Seq. This approach was applied to identify CTRs in Drosophila S2 cells and human HeLa cells. Although many insulator proteins have been characterized in Drosophila, less than half of the CTRs in S2 cells are associated with known insulator proteins, indicating unknown mechanisms remain to be characterized. Our analysis also revealed that the peak binding of insulator proteins are usually 1–2 nucleosomes away from the CTR. Comparison of CTR-associated insulator protein binding sites vs. those in heterochromatic region revealed that boundary-associated binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significant decreased nucleosome density and increased binding intensities of co-factors. Interestingly, several subgroups of boundaries have enhanced H3.3 incorporation but reduced nucleosome turnover rate. Our genome-wide study reveals that diverse mechanisms are employed to define the boundaries of facultative heterochromatin. In both Drosophila and mammalian systems, only a small fraction of insulator protein binding sites co-localize with H3K27me3 boundaries. However, boundary-associated insulator binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significantly decreased nucleosome density and increased binding of co-factors. PMID:23840609

G-LoSA for Prediction of Protein-Ligand Binding Sites and Structures.

PubMed

Lee, Hui Sun; Im, Wonpil

2017-01-01

Recent advances in high-throughput structure determination and computational protein structure prediction have significantly enriched the universe of protein structure. However, there is still a large gap between the number of available protein structures and that of proteins with annotated function in high accuracy. Computational structure-based protein function prediction has emerged to reduce this knowledge gap. The identification of a ligand binding site and its structure is critical to the determination of a protein's molecular function. We present a computational methodology for predicting small molecule ligand binding site and ligand structure using G-LoSA, our protein local structure alignment and similarity measurement tool. All the computational procedures described here can be easily implemented using G-LoSA Toolkit, a package of standalone software programs and preprocessed PDB structure libraries. G-LoSA and G-LoSA Toolkit are freely available to academic users at http://compbio.lehigh.edu/GLoSA . We also illustrate a case study to show the potential of our template-based approach harnessing G-LoSA for protein function prediction.

Identification of natural and artificial DNA substrates for the light-activated LOV-HTH transcription factor EL222

PubMed Central

Rivera-Cancel, Giomar; Motta-Mena, Laura B.; Gardner, Kevin H.

2012-01-01

Light-oxygen-voltage (LOV) domains serve as the photosensory modules for a wide range of plant and bacterial proteins, conferring blue light dependent regulation to effector activities as diverse as enzymes and DNA binding. LOV domains can also be engineered into a variety of exogenous targets, enabling similar regulation for new protein-based reagents. Common to these proteins is the ability for LOV domains to reversibly form a photochemical adduct between an internal flavin chromophore and the surrounding protein, using this to trigger conformational changes that affect output activity. Using the Erythrobacter litoralis protein EL222 model system which links LOV regulation to a helix-turn-helix (HTH) DNA binding domain, we demonstrated that the LOV domain binds and inhibits the HTH domain in the dark, releasing these interactions upon illumination [Nash et al. (2011) Proc. Natl. Acad. Sci. USA 108, 9449–9454]. Here we combine genomic and in vitro selection approaches to identify optimal DNA binding sites for EL222. Within the bacterial host, we observe binding several genomic sites using a 12 bp sequence consensus that is also found by in vitro selection methods. Sequence-specific alterations in the DNA consensus reduce EL222-binding affinity in a manner consistent with the expected binding mode: a protein dimer binding to two repeats. Finally, we demonstrate the light-dependent activation of transcription of two genes adjacent to an EL222 binding site. Taken together, these results shed light on the native function of EL222 and provide useful reagents for further basic and applications research of this versatile protein. PMID:23205774

Identification and characterization of (/sup 3/H)-rauwolscine binding to alpha2-adrenoceptors in the canine saphenous vein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gout, B.

1988-01-01

The biochemical exploration of the alpha2-adrenergic receptors was investigated in the canine saphenous vein using the highly selective alpha2-adrenergic antagonist rauwolscine as a tritiated ligand. Following an enzymatic digestive pretreatment, the authors isolated a purified smooth muscle cell membranes fraction from saphenous veins in quantity sufficient to permit them to study the venous alpha2-adrenoreceptor content. The binding of tritiated rauwolscine was rapid, specific, saturable and reversible. The presence of high affinity sites with a density of binding Bmax of 125.2 /+ -/ 43.1 fmol/mg protein was demonstrated on a unique class of non interacting sites. The kinetically derived Kd wasmore » 1.28 nM, in good agreement with the value obtained from saturation isotherms. The pharmacological profile of these sites was assessed by the comparison of the potency of alpha-adrenergic agonists and antagonists to inhibit 1 nM (/sup 3/H)-rauwolscine. Their efficacy was respectively: rauwolscine > phentolamine > RX 781094 > clonidine >> prazosin > (-)-phenylephrine > (-)-noradrenaline. The results showed that (/sup 3/H)-rauwolscine bound specifically to sites in their membranal preparation, which had the pharmacological characteristics of the alpha2-adrenoceptors. The correlation between biochemical and pharmacological data revealed the usefulness of binding methods in the further study of adrenergic mechanisms in the canine saphenous vein.« less

Identification of protein–protein interfaces by decreased amide proton solvent accessibility

PubMed Central

Mandell, Jeffrey G.; Falick, Arnold M.; Komives, Elizabeth A.

1998-01-01

Matrix-assisted laser desorption ionization–time-of-flight mass spectrometry was used to identify peptic fragments from protein complexes that retained deuterium under hydrogen exchange conditions due to decreased solvent accessibility at the interface of the complex. Short deuteration times allowed preferential labeling of rapidly exchanging surface amides so that primarily solvent accessibility changes and not conformational changes were detected. A single mass spectrum of the peptic digest mixture was analyzed to determine the deuterium content of all proteolytic fragments of the protein. The protein–protein interface was reliably indicated by those peptides that retained more deuterons in the complex compared with control experiments in which only one protein was present. The method was used to identify the kinase inhibitor [PKI(5–24)] and ATP-binding sites in the cyclic-AMP-dependent protein kinase. Three overlapping peptides identified the ATP-binding site, three overlapping peptides identified the glycine-rich loop, and two peptides identified the PKI(5–24)-binding site. A complex of unknown structure also was analyzed, human α-thrombin bound to an 83-aa fragment of human thrombomodulin [TMEGF(4–5)]. Five peptides from thrombin showed significantly decreased solvent accessibility in the complex. Three peptides identified the anion-binding exosite I, confirming ligand competition experiments. Two peptides identified a new region of thrombin near the active site providing a potential mechanism of how thrombomodulin alters thrombin substrate specificity. PMID:9843953

Identification of Propofol Binding Sites in a Nicotinic Acetylcholine Receptor with a Photoreactive Propofol Analog*

PubMed Central

Jayakar, Selwyn S.; Dailey, William P.; Eckenhoff, Roderic G.; Cohen, Jonathan B.

2013-01-01

Propofol, a widely used intravenous general anesthetic, acts at anesthetic concentrations as a positive allosteric modulator of γ-aminobutyric acid type A receptors and at higher concentration as an inhibitor of nicotinic acetylcholine receptors (nAChRs). Here, we characterize propofol binding sites in a muscle-type nAChR by use of a photoreactive analog of propofol, 2-isopropyl-5-[3-(trifluoromethyl)-3H-diazirin-3-yl]phenol (AziPm). Based upon radioligand binding assays, AziPm stabilized the Torpedo nAChR in the resting state, whereas propofol stabilized the desensitized state. nAChR-rich membranes were photolabeled with [3H]AziPm, and labeled amino acids were identified by Edman degradation. [3H]AziPm binds at three sites within the nAChR transmembrane domain: (i) an intrasubunit site in the δ subunit helix bundle, photolabeling in the nAChR desensitized state (+agonist) δM2-18′ and two residues in δM1 (δPhe-232 and δCys-236); (ii) in the ion channel, photolabeling in the nAChR resting, closed channel state (−agonist) amino acids in the M2 helices (αM2-6′, βM2-6′ and -13′, and δM2-13′) that line the channel lumen (with photolabeling reduced by >90% in the desensitized state); and (iii) at the γ-α interface, photolabeling αM2-10′. Propofol enhanced [3H]AziPm photolabeling at αM2-10′. Propofol inhibited [3H]AziPm photolabeling within the δ subunit helix bundle at lower concentrations (IC50 = 40 μm) than it inhibited ion channel photolabeling (IC50 = 125 μm). These results identify for the first time a single intrasubunit propofol binding site in the nAChR transmembrane domain and suggest that this is the functionally relevant inhibitory binding site. PMID:23300078

Identification of novel target sites and an inhibitor of the dengue virus E protein.

PubMed

Yennamalli, Ragothaman; Subbarao, Naidu; Kampmann, Thorsten; McGeary, Ross P; Young, Paul R; Kobe, Bostjan

2009-06-01

Dengue and related flaviviruses represent a significant global health threat. The envelope glycoprotein E mediates virus attachment to a host cell and the subsequent fusion of viral and host cell membranes. The fusion process is driven by conformational changes in the E protein and is an essential step in the virus life cycle. In this study, we analyzed the pre-fusion and post-fusion structures of the dengue virus E protein to identify potential novel sites that could bind small molecules, which could interfere with the conformational transitions that mediate the fusion process. We used an in silico virtual screening approach combining three different docking algorithms (DOCK, GOLD and FlexX) to identify compounds that are likely to bind to these sites. Seven structurally diverse molecules were selected to test experimentally for inhibition of dengue virus propagation. The best compound showed an IC(50) in the micromolar range against dengue virus type 2.

Identification of novel target sites and an inhibitor of the dengue virus E protein

NASA Astrophysics Data System (ADS)

Yennamalli, Ragothaman; Subbarao, Naidu; Kampmann, Thorsten; McGeary, Ross P.; Young, Paul R.; Kobe, Bostjan

2009-06-01

Dengue and related flaviviruses represent a significant global health threat. The envelope glycoprotein E mediates virus attachment to a host cell and the subsequent fusion of viral and host cell membranes. The fusion process is driven by conformational changes in the E protein and is an essential step in the virus life cycle. In this study, we analyzed the pre-fusion and post-fusion structures of the dengue virus E protein to identify potential novel sites that could bind small molecules, which could interfere with the conformational transitions that mediate the fusion process. We used an in silico virtual screening approach combining three different docking algorithms (DOCK, GOLD and FlexX) to identify compounds that are likely to bind to these sites. Seven structurally diverse molecules were selected to test experimentally for inhibition of dengue virus propagation. The best compound showed an IC50 in the micromolar range against dengue virus type 2.

Identification of the components of a glycolytic enzyme metabolon on the human red blood cell membrane.

PubMed

Puchulu-Campanella, Estela; Chu, Haiyan; Anstee, David J; Galan, Jacob A; Tao, W Andy; Low, Philip S

2013-01-11

Glycolytic enzymes (GEs) have been shown to exist in multienzyme complexes on the inner surface of the human erythrocyte membrane. Because no protein other than band 3 has been found to interact with GEs, and because several GEs do not bind band 3, we decided to identify the additional membrane proteins that serve as docking sites for GE on the membrane. For this purpose, a method known as "label transfer" that employs a photoactivatable trifunctional cross-linking reagent to deliver a biotin from a derivatized GE to its binding partner on the membrane was used. Mass spectrometry analysis of membrane proteins that were biotinylated following rebinding and photoactivation of labeled GAPDH, aldolase, lactate dehydrogenase, and pyruvate kinase revealed not only the anticipated binding partner, band 3, but also the association of GEs with specific peptides in α- and β-spectrin, ankyrin, actin, p55, and protein 4.2. More importantly, the labeled GEs were also found to transfer biotin to other GEs in the complex, demonstrating for the first time that GEs also associate with each other in their membrane complexes. Surprisingly, a new GE binding site was repeatedly identified near the junction of the membrane-spanning and cytoplasmic domains of band 3, and this binding site was confirmed by direct binding studies. These results not only identify new components of the membrane-associated GE complexes but also provide molecular details on the specific peptides that form the interfacial contacts within each interaction.

Identification of the Components of a Glycolytic Enzyme Metabolon on the Human Red Blood Cell Membrane*

PubMed Central

Puchulu-Campanella, Estela; Chu, Haiyan; Anstee, David J.; Galan, Jacob A.; Tao, W. Andy; Low, Philip S.

2013-01-01

Glycolytic enzymes (GEs) have been shown to exist in multienzyme complexes on the inner surface of the human erythrocyte membrane. Because no protein other than band 3 has been found to interact with GEs, and because several GEs do not bind band 3, we decided to identify the additional membrane proteins that serve as docking sites for GE on the membrane. For this purpose, a method known as “label transfer” that employs a photoactivatable trifunctional cross-linking reagent to deliver a biotin from a derivatized GE to its binding partner on the membrane was used. Mass spectrometry analysis of membrane proteins that were biotinylated following rebinding and photoactivation of labeled GAPDH, aldolase, lactate dehydrogenase, and pyruvate kinase revealed not only the anticipated binding partner, band 3, but also the association of GEs with specific peptides in α- and β-spectrin, ankyrin, actin, p55, and protein 4.2. More importantly, the labeled GEs were also found to transfer biotin to other GEs in the complex, demonstrating for the first time that GEs also associate with each other in their membrane complexes. Surprisingly, a new GE binding site was repeatedly identified near the junction of the membrane-spanning and cytoplasmic domains of band 3, and this binding site was confirmed by direct binding studies. These results not only identify new components of the membrane-associated GE complexes but also provide molecular details on the specific peptides that form the interfacial contacts within each interaction. PMID:23150667

BiPPred: Combined sequence- and structure-based prediction of peptide binding to the Hsp70 chaperone BiP.

PubMed

Schneider, Markus; Rosam, Mathias; Glaser, Manuel; Patronov, Atanas; Shah, Harpreet; Back, Katrin Christiane; Daake, Marina Angelika; Buchner, Johannes; Antes, Iris

2016-10-01

Substrate binding to Hsp70 chaperones is involved in many biological processes, and the identification of potential substrates is important for a comprehensive understanding of these events. We present a multi-scale pipeline for an accurate, yet efficient prediction of peptides binding to the Hsp70 chaperone BiP by combining sequence-based prediction with molecular docking and MMPBSA calculations. First, we measured the binding of 15mer peptides from known substrate proteins of BiP by peptide array (PA) experiments and performed an accuracy assessment of the PA data by fluorescence anisotropy studies. Several sequence-based prediction models were fitted using this and other peptide binding data. A structure-based position-specific scoring matrix (SB-PSSM) derived solely from structural modeling data forms the core of all models. The matrix elements are based on a combination of binding energy estimations, molecular dynamics simulations, and analysis of the BiP binding site, which led to new insights into the peptide binding specificities of the chaperone. Using this SB-PSSM, peptide binders could be predicted with high selectivity even without training of the model on experimental data. Additional training further increased the prediction accuracies. Subsequent molecular docking (DynaDock) and MMGBSA/MMPBSA-based binding affinity estimations for predicted binders allowed the identification of the correct binding mode of the peptides as well as the calculation of nearly quantitative binding affinities. The general concept behind the developed multi-scale pipeline can readily be applied to other protein-peptide complexes with linearly bound peptides, for which sufficient experimental binding data for the training of classical sequence-based prediction models is not available. Proteins 2016; 84:1390-1407. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

PubMed Central

Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

2008-01-01

The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

Identification of potential leads against 4-hydroxytetrahydrodipicolinate synthase from Mycobacterium tuberculosis

PubMed Central

Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.

2016-01-01

4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards identification of more potent phyto-inhibitors. Molecular interaction studies were accomplished using three different tools to understand and establish the participation of active site residues as the key players in stabilizing the binding mode of ligands and target protein. The best phyto-compound deduced on the basis of binding affinity was further used as a template to make similarity scan across the PubChem Compound database (score > = 80 %) to get more divesred leads. In this search 5098 hits were obtained that further reduced to 262 after drug-likeness filtration. These phytochemicallike compounds were docked at the active site of DHDPS.Then, those hits selected from docking analysis that showing stronger binding and forming maximum H-bonds with the active site residues (Thr54, Thr55, Tyr143, Arg148 and Lys171). Finally, we predicted one phytochemical compound (SN00003544), two PubChem-compounds (CID41032023, CID54025334) akin to phytochemical molecule showing better interactions in comaprison of known inhibitors of target protein.These findings might be further useful to gain the structural insight into the designing of novel leads against DapA family. PMID:28293071

Identification of second arginine-glycine-aspartic acid motif of ovine vitronectin as the complement C9 binding site and its implication in bacterial infection.

PubMed

Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi

2017-02-01

Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Catalytic site identification—a web server to identify catalytic site structural matches throughout PDB

PubMed Central

Kirshner, Daniel A.; Nilmeier, Jerome P.; Lightstone, Felice C.

2013-01-01

The catalytic site identification web server provides the innovative capability to find structural matches to a user-specified catalytic site among all Protein Data Bank proteins rapidly (in less than a minute). The server also can examine a user-specified protein structure or model to identify structural matches to a library of catalytic sites. Finally, the server provides a database of pre-calculated matches between all Protein Data Bank proteins and the library of catalytic sites. The database has been used to derive a set of hypothesized novel enzymatic function annotations. In all cases, matches and putative binding sites (protein structure and surfaces) can be visualized interactively online. The website can be accessed at http://catsid.llnl.gov. PMID:23680785

MotifMark: Finding regulatory motifs in DNA sequences.

PubMed

Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D

2017-07-01

The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.

Degenerate Pax2 and Senseless binding motifs improve detection of low-affinity sites required for enhancer specificity

PubMed Central

Zandvakili, Arya; Campbell, Ian; Weirauch, Matthew T.

2018-01-01

Cells use thousands of regulatory sequences to recruit transcription factors (TFs) and produce specific transcriptional outcomes. Since TFs bind degenerate DNA sequences, discriminating functional TF binding sites (TFBSs) from background sequences represents a significant challenge. Here, we show that a Drosophila regulatory element that activates Epidermal Growth Factor signaling requires overlapping, low-affinity TFBSs for competing TFs (Pax2 and Senseless) to ensure cell- and segment-specific activity. Testing available TF binding models for Pax2 and Senseless, however, revealed variable accuracy in predicting such low-affinity TFBSs. To better define parameters that increase accuracy, we developed a method that systematically selects subsets of TFBSs based on predicted affinity to generate hundreds of position-weight matrices (PWMs). Counterintuitively, we found that degenerate PWMs produced from datasets depleted of high-affinity sequences were more accurate in identifying both low- and high-affinity TFBSs for the Pax2 and Senseless TFs. Taken together, these findings reveal how TFBS arrangement can be constrained by competition rather than cooperativity and that degenerate models of TF binding preferences can improve identification of biologically relevant low affinity TFBSs. PMID:29617378

Harmane and harmalan are bioactive components of classical clonidine-displacing substance.

PubMed

Parker, Christine A; Anderson, Neil J; Robinson, Emma S J; Price, Rhiannon; Tyacke, Robin J; Husbands, Stephen M; Dillon, Michael P; Eglen, Richard M; Hudson, Alan L; Nutt, David J; Crump, Matthew P; Crosby, John

2004-12-28

Elucidation of the structure of the endogenous ligand(s) for imidazoline binding sites, clonidine-displacing substance (CDS), has been a major goal for many years. Crude CDS from bovine lung was purified by reverse-phase high-pressure liquid chromatography. Electrospray mass spectrometry (ESMS) and nuclear magnetic resonance ((1)H NMR) analysis revealed the presence of L-tryptophan and 1-carboxy-1-methyltetrahydro-beta-carboline in the active CDS extract. Competition radioligand binding studies, however, failed to show displacement of specific [(3)H]clonidine binding to rat brain membranes for either compound. Further purification of the bovine lung extract allowed the isolation of the beta-carbolines harmane and harmalan as confirmed by ESMS, (1)H NMR, and comparison with synthetic standards. Both compounds exhibited a high (nanomolar) affinity for both type 1 and type 2 imidazoline binding sites, and the synthetic standards were shown to coelute with the active classical CDS extracts. We therefore propose that the beta-carbolines harmane and harmalan represent active components of classical CDS. The identification of these compounds will allow us to establish clear physiological roles for CDS.

Calpha methylation in molecular recognition. Application to substance P and the two neurokinin-1 receptor binding sites.

PubMed

Sagan, S; Lequin, O; Frank, F; Convert, O; Ayoub, M; Lavielle, S; Chassaing, G

2001-05-01

Two binding sites NK-1M (major, more abundant) and NK-1m (minor) are associated with the neurokinin-1 receptor. For the first time with a bioactive peptide, the Calpha methylation constraint, shown to be a helix stabiliser in model peptides, was systematically used to probe the molecular requirements of NK-1M and NK-1m binding sites and the previously postulated bioactive helical conformation of substance P (SP). Seven Calpha methylated analogues of the undecapeptide SP (from position 5-11) have been assayed for their affinities and their potencies to stimulate second messenger production. The consequences of Calpha methylation on the structure of SP have been analysed by circular dichroism and nuclear magnetic resonance combined with restrained molecular dynamics. The decreased potencies of six out of these seven Calpha methylated SP analogues do not allow the identification of any clear-cut differences in the structural requirements between the two binding sites. Strikingly, the most active analogue, [alphaMeMet5]SP, leads to variable subnanomolar affinity and potency when interacting with the NK-1m binding site. The conformational analyses show that the structural consequences associated with Calpha methylation of SP are sequence dependent. Moreover, a single Calpha methylation is not sufficient by itself to drastically stabilize a helical structure even pre-existing in solution, except when Gly9 is substituted by an alpha-aminoisobutyric acid. Furthermore, Calpha methylation of residues 5 and 6 of SP in the middle of the postulated helix does not stabilize, but decreases (to different extents) the stability of the helical structure previously observed in the 4-8 domain of other potent SP analogues.

Apigenin shows synergistic anticancer activity with curcumin by binding at different sites of tubulin.

PubMed

Choudhury, Diptiman; Ganguli, Arnab; Dastidar, Debabrata Ghosh; Acharya, Bipul R; Das, Amlan; Chakrabarti, Gopal

2013-06-01

Apigenin, a natural flavone, present in many plants sources, induced apoptosis and cell death in lung epithelium cancer (A549) cells with an IC50 value of 93.7 ± 3.7 μM for 48 h treatment. Target identification investigations using A549 cells and also in cell-free system demonstrated that apigenin depolymerized microtubules and inhibited reassembly of cold depolymerized microtubules of A549 cells. Again apigenin inhibited polymerization of purified tubulin with an IC50 value of 79.8 ± 2.4 μM. It bounds to tubulin in cell-free system and quenched the intrinsic fluorescence of tubulin in a concentration- and time-dependent manner. The interaction was temperature-dependent and kinetics of binding was biphasic in nature with binding rate constants of 11.5 × 10(-7) M(-1) s(-1) and 4.0 × 10(-9) M(-1) s(-1) for fast and slow phases at 37 °C, respectively. The stoichiometry of tubulin-apigenin binding was 1:1 and binding the binding constant (Kd) was 6.08 ± 0.096 μM. Interestingly, apigenin showed synergistic anti-cancer effect with another natural anti-tubulin agent curcumin. Apigenin and curcumin synergistically induced cell death and apoptosis and also blocked cell cycle progression at G2/M phase of A549 cells. The synergistic activity of apigenin and curcumin was also apparent from their strong depolymerizing effects on interphase microtubules and inhibitory effect of reassembly of cold depolymerized microtubules when used in combinations, indicating that these ligands bind to tubulin at different sites. In silico modeling suggested apigenin bounds at the interphase of α-β-subunit of tubulin. The binding site is 19 Å in distance from the previously predicted curcumin binding site. Binding studies with purified protein also showed both apigenin and curcumin can simultaneously bind to purified tubulin. Understanding the mechanism of synergistic effect of apigenin and curcumin could be helped to develop anti-cancer combination drugs from cheap and readily available nutraceuticals. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Identification of the hydrophobic strand in the A–B loop of leptin as major binding site III: implications for large-scale preparation of potent recombinant human and ovine leptin antagonists

PubMed Central

Niv-Spector, Leonora; Gonen-Berger, Dana; Gourdou, Isabelle; Biener, Eva; Gussakovsky, Eugene E.; Benomar, Yackir; Ramanujan, Krishnan V.; Taouis, Mohammed; Herman, Brian; Callebaut, Isabelle; Djiane, Jean; Gertler, Arieh

2005-01-01

Interaction of leptin with its receptors resembles that of interleukin-6 and granulocyte colony-stimulating factor, which interact with their receptors through binding sites I–III. Site III plays a pivotal role in receptors' dimerization or tetramerization and subsequent activation. Leptin's site III also mediates the formation of an active multimeric complex through its interaction with the IGD (immunoglobulin-like domain) of LEPRs (leptin receptors). Using a sensitive hydrophobic cluster analysis of leptin's and LEPR's sequences, we identified hydrophobic stretches in leptin's A–B loop (amino acids 39–42) and in the N-terminal end of LEPR's IGD (amino acids 325–328) that are predicted to participate in site III and to interact with each other in a β-sheet-like configuration. To verify this hypothesis, we prepared and purified to homogeneity (as verified by SDS/PAGE, gel filtration and reverse-phase chromatography) several alanine muteins of amino acids 39–42 in human and ovine leptins. CD analyses revealed that those mutations hardly affect the secondary structure. All muteins acted as true antagonists, i.e. they bound LEPR with an affinity similar to the wild-type hormone, had no agonistic activity and specifically inhibited leptin action in several leptin-responsive in vitro bioassays. Alanine mutagenesis of LEPR's IGD (amino acids 325–328) drastically reduced its biological but not binding activity, indicating the importance of this region for interaction with leptin's site III. FRET (fluorescence resonance energy transfer) microscopy experiments have documented that the transient FRET signalling occurring upon exposure to leptin results not from binding of the ligand, but from ligand-induced oligomerization of LEPRs mediated by leptin's site III. PMID:15952938

Cross-neutralizing human anti-poliovirus antibodies bind the recognition site for cellular receptor

PubMed Central

Chen, Zhaochun; Fischer, Elizabeth R.; Kouiavskaia, Diana; Hansen, Bryan T.; Ludtke, Steven J.; Bidzhieva, Bella; Makiya, Michelle; Agulto, Liane; Purcell, Robert H.; Chumakov, Konstantin

2013-01-01

Most structural information about poliovirus interaction with neutralizing antibodies was obtained in the 1980s in studies of mouse monoclonal antibodies. Recently we have isolated a number of human/chimpanzee anti-poliovirus antibodies and demonstrated that one of them, MAb A12, could neutralize polioviruses of both serotypes 1 and 2. This communication presents data on isolation of an additional cross-neutralizing antibody (F12) and identification of a previously unknown epitope on the surface of poliovirus virions. Epitope mapping was performed by sequencing of antibody-resistant mutants and by cryo-EM of complexes of virions with Fab fragments. The results have demonstrated that both cross-neutralizing antibodies bind the site located at the bottom of the canyon surrounding the fivefold axis of symmetry that was previously shown to interact with cellular poliovirus receptor CD155. However, the same antibody binds to serotypes 1 and 2 through different specific interactions. It was also shown to interact with type 3 poliovirus, albeit with about 10-fold lower affinity, insufficient for effective neutralization. Antibody interaction with the binding site of the cellular receptor may explain its broad reactivity and suggest that further screening or antibody engineering could lead to a universal antibody capable of neutralizing all three serotypes of poliovirus. PMID:24277851

Identification of key binding site residues of MCT1 for AR-C155858 reveals the molecular basis of its isoform selectivity.

PubMed

Nancolas, Bethany; Sessions, Richard B; Halestrap, Andrew P

2015-02-15

The proton-linked monocarboxylate transporters (MCTs) are required for lactic acid transport into and out of all mammalian cells. Thus, they play an essential role in tumour cells that are usually highly glycolytic and are promising targets for anti-cancer drugs. AR-C155858 is a potent MCT1 inhibitor (Ki ~2 nM) that also inhibits MCT2 when associated with basigin but not MCT4. Previous work [Ovens, M.J. et al. (2010) Biochem. J. 425, 523-530] revealed that AR-C155858 binding to MCT1 occurs from the intracellular side and involves transmembrane helices (TMs) 7-10. In the present paper, we generate a molecular model of MCT4 based on our previous models of MCT1 and identify residues in the intracellular substrate-binding cavity that differ significantly between MCT4 and MCT1/MCT2 and so might account for differences in inhibitor binding. We tested their involvement using site-directed mutagenesis (SDM) of MCT1 to change residues individually or in combination with their MCT4 equivalent and determined inhibitor sensitivity following expression in Xenopus oocytes. Phe360 and Ser364 were identified as important for AR-C155858 binding with the F360Y/S364G mutant exhibiting >100-fold reduction in inhibitor sensitivity. To refine the binding site further, we used molecular dynamics (MD) simulations and additional SDM. This approach implicated six more residues whose involvement was confirmed by both transport studies and [3H]-AR-C155858 binding to oocyte membranes. Taken together, our data imply that Asn147, Arg306 and Ser364 are important for directing AR-C155858 to its final binding site which involves interaction of the inhibitor with Lys38, Asp302 and Phe360 (residues that also play key roles in the translocation cycle) and also Leu274 and Ser278.

Identification of key binding site residues of MCT1 for AR-C155858 reveals the molecular basis of its isoform selectivity

PubMed Central

Nancolas, Bethany; Sessions, Richard B.; Halestrap, Andrew P.

2014-01-01

The proton-linked monocarboxylate transporters (MCTs) are required for lactic acid transport into and out of all mammalian cells. Thus, they play an essential role in tumour cells that are usually highly glycolytic and are promising targets for anti-cancer drugs. AR-C155858 is a potent MCT1 inhibitor (Ki ~2 nM) that also inhibits MCT2 when associated with basigin but not MCT4. Previous work [Ovens, M.J. et al. (2010) Biochem. J. 425, 523–530] revealed that AR-C155858 binding to MCT1 occurs from the intracellular side and involves transmembrane helices (TMs) 7–10. In the present paper, we generate a molecular model of MCT4 based on our previous models of MCT1 and identify residues in the intracellular substrate-binding cavity that differ significantly between MCT4 and MCT1/MCT2 and so might account for differences in inhibitor binding. We tested their involvement using site-directed mutagenesis (SDM) of MCT1 to change residues individually or in combination with their MCT4 equivalent and determined inhibitor sensitivity following expression in Xenopus oocytes. Phe360 and Ser364 were identified as important for AR-C155858 binding with the F360Y/S364G mutant exhibiting >100-fold reduction in inhibitor sensitivity. To refine the binding site further, we used molecular dynamics (MD) simulations and additional SDM. This approach implicated six more residues whose involvement was confirmed by both transport studies and [3H]-AR-C155858 binding to oocyte membranes. Taken together, our data imply that Asn147, Arg306 and Ser364 are important for directing AR-C155858 to its final binding site which involves interaction of the inhibitor with Lys38, Asp302 and Phe360 (residues that also play key roles in the translocation cycle) and also Leu274 and Ser278. PMID:25437897

Combining modelling and mutagenesis studies of synaptic vesicle protein 2A to identify a series of residues involved in racetam binding.

PubMed

Shi, Jiye; Anderson, Dina; Lynch, Berkley A; Castaigne, Jean-Gabriel; Foerch, Patrik; Lebon, Florence

2011-10-01

LEV (levetiracetam), an antiepileptic drug which possesses a unique profile in animal models of seizure and epilepsy, has as its unique binding site in brain, SV2A (synaptic vesicle protein 2A). Previous studies have used a chimaeric and site-specific mutagenesis approach to identify three residues in the putative tenth transmembrane helix of SV2A that, when mutated, alter binding of LEV and related racetam derivatives to SV2A. In the present paper, we report a combined modelling and mutagenesis study that successfully identifies another 11 residues in SV2A that appear to be involved in ligand binding. Sequence analysis and modelling of SV2A suggested residues equivalent to critical functional residues of other MFS (major facilitator superfamily) transporters. Alanine scanning of these and other SV2A residues resulted in the identification of residues affecting racetam binding, including Ile273 which differentiated between racetam analogues, when mutated to alanine. Integrating mutagenesis results with docking analysis led to the construction of a mutant in which six SV2A residues were replaced with corresponding SV2B residues. This mutant showed racetam ligand-binding affinity intermediate to the affinities observed for SV2A and SV2B.

Identification of differentially expressed genes affecting hair and cashmere growth in the Laiwu black goat by microarray.

PubMed

Zhao, Jinshan; Li, Hegang; Liu, Kaidong; Zhang, Baoxun; Li, Peipei; He, Jianning; Cheng, Ming; De, Wei; Liu, Jifeng; Zhao, Yaofeng; Yang, Lihua; Liu, Nan

2016-10-01

Goats are an important source of fibers. In the present study microarray technology was used to investigate the potential genes primarily involved in hair and cashmere growth in the Laiwu black goat. A total of 655 genes differentially expressed in body (hair‑growing) and groin (hairless) skin were identified, and their potential association with hair and cashmere growth was analyzed. The majority of genes associated with hair growth regulation could be assigned to intracellular, intracellular organelle, membrane‑bound vesicle, cytoplasmic vesicle, pattern binding, heparin binding, polysaccharide binding, glycosaminoglycan binding and cytoplasmic membrane‑bound vesicle categories. Numerous genes upregulated in body compared with groin skin contained common motifs for nuclear factor 1A, Yi, E2 factor (E2F) and cyclic adenosine monophosphate response element binding (CREB)/CREBβ binding sites in their promoter region. The promoter region of certain genes downregulated in body compared with groin skin contained three common regions with LF‑A1, Yi, E2F, Collier/Olfactory‑1/early B‑cell factor 1, peroxisome proliferator‑activated receptor α or U sites. Thus, the present study identified molecules in the cashmere‑bearing skin area of the Laiwu black goat, which may contribute to hair and cashmere traits.

Antigenic regions within the hepatitis C virus envelope 1 and non-structural proteins: identification of an IgG3-restricted recognition site with the envelope 1 protein.

PubMed Central

Sällberg, M; Rudén, U; Wahren, B; Magnius, L O

1993-01-01

Antibody binding to antigenic regions of hepatitis C virus (HCV) envelope 1 (E1; residues 183-380, E2/non-structural (NS) 1 (residues 380-437), NS1 (residues 643-690), and NS4 (1684-1751) proteins were assayed for 50 sera with antibodies to HCV (anti-HCV) and for 46 sera without anti-HCV. Thirty-four peptides, 18 residues long with an eight-amino acid overlap within each HCV region, were synthesized and tested with all 96 sera. Within the E region 183-380, the major binding site was located to residues 203-220, and was recognized by eight sera. Within the E2/NS1 region 380-437, the peptide covering residues 410-427 was recognized by two sera, and within the NS1 region 643-690, peptides covering residues 663-690 were recognized by four sera. Within the NS4 region 1684-1751, 27 sera were reactive to one or more of the NS4 peptides, and 21 out of these were reactive with peptide 1694-1711. One part of the major binding site could be located to residues 1701-1704, with the sequence Leu-Tyr-Arg-Glu. The IgG1, IgG3 and IgG4 subclasses were reactive with the five antigenic regions of HCV core, residues 1-18, 11-28, 21-38, 51-68 and 101-118. Reactivity to the major envelope site consisted almost exclusively of IgG3, and reactivity to the major site of NS4 consisted only of IgG1. Thus, a non-restricted IgG response to linear HCV-encoded binding sites was found to the core protein, whereas IgG subclass-restricted linear binding sites were found within the E1 protein, and within the NS4 protein. PMID:7680297

Structure of L-Xylulose-5-Phosphate 3-Epimerase (UlaE) from the Anaerobic L-Ascorbate Utilization Pathway of Escherichia coli: Identification of a Novel Phosphate Binding Motif within a TIM Barrel Fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Rong; Pineda, Marco; Ajamian, Eunice

2009-01-15

Three catabolic enzymes, UlaD, UlaE, and UlaF, are involved in a pathway leading to fermentation of L-ascorbate under anaerobic conditions. UlaD catalyzes a {beta}-keto acid decarboxylation reaction to produce L-xylulose-5-phosphate, which undergoes successive epimerization reactions with UlaE (L-xylulose-5-phosphate 3-epimerase) and UlaF (L-ribulose-5-phosphate 4-epimerase), yielding D-xylulose-5-phosphate, an intermediate in the pentose phosphate pathway. We describe here crystallographic studies of UlaE from Escherichia coli O157:H7 that complete the structural characterization of this pathway. UlaE has a triosephosphate isomerase (TIM) barrel fold and forms dimers. The active site is located at the C-terminal ends of the parallel {beta}-strands. The enzyme binds Zn{sup 2+},more » which is coordinated by Glu155, Asp185, His211, and Glu251. We identified a phosphate-binding site formed by residues from the {beta}1/{alpha}1 loop and {alpha}3' helix in the N-terminal region. This site differs from the well-characterized phosphate-binding motif found in several TIM barrel superfamilies that is located at strands {beta}7 and {beta}8. The intrinsic flexibility of the active site region is reflected by two different conformations of loops forming part of the substrate-binding site. Based on computational docking of the L-xylulose 5-phosphate substrate to UlaE and structural similarities of the active site of this enzyme to the active sites of other epimerases, a metal-dependent epimerization mechanism for UlaE is proposed, and Glu155 and Glu251 are implicated as catalytic residues. Mutation and activity measurements for structurally equivalent residues in related epimerases supported this mechanistic proposal.« less

Identification of two H3-histamine receptor subtypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

West, R.E. Jr.; Zweig, A.; Shih, N.Y.

The H3-histamine receptor provides feedback inhibition of histamine synthesis and release as well as inhibition of other neurotransmitter release. We have characterized this receptor by radioligand binding studies with the H3 agonist N alpha-(3H)methylhistamine ((3H)NAMHA). The results of (3H)NAMHA saturation binding and NAMHA inhibition of (3H)NAMHA binding were consistent with an apparently single class of receptors (KD = 0.37 nM, Bmax = 73 fmol/mg of protein) and competition assays with other agonists and the antagonists impromidine and dimaprit disclosed only a single class of sites. In contrast, inhibition of (3H)NAMHA binding by the specific high affinity H3 antagonist thioperamide revealedmore » two classes of sites (KiA = 5 nM, BmaxA = 30 fmol/mg of protein; KiB = 68 nM, BmaxB = 48 fmol/mg of protein). Burimamide, another antagonist that, like thioperamide, contains a thiourea group, likewise discriminated between two classes of sites. In addition to differences between some antagonist potencies for the two receptors, there is a differential guanine nucleotide sensitivity of the two. The affinity of the H3A receptor for (3H) NAMHA was reduced less than 2-fold, whereas (3H)NAMHA binding to the H3B receptor was undetectable in the presence of guanosine 5'-O-(3-thiotriphosphate). The distinction between H3A and H3B receptor subtypes, the former a high affinity and the latter a low affinity thioperamide site, draws support from published in vitro data.« less

Fluorescence spectroscopy approaches for the development of a real-time organophosphate detection system using an enzymatic sensor.

PubMed

Carullo, Paola; Cetrangolo, Giovanni Paolo; Mandrich, Luigi; Manco, Giuseppe; Febbraio, Ferdinando

2015-02-09

Organophosphates are organic substances that contain a phosphoryl or a thiophosphoryl bond. They are mainly used around the world as pesticides, but can also be used as chemical warfare agents. Their detection is normally entrusted to techniques like GC- and LC-MS that, although sensitive, do not allow their identification on site and in real time. We have approached their identification by exploiting the high-affinity binding of these compounds with the esterase 2 from Alicyclobacillus acidocaldarius. Using an in silico analysis to evaluate the binding affinities of the enzyme with organophosphate inhibitors, like paraoxon, and other organophosphate compounds, like parathion, chlorpyriphos, and other organophosphate thio-derivatives, we have designed fluorescence spectroscopy experiments to study the quenching of the tryptophan residues after esterase 2 binding with the organophosphate pesticides. The changes in the fluorescence signals permitted an immediate and quantitative identification of these compounds from nano- to picomolar concentrations. A fluorescence based polarity-sensitive probe (ANS) was also employed as a means to understand the extent of the interactions involved, as well as to explore other ways to detect organophosphate pesticides. Finally, we designed a framework for the development of a biosensor that exploits fluorescence technology in combination with a sensitive and very stable bio-receptor.

Inhibition of Non-ATG Translational Events in Cells via Covalent Small Molecules Targeting RNA.

PubMed

Yang, Wang-Yong; Wilson, Henry D; Velagapudi, Sai Pradeep; Disney, Matthew D

2015-04-29

One major class of disease-causing RNAs is expanded repeating transcripts. These RNAs cause diseases via multiple mechanisms, including: (i) gain-of-function, in which repeating RNAs bind and sequester proteins involved in RNA biogenesis and (ii) repeat associated non-ATG (RAN) translation, in which repeating transcripts are translated into toxic proteins without use of a canonical, AUG, start codon. Herein, we develop and study chemical probes that bind and react with an expanded r(CGG) repeat (r(CGG)(exp)) present in a 5' untranslated region that causes fragile X-associated tremor/ataxia syndrome (FXTAS). Reactive compounds bind to r(CGG)(exp) in cellulo as shown with Chem-CLIP-Map, an approach to map small molecule binding sites within RNAs in cells. Compounds also potently improve FXTAS-associated pre-mRNA splicing and RAN translational defects, while not affecting translation of the downstream open reading frame. In contrast, oligonucleotides affect both RAN and canonical translation when they bind to r(CGG)(exp), which is mechanistically traced to a decrease in polysome loading. Thus, designer small molecules that react with RNA targets can be used to profile the RNAs to which they bind in cells, including identification of binding sites, and can modulate several aspects of RNA-mediated disease pathology in a manner that may be more beneficial than oligonucleotides.

Evolution of the herpes thymidine kinase: identification and comparison of the equine herpesvirus 1 thymidine kinase gene reveals similarity to a cell-encoded thymidylate kinase.

PubMed Central

Robertson, G R; Whalley, J M

1988-01-01

We have identified the equine herpesvirus 1 (EHV-1) thymidine kinase gene (TK) by DNA-mediated transformation and by DNA sequencing. Alignment of the amino acid sequence of the EHV-1 TK with the TKs from 3 other herpesviruses revealed regions of homology, some of which correspond to the previously identified substrate binding sites, while others have as yet, no assigned function. In particular, the strict conservation of an aspartate within the proposed nucleoside binding site suggests a role in ATP binding for this residue. Comparison of 5 herpes TKs with the thymidylate kinase of yeast revealed significant similarity which was strongest in those regions important to catalytic activity of the herpes TKs, and, therefore we propose that the herpes TK may be derived from a cellular thymidylate kinase. The implications for the evolution of enzyme activities within a pathway of nucleotide metabolism are discussed. PMID:2849761

Bioinformatics approaches to predict target genes from transcription factor binding data.

PubMed

Essebier, Alexandra; Lamprecht, Marnie; Piper, Michael; Bodén, Mikael

2017-12-01

Transcription factors regulate gene expression and play an essential role in development by maintaining proliferative states, driving cellular differentiation and determining cell fate. Transcription factors are capable of regulating multiple genes over potentially long distances making target gene identification challenging. Currently available experimental approaches to detect distal interactions have multiple weaknesses that have motivated the development of computational approaches. Although an improvement over experimental approaches, existing computational approaches are still limited in their application, with different weaknesses depending on the approach. Here, we review computational approaches with a focus on data dependency, cell type specificity and usability. With the aim of identifying transcription factor target genes, we apply available approaches to typical transcription factor experimental datasets. We show that approaches are not always capable of annotating all transcription factor binding sites; binding sites should be treated disparately; and a combination of approaches can increase the biological relevance of the set of genes identified as targets. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of a CD4-Binding-Site Antibody to HIV that Evolved Near-Pan Neutralization Breadth

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Jinghe; Kang, Byong H.; Ishida, Elise

Detailed studies of the broadly neutralizing antibodies (bNAbs) that underlie the best available examples of the humoral immune response to HIV are providing important information for the development of therapies and prophylaxis for HIV-1 infection. Here, we report a CD4-binding site (CD4bs) antibody, named N6, that potently neutralized 98% of HIV-1 isolates, including 16 of 20 that were resistant to other members of its class. N6 evolved a mode of recognition such that its binding was not impacted by the loss of individual contacts across the immunoglobulin heavy chain. In addition, structural analysis revealed that the orientation of N6 permittedmore » it to avoid steric clashes with glycans, which is a common mechanism of resistance. Thus, an HIV-1-specific bNAb can achieve potent, near-pan neutralization of HIV-1, making it an attractive candidate for use in therapy and prophylaxis.« less

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

PubMed Central

Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

2011-01-01

Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

The Enzymatic and Structural Basis for Inhibition of Echinococcus granulosus Thioredoxin Glutathione Reductase by Gold(I).

PubMed

Salinas, Gustavo; Gao, Wei; Wang, Yang; Bonilla, Mariana; Yu, Long; Novikov, Andrey; Virginio, Veridiana G; Ferreira, Henrique B; Vieites, Marisol; Gladyshev, Vadim N; Gambino, Dinorah; Dai, Shaodong

2017-12-20

New drugs are needed to treat flatworm infections that cause severe human diseases such as schistosomiasis. The unique flatworm enzyme thioredoxin glutathione reductase (TGR), structurally different from the human enzyme, is a key drug target. Structural studies of the flatworm Echinococcus granulosus TGR, free and complexed with Au I -MPO, a novel gold inhibitor, together with inhibition assays were performed. Au I -MPO is a potent TGR inhibitor that achieves 75% inhibition at a 1:1 TGR:Au ratio and efficiently kills E. granulosus in vitro. The structures revealed salient insights: (i) unique monomer-monomer interactions, (ii) distinct binding sites for thioredoxin and the glutaredoxin (Grx) domain, (iii) a single glutathione disulfide reduction site in the Grx domain, (iv) rotation of the Grx domain toward the Sec-containing redox active site, and (v) a single gold atom bound to Cys 519 and Cys 573 in the Au I -TGR complex. Structural modeling suggests that these residues are involved in the stabilization of the Sec-containing C-terminus. Consistently, Cys→Ser mutations in these residues decreased TGR activities. Mass spectroscopy confirmed these cysteines are the primary binding site. The identification of a primary site for gold binding and the structural model provide a basis for gold compound optimization through scaffold adjustments. The structural study revealed that TGR functions are achieved not only through a mobile Sec-containing redox center but also by rotation of the Grx domain and distinct binding sites for Grx domain and thioredoxin. The conserved Cys 519 and Cys 573 residues targeted by gold assist catalysis through stabilization of the Sec-containing redox center. Antioxid. Redox Signal. 27, 1491-1504.

The Enzymatic and Structural Basis for Inhibition of Echinococcus granulosus Thioredoxin Glutathione Reductase by Gold(I)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salinas, Gustavo; Gao, Wei; Wang, Yang

Aims: New drugs are needed to treat flatworm infections that cause severe human diseases such as schistosomiasis. The unique flatworm enzyme thioredoxin glutathione reductase (TGR), structurally different from the human enzyme, is a key drug target. Structural studies of the flatworm Echinococcus granulosus TGR, free and complexed with AuI-MPO, a novel gold inhibitor, together with inhibition assays were performed. Results: AuI-MPO is a potent TGR inhibitor that achieves 75% inhibition at a 1:1 TGR:Au ratio and efficiently kills E. granulosus in vitro. The structures revealed salient insights: (i) unique monomer–monomer interactions, (ii) distinct binding sites for thioredoxin and the glutaredoxinmore » (Grx) domain, (iii) a single glutathione disulfide reduction site in the Grx domain, (iv) rotation of the Grx domain toward the Sec-containing redox active site, and (v) a single gold atom bound to Cys519 and Cys573 in the AuI-TGR complex. Structural modeling suggests that these residues are involved in the stabilization of the Sec-containing C-terminus. Consistently, Cys→Ser mutations in these residues decreased TGR activities. Mass spectroscopy confirmed these cysteines are the primary binding site. Innovation: The identification of a primary site for gold binding and the structural model provide a basis for gold compound optimization through scaffold adjustments. Conclusions: The structural study revealed that TGR functions are achieved not only through a mobile Sec-containing redox center but also by rotation of the Grx domain and distinct binding sites for Grx domain and thioredoxin. The conserved Cys519 and Cys573 residues targeted by gold assist catalysis through stabilization of the Sec-containing redox center. Antioxid. Redox Signal. 27, 1491–1504.« less

Hot-spot identification on a broad class of proteins and RNA suggest unifying principles of molecular recognition

PubMed Central

Kulp, John L.; Cloudsdale, Ian S.; Kulp, John L.

2017-01-01

Chemically diverse fragments tend to collectively bind at localized sites on proteins, which is a cornerstone of fragment-based techniques. A central question is how general are these strategies for predicting a wide variety of molecular interactions such as small molecule-protein, protein-protein and protein-nucleic acid for both experimental and computational methods. To address this issue, we recently proposed three governing principles, (1) accurate prediction of fragment-macromolecule binding free energy, (2) accurate prediction of water-macromolecule binding free energy, and (3) locating sites on a macromolecule that have high affinity for a diversity of fragments and low affinity for water. To test the generality of these concepts we used the computational technique of Simulated Annealing of Chemical Potential to design one small fragment to break the RecA-RecA protein-protein interaction and three fragments that inhibit peptide-deformylase via water-mediated multi-body interactions. Experiments confirm the predictions that 6-hydroxydopamine potently inhibits RecA and that PDF inhibition quantitatively tracks the water-mediated binding predictions. Additionally, the principles correctly predict the essential bound waters in HIV Protease, the surprisingly extensive binding site of elastase, the pinpoint location of electron transfer in dihydrofolate reductase, the HIV TAT-TAR protein-RNA interactions, and the MDM2-MDM4 differential binding to p53. The experimental confirmations of highly non-obvious predictions combined with the precise characterization of a broad range of known phenomena lend strong support to the generality of fragment-based methods for characterizing molecular recognition. PMID:28837642

Hot-spot identification on a broad class of proteins and RNA suggest unifying principles of molecular recognition.

PubMed

Kulp, John L; Cloudsdale, Ian S; Kulp, John L; Guarnieri, Frank

2017-01-01

Chemically diverse fragments tend to collectively bind at localized sites on proteins, which is a cornerstone of fragment-based techniques. A central question is how general are these strategies for predicting a wide variety of molecular interactions such as small molecule-protein, protein-protein and protein-nucleic acid for both experimental and computational methods. To address this issue, we recently proposed three governing principles, (1) accurate prediction of fragment-macromolecule binding free energy, (2) accurate prediction of water-macromolecule binding free energy, and (3) locating sites on a macromolecule that have high affinity for a diversity of fragments and low affinity for water. To test the generality of these concepts we used the computational technique of Simulated Annealing of Chemical Potential to design one small fragment to break the RecA-RecA protein-protein interaction and three fragments that inhibit peptide-deformylase via water-mediated multi-body interactions. Experiments confirm the predictions that 6-hydroxydopamine potently inhibits RecA and that PDF inhibition quantitatively tracks the water-mediated binding predictions. Additionally, the principles correctly predict the essential bound waters in HIV Protease, the surprisingly extensive binding site of elastase, the pinpoint location of electron transfer in dihydrofolate reductase, the HIV TAT-TAR protein-RNA interactions, and the MDM2-MDM4 differential binding to p53. The experimental confirmations of highly non-obvious predictions combined with the precise characterization of a broad range of known phenomena lend strong support to the generality of fragment-based methods for characterizing molecular recognition.

Photoaffinity labelling and solubilization on the central 5-HT1A receptor binding site.

PubMed

Gozlan, H; Emerit, M B; el Mestikawy, S; Cossery, J M; Marquet, A; Besselievre, R; Hamon, M

1987-01-01

Two complementary approaches, covalent labelling and solubilization, have been used to study the biochemical properties of the central 5-HT1A receptor binding site. We have first designed a photoaffinity ligand containing the structure of 8-OH-DPAT, a potent and specific agonist of 5-HT1A sites. Thus, 8-methoxy-2[N-n-propyl,N-3-(2-nitro-4-azido-phenyl)- aminopropyl]aminotetralin or 8-methoxy-3'-NAP-amino-PAT, was found to displace, in the dark, [3H]8-OH-DPAT from 5-HT1A sites in rat hippocampal membranes with an IC50 of 6.6 nM. Under two cumulative UV irradiations (366 nm, for 20 min at 4 degrees C), 8-methoxy-3-'-NAP-amino-PAT (30 nM) blocked irreversibly 55-60% of 5-HT1A binding sites. This blockade was specific of 5-HT1A sites since the other serotoninergic sites, 5-HT1B, 5-HT2 and also the presynaptic 5-HT3 sites were not affected by the treatment. In addition, the binding of [3H]Spiperone and [3H]7-OH-DPAT to striatal dopamine sites remained unchanged under similar photolysis conditions. The tritiated derivative of the photoaffinity ligand (92 Ci/mmol) was then synthesized for the identification of the covalently bound protein(s). SDS-PAGE of solubilized membranes irradiated in the presence of 20 nM 3H-8-methoxy-3'-NAP-amino-PAT allowed the detection of a 63 kD protein whose labelling appeared specific. Thus, 3H-incorporation into the 63 kD band could be prevented by microM concentrations of 5-HT, 8-OH-DPAT and other selective 5-HT1A ligands such as isapirone. In contrast, the 5-HT2 antagonist ketanserin, norepinephrine and dopamine-related ligands (including 7-OH-DPAT) were ineffective. Direct solubilization of 5-HT1A receptor binding sites was also attempted from rat hippocampal membranes. The best results were obtained using CHAPS (10 mM) plus NaCl (0.2 M), which led to 50% recovery of 5-HT1A sites in the 100,000 g supernatant. The pharmacological properties and sensitivity to N-ethyl-maleimide and GppNHp of soluble sites appeared near identical to those of membrane-bound 5-HT1A sites.

Studies of the Binding of Modest Modulators of the Human Enzyme, Sirtuin 6, by STD NMR.

PubMed

Bolívar, Beatriz E; Welch, John T

2017-05-18

Pyrazinamide (PZA), an essential constituent of short-course tuberculosis chemotherapy, binds weakly but selectively to Sirtuin 6 (SIRT6). Despite the structural similarities between nicotinamide (NAM), PZA, and pyrazinoic acid (POA), these inhibitors modulate SIRT6 by different mechanisms and through different binding sites, as suggested by saturation transfer difference (STD) NMR. Available experimental evidence, such as that derived from crystal structures and kinetic experiments, has been of only limited utility in elucidation of the mechanistic details of sirtuin inhibition by NAM or other inhibitors. For instance, crystallographic structural analysis of sirtuin binding sites does not help us understand important differences in binding affinities among sirtuins or capture details of such dynamic process. Hence, STD NMR was utilized throughout this study. Our results not only agreed with the binding kinetics experiments but also gave a qualitative insight into the binding process. The data presented herein suggested some details about the geometry of the binding epitopes of the ligands in solution with the apo- and holoenzyme. Recognition that SIRT6 is affected selectively by PZA, an established clinical agent, suggests that the rational development of more potent and selective NAM surrogates might be possible. These derivatives might be accessible by employing the malleability of this scaffold to assist in the identification by STD NMR of the motifs that interact with the apo- and holoenzymes in solution. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of an inducible regulator of c-myb expression during T-cell activation.

PubMed Central

Phan, S C; Feeley, B; Withers, D; Boxer, L M

1996-01-01

Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306

Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma

PubMed Central

Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong

2007-01-01

Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291

Identification of a unique IgG Fc binding site in human intestinal epithelium.

PubMed

Kobayashi, K; Blaser, M J; Brown, W R

1989-10-15

In experiments to determine whether serum antibodies in patients with Crohn's disease could be used as probes for detecting potentially etiologic Ag in the patients' tissues, we found that peroxidase (HRP)-labeled IgG from healthy persons, as well as from the patients, bound to normal colonic and small intestinal epithelium, mostly or entirely to goblet cells. The binding was due to a reaction involving the Fc region of IgG because HRP-labeled Fc fragments of IgG bound, but HRP-Fab, HRP-IgA, and HRP-bovine albumin did not, and because binding of HRP-IgG was inhibited competitively by unlabeled IgG or Fc fragments but not by IgG Fab fragments or IgA. These immunohistochemical results were confirmed by ELISA with microtiter wells coated with a sonicated homogenate from human colonocytes. The epithelial IgG Fc binding site was characterized by SDS-PAGE as consisting of a high Mr (greater than 200,000 Da) and a 78,000-Da component. It bound all four subclasses of human IgG and bound aggregated as well as monomeric IgG. It is distinct from known human Fc-gamma R by lack of recognition by mAb to those receptors and differences in affinity for various subclasses of human and murine IgG. This unique IgG Fc binding site might be involved in immunologic defense of the gut, perhaps by mediating reactions between foreign Ag and the contents of goblet cells.

Identification of the hot spot residues for pyridine derivative inhibitor CCT251455 and ATP substrate binding on monopolar spindle 1 (MPS1) kinase by molecular dynamic simulation.

PubMed

Chen, Kai; Duan, Wenxiu; Han, Qianqian; Sun, Xuan; Li, Wenqian; Hu, Shuangyun; Wan, Jiajia; Wu, Jiang; Ge, Yushu; Liu, Dan

2018-03-08

Protein kinase monopolar spindle 1 plays an important role in spindle assembly checkpoint at the onset of mitosis. Over expression of MPS1 correlated with a wide range of human tumors makes it an attractive target for finding an effective and specific inhibitor. In this work, we performed molecular dynamics simulations of protein MPS1 itself as well as protein bound systems with the inhibitor and natural substrate based on crystal structures. The reported orally bioavailable 1 h-pyrrolo [3,2-c] pyridine inhibitors of MPS1 maintained stable binding in the catalytic site, while natural substrate ATP could not stay. Comparative study of stability and flexibility of three systems reveals position shifting of β-sheet region within the catalytic site, which indicates inhibition mechanism was through stabilizing the β-sheet region. Binding free energies calculated with MM-GB/PBSA method shows different binding affinity for inhibitor and ATP. Finally, interactions between protein and inhibitor during molecular dynamic simulations were measured and counted. Residue Gly605 and Leu654 were suggested as important hot spots for stable binding of inhibitor by molecular dynamic simulation. Our results reveal an important position shifting within catalytic site for non-inhibited proteins. Together with hot spots found by molecular dynamic simulation, the results provide important information of inhibition mechanism and will be referenced for designing novel inhibitors.

CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells.

PubMed

Xia, Heng; Chen, Dong; Wu, Qijia; Wu, Gang; Zhou, Yanhong; Zhang, Yi; Zhang, Libin

2017-09-01

The current RIP-seq approach has been developed for the identification of genome-wide interaction between RNA binding protein (RBP) and the bound RNA transcripts, but still rarely for identifying its binding sites. In this study, we performed RIP-seq experiments in HeLa cells using a monoclonal antibody against CELF1. Mapping of the RIP-seq reads showed a biased distribution at the 3'UTR and intronic regions. A total of 15,285 and 1384 CELF1-specific sense and antisense peaks were identified using the ABLIRC software tool. Our bioinformatics analyses revealed that 5' and 3' splice site motifs and GU-rich motifs were highly enriched in the CELF1-bound peaks. Furthermore, transcriptome analyses revealed that alternative splicing was globally regulated by CELF1 in HeLa cells. For example, the inclusion of exon 16 of LMO7 gene, a marker gene of breast cancer, is positively regulated by CELF1. Taken together, we have shown that RIP-seq data can be used to decipher RBP binding sites and reveal an unexpected landscape of the genome-wide CELF1-RNA interactions in HeLa cells. In addition, we found that CELF1 globally regulates the alternative splicing by binding the exon-intron boundary in HeLa cells, which will deepen our understanding of the regulatory roles of CELF1 in the pre-mRNA splicing process. Copyright © 2017 Elsevier B.V. All rights reserved.

Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

PubMed

Kel, AlexanderE

2017-02-01

Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

Identification of ribozymes within a ribozyme library that efficiently cleave a long substrate RNA.

PubMed Central

Campbell, T B; Cech, T R

1995-01-01

Positions 2-6 of the substrate-binding internal guide sequence (IGS) of the L-21 Sca I form of the Tetrahymena thermophila intron were mutagenized to produce a GN5 IGS library. Ribozymes within the GN5 library capable of efficient cleavage of an 818-nt human immunodeficiency virus type 1 vif-vpr RNA, at 37 degrees C, were identified by ribozyme-catalyzed guanosine addition to the 3' cleavage product. Three ribozymes (IGS = GGGGCU, GGCUCC, and GUGGCU) within the GN5 library that actively cleaved the long substrate were characterized kinetically and compared to the wild-type ribozyme (GGAGGG) and two control ribozymes (GGAGUC and GGAGAU). The two control ribozymes have specific sites within the long substrate, but were not identified during screening of the library. Under single-turnover conditions, ribozymes GGGGCU, GGCUCC, and GUGGCU cleaved the 818-nt substrate 4- to 200-fold faster than control ribozymes. Short cognate substrates, which should be structureless and therefore accessible to ribozyme binding, were cleaved at similar rates by all ribozymes except GGGGCU, which showed a fourfold rate enhancement. The rate of cleavage of long relative to short substrate under single-turnover conditions suggests that GGCUCC and GUGGCU were identified because of accessibility to their specific cleavage sites within the long substrate (substrate-specific effects), whereas GGGGCU was identified because of an enhanced rate of substrate binding despite a less accessible site in the long substrate. Even though screening was performed with 100-fold excess substrate (relative to total ribozyme), the rate of multiple-turnover catalysis did not contribute to identification of trans-cleaving ribozymes in the GN5 library. PMID:7489519

Fine epitope signature of antibody neutralization breadth at the HIV-1 envelope CD4-binding site.

PubMed

Cheng, Hao D; Grimm, Sebastian K; Gilman, Morgan Sa; Gwom, Luc Christian; Sok, Devin; Sundling, Christopher; Donofrio, Gina; Hedestam, Gunilla B Karlsson; Bonsignori, Mattia; Haynes, Barton F; Lahey, Timothy P; Maro, Isaac; von Reyn, C Fordham; Gorny, Miroslaw K; Zolla-Pazner, Susan; Walker, Bruce D; Alter, Galit; Burton, Dennis R; Robb, Merlin L; Krebs, Shelly J; Seaman, Michael S; Bailey-Kellogg, Chris; Ackerman, Margaret E

2018-03-08

Major advances in donor identification, antigen probe design, and experimental methods to clone pathogen-specific antibodies have led to an exponential growth in the number of newly characterized broadly neutralizing antibodies (bnAbs) that recognize the HIV-1 envelope glycoprotein. Characterization of these bnAbs has defined new epitopes and novel modes of recognition that can result in potent neutralization of HIV-1. However, the translation of envelope recognition profiles in biophysical assays into an understanding of in vivo activity has lagged behind, and identification of subjects and mAbs with potent antiviral activity has remained reliant on empirical evaluation of neutralization potency and breadth. To begin to address this discrepancy between recombinant protein recognition and virus neutralization, we studied the fine epitope specificity of a panel of CD4-binding site (CD4bs) antibodies to define the molecular recognition features of functionally potent humoral responses targeting the HIV-1 envelope site bound by CD4. Whereas previous studies have used neutralization data and machine-learning methods to provide epitope maps, here, this approach was reversed, demonstrating that simple binding assays of fine epitope specificity can prospectively identify broadly neutralizing CD4bs-specific mAbs. Building on this result, we show that epitope mapping and prediction of neutralization breadth can also be accomplished in the assessment of polyclonal serum responses. Thus, this study identifies a set of CD4bs bnAb signature amino acid residues and demonstrates that sensitivity to mutations at signature positions is sufficient to predict neutralization breadth of polyclonal sera with a high degree of accuracy across cohorts and across clades.

Identification of the first small-molecule ligand of the neuronal receptor sortilin and structure determination of the receptor–ligand complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, Jacob Lauwring, E-mail: jla@mb.au.dk; Schrøder, Tenna Juul; Christensen, Søren

2014-02-01

The identification of the first small-molecule ligand of the neuronal receptor sortilin and structure determination of the receptor–ligand complex are reported. Sortilin is a type I membrane glycoprotein belonging to the vacuolar protein sorting 10 protein (Vps10p) family of sorting receptors and is most abundantly expressed in the central nervous system. Sortilin has emerged as a key player in the regulation of neuronal viability and has been implicated as a possible therapeutic target in a range of disorders. Here, the identification of AF40431, the first reported small-molecule ligand of sortilin, is reported. Crystals of the sortilin–AF40431 complex were obtained bymore » co-crystallization and the structure of the complex was solved to 2.7 Å resolution. AF40431 is bound in the neurotensin-binding site of sortilin, with the leucine moiety of AF40431 mimicking the binding mode of the C-terminal leucine of neurotensin and the 4-methylumbelliferone moiety of AF40431 forming π-stacking with a phenylalanine.« less

Capture and quality control mechanisms for ATP binding

PubMed Central

Li, Li; Martinis, Susan A.

2013-01-01

The catalytic events in members of the nucleotidylyl transferase superfamily are initiated by a millisecond binding of ATP in the active site. Through metadynamics simulations on a class I aminoacyl-tRNA synthetase (aaRSs), the largest group in the superfamily, we calculate the free energy landscape of ATP selection and binding. Mutagenesis studies and fluorescence spectroscopy validated the identification of the most populated intermediate states. The rapid first binding step involves formation of encounter complexes captured through a fly-casting mechanism that acts up on the triphosphate moiety of ATP. In the slower nucleoside binding step, a conserved histidine in the HxxH motif orients the incoming ATP through base-stacking interactions resulting in a deep minimum in the free energy surface. Mutation of this histidine significantly decreases the binding affinity measured experimentally and computationally. The metadynamics simulations further reveal an intermediate quality control state that the synthetases and most likely other members of the superfamily use to select ATP over other nucleoside triphosphates. PMID:23276298

Capture and quality control mechanisms for adenosine-5'-triphosphate binding.

PubMed

Li, Li; Martinis, Susan A; Luthey-Schulten, Zaida

2013-04-24

The catalytic events in members of the nucleotidylyl transferase superfamily are initiated by a millisecond binding of ATP in the active site. Through metadynamics simulations on a class I aminoacyl-tRNA synthetase (aaRSs), the largest group in the superfamily, we calculate the free energy landscape of ATP selection and binding. Mutagenesis studies and fluorescence spectroscopy validated the identification of the most populated intermediate states. The rapid first binding step involves formation of encounter complexes captured through a fly casting mechanism that acts upon the triphosphate moiety of ATP. In the slower nucleoside binding step, a conserved histidine in the HxxH motif orients the incoming ATP through base-stacking interactions resulting in a deep minimum in the free energy surface. Mutation of this histidine significantly decreases the binding affinity measured experimentally and computationally. The metadynamics simulations further reveal an intermediate quality control state that the synthetases and most likely other members of the superfamily use to select ATP over other nucleoside triphosphates.

Unraveling transcriptional control and cis-regulatory codes using the software suite GeneACT

PubMed Central

Cheung, Tom Hiu; Kwan, Yin Lam; Hamady, Micah; Liu, Xuedong

2006-01-01

Deciphering gene regulatory networks requires the systematic identification of functional cis-acting regulatory elements. We present a suite of web-based bioinformatics tools, called GeneACT , that can rapidly detect evolutionarily conserved transcription factor binding sites or microRNA target sites that are either unique or over-represented in differentially expressed genes from DNA microarray data. GeneACT provides graphic visualization and extraction of common regulatory sequence elements in the promoters and 3'-untranslated regions that are conserved across multiple mammalian species. PMID:17064417

Direct identification of the site of binding on the chaperone SecB for the amino terminus of the translocon motor SecA.

PubMed

Randall, Linda L; Henzl, Michael T

2010-06-01

Protein export mediated by the general secretory Sec system in Escherichia coli proceeds by a dynamic transfer of a precursor polypeptide from the chaperone SecB to the SecA ATPase motor of the translocon and subsequently into and through the channel of the membrane-embedded SecYEG heterotrimer. The complex between SecA and SecB is stabilized by several separate sites of contact. Here we have demonstrated directly an interaction between the N-terminal residues 2 through 11 of SecA and the C-terminal 13 residues of SecB by isothermal titration calorimetry and analytical sedimentation velocity centrifugation. We discuss the unusual binding properties of SecA and SecB in context of a model for transfer of the precursor along the pathway of export.

GRID-seq reveals the global RNA-chromatin interactome

PubMed Central

Li, Xiao; Zhou, Bing; Chen, Liang; Gou, Lan-Tao; Li, Hairi; Fu, Xiang-Dong

2017-01-01

Higher eukaryotic genomes are bound by a large number of coding and non-coding RNAs, but approaches to comprehensively map the identity and binding sites of these RNAs are lacking. Here we report a method to in situ capture global RNA interactions with DNA by deep sequencing (GRID-seq), which enables the comprehensive identification of the entire repertoire of chromatin-interacting RNAs and their respective binding sites. In human, mouse and Drosophila cells, we detected a large set of tissue-specific coding and non-coding RNAs that are bound to active promoters and enhancers, especially super-enhancers. Assuming that most mRNA-chromatin interactions indicate the physical proximity of a promoter and an enhancer, we constructed a three-dimensional global connectivity map of promoters and enhancers, revealing transcription activity-linked genomic interactions in the nucleus. PMID:28922346

Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H7.

PubMed

Zou, Ying; Duan, Nuo; Wu, Shijia; Shen, Mofei; Wang, Zhouping

2018-06-06

Enterohemorrhagic Escherichia coli O157:H7 ( E. coli O157:H7) is known as an important food-borne pathogen related to public health. In this study, aptamers which could bind to different stages of E. coli O157:H7 (adjustment phase, log phase, and stationary phase) with high affinity and specificity were obtained by the whole cell-SELEX method through 14 selection rounds including three counter-selection rounds. Altogether, 32 sequences were obtained, and nine families were classified to select the optimal aptamer. To analyze affinity and specificity by flow cytometer, an ssDNA aptamer named Apt-5 was picked out as the optimal aptamer that recognizes different stages of E. coli O157:H7 specifically with the K d value of 9.04 ± 2.80 nM. In addition, in order to study the binding mechanism, target bacteria were treated by proteinase K and trypsin, indicating that the specific binding site is not protein on the cell membrane. Furthermore, when we treated E. coli O157:H7 with EDTA, the result showed that the binding site might be lipopolysaccharide (LPS) on the outer membrane of E. coli O157:H7.

Purification and characterization of FBI-1, a cellular factor that binds to the human immunodeficiency virus type 1 inducer of short transcripts.

PubMed

Pessler, F; Pendergrast, P S; Hernandez, N

1997-07-01

The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes.

How allosteric control of Staphylococcus aureus penicillin binding protein 2a enables methicillin resistance and physiological function

PubMed Central

Otero, Lisandro H.; Rojas-Altuve, Alzoray; Llarrull, Leticia I.; Carrasco-López, Cesar; Kumarasiri, Malika; Lastochkin, Elena; Fishovitz, Jennifer; Dawley, Matthew; Hesek, Dusan; Lee, Mijoon; Johnson, Jarrod W.; Fisher, Jed F.; Chang, Mayland; Mobashery, Shahriar; Hermoso, Juan A.

2013-01-01

The expression of penicillin binding protein 2a (PBP2a) is the basis for the broad clinical resistance to the β-lactam antibiotics by methicillin-resistant Staphylococcus aureus (MRSA). The high-molecular mass penicillin binding proteins of bacteria catalyze in separate domains the transglycosylase and transpeptidase activities required for the biosynthesis of the peptidoglycan polymer that comprises the bacterial cell wall. In bacteria susceptible to β-lactam antibiotics, the transpeptidase activity of their penicillin binding proteins (PBPs) is lost as a result of irreversible acylation of an active site serine by the β-lactam antibiotics. In contrast, the PBP2a of MRSA is resistant to β-lactam acylation and successfully catalyzes the dd-transpeptidation reaction necessary to complete the cell wall. The inability to contain MRSA infection with β-lactam antibiotics is a continuing public health concern. We report herein the identification of an allosteric binding domain—a remarkable 60 Å distant from the dd-transpeptidase active site—discovered by crystallographic analysis of a soluble construct of PBP2a. When this allosteric site is occupied, a multiresidue conformational change culminates in the opening of the active site to permit substrate entry. This same crystallographic analysis also reveals the identity of three allosteric ligands: muramic acid (a saccharide component of the peptidoglycan), the cell wall peptidoglycan, and ceftaroline, a recently approved anti-MRSA β-lactam antibiotic. The ability of an anti-MRSA β-lactam antibiotic to stimulate allosteric opening of the active site, thus predisposing PBP2a to inactivation by a second β-lactam molecule, opens an unprecedented realm for β-lactam antibiotic structure-based design. PMID:24085846

Site-specific identification of heparan and chondroitin sulfate glycosaminoglycans in hybrid proteoglycans.

PubMed

Noborn, Fredrik; Gomez Toledo, Alejandro; Green, Anders; Nasir, Waqas; Sihlbom, Carina; Nilsson, Jonas; Larson, Göran

2016-10-03

Heparan sulfate (HS) and chondroitin sulfate (CS) are complex polysaccharides that regulate important biological pathways in virtually all metazoan organisms. The polysaccharides often display opposite effects on cell functions with HS and CS structural motifs presenting unique binding sites for specific ligands. Still, the mechanisms by which glycan biosynthesis generates complex HS and CS polysaccharides required for the regulation of mammalian physiology remain elusive. Here we present a glycoproteomic approach that identifies and differentiates between HS and CS attachment sites and provides identity to the core proteins. Glycopeptides were prepared from perlecan, a complex proteoglycan known to be substituted with both HS and CS chains, further digested with heparinase or chondroitinase ABC to reduce the HS and CS chain lengths respectively, and thereafter analyzed by nLC-MS/MS. This protocol enabled the identification of three consensus HS sites and one hybrid site, carrying either a HS or a CS chain. Inspection of the amino acid sequence at the hybrid attachment locus indicates that certain peptide motifs may encode for the chain type selection process. This analytical approach will become useful when addressing fundamental questions in basic biology specifically in elucidating the functional roles of site-specific glycosylations of proteoglycans.

Computer-assisted identification of novel small molecule inhibitors targeting GLUT1

NASA Astrophysics Data System (ADS)

Wan, Zhining; Li, Xin; Sun, Rong; Li, Yuanyuan; Wang, Xiaoyun; Li, Xinru; Rong, Li; Shi, Zheng; Bao, Jinku

2015-12-01

Glucose transporters (GLUTs) are the main carriers of glucose that facilitate the diffusion of glucose in mammalian cells, especially GLUT1. Notably, GLUT1 is a rate-limiting transporter for glucose uptake, and its overexpression is a common characteristic in most cancers. Thus, the inhibition of GLUT1 by novel small compounds to lower glucose levels for cancer cells has become an emerging strategy. Herein, we employed high-throughput screening approaches to identify potential inhibitors against the sugar-binding site of GLUT1. Firstly, molecular docking screening was launched against the specs products, and three molecules (ZINC19909927, ZINC19908826, and ZINC19815451) were selected as candidate GLUT1 inhibitors for further analysis. Then, taking the initial ligand β-NG as a reference, molecular dynamic (MD) simulations and molecular mechanics/generalized born surface area (MM/GBSA) method were applied to evaluate the binding stability and affinity of the three candidates towards GLUT1. Finally, we found that ZINC19909927 might have the highest affinity to occupy the binding site of GLUT1. Meanwhile, energy decomposition analysis identified several residues located in substrate-binding site that might provide clues for future inhibitor discovery towards GLUT1. Taken together, these results in our study may provide valuable information for identifying new inhibitors targeting GLUT1-mediated glucose transport and metabolism for cancer therapeutics.

Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2003-01-01

Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461

Structurally distinct toxicity inhibitors bind at common loci on β-amyloid fibril

PubMed Central

Keshet, Ben; Gray, Jeffrey J; Good, Theresa A

2010-01-01

The accumulation of aggregated β-Amyloid (Aβ) in the brain is a hallmark of Alzheimer's disease and is thought to play a role in the neurotoxicity associated with the disease. The mechanism by which Aβ aggregates induce toxicity is uncertain. Nonetheless, several small molecules have been found to interact with Aβ fibrils and to prevent their toxicity. In this paper we studied the binding of these known toxicity inhibitors to Aβ fibrils, as a means to explore surfaces or loci on Aβ aggregates that may be significant in the mechanism of action of these inhibitors. We believe knowledge of these binding loci will provide insight into surfaces on the Aβ fibrils important in Aβ biological activity. The program DOCK was used to computationally dock the inhibitors to an Aβ fibril. The inhibitors docked at two shared binding loci, near Lys28 and at the C-termini near Asn27 and Val39. The docking predictions were experimentally verified using lysine specific chemical modifications and Aβ fibrils mutated at Asn27. We found that both Congo red and Myricetin, despite being structurally different, bound at the same two sites. Additionally, our data suggests that three additional Aβ toxicity inhibitors may also bind in one of the sites. Identification of these common binding loci provides targets on the Aβ fibril surface that can be tested in the future for their role in Aβ biological activity. PMID:20882638

On the nature of cavities on protein surfaces: application to the identification of drug-binding sites.

PubMed

Nayal, Murad; Honig, Barry

2006-06-01

In this article we introduce a new method for the identification and the accurate characterization of protein surface cavities. The method is encoded in the program SCREEN (Surface Cavity REcognition and EvaluatioN). As a first test of the utility of our approach we used SCREEN to locate and analyze the surface cavities of a nonredundant set of 99 proteins cocrystallized with drugs. We find that this set of proteins has on average about 14 distinct cavities per protein. In all cases, a drug is bound at one (and sometimes more than one) of these cavities. Using cavity size alone as a criterion for predicting drug-binding sites yields a high balanced error rate of 15.7%, with only 71.7% coverage. Here we characterize each surface cavity by computing a comprehensive set of 408 physicochemical, structural, and geometric attributes. By applying modern machine learning techniques (Random Forests) we were able to develop a classifier that can identify drug-binding cavities with a balanced error rate of 7.2% and coverage of 88.9%. Only 18 of the 408 cavity attributes had a statistically significant role in the prediction. Of these 18 important attributes, almost all involved size and shape rather than physicochemical properties of the surface cavity. The implications of these results are discussed. A SCREEN Web server is available at http://interface.bioc.columbia.edu/screen. 2006 Wiley-Liss, Inc.

Hierarchy within the mammary STAT5-driven Wap super-enhancer

PubMed Central

Zeng, Xianke; Wang, Chaochen; Metser, Gil; Hennighausen, Lothar

2016-01-01

Super-enhancers comprise of dense transcription factor platforms highly enriched for active chromatin marks. A paucity of functional data led us to investigate their role in the mammary gland, an organ characterized by exceptional gene regulatory dynamics during pregnancy. ChIP-Seq for the master regulator STAT5, the glucocorticoid receptor, H3K27ac and MED1, identified 440 mammary-specific super-enhancers, half of which were associated with genes activated during pregnancy. We interrogated the Wap super-enhancer, generating mice carrying mutations in STAT5 binding sites within its three constituent enhancers. Individually, only the most distal site displayed significant enhancer activity. However, combinatorial mutations showed that the 1,000-fold gene induction relied on all enhancers. Disabling the binding sites of STAT5, NFIB and ELF5 in the proximal enhancer incapacitated the entire super-enhancer, suggesting an enhancer hierarchy. The identification of mammary-specific super-enhancers and the mechanistic exploration of the Wap locus provide insight into the complexity of cell-specific and hormone-regulated genes. PMID:27376239

Protein arginine deiminase 2 binds calcium in an ordered fashion: Implications for inhibitor design

DOE PAGES

Slade, Daniel J.; Fang, Pengfei; Dreyton, Christina J.; ...

2015-01-26

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ionsmore » that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs.« less

Protein Arginine Deiminase 2 Binds Calcium in an Ordered Fashion: Implications for Inhibitor Design

PubMed Central

2015-01-01

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ions that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs. PMID:25621824

Improve the prediction of RNA-binding residues using structural neighbours.

PubMed

Li, Quan; Cao, Zanxia; Liu, Haiyan

2010-03-01

The interactions between RNA-binding proteins (RBPs) with RNA play key roles in managing some of the cell's basic functions. The identification and prediction of RNA binding sites is important for understanding the RNA-binding mechanism. Computational approaches are being developed to predict RNA-binding residues based on the sequence- or structure-derived features. To achieve higher prediction accuracy, improvements on current prediction methods are necessary. We identified that the structural neighbors of RNA-binding and non-RNA-binding residues have different amino acid compositions. Combining this structure-derived feature with evolutionary (PSSM) and other structural information (secondary structure and solvent accessibility) significantly improves the predictions over existing methods. Using a multiple linear regression approach and 6-fold cross validation, our best model can achieve an overall correct rate of 87.8% and MCC of 0.47, with a specificity of 93.4%, correctly predict 52.4% of the RNA-binding residues for a dataset containing 107 non-homologous RNA-binding proteins. Compared with existing methods, including the amino acid compositions of structure neighbors lead to clearly improvement. A web server was developed for predicting RNA binding residues in a protein sequence (or structure),which is available at http://mcgill.3322.org/RNA/.

Analysis of sequencing data for probing RNA secondary structures and protein-RNA binding in studying posttranscriptional regulations.

PubMed

Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y

2016-11-01

High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Identification of gold sensing peptide by integrative proteomics and a bacterial two-component system

NASA Astrophysics Data System (ADS)

Ng, I.-Son; Yu, You-Jin; Yi, Ying-Chen; Tan, Shih-I.; Huang, Bo-Chuan; Han, Yin-Lung

2017-12-01

The proteomics strategy was utilized to analyze and identify the gold adsorption proteins from Tepidimonas fonticaldi AT-A2, due to its outstanding performance in gold-binding and recovery. The results showed that three small proteins, including histidine biosynthesis protein (HisIE), iron donor protein (CyaY) and hypothetical protein_65aa, have a higher ability to adsorb gold ions because of the negatively charged domains or metal binding sites. On the other hand, the Salmonella PmrA/PmrB two-component system first replaces the iron (III)-binding motif using the peptide sequence from hypothetical protein_65aa, and this is then used to reveal the sensing and responsiveness to gold metal ions, which is totally different from the performance of traditional gold binding peptide (GBP) on the crystals on the surface of gold (111). We have successfully demonstrated an integrative proteomics and bacterial two-component system to explore the novel gold binding peptide. Finally, the heterologous over-expression of gold binding peptide by E. coli and the equilibrium of binding capacity for Au(III) have been conducted.

EMSA Analysis of DNA Binding By Rgg Proteins

PubMed Central

LaSarre, Breah; Federle, Michael J.

2016-01-01

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004

EMSA Analysis of DNA Binding By Rgg Proteins.

PubMed

LaSarre, Breah; Federle, Michael J

2013-08-20

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).

Proteasome subunit Rpn13 is a novel ubiquitin receptor

PubMed Central

Husnjak, Koraljka; Elsasser, Suzanne; Zhang, Naixia; Chen, Xiang; Randles, Leah; Shi, Yuan; Hofmann, Kay; Walters, Kylie; Finley, Daniel; Dikic, Ivan

2010-01-01

Proteasomal receptors that recognize ubiquitin chains attached to substrates are key mediators of selective protein degradation in eukaryotes. Here we report the identification of a new ubiquitin receptor, Rpn13/ARM1, a known component of the proteasome. Rpn13 binds ubiquitin via a conserved N-terminal region termed the Pru domain (Pleckstrin-like receptor for ubiquitin), which binds K48-linked diubiquitin with an affinity of ∼90 nM. Like proteasomal ubiquitin receptor Rpn10/S5a, Rpn13 also binds ubiquitin-like domains of the UBL/UBA family of ubiquitin receptors. A synthetic phenotype results in yeast when specific mutations of the ubiquitin binding sites of Rpn10 and Rpn13 are combined, indicating functional linkage between these ubiquitin receptors. Since Rpn13 is also the proteasomal receptor for Uch37, a deubiquitinating enzyme, our findings suggest a coupling of chain recognition and disassembly at the proteasome. PMID:18497817

The Role of Genome Accessibility in Transcription Factor Binding in Bacteria.

PubMed

Gomes, Antonio L C; Wang, Harris H

2016-04-01

ChIP-seq enables genome-scale identification of regulatory regions that govern gene expression. However, the biological insights generated from ChIP-seq analysis have been limited to predictions of binding sites and cooperative interactions. Furthermore, ChIP-seq data often poorly correlate with in vitro measurements or predicted motifs, highlighting that binding affinity alone is insufficient to explain transcription factor (TF)-binding in vivo. One possibility is that binding sites are not equally accessible across the genome. A more comprehensive biophysical representation of TF-binding is required to improve our ability to understand, predict, and alter gene expression. Here, we show that genome accessibility is a key parameter that impacts TF-binding in bacteria. We developed a thermodynamic model that parameterizes ChIP-seq coverage in terms of genome accessibility and binding affinity. The role of genome accessibility is validated using a large-scale ChIP-seq dataset of the M. tuberculosis regulatory network. We find that accounting for genome accessibility led to a model that explains 63% of the ChIP-seq profile variance, while a model based in motif score alone explains only 35% of the variance. Moreover, our framework enables de novo ChIP-seq peak prediction and is useful for inferring TF-binding peaks in new experimental conditions by reducing the need for additional experiments. We observe that the genome is more accessible in intergenic regions, and that increased accessibility is positively correlated with gene expression and anti-correlated with distance to the origin of replication. Our biophysically motivated model provides a more comprehensive description of TF-binding in vivo from first principles towards a better representation of gene regulation in silico, with promising applications in systems biology.

The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response.

PubMed

Erill, Ivan; Campoy, Susana; Kılıç, Sefa; Barbé, Jordi

2016-01-01

The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division, and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

Supramolecular interaction of 6-shogaol, a therapeutic agent of Zingiber officinale with human serum albumin as elucidated by spectroscopic, calorimetric and molecular docking methods.

PubMed

Feroz, S R; Mohamad, S B; Lee, G S; Malek, S N A; Tayyab, S

2015-06-01

6-Shogaol, one of the main bioactive constituents of Zingiber officinale has been shown to possess various therapeutic properties. Interaction of a therapeutic compound with plasma proteins greatly affects its pharmacokinetic and pharmacodynamic properties. The present investigation was undertaken to characterize the interaction between 6-shogaol and the main in vivo transporter, human serum albumin (HSA). Various binding characteristics of 6-shogaol-HSA interaction were studied using fluorescence spectroscopy. Thermal stability of 6-shogaol-HSA system was determined by circular dichroism (CD) and differential scanning calorimetric (DSC) techniques. Identification of the 6-shogaol binding site on HSA was made by competitive drug displacement and molecular docking experiments. Fluorescence quench titration results revealed the association constant, Ka of 6-shogaol-HSA interaction as 6.29 ± 0.33 × 10(4) M(-1) at 25 ºC. Values of the enthalpy change (-11.76 kJ mol(-1)) and the entropy change (52.52 J mol(-1) K(-1)), obtained for the binding reaction suggested involvement of hydrophobic and van der Waals forces along with hydrogen bonds in the complex formation. Higher thermal stability of HSA was noticed in the presence of 6-shogaol, as revealed by DSC and thermal denaturation profiles. Competitive ligand displacement experiments along with molecular docking results suggested the binding preference of 6-shogaol for Sudlow's site I of HSA. All these results suggest that 6-shogaol binds to Sudlow's site I of HSA through moderate binding affinity and involves hydrophobic and van der Waals forces along with hydrogen bonds. Copyright © 2015 Elsevier GmbH. All rights reserved.

Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

PubMed

Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

PubMed Central

Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

Hybrid In Silico/In Vitro Approaches for the Identification of Functional Cholesterol-Binding Domains in Membrane Proteins.

PubMed

Di Scala, Coralie; Fantini, Jacques

2017-01-01

In eukaryotic cells, cholesterol is an important regulator of a broad range of membrane proteins, including receptors, transporters, and ion channels. Understanding how cholesterol interacts with membrane proteins is a difficult task because structural data of these proteins complexed with cholesterol are scarce. Here, we describe a dual approach based on in silico studies of protein-cholesterol interactions, combined with physico-chemical measurements of protein insertion into cholesterol-containing monolayers. Our algorithm is validated through careful analysis of the effect of key mutations within and outside the predicted cholesterol-binding site. Our method is illustrated by a complete analysis of cholesterol-binding to Alzheimer's β-amyloid peptide, a protein that penetrates the plasma membrane of brain cells through a cholesterol-dependent process.

Innate immunity in rice

PubMed Central

Chen, Xuewei; Ronald, Pamela C.

2011-01-01

Advances in studies of rice innate immunity have led to the identification and characterization of host sensors encoding receptor kinases that perceive conserved microbial signatures. The non-RD domain, a newly recognized hallmark of these receptor kinases is highly expanded in rice (Oryza sativa) compared with Arabidopsis (Arabidopsis thaliana). Researchers have also identified a diverse array of microbial effectors from bacterial and fungal pathogens that triggers immune responses upon perception. These include both, effectors that indirectly target host Nucleotide binding site/Leucine rice repeat (NBS-LRR) proteins and transcription activator-like (TAL) effectors that directly bind promoters of host genes. Here we review the recognition and signaling events that govern rice innate immunity. PMID:21602092

[Protein S3 fragments neighboring mRNA during elongation and translation termination on the human ribosome].

PubMed

Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'yaminova, A G; Frolova, L Iu; Stahl, J; Karpova, G G

2008-01-01

Protein S3 fragments were determined that crosslink to modified mRNA analogues in positions +5 to +12 relative to the first nucleotide in the P-site binding codon in model complexes mimicking states of ribosomes at the elongation and translation termination steps. The mRNA analogues contained a Phe codon UUU/UUC at the 5'-termini that could predetermine the position of the tRNA(Phe) on the ribosome by the location of P-site binding and perfluorophenylazidobenzoyl group at a nucleotide in various positions 3' of the UUU/UUC codon. The crosslinked S3 protein was isolated from 80S ribosomal complexes irradiated with mild UV light and subjected to cyanogen bromide-induced cleavage at methionine residues with subsequent identification of the crosslinked oligopeptides. An analysis of the positions of modified oligopeptides resulting from the cleavage showed that, in dependence on the positions of modified nucleotides in the mRNA analogue, the crosslinking sites were found in the N-terminal half of the protein (fragment 2-127) and/or in the C-terminal fragment 190-236; the latter reflects a new peculiarity in the structure of the mRNA binding center in the ribosome, unknown to date. The results of crosslinking did not depend on the type of A-site codon or on the presence of translation termination factor eRF1.

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

Probing the substrate specificity of Golgi alpha-mannosidase II by use of synthetic oligosaccharides and a catalytic nucleophile mutant.

PubMed

Zhong, Wei; Kuntz, Douglas A; Ember, Brian; Singh, Harminder; Moremen, Kelley W; Rose, David R; Boons, Geert-Jan

2008-07-16

Inhibition of Golgi alpha-mannosidase II (GMII), which acts late in the N-glycan processing pathway, provides a route to blocking cancer-induced changes in cell surface oligosaccharide structures. To probe the substrate requirements of GMII, oligosaccharides were synthesized that contained an alpha(1,3)- or alpha(1,6)-linked 1-thiomannoside. Surprisingly, these oligosaccharides were not observed in X-ray crystal structures of native Drosophila GMII (dGMII). However, a mutant enzyme in which the catalytic nucleophilic aspartate was changed to alanine (D204A) allowed visualization of soaked oligosaccharides and led to the identification of the binding site for the alpha(1,3)-linked mannoside of the natural substrate. These studies also indicate that the conformational change of the bound mannoside to a high-energy B 2,5 conformation is facilitated by steric hindrance from, and the formation of strong hydrogen bonds to, Asp204. The observation that 1-thio-linked mannosides are not well tolerated by the catalytic site of dGMII led to the synthesis of a pentasaccharide containing the alpha(1,6)-linked Man of the natural substrate and the beta(1,2)-linked GlcNAc moiety proposed to be accommodated by the extended binding site of the enzyme. A cocrystal structure of this compound with the D204A enzyme revealed the molecular interactions with the beta(1,2)-linked GlcNAc. The structure is consistent with the approximately 80-fold preference of dGMII for the cleavage of substrates containing a nonreducing beta(1,2)-linked GlcNAc. By contrast, the lysosomal mannosidase lacks an equivalent GlcNAc binding site and kinetic analysis indicates oligomannoside substrates without non-reducing-terminal GlcNAc modifications are preferred, suggesting that selective inhibitors for GMII could exploit the additional binding specificity of the GlcNAc binding site.

Binding of extracellular matrix proteins to Aspergillus fumigatus conidia.

PubMed Central

Gil, M L; Peñalver, M C; Lopez-Ribot, J L; O'Connor, J E; Martinez, J P

1996-01-01

As detected by confocal immunofluorescence microscopy, binding of fibronectin and laminin appeared to be associated with the protrusions present on the outer cell wall layer of resting Aspergillus fumigatus conidia. Flow cytometry confirmed that binding of laminin to conidia was dose dependent and saturable. Laminin binding was virtually eliminated in trypsin-treated organisms, thus suggesting the protein nature of the binding site. Conidia were also able to specifically adhere to laminin immobilized on microtiter plates. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting (immunoblotting) with laminin and antilaminin antibody of whole conidial homogenates allowed identification, among the complex array of protein and glycoprotein species, of one polypeptide with an apparent molecular mass of 37 kDa which specifically interacts with laminin. The fact that binding of conidia to soluble or immobilized laminin or fibronectin was inhibited by fibronectin or laminin, respectively, suggests the existence of common binding sites for both ligands on the surface of conidia. Intact conidia were also able to adhere to type I and IV collagen immobilized on microtiter plates; adhesion was found to be dose dependent and saturable. Adhesion to immobilized type I and IV collagen was markedly inhibited by laminin and weakly inhibited by fibronectin. Coincubation of conidia with Arg-Gly-Asp (RGD) peptides caused a dose-dependent decrease in binding of cells to immobilized or soluble fibronectin, yet interaction of cells with soluble or immobilized laminin and type I and IV collagen remained unaffected. Interactions described here could be important in mediating attachment of the fungus to host tissues, thus playing a role in the establishment of the disease. PMID:8945572

Glycosaminoglycans are interactants of Langerin: comparison with gp120 highlights an unexpected calcium-independent binding mode.

PubMed

Chabrol, Eric; Nurisso, Alessandra; Daina, Antoine; Vassal-Stermann, Emilie; Thepaut, Michel; Girard, Eric; Vivès, Romain R; Fieschi, Franck

2012-01-01

Langerin is a C-type lectin specifically expressed in Langerhans cells. As recently shown for HIV, Langerin is thought to capture pathogens and mediate their internalisation into Birbeck Granules for elimination. However, the precise functions of Langerin remain elusive, mostly because of the lack of information on its binding properties and physiological ligands. Based on recent reports that Langerin binds to sulfated sugars, we conducted here a comparative analysis of Langerin interaction with mannose-rich HIV glycoprotein gp120 and glycosaminoglycan (GAGs), a family of sulfated polysaccharides expressed at the surface of most mammalian cells. Our results first revealed that Langerin bound to these different glycans through very distinct mechanisms and led to the identification of a novel, GAG-specific binding mode within Langerin. In contrast to the canonical lectin domain, this new binding site showed no Ca(2+)-dependency, and could only be detected in entire, trimeric extracellular domains of Langerin. Interestingly binding to GAGs, did not simply rely on a net charge effect, but rather on more discrete saccharide features, such as 6-O-sulfation, or iduronic acid content. Using molecular modelling simulations, we proposed a model of Langerin/heparin complex, which located the GAG binding site at the interface of two of the three Carbohydrate-recognition domains of the protein, at the edge of the a-helix coiled-coil. To our knowledge, the binding properties that we have highlighted here for Langerin, have never been reported for C-type lectins before. These findings provide new insights towards the understanding of Langerin biological functions.

Identification of C1q as a Binding Protein for Advanced Glycation End Products.

PubMed

Chikazawa, Miho; Shibata, Takahiro; Hatasa, Yukinori; Hirose, Sayumi; Otaki, Natsuki; Nakashima, Fumie; Ito, Mika; Machida, Sachiko; Maruyama, Shoichi; Uchida, Koji

2016-01-26

Advanced glycation end products (AGEs) make up a heterogeneous group of molecules formed from the nonenzymatic reaction of reducing sugars with the free amino groups of proteins. The abundance of AGEs in a variety of age-related diseases, including diabetic complications and atherosclerosis, and their pathophysiological effects suggest the existence of innate defense mechanisms. Here we examined the presence of serum proteins that are capable of binding glycated bovine serum albumin (AGEs-BSA), prepared upon incubation of BSA with dehydroascorbate, and identified complement component C1q subcomponent subunit A as a novel AGE-binding protein in human serum. A molecular interaction analysis showed the specific binding of C1q to the AGEs-BSA. In addition, we identified DNA-binding regions of C1q, including a collagen-like domain, as the AGE-binding site and established that the amount of positive charge on the binding site was the determining factor. C1q indeed recognized several other modified proteins, including acylated proteins, suggesting that the binding specificity of C1q might be ascribed, at least in part, to the electronegative potential of the ligand proteins. We also observed that C1q was involved in the AGEs-BSA-activated deposition of complement proteins, C3b and C4b. In addition, the AGEs-BSA mediated the proteolytic cleavage of complement protein 5 to release C5a. These findings provide the first evidence of AGEs as a new ligand recognized by C1q, stimulating the C1q-dependent classical complement pathway.

[Mechanism of action of neurotoxins acting on the inactivation of voltage-gated sodium channels].

PubMed

Benoit, E

1998-01-01

This review focuses on the mechanism(s) of action of neurotoxins acting on the inactivation of voltage-gated Na channels. Na channels are transmembrane proteins which are fundamental for cellular communication. These proteins form pores in the plasma membrane allowing passive ionic movements to occur. Their opening and closing are controlled by gating systems which depend on both membrane potential and time. Na channels have three functional properties, mainly studied using electrophysiological and biochemical techniques, to ensure their role in the generation and propagation of action potentials: 1) a highly selectivity for Na ions, 2) a rapid opening ("activation"), responsible for the depolarizing phase of the action potential, and 3) a late closing ("inactivation") involved in the repolarizing phase of the action potential. As an essential protein for membrane excitability, the Na channel is the specific target of a number of vegetal and animal toxins which, by binding to the channel, alter its activity by affecting one or more of its properties. At least six toxin receptor sites have been identified on the neuronal Na channel on the basis of binding studies. However, only toxins interacting with four of these sites (sites 2, 3, 5 et 6) produce alterations of channel inactivation. The maximal percentage of Na channels modified by the binding of neurotoxins to sites 2 (batrachotoxin and some alkaloids), 3 (alpha-scorpion and sea anemone toxins), 5 (brevetoxins and ciguatoxins) et 6 (delta-conotoxins) is different according to the site considered. However, in all cases, these channels do not inactivate. Moreover, Na channels modified by toxins which bind to sites 2, 5 and 6 activate at membrane potentials more negative than do unmodified channels. The physiological consequences of Na channel modifications, induced by the binding of neurotoxins to sites 2, 3, 5 and 6, are (i) an inhibition of cellular excitability due to an important membrane depolarization (site 2), (ii) a decrease of cellular excitability due to an important increase in the action potential duration (site 3) and (iii) an increase in cellular excitability which results in spontaneous and repetitive firing of action potentials (sites 5 and 6). The biochemical and electrophysiological studies performed with these toxins, as well as the determination of their molecular structure, have given basic information on the function and structure of the Na channel protein. Therefore, various models representing the different states of Na channels have been proposed to account for the neurotoxin-induced modifications of Na inactivation. Moreover, the localization of receptor binding sites 2, 3, 5 et 6 for these toxins on the neuronal Na channel has been deduced and the molecular identification of the recognition site(s) for some of them has been established on the alpha sub-unit forming the Na channel protein.

Identification of the RNA recognition element of the RBPMS family of RNA-binding proteins and their transcriptome-wide mRNA targets

PubMed Central

Farazi, Thalia A.; Leonhardt, Carl S.; Mukherjee, Neelanjan; Mihailovic, Aleksandra; Li, Song; Max, Klaas E.A.; Meyer, Cindy; Yamaji, Masashi; Cekan, Pavol; Jacobs, Nicholas C.; Gerstberger, Stefanie; Bognanni, Claudia; Larsson, Erik; Ohler, Uwe; Tuschl, Thomas

2014-01-01

Recent studies implicated the RNA-binding protein with multiple splicing (RBPMS) family of proteins in oocyte, retinal ganglion cell, heart, and gastrointestinal smooth muscle development. These RNA-binding proteins contain a single RNA recognition motif (RRM), and their targets and molecular function have not yet been identified. We defined transcriptome-wide RNA targets using photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) in HEK293 cells, revealing exonic mature and intronic pre-mRNA binding sites, in agreement with the nuclear and cytoplasmic localization of the proteins. Computational and biochemical approaches defined the RNA recognition element (RRE) as a tandem CAC trinucleotide motif separated by a variable spacer region. Similar to other mRNA-binding proteins, RBPMS family of proteins relocalized to cytoplasmic stress granules under oxidative stress conditions suggestive of a support function for mRNA localization in large and/or multinucleated cells where it is preferentially expressed. PMID:24860013

Positive allosteric modulators as an approach to nicotinic acetylcholine receptor- targeted therapeutics: advantages and limitations

PubMed Central

Williams, Dustin K.; Wang, Jingyi; Papke, Roger L.

2011-01-01

Neuronal nicotinic acetylcholine receptors (nAChR), recognized targets for drug development in cognitive and neuro-degenerative disorders, are allosteric proteins with dynamic interconversions between multiple functional states. Activation of the nAChR ion channel is primarily controlled by the binding of ligands (agonists, partial agonists, competitive antagonists) at conventional agonist binding sites, but is also regulated in either negative or positive ways by the binding of ligands to other modulatory sites. In this review, we discuss models for the activation and desensitization of nAChR, and the discovery of multiple types of ligands that influence those processes in both heteromeric nAChR, such as the high affinity nicotine receptors of the brain, and homomeric α7-type receptors. In recent years, α7 nAChRs have been identified as a potential target for therapeutic indications leading to the development of α7-selective agonists and partial agonists. However, unique properties of α7 nAChR, including low probability of channel opening and rapid desensitization, may limit the therapeutic usefulness of ligands binding exclusively to conventional agonist binding sites. New enthusiasm for the therapeutic targeting of α7 has come from the identification of α7-selective positive allosteric modulators (PAMs) that work effectively on the intrinsic factors that limit α7 ion channel activation. While these new drugs appear promising for therapeutic development, we also consider potential caveats and possible limitations for their use, including PAM-insensitive forms of desensitization and cytotoxicity issues. PMID:21575610

Positive allosteric modulators as an approach to nicotinic acetylcholine receptor-targeted therapeutics: advantages and limitations.

PubMed

Williams, Dustin K; Wang, Jingyi; Papke, Roger L

2011-10-15

Neuronal nicotinic acetylcholine receptors (nAChR), recognized targets for drug development in cognitive and neuro-degenerative disorders, are allosteric proteins with dynamic interconversions between multiple functional states. Activation of the nAChR ion channel is primarily controlled by the binding of ligands (agonists, partial agonists, competitive antagonists) at conventional agonist binding sites, but is also regulated in either negative or positive ways by the binding of ligands to other modulatory sites. In this review, we discuss models for the activation and desensitization of nAChR, and the discovery of multiple types of ligands that influence those processes in both heteromeric nAChR, such as the high-affinity nicotine receptors of the brain, and homomeric α7-type receptors. In recent years, α7 nAChRs have been identified as a potential target for therapeutic indications leading to the development of α7-selective agonists and partial agonists. However, unique properties of α7 nAChR, including low probability of channel opening and rapid desensitization, may limit the therapeutic usefulness of ligands binding exclusively to conventional agonist binding sites. New enthusiasm for the therapeutic targeting of α7 has come from the identification of α7-selective positive allosteric modulators (PAMs) that work effectively on the intrinsic factors that limit α7 ion channel activation. While these new drugs appear promising for therapeutic development, we also consider potential caveats and possible limitations for their use, including PAM-insensitive forms of desensitization and cytotoxicity issues. Copyright © 2011 Elsevier Inc. All rights reserved.

Ferrate oxidation of Escherichia coli DNA polymerase-I. Identification of a methionine residue that is essential for DNA binding.

PubMed

Basu, A; Williams, K R; Modak, M J

1987-07-15

Treatment of Escherichia coli DNA polymerase-I with potassium ferrate (K2FeO4), a site-specific oxidizing agent for the phosphate group-binding sites of proteins, results in the irreversible inactivation of enzyme activity as judged by the loss of polymerization as well as 3'-5' exonuclease activity. A significant protection from ferrate-mediated inactivation is observed in the presence of DNA but not by substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme also exhibits loss of template-primer binding activity, whereas its ability to bind substrate triphosphates is unaffected. In addition, comparative high pressure liquid chromatography tryptic peptide maps obtained before and after ferrate oxidation demonstrated that only five peptides of the more than 60 peptide peaks present in the tryptic digest underwent a major change in either peak position or intensity as a result of ferrate treatment. Amino acid analyses and/or sequencing identified four of these affected peaks as corresponding to peptides that span residues 324-340, 437-455, 456-464, and 512-518, respectively. However, only the last peptide, which has the sequence: Met-Trp-Pro-Asp-Leu-Gln-Lys, was significantly protected in the presence of DNA. This latter peptide was also the only peptide whose degree of oxidation correlated directly with the extent of inactivation of the enzyme. Amino acid analysis indicated that methionine 512 is the target site in this peptide for ferrate oxidation. Methionine 512, therefore, appears to be essential for the DNA-binding function of DNA polymerase-I from E. coli.

Definition of a consensus DNA-binding site for PecS, a global regulator of virulence gene expression in Erwinia chrysanthemi and identification of new members of the PecS regulon.

PubMed

Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William

2004-07-16

In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

Identification and analysis of cytochrome P450IID6 antigenic sites recognized by anti-liver-kidney microsome type-1 antibodies (LKM1).

PubMed

Yamamoto, A M; Cresteil, D; Boniface, O; Clerc, F F; Alvarez, F

1993-05-01

Anti-liver-kidney microsome type-1 antibodies (LKM1), present in sera from a group of patients with autoimmune hepatitis, are directed against P450IID6. Previous work, using cDNA constructions spanning most of the P450IID6 protein defined the main immunogenic site between the amino acids (aa), 254-271 and predicted the presence of other putative immunogenic sites in the molecule. Fusion proteins from new cDNA constructions, spanning so-far-untested regions between aa 1-125 and 431-522, were not recognized by LKM1-positive sera. Synthetic peptides, representing sequences from putative immunogenic regions or previously untested regions, allowed a precise definition of four antigenic sites located between peptides 257-269, 321-351, 373-389 and 410-429, which were recognized, respectively, by 14, 8, 1 and 2 out of 15 LKM1-positive sera tested. The minimal sequence of the main antigenic site (peptide 257-269) recognized by the autoantibody was established to be WDPAQPPRD (peptide 262-270). In addition, deletion and replacement experiments showed that aa 263 (Asp) was essential for the binding of the autoantibody to peptide 262-270. Analysis of the second most frequently recognized peptide between aa 321-351, was performed using peptides 321-339 and 340-351 in competitive inhibition studies. Complete elimination of antibody binding to peptide 321-351 obtained by absorption of both shorter peptides indicated that peptide 321-351 is a discontinuous antigenic site. LKM1-positive sera reacting against peptide 321-351 recognized either both the shorter peptides or just one of them preferentially. Results of the present study suggest that the production of LKM1 antibodies is an antigen-driven, poly- or oligoclonal B cell response. The identification of antigenic sites will allow: (i) the development of specific diagnostic tests and (ii) further studies on the pathogenic value of LKM1 antibodies in autoimmune hepatitis.

Leveraging cross-species transcription factor binding site patterns: from diabetes risk loci to disease mechanisms.

PubMed

Claussnitzer, Melina; Dankel, Simon N; Klocke, Bernward; Grallert, Harald; Glunk, Viktoria; Berulava, Tea; Lee, Heekyoung; Oskolkov, Nikolay; Fadista, Joao; Ehlers, Kerstin; Wahl, Simone; Hoffmann, Christoph; Qian, Kun; Rönn, Tina; Riess, Helene; Müller-Nurasyid, Martina; Bretschneider, Nancy; Schroeder, Timm; Skurk, Thomas; Horsthemke, Bernhard; Spieler, Derek; Klingenspor, Martin; Seifert, Martin; Kern, Michael J; Mejhert, Niklas; Dahlman, Ingrid; Hansson, Ola; Hauck, Stefanie M; Blüher, Matthias; Arner, Peter; Groop, Leif; Illig, Thomas; Suhre, Karsten; Hsu, Yi-Hsiang; Mellgren, Gunnar; Hauner, Hans; Laumen, Helmut

2014-01-16

Genome-wide association studies have revealed numerous risk loci associated with diverse diseases. However, identification of disease-causing variants within association loci remains a major challenge. Divergence in gene expression due to cis-regulatory variants in noncoding regions is central to disease susceptibility. We show that integrative computational analysis of phylogenetic conservation with a complexity assessment of co-occurring transcription factor binding sites (TFBS) can identify cis-regulatory variants and elucidate their mechanistic role in disease. Analysis of established type 2 diabetes risk loci revealed a striking clustering of distinct homeobox TFBS. We identified the PRRX1 homeobox factor as a repressor of PPARG2 expression in adipose cells and demonstrate its adverse effect on lipid metabolism and systemic insulin sensitivity, dependent on the rs4684847 risk allele that triggers PRRX1 binding. Thus, cross-species conservation analysis at the level of co-occurring TFBS provides a valuable contribution to the translation of genetic association signals to disease-related molecular mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slade, Daniel J.; Fang, Pengfei; Dreyton, Christina J.

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ionsmore » that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs.« less

Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

PubMed Central

Zheng, Zhaoqing; Keifer, Joyce

2014-01-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

PubMed

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

Saturation analysis of ChIP-seq data for reproducible identification of binding peaks

PubMed Central

Hansen, Peter; Hecht, Jochen; Ibrahim, Daniel M.; Krannich, Alexander; Truss, Matthias; Robinson, Peter N.

2015-01-01

Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a powerful technology to identify the genome-wide locations of transcription factors and other DNA binding proteins. Computational ChIP-seq peak calling infers the location of protein–DNA interactions based on various measures of enrichment of sequence reads. In this work, we introduce an algorithm, Q, that uses an assessment of the quadratic enrichment of reads to center candidate peaks followed by statistical analysis of saturation of candidate peaks by 5′ ends of reads. We show that our method not only is substantially faster than several competing methods but also demonstrates statistically significant advantages with respect to reproducibility of results and in its ability to identify peaks with reproducible binding site motifs. We show that Q has superior performance in the delineation of double RNAPII and H3K4me3 peaks surrounding transcription start sites related to a better ability to resolve individual peaks. The method is implemented in C+l+ and is freely available under an open source license. PMID:26163319

Identification of an Electrostatic Ruler Motif for Sequence-Specific Binding of Collagenase to Collagen.

PubMed

Subramanian, Sundar Raman; Singam, Ettayapuram Ramaprasad Azhagiya; Berinski, Michael; Subramanian, Venkatesan; Wade, Rebecca C

2016-08-25

Sequence-specific cleavage of collagen by mammalian collagenase plays a pivotal role in cell function. Collagenases are matrix metalloproteinases that cleave the peptide bond at a specific position on fibrillar collagen. The collagenase Hemopexin-like (HPX) domain has been proposed to be responsible for substrate recognition, but the mechanism by which collagenases identify the cleavage site on fibrillar collagen is not clearly understood. In this study, Brownian dynamics simulations coupled with atomic-detail and coarse-grained molecular dynamics simulations were performed to dock matrix metalloproteinase-1 (MMP-1) on a collagen IIIα1 triple helical peptide. We find that the HPX domain recognizes the collagen triple helix at a conserved R-X11-R motif C-terminal to the cleavage site to which the HPX domain of collagen is guided electrostatically. The binding of the HPX domain between the two arginine residues is energetically stabilized by hydrophobic contacts with collagen. From the simulations and analysis of the sequences and structural flexibility of collagen and collagenase, a mechanistic scheme by which MMP-1 can recognize and bind collagen for proteolysis is proposed.

Identification and structural analysis of ricin inhibitors. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robertus, J.D.

1996-12-01

Ricin is a potent cytotoxin which has been used by governments and terrorists as a poison. The three-dimensional structure of this toxic molecule was solved by X-ray crystallography, including an atomic description of its active site. The goal of this project was to use computer searches and other molecular modeling techniques to identify an inhibitor or ricin A chain (RTA). The program CHEM-X was used to predict that pteroic acid (PTA) would bind to RTA. This was shown to be the case by kinetic assays, where PTA protected ribosomes against the action of RTA, and by X-ray crystallography. The affinitymore » of PTA is weak, with a Ki estimated at 600 Micrometers. The pterin group of PTA was observed to make many polar interactions with RTA within the specificity site of the enzyme, and to bind more strongly than the natural substrate adenine. Further work will be required to increase the binding affinity of this class of inhibitors, and to improve their solubility if efficacious antidotes are to be designed from this lead.« less

Biochemistry of terminal deoxynucleotidyltransferase. Identification and unity of ribo- and deoxyribonucleoside triphosphate binding site in terminal deoxynucleotidyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pandey, V.N.; Modak, M.J.

Terminal deoxynucleotidyltransferase is the only DNA polymerase that is strongly inhibited in the presence of ATP. We have labeled calf terminal deoxynucleotidyltransferase with (/sup 32/P)ATP in order to identify its binding site in terminal deoxynucleotidyltransferase. The specificity of ATP cross-linking to terminal deoxynucleotidyltransferase is shown by the competitive inhibition of the overall cross-linking reaction by deoxynucleoside triphosphates, as well as the ATP analogs Ap4A and Ap5A. Tryptic peptide mapping of (/sup 32/P)ATP-labeled enzyme revealed a peptide fraction that contained the majority of cross-linked ATP. The properties, chromatographic characteristics, amino acid composition, and sequence analysis of this peptide fraction were identicalmore » with those found associated with dTTP cross-linked terminal deoxynucleotidyl-transferase peptide. The involvement of the same 2 cysteine residues in the crosslinking of both nucleotides further confirmed the unity of the ATP and dTTP binding domain that contains residues 224-237 in the primary amino acid sequence of calf terminal deoxynucleotidyltransferase.« less

Mapping sites of aspirin-induced acetylations in live cells by quantitative acid-cleavable activity-based protein profiling (QA-ABPP)

PubMed Central

Wang, Jigang; Zhang, Chong-Jing; Zhang, Jianbin; He, Yingke; Lee, Yew Mun; Chen, Songbi; Lim, Teck Kwang; Ng, Shukie; Shen, Han-Ming; Lin, Qingsong

2015-01-01

Target-identification and understanding of mechanism-of-action (MOA) are challenging for development of small-molecule probes and their application in biology and drug discovery. For example, although aspirin has been widely used for more than 100 years, its molecular targets have not been fully characterized. To cope with this challenge, we developed a novel technique called quantitative acid-cleavable activity-based protein profiling (QA-ABPP) with combination of the following two parts: (i) activity-based protein profiling (ABPP) and iTRAQ™ quantitative proteomics for identification of target proteins and (ii) acid-cleavable linker-based ABPP for identification of peptides with specific binding sites. It is known that reaction of aspirin with its target proteins leads to acetylation. We thus applied the above technique using aspirin-based probes in human cancer HCT116 cells. We identified 1110 target proteins and 2775 peptides with exact acetylation sites. By correlating these two sets of data, 523 proteins were identified as targets of aspirin. We used various biological assays to validate the effects of aspirin on inhibition of protein synthesis and induction of autophagy which were elicited from the pathway analysis of Aspirin target profile. This technique is widely applicable for target identification in the field of drug discovery and biology, especially for the covalent drugs. PMID:25600173

Design and synthesis of emodin derivatives as novel inhibitors of ATP-citrate lyase.

PubMed

Koerner, Steffi K; Hanai, Jun-Ichi; Bai, Sha; Jernigan, Finith E; Oki, Miwa; Komaba, Chieko; Shuto, Emi; Sukhatme, Vikas P; Sun, Lijun

2017-01-27

Aberrant cellular metabolism drives cancer proliferation and metastasis. ATP citrate lyase (ACL) plays a critical role in generating cytosolic acetyl CoA, a key building block for de novo fatty acid and cholesterol biosynthesis. ACL is overexpressed in cancer cells, and siRNA knockdown of ACL limits cancer cell proliferation and reduces cancer stemness. We characterized a new class of ACL inhibitors bearing the key structural feature of the natural product emodin. Structure-activity relationship (SAR) study led to the identification of 1d as a potent lead that demonstrated dose-dependent inhibition of proliferation and cancer stemness of the A549 lung cancer cell line. Computational modeling indicates this class of inhibitors occupies an allosteric binding site and blocks the entrance of the substrate citrate to its binding site. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Indirubin core structure of glycogen synthase kinase-3 inhibitors as novel chemotype for intervention with 5-lipoxygenase.

PubMed

Pergola, Carlo; Gaboriaud-Kolar, Nicolas; Jestädt, Nadine; König, Stefanie; Kritsanida, Marina; Schaible, Anja M; Li, Haokun; Garscha, Ulrike; Weinigel, Christina; Barz, Dagmar; Albring, Kai F; Huber, Otmar; Skaltsounis, Alexios L; Werz, Oliver

2014-05-08

The enzymes 5-lipoxygenase (5-LO) and glycogen synthase kinase (GSK)-3 represent promising drug targets in inflammation. We made use of the bisindole core of indirubin, present in GSK-3 inhibitors, to innovatively target 5-LO at the ATP-binding site for the design of dual 5-LO/GSK-3 inhibitors. Evaluation of substituted indirubin derivatives led to the identification of (3Z)-6-bromo-3-[(3E)-3-hydroxyiminoindolin-2-ylidene]indolin-2-one (15) as a potent, direct, and reversible 5-LO inhibitor (IC50 = 1.5 μM), with comparable cellular effectiveness on 5-LO and GSK-3. Together, we present indirubins as novel chemotypes for the development of 5-LO inhibitors, the interference with the ATP-binding site as a novel strategy for 5-LO targeting, and dual 5-LO/GSK-3 inhibition as an unconventional and promising concept for anti-inflammatory intervention.

In silico assessment of phosphorylation and O-β-GlcNAcylation sites in human NPC1 protein critical for Ebola virus entry.

PubMed

Basharat, Zarrin; Yasmin, Azra

2015-08-01

Ebola is a highly pathogenic enveloped virus responsible for deadly outbreaks of severe hemorrhagic fever. It enters human cells by binding a multifunctional cholesterol transporter Niemann-Pick C1 (NPC1) protein. Post translational modification (PTM) information for NPC1 is crucial to understand Ebola virus (EBOV) entry and action due to changes in phosphorylation or glycosylation at the binding site. It is difficult and costly to experimentally assess this type of interaction, so in silico strategy was employed. Identification of phosphorylation sites, including conserved residues that could be possible targets for 21 predicted kinases was followed by interplay study between phosphorylation and O-β-GlcNAc modification of NPC1. Results revealed that only 4 out of 48 predicted phosphosites exhibited O-β-GlcNAc activity. Predicted outcomes were integrated with residue conservation and 3D structural information. Three Yin Yang sites were located in the α-helix regions and were conserved in studied vertebrate and mammalian species. Only one modification site S425 was found in β-turn region located near the N-terminus of NPC1 and was found to differ in pig, mouse, cobra and humans. The predictions suggest that Yin Yang sites may not be important for virus attachment to NPC1, whereas phosphosite 473 may be important for binding and hence entry of Ebola virus. This information could be useful in addressing further experimental studies and therapeutic strategies targeting PTM events in EBOV entry. Copyright © 2015 Elsevier B.V. All rights reserved.

Identification of a novel K311 ubiquitination site critical for androgen receptor transcriptional activity

PubMed Central

Cork, David M.W.; Darby, Steven; Ryan-Munden, Claudia A.; Nakjang, Sirintra; Mendes Côrtes, Leticia; Treumann, Achim; Gaughan, Luke

2017-01-01

Abstract The androgen receptor (AR) is the main driver of prostate cancer (PC) development and progression, and the primary therapeutic target in PC. To date, two functional ubiquitination sites have been identified on AR, both located in its C-terminal ligand binding domain (LBD). Recent reports highlight the emergence of AR splice variants lacking the LBD that can arise during disease progression and contribute to castrate resistance. Here, we report a novel N-terminal ubiquitination site at lysine 311. Ubiquitination of this site plays a role in AR stability and is critical for its transcriptional activity. Inactivation of this site causes AR to accumulate on chromatin and inactivates its transcriptional function as a consequence of inability to bind to p300. Additionally, mutation at lysine 311 affects cellular transcriptome altering the expression of genes involved in chromatin organization, signaling, adhesion, motility, development and metabolism. Even though this site is present in clinically relevant AR-variants it can only be ubiquitinated in cells when AR retains LBD suggesting a role for AR C-terminus in E2/E3 substrate recognition. We report that as a consequence AR variants lacking the LBD cannot be ubiquitinated in the cellular environment and their protein turnover must be regulated via an alternate pathway. PMID:27903893

Discovery of novel dengue virus NS5 methyltransferase non-nucleoside inhibitors by fragment-based drug design.

PubMed

Benmansour, Fatiha; Trist, Iuni; Coutard, Bruno; Decroly, Etienne; Querat, Gilles; Brancale, Andrea; Barral, Karine

2017-01-05

With the aim to help drug discovery against dengue virus (DENV), a fragment-based drug design approach was applied to identify ligands targeting a main component of DENV replication complex: the NS5 AdoMet-dependent mRNA methyltransferase (MTase) domain, playing an essential role in the RNA capping process. Herein, we describe the identification of new inhibitors developed using fragment-based, structure-guided linking and optimization techniques. Thermal-shift assay followed by a fragment-based X-ray crystallographic screening lead to the identification of three fragment hits binding DENV MTase. We considered linking two of them, which bind to proximal sites of the AdoMet binding pocket, in order to improve their potency. X-ray crystallographic structures and computational docking were used to guide the fragment linking, ultimately leading to novel series of non-nucleoside inhibitors of flavivirus MTase, respectively N-phenyl-[(phenylcarbamoyl)amino]benzene-1-sulfonamide and phenyl [(phenylcarbamoyl)amino]benzene-1-sulfonate derivatives, that show a 10-100-fold stronger inhibition of 2'-O-MTase activity compared to the initial fragments. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Fatty Acid-binding Proteins Interact with Comparative Gene Identification-58 Linking Lipolysis with Lipid Ligand Shuttling*

PubMed Central

Hofer, Peter; Boeszoermenyi, Andras; Jaeger, Doris; Feiler, Ursula; Arthanari, Haribabu; Mayer, Nicole; Zehender, Fabian; Rechberger, Gerald; Oberer, Monika; Zimmermann, Robert; Lass, Achim; Haemmerle, Guenter; Breinbauer, Rolf; Zechner, Rudolf; Preiss-Landl, Karina

2015-01-01

The coordinated breakdown of intracellular triglyceride (TG) stores requires the exquisitely regulated interaction of lipolytic enzymes with regulatory, accessory, and scaffolding proteins. Together they form a dynamic multiprotein network designated as the “lipolysome.” Adipose triglyceride lipase (Atgl) catalyzes the initiating step of TG hydrolysis and requires comparative gene identification-58 (Cgi-58) as a potent activator of enzyme activity. Here, we identify adipocyte-type fatty acid-binding protein (A-Fabp) and other members of the fatty acid-binding protein (Fabp) family as interaction partners of Cgi-58. Co-immunoprecipitation, microscale thermophoresis, and solid phase assays proved direct protein/protein interaction between A-Fabp and Cgi-58. Using nuclear magnetic resonance titration experiments and site-directed mutagenesis, we located a potential contact region on A-Fabp. In functional terms, A-Fabp stimulates Atgl-catalyzed TG hydrolysis in a Cgi-58-dependent manner. Additionally, transcriptional transactivation assays with a luciferase reporter system revealed that Fabps enhance the ability of Atgl/Cgi-58-mediated lipolysis to induce the activity of peroxisome proliferator-activated receptors. Our studies identify Fabps as crucial structural and functional components of the lipolysome. PMID:25953897

Smooth Muscle Cell Genome Browser: Enabling the Identification of Novel Serum Response Factor Target Genes

PubMed Central

Lee, Moon Young; Park, Chanjae; Berent, Robyn M.; Park, Paul J.; Fuchs, Robert; Syn, Hannah; Chin, Albert; Townsend, Jared; Benson, Craig C.; Redelman, Doug; Shen, Tsai-wei; Park, Jong Kun; Miano, Joseph M.; Sanders, Kenton M.; Ro, Seungil

2015-01-01

Genome-scale expression data on the absolute numbers of gene isoforms offers essential clues in cellular functions and biological processes. Smooth muscle cells (SMCs) perform a unique contractile function through expression of specific genes controlled by serum response factor (SRF), a transcription factor that binds to DNA sites known as the CArG boxes. To identify SRF-regulated genes specifically expressed in SMCs, we isolated SMC populations from mouse small intestine and colon, obtained their transcriptomes, and constructed an interactive SMC genome and CArGome browser. To our knowledge, this is the first online resource that provides a comprehensive library of all genetic transcripts expressed in primary SMCs. The browser also serves as the first genome-wide map of SRF binding sites. The browser analysis revealed novel SMC-specific transcriptional variants and SRF target genes, which provided new and unique insights into the cellular and biological functions of the cells in gastrointestinal (GI) physiology. The SRF target genes in SMCs, which were discovered in silico, were confirmed by proteomic analysis of SMC-specific Srf knockout mice. Our genome browser offers a new perspective into the alternative expression of genes in the context of SRF binding sites in SMCs and provides a valuable reference for future functional studies. PMID:26241044

Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

NASA Astrophysics Data System (ADS)

Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

2014-07-01

Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors.

High-throughput screening using the differential radial capillary action of ligand assay identifies ebselen as an inhibitor of diguanylate cyclases.

PubMed

Lieberman, Ori J; Orr, Mona W; Wang, Yan; Lee, Vincent T

2014-01-17

The rise of bacterial resistance to traditional antibiotics has motivated recent efforts to identify new drug candidates that target virulence factors or their regulatory pathways. One such antivirulence target is the cyclic-di-GMP (cdiGMP) signaling pathway, which regulates biofilm formation, motility, and pathogenesis. Pseudomonas aeruginosa is an important opportunistic pathogen that utilizes cdiGMP-regulated polysaccharides, including alginate and pellicle polysaccharide (PEL), to mediate virulence and antibiotic resistance. CdiGMP activates PEL and alginate biosynthesis by binding to specific receptors including PelD and Alg44. Mutations that abrogate cdiGMP binding to these receptors prevent polysaccharide production. Identification of small molecules that can inhibit cdiGMP binding to the allosteric sites on these proteins could mimic binding defective mutants and potentially reduce biofilm formation or alginate secretion. Here, we report the development of a rapid and quantitative high-throughput screen for inhibitors of protein-cdiGMP interactions based on the differential radial capillary action of ligand assay (DRaCALA). Using this approach, we identified ebselen as an inhibitor of cdiGMP binding to receptors containing an RxxD domain including PelD and diguanylate cyclases (DGC). Ebselen reduces diguanylate cyclase activity by covalently modifying cysteine residues. Ebselen oxide, the selenone analogue of ebselen, also inhibits cdiGMP binding through the same covalent mechanism. Ebselen and ebselen oxide inhibit cdiGMP regulation of biofilm formation and flagella-mediated motility in P. aeruginosa through inhibition of diguanylate cyclases. The identification of ebselen provides a proof-of-principle that a DRaCALA high-throughput screening approach can be used to identify bioactive agents that reverse regulation of cdiGMP signaling by targeting cdiGMP-binding domains.

Synthetic PAMAM-RGD conjugates target and bind to odontoblast-like MDPC 23 cells and the predentin in tooth organ cultures.

PubMed

Hill, Elliott; Shukla, Rameshwer; Park, Steve S; Baker, James R

2007-01-01

Screening techniques now allow for the identification of small peptides that bind specifically to molecules like cells. However, despite the enthusiasm for this approach, single peptides often lack the binding affinity to target in vivo and regulate cell function. We took peptides containing the Arg-Gly Asp(RGD) motif that bind to the alpha Vbeta 3 integrin and have shown potential as therapeutics. To improve their binding affinity, we synthesized polyamidoamine (PAMAM) dendrimer-RGD conjugates that that contain 12-13 copies of the peptide. When cultured with human dermal microvessel endothelial cells (HDMEC), human vascular endothelial cells (HUVEC), or odontoblast-like MDPC-23 cells, the PAMAM dendrimer conjugate targets this receptor in a manner that is both time- and dose-dependent. Finally, this conjugate selectively targets RGD binding sites in the predentin of human tooth organ cultures. Taken together, these studies provide proof of principle that synthetic PAMAM-RGD conjugates could prove useful as carriers for the tissue-specific delivery of integrin-targeted therapeutics or imaging agents and could be used to engineer tissue regeneration.

Identification of Human Lineage-Specific Transcriptional Coregulators Enabled by a Glossary of Binding Modules and Tunable Genomic Backgrounds.

PubMed

Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L

2017-09-27

Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.

Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

PubMed Central

2011-01-01

Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588

Computational insights into the interaction of small molecule inhibitors with HRI kinase domain.

PubMed

Palrecha, Sourabh; Lakade, Dushant; Kulkarni, Abhijeet; Pal, Jayanta K; Joshi, Manali

2018-05-07

The Heme-Regulated Inhibitor (HRI) kinase regulates globin synthesis in a heme-dependent manner in reticulocytes and erythroid cells in bone marrow. Inhibitors of HRI have been proposed to lead to an increased amount of haemoglobin, benefitting anaemia patients. A series of indeno[1,2-c]pyrazoles were discovered to be the first known in vitro inhibitors of HRI. However, the structural mechanism of inhibition is yet to be understood. The aim of this study was to unravel the binding mechanism of these inhibitors using molecular dynamic simulations and docking. The docking scores were observed to correlate well with experimentally determined pIC 50 values. The inhibitors were observed to bind in the ATP-binding site forming hydrogen bonds with the hinge region and van der Waals interactions with non-polar residues in the binding site. Further, quantitative structure-activity relationship (QSAR) studies were performed to correlate the structural features of the inhibitors with their biological activity. The developed QSAR models were found to be statistically significant in terms of internal and external predictabilities. The presence of chlorine atoms and the hydroxymethyl groups were found to correlate with higher activity. The identified binding modes and the descriptors can support future rational identification of more potent and selective small molecule inhibitors for this kinase which are of therapeutic importance in the context of various human pathological disorders.

Method for Developing Optical Sensors Using a Synthetic Dye-Fluorescent Protein FRET Pair and Computational Modeling and Assessment.

PubMed

Mitchell, Joshua A; Zhang, William H; Herde, Michel K; Henneberger, Christian; Janovjak, Harald; O'Mara, Megan L; Jackson, Colin J

2017-01-01

Biosensors that exploit Förster resonance energy transfer (FRET) can be used to visualize biological and physiological processes and are capable of providing detailed information in both spatial and temporal dimensions. In a FRET-based biosensor, substrate binding is associated with a change in the relative positions of two fluorophores, leading to a change in FRET efficiency that may be observed in the fluorescence spectrum. As a result, their design requires a ligand-binding protein that exhibits a conformational change upon binding. However, not all ligand-binding proteins produce responsive sensors upon conjugation to fluorescent proteins or dyes, and identifying the optimum locations for the fluorophores often involves labor-intensive iterative design or high-throughput screening. Combining the genetic fusion of a fluorescent protein to the ligand-binding protein with site-specific covalent attachment of a fluorescent dye can allow fine control over the positions of the two fluorophores, allowing the construction of very sensitive sensors. This relies upon the accurate prediction of the locations of the two fluorophores in bound and unbound states. In this chapter, we describe a method for computational identification of dye-attachment sites that allows the use of cysteine modification to attach synthetic dyes that can be paired with a fluorescent protein for the purposes of creating FRET sensors.

Purification and characterization of FBI-1, a cellular factor that binds to the human immunodeficiency virus type 1 inducer of short transcripts.

PubMed Central

Pessler, F; Pendergrast, P S; Hernandez, N

1997-01-01

The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes. PMID:9199312

Prostaglandin E/sub 2/ localization and receptor identification within the developing murine secondary palate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jones, J.

1986-01-01

Transient elevations in murine secondary palatal adenosine 3',5'-monophosphate (cAMP) levels occur during palate ontogeny. Since palatal processes exposed to dibutyryl cAMP differentiate precociously, increases in palatal cAMP levels are of interest. Prostaglandin E/sub 2/ (PGE/sub 2/), which is synthesized by murine embryonic palate mesenchyme cells (MEPM), regulates cAMP levels in adult tissues via specific membrane bound receptors coupled to adenylate cyclase. Therefore, a PGE/sub 2/ receptor-adenylate cyclase systems was proposed in the developing murine secondary palate. Utilizing a radioligand binding assay, it was determined that murine palatal tissue on day 13 of gestation contained PGE/sub 2/ receptors that were saturable,more » of high affinity and low capacity. Specific (/sup 3/H)-PGE/sub 2/ binding was reversible by 30 min. The order of prostanoid binding affinity at specific PGE/sub 2/ binding sites was E/sub 2/ > F/sub 2//sub ..cap alpha../ > A/sub 2/ > E/sub 1/ = D/sub 2/ indicating specificity of the receptor for PGE/sub 2/. The ability of MEPM cells to respond to PGE/sub 2/ with dose-dependent accumulations of intracellular cAMP demonstrated the functional nature of these binding sites. Analysis of palatal PGE/sub 2/ receptor characteristics on days 12 and 14 of palate development indicated temporal alterations in receptor affinity and density during palate ontogeny.« less

Identification and specificity studies of small-molecule ligands for SH3 protein domains.

PubMed

Inglis, Steven R; Stojkoski, Cvetan; Branson, Kim M; Cawthray, Jacquie F; Fritz, Daniel; Wiadrowski, Emma; Pyke, Simon M; Booker, Grant W

2004-10-21

The Src Homology 3 (SH3) domains are small protein-protein interaction domains that bind proline-rich sequences and mediate a wide range of cell-signaling and other important biological processes. Since deregulated signaling pathways form the basis of many human diseases, the SH3 domains have been attractive targets for novel therapeutics. High-affinity ligands for SH3 domains have been designed; however, these have all been peptide-based and no examples of entirely nonpeptide SH3 ligands have previously been reported. Using the mouse Tec Kinase SH3 domain as a model system for structure-based ligand design, we have identified several simple heterocyclic compounds that selectively bind to the Tec SH3 domain. Using a combination of nuclear magnetic resonance chemical shift perturbation, structure-activity relationships, and site-directed mutagenesis, the binding of these compounds at the proline-rich peptide-binding site has been characterized. The most potent of these, 2-aminoquinoline, bound with Kd = 125 microM and was able to compete for binding with a proline-rich peptide. Synthesis of 6-substituted-2-aminoquinolines resulted in ligands with up to 6-fold improved affinity over 2-aminoquinoline and enhanced specificity for the Tec SH3 domain. Therefore, 2-aminoquinolines may potentially be useful for the development of high affinity small molecule ligands for SH3 domains.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

Structurally distinct toxicity inhibitors bind at common loci on β-amyloid fibril.

PubMed

Keshet, Ben; Gray, Jeffrey J; Good, Theresa A

2010-12-01

The accumulation of aggregated β-Amyloid (Aβ) in the brain is a hallmark of Alzheimer's disease and is thought to play a role in the neurotoxicity associated with the disease. The mechanism by which Aβ aggregates induce toxicity is uncertain. Nonetheless, several small molecules have been found to interact with Aβ fibrils and to prevent their toxicity. In this paper we studied the binding of these known toxicity inhibitors to Aβ fibrils, as a means to explore surfaces or loci on Aβ aggregates that may be significant in the mechanism of action of these inhibitors. We believe knowledge of these binding loci will provide insight into surfaces on the Aβ fibrils important in Aβ biological activity. The program DOCK was used to computationally dock the inhibitors to an Aβ fibril. The inhibitors docked at two shared binding loci, near Lys28 and at the C-termini near Asn27 and Val39. The docking predictions were experimentally verified using lysine specific chemical modifications and Aβ fibrils mutated at Asn27. We found that both Congo red and Myricetin, despite being structurally different, bound at the same two sites. Additionally, our data suggests that three additional Aβ toxicity inhibitors may also bind in one of the sites. Identification of these common binding loci provides targets on the Aβ fibril surface that can be tested in the future for their role in Aβ biological activity. Copyright © 2010 The Protein Society.

Identification and characterization of small molecule inhibitors of the calcium-dependent S100B-p53 tumor suppressor interaction.

PubMed

Markowitz, Joseph; Chen, Ijen; Gitti, Rossi; Baldisseri, Donna M; Pan, Yongping; Udan, Ryan; Carrier, France; MacKerell, Alexander D; Weber, David J

2004-10-07

The binding of S100B to p53 down-regulates wild-type p53 tumor suppressor activity in cancer cells such as malignant melanoma, so a search for small molecules that bind S100B and prevent S100B-p53 complex formation was undertaken. Chemical databases were computationally searched for potential inhibitors of S100B, and 60 compounds were selected for testing on the basis of energy scoring, commercial availability, and chemical similarity clustering. Seven of these compounds bound to S100B as determined by steady state fluorescence spectroscopy (1.0 microM < or = K(D) < or = 120 microM) and five inhibited the growth of primary malignant melanoma cells (C8146A) at comparable concentrations (1.0 microM < or = IC(50) < or = 50 microM). Additionally, saturation transfer difference (STD) NMR experiments confirmed binding and qualitatively identified protons from the small molecule at the small molecule-S100B interface. Heteronuclear single quantum coherence (HSQC) NMR titrations indicate that these compounds interact with the p53 binding site on S100B. An NMR-docked model of one such inhibitor, pentamidine, bound to Ca(2+)-loaded S100B was calculated using intermolecular NOE data between S100B and the drug, and indicates that pentamidine binds into the p53 binding site on S100B defined by helices 3 and 4 and loop 2 (termed the hinge region).

Identification of RhoGAP22 as an Akt-Dependent Regulator of Cell Motility in Response to Insulin▿‡

PubMed Central

Rowland, Alexander F.; Larance, Mark; Hughes, William E.; James, David E.

2011-01-01

Insulin exerts many of its metabolic actions via the canonical phosphatidylinositide 3 kinase (PI3K)/Akt pathway, leading to phosphorylation and 14-3-3 binding of key metabolic targets. We previously identified a GTPase-activating protein (GAP) for Rac1 called RhoGAP22 as an insulin-responsive 14-3-3 binding protein. Insulin increased 14-3-3 binding to RhoGAP22 fourfold, and this effect was PI3K dependent. We identified two insulin-responsive 14-3-3 binding sites (pSer16 and pSer395) within RhoGAP22, and mutagenesis studies revealed a complex interplay between the phosphorylation at these two sites. Mutating Ser16 to alanine blocked 14-3-3 binding to RhoGAP22 in vivo, and phosphorylation at Ser16 was mediated by the kinase Akt. Overexpression of a mutant RhoGAP22 that was unable to bind 14-3-3 reduced cell motility in NIH-3T3 fibroblasts, and this effect was dependent on a functional GAP domain. Mutation of the catalytic arginine of the GAP domain of RhoGAP22 potentiated growth factor-stimulated Rac1 GTP loading. We propose that insulin and possibly growth factors such as platelet-derived growth factor may play a novel role in regulating cell migration and motility via the Akt-dependent phosphorylation of RhoGAP22, leading to modulation of Rac1 activity. PMID:21969604

Efficient one-cycle affinity selection of binding proteins or peptides specific for a small-molecule using a T7 phage display pool.

PubMed

Takakusagi, Yoichi; Kuramochi, Kouji; Takagi, Manami; Kusayanagi, Tomoe; Manita, Daisuke; Ozawa, Hiroko; Iwakiri, Kanako; Takakusagi, Kaori; Miyano, Yuka; Nakazaki, Atsuo; Kobayashi, Susumu; Sugawara, Fumio; Sakaguchi, Kengo

2008-11-15

Here, we report an efficient one-cycle affinity selection using a natural-protein or random-peptide T7 phage pool for identification of binding proteins or peptides specific for small-molecules. The screening procedure involved a cuvette type 27-MHz quartz-crystal microbalance (QCM) apparatus with introduction of self-assembled monolayer (SAM) for a specific small-molecule immobilization on the gold electrode surface of a sensor chip. Using this apparatus, we attempted an affinity selection of proteins or peptides against synthetic ligand for FK506-binding protein (SLF) or irinotecan (Iri, CPT-11). An affinity selection using SLF-SAM and a natural-protein T7 phage pool successfully detected FK506-binding protein 12 (FKBP12)-displaying T7 phage after an interaction time of only 10 min. Extensive exploration of time-consuming wash and/or elution conditions together with several rounds of selection was not required. Furthermore, in the selection using a 15-mer random-peptide T7 phage pool and subsequent analysis utilizing receptor ligand contact (RELIC) software, a subset of SLF-selected peptides clearly pinpointed several amino-acid residues within the binding site of FKBP12. Likewise, a subset of Iri-selected peptides pinpointed part of the positive amino-acid region of residues from the Iri-binding site of the well-known direct targets, acetylcholinesterase (AChE) and carboxylesterase (CE). Our findings demonstrate the effectiveness of this method and general applicability for a wide range of small-molecules.

Identification and characterization of a receptor for tissue ferritin on activated rat lipocytes.

PubMed Central

Ramm, G A; Britton, R S; O'Neill, R; Bacon, B R

1994-01-01

Hepatic iron overload causes lipocyte activation with resultant fibrogenesis. This study examines whether rat lipocytes express ferritin receptors, which could be involved in paracellular iron movement and in cellular regulation. Lipocytes from normal rat liver were cultured on plastic and incubated with 125I-labeled rat liver ferritin (RLF) +/- a 100-fold excess of either unlabeled RLF or human heart ferritin, human liver ferritin, human recombinant H-ferritin, a mutant human recombinant L-ferritin, or a variety of nonspecific proteins. Specific binding sites for ferritin were demonstrated by displacement of 125I-RLF by RLF (64.5 +/- 4.3%) and by other ferritins (55-60%), but not by recombinant L-ferritin. Scatchard analysis demonstrated a single class of binding sites with a Kd of 5.1 +/- 2.9 x 10(-10) M, maximum binding capacity of 4.7 +/- 1.3 x 10(-12) M, and 5,000-10,000 receptor sites/cell. Ferritin receptor expression was observed only in activated lipocytes. Internalization of RLF was observed within 15 min using FITC-RLF and confocal microscopy. This study demonstrates that (a) activated lipocytes express a specific high affinity ferritin receptor; (b) the binding appears to be dependent on the H-ferritin subunit; and (c) lipocytes internalize ferritin. Expression of ferritin receptors in activated lipocytes suggests that the receptor may either be involved in the activation cascade or may be a marker of activation. Images PMID:8040296

Acetylcholine-Binding Protein in the Hemolymph of the Planorbid Snail Biomphalaria glabrata Is a Pentagonal Dodecahedron (60 Subunits)

PubMed Central

Kapetanopoulos, Katharina; Braukmann, Sandra; Gebauer, Wolfgang; Tenzer, Stefan; Markl, Jürgen

2012-01-01

Nicotinic acetylcholine receptors (nAChR) play important neurophysiological roles and are of considerable medical relevance. They have been studied extensively, greatly facilitated by the gastropod acetylcholine-binding proteins (AChBP) which represent soluble structural and functional homologues of the ligand-binding domain of nAChR. All these proteins are ring-like pentamers. Here we report that AChBP exists in the hemolymph of the planorbid snail Biomphalaria glabrata (vector of the schistosomiasis parasite) as a regular pentagonal dodecahedron, 22 nm in diameter (12 pentamers, 60 active sites). We sequenced and recombinantly expressed two ∼25 kDa polypeptides (BgAChBP1 and BgAChBP2) with a specific active site, N-glycan site and disulfide bridge variation. We also provide the exon/intron structures. Recombinant BgAChBP1 formed pentamers and dodecahedra, recombinant BgAChBP2 formed pentamers and probably disulfide-bridged di-pentamers, but not dodecahedra. Three-dimensional electron cryo-microscopy (3D-EM) yielded a 3D reconstruction of the dodecahedron with a resolution of 6 Å. Homology models of the pentamers docked to the 6 Å structure revealed opportunities for chemical bonding at the inter-pentamer interfaces. Definition of the ligand-binding pocket and the gating C-loop in the 6 Å structure suggests that 3D-EM might lead to the identification of functional states in the BgAChBP dodecahedron. PMID:22916297

Structural characterization of nonactive site, TrkA-selective kinase inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Hua-Poo; Rickert, Keith; Burlein, Christine

Current therapies for chronic pain can have insufficient efficacy and lead to side effects, necessitating research of novel targets against pain. Although originally identified as an oncogene, Tropomyosin-related kinase A (TrkA) is linked to pain and elevated levels of NGF (the ligand for TrkA) are associated with chronic pain. Antibodies that block TrkA interaction with its ligand, NGF, are in clinical trials for pain relief. Here, we describe the identification of TrkA-specific inhibitors and the structural basis for their selectivity over other Trk family kinases. The X-ray structures reveal a binding site outside the kinase active site that uses residuesmore » from the kinase domain and the juxtamembrane region. Three modes of binding with the juxtamembrane region are characterized through a series of ligand-bound complexes. The structures indicate a critical pharmacophore on the compounds that leads to the distinct binding modes. The mode of interaction can allow TrkA selectivity over TrkB and TrkC or promiscuous, pan-Trk inhibition. This finding highlights the difficulty in characterizing the structure-activity relationship of a chemical series in the absence of structural information because of substantial differences in the interacting residues. These structures illustrate the flexibility of binding to sequences outside of—but adjacent to—the kinase domain of TrkA. This knowledge allows development of compounds with specificity for TrkA or the family of Trk proteins.« less

Identification of the platelet-derived chemokine CXCL4/PF-4 as a broad-spectrum HIV-1 inhibitor

PubMed Central

Auerbach, David J.; Lin, Yin; Miao, Huiyi; Cimbro, Raffaello; DiFiore, Michelle J.; Gianolini, Monica E.; Furci, Lucinda; Biswas, Priscilla; Fauci, Anthony S.; Lusso, Paolo

2012-01-01

The natural history of HIV-1 infection is highly variable in different individuals, spanning from a rapidly progressive course to a long-term asymptomatic infection. A major determinant of the pace of disease progression is the in vivo level of HIV-1 replication, which is regulated by a complex network of cytokines and chemokines expressed by immune and inflammatory cells. The chemokine system is critically involved in the control of HIV-1 replication by virtue of the role played by specific chemokine receptors, most notably CCR5 and CXCR4, as cell-surface coreceptors for HIV-1 entry; hence, the chemokines that naturally bind such coreceptors act as endogenous inhibitors of HIV-1. Here, we show that the CXC chemokine CXCL4 (PF-4), the most abundant protein contained within the α-granules of platelets, is a broad-spectrum inhibitor of HIV-1 infection. Unlike other known HIV-suppressive chemokines, CXCL4 inhibits infection by the majority of primary HIV-1 isolates regardless of their coreceptor-usage phenotype or genetic subtype. Consistent with the lack of viral phenotype specificity, blockade of HIV-1 infection occurs at the level of virus attachment and entry via a unique mechanism that involves direct interaction of CXCL4 with the major viral envelope glycoprotein, gp120. The binding site for CXCL4 was mapped to a region of the gp120 outer domain proximal to the CD4-binding site. The identification of a platelet-derived chemokine as an endogenous antiviral factor may have relevance for the pathogenesis and treatment of HIV-1 infection. PMID:22645343

Identification of the platelet-derived chemokine CXCL4/PF-4 as a broad-spectrum HIV-1 inhibitor.

PubMed

Auerbach, David J; Lin, Yin; Miao, Huiyi; Cimbro, Raffaello; Difiore, Michelle J; Gianolini, Monica E; Furci, Lucinda; Biswas, Priscilla; Fauci, Anthony S; Lusso, Paolo

2012-06-12

The natural history of HIV-1 infection is highly variable in different individuals, spanning from a rapidly progressive course to a long-term asymptomatic infection. A major determinant of the pace of disease progression is the in vivo level of HIV-1 replication, which is regulated by a complex network of cytokines and chemokines expressed by immune and inflammatory cells. The chemokine system is critically involved in the control of HIV-1 replication by virtue of the role played by specific chemokine receptors, most notably CCR5 and CXCR4, as cell-surface coreceptors for HIV-1 entry; hence, the chemokines that naturally bind such coreceptors act as endogenous inhibitors of HIV-1. Here, we show that the CXC chemokine CXCL4 (PF-4), the most abundant protein contained within the α-granules of platelets, is a broad-spectrum inhibitor of HIV-1 infection. Unlike other known HIV-suppressive chemokines, CXCL4 inhibits infection by the majority of primary HIV-1 isolates regardless of their coreceptor-usage phenotype or genetic subtype. Consistent with the lack of viral phenotype specificity, blockade of HIV-1 infection occurs at the level of virus attachment and entry via a unique mechanism that involves direct interaction of CXCL4 with the major viral envelope glycoprotein, gp120. The binding site for CXCL4 was mapped to a region of the gp120 outer domain proximal to the CD4-binding site. The identification of a platelet-derived chemokine as an endogenous antiviral factor may have relevance for the pathogenesis and treatment of HIV-1 infection.

Identification of novel binding partners (annexins) for the cell death signal phosphatidylserine and definition of their recognition motif.

PubMed

Rosenbaum, Sabrina; Kreft, Sandra; Etich, Julia; Frie, Christian; Stermann, Jacek; Grskovic, Ivan; Frey, Benjamin; Mielenz, Dirk; Pöschl, Ernst; Gaipl, Udo; Paulsson, Mats; Brachvogel, Bent

2011-02-18

Identification and clearance of apoptotic cells prevents the release of harmful cell contents thereby suppressing inflammation and autoimmune reactions. Highly conserved annexins may modulate the phagocytic cell removal by acting as bridging molecules to phosphatidylserine, a characteristic phagocytosis signal of dying cells. In this study five members of the structurally and functionally related annexin family were characterized for their capacity to interact with phosphatidylserine and dying cells. The results showed that AnxA3, AnxA4, AnxA13, and the already described interaction partner AnxA5 can bind to phosphatidylserine and apoptotic cells, whereas AnxA8 lacks this ability. Sequence alignment experiments located the essential amino residues for the recognition of surface exposed phosphatidylserine within the calcium binding motifs common to all annexins. These amino acid residues were missing in the evolutionary young AnxA8 and when they were reintroduced by site directed mutagenesis AnxA8 gains the capability to interact with phosphatidylserine containing liposomes and apoptotic cells. By defining the evolutionary conserved amino acid residues mediating phosphatidylserine binding of annexins we show that the recognition of dying cells represent a common feature of most annexins. Hence, the individual annexin repertoire bound to the cell surface of dying cells may fulfil opsonin-like function in cell death recognition.

Competitive binding experiments can reduce the false positive results of affinity-based ultrafiltration-HPLC: A case study for identification of potent xanthine oxidase inhibitors from Perilla frutescens extract.

PubMed

Wang, Zhiqiang; Kwon, Shin Hwa; Hwang, Seung Hwan; Kang, Young-Hee; Lee, Jae-Yong; Lim, Soon Sung

2017-03-24

The purpose of this study was to assess the possibility of using competitive binding experiments with ultrafiltration-HPLC analysis to identify potent xanthine oxidase (XO) inhibitors from the Perilla frutescens extract as an attempt to reduce the number of false positive results. To isolate the enzyme-ligand complex from unbound compounds, the P. frutescens extract was either incubated in the absence of XO, in the presence of XO, or with the active site blocked XO before the ultrafiltration was performed. Allopurinaol was used as the XO active site blocker. The unbound compounds were subjected to HPLC analysis. The degree of total binding (TBD) and degree of specific binding (SBD) of each compound were calculated using the peak areas. TBD represents the binding affinities of compounds from the P. frutescens extract for the XO binding site. SBD represents the XO competitive binding between allopurinol and ligands from the extract samples. Two criteria were applied to select putative targets that could help avoid false positives. These include TBD>30% and SBD>10%. Using that approach, kaempferol-3-O-rutinoside, rosmarinic acid, methyl-rosmarinic acid, apigenin, and 4',5,7-trimethoxyflavone were identified, from total 11 compounds, as potent XO inhibitors. Finally, apigenin, 4',5,7-trimethoxyflavone, and luteolin were XO inhibitors verified through an XO inhibition assay and structural simulation of the complex. These results showed that the newly developed strategy has the advantage that the number of targets identified via ultrafiltration-HPLC can be narrowed from many false positives. However, not all false positives can be eliminated with this approach. Some potent inhibitors might also be excluded with the use of this method. The limitations of this method are also discussed herein. Copyright © 2017 Elsevier B.V. All rights reserved.

Integrative analysis of the Caenorhabditis elegans genome by the modENCODE project.

PubMed

Gerstein, Mark B; Lu, Zhi John; Van Nostrand, Eric L; Cheng, Chao; Arshinoff, Bradley I; Liu, Tao; Yip, Kevin Y; Robilotto, Rebecca; Rechtsteiner, Andreas; Ikegami, Kohta; Alves, Pedro; Chateigner, Aurelien; Perry, Marc; Morris, Mitzi; Auerbach, Raymond K; Feng, Xin; Leng, Jing; Vielle, Anne; Niu, Wei; Rhrissorrakrai, Kahn; Agarwal, Ashish; Alexander, Roger P; Barber, Galt; Brdlik, Cathleen M; Brennan, Jennifer; Brouillet, Jeremy Jean; Carr, Adrian; Cheung, Ming-Sin; Clawson, Hiram; Contrino, Sergio; Dannenberg, Luke O; Dernburg, Abby F; Desai, Arshad; Dick, Lindsay; Dosé, Andréa C; Du, Jiang; Egelhofer, Thea; Ercan, Sevinc; Euskirchen, Ghia; Ewing, Brent; Feingold, Elise A; Gassmann, Reto; Good, Peter J; Green, Phil; Gullier, Francois; Gutwein, Michelle; Guyer, Mark S; Habegger, Lukas; Han, Ting; Henikoff, Jorja G; Henz, Stefan R; Hinrichs, Angie; Holster, Heather; Hyman, Tony; Iniguez, A Leo; Janette, Judith; Jensen, Morten; Kato, Masaomi; Kent, W James; Kephart, Ellen; Khivansara, Vishal; Khurana, Ekta; Kim, John K; Kolasinska-Zwierz, Paulina; Lai, Eric C; Latorre, Isabel; Leahey, Amber; Lewis, Suzanna; Lloyd, Paul; Lochovsky, Lucas; Lowdon, Rebecca F; Lubling, Yaniv; Lyne, Rachel; MacCoss, Michael; Mackowiak, Sebastian D; Mangone, Marco; McKay, Sheldon; Mecenas, Desirea; Merrihew, Gennifer; Miller, David M; Muroyama, Andrew; Murray, John I; Ooi, Siew-Loon; Pham, Hoang; Phippen, Taryn; Preston, Elicia A; Rajewsky, Nikolaus; Rätsch, Gunnar; Rosenbaum, Heidi; Rozowsky, Joel; Rutherford, Kim; Ruzanov, Peter; Sarov, Mihail; Sasidharan, Rajkumar; Sboner, Andrea; Scheid, Paul; Segal, Eran; Shin, Hyunjin; Shou, Chong; Slack, Frank J; Slightam, Cindie; Smith, Richard; Spencer, William C; Stinson, E O; Taing, Scott; Takasaki, Teruaki; Vafeados, Dionne; Voronina, Ksenia; Wang, Guilin; Washington, Nicole L; Whittle, Christina M; Wu, Beijing; Yan, Koon-Kiu; Zeller, Georg; Zha, Zheng; Zhong, Mei; Zhou, Xingliang; Ahringer, Julie; Strome, Susan; Gunsalus, Kristin C; Micklem, Gos; Liu, X Shirley; Reinke, Valerie; Kim, Stuart K; Hillier, LaDeana W; Henikoff, Steven; Piano, Fabio; Snyder, Michael; Stein, Lincoln; Lieb, Jason D; Waterston, Robert H

2010-12-24

We systematically generated large-scale data sets to improve genome annotation for the nematode Caenorhabditis elegans, a key model organism. These data sets include transcriptome profiling across a developmental time course, genome-wide identification of transcription factor-binding sites, and maps of chromatin organization. From this, we created more complete and accurate gene models, including alternative splice forms and candidate noncoding RNAs. We constructed hierarchical networks of transcription factor-binding and microRNA interactions and discovered chromosomal locations bound by an unusually large number of transcription factors. Different patterns of chromatin composition and histone modification were revealed between chromosome arms and centers, with similarly prominent differences between autosomes and the X chromosome. Integrating data types, we built statistical models relating chromatin, transcription factor binding, and gene expression. Overall, our analyses ascribed putative functions to most of the conserved genome.

New insights into the catalytic mechanism of Bombyx mori prostaglandin E synthase gained from structure–function analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp; Suzuki, Mamoru; Higashiura, Akifumi

2013-11-01

Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolutionmore » of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.« less

Recognition of DNA abasic site nanocavity by fluorophore-switched probe: Suitable for all sequence environments

NASA Astrophysics Data System (ADS)

Wang, Ying; Hu, Yuehua; Wu, Tao; Zhang, Lihua; Liu, Hua; Zhou, Xiaoshun; Shao, Yong

2016-01-01

Removal of a damaged base in DNA produces an abasic site (AP site) nanocavity. If left un-repaired in vivo by the specific enzyme, this nanocavity will result in nucleotide mutation in the following DNA replication. Therefore, selective recognition of AP site nanocavity by small molecules is important for identification of such DNA damage and development of genetic drugs. In this work, we investigate the fluorescence behavior of isoquinoline alkaloids including palmatine (PAL), berberine (BER), epiberberine (EPI), jatrorrhizine (JAT), coptisine (COP), coralyne (COR), worenine (WOR), berberrubine (BEU), sanguinarine (SAN), chelerythrine (CHE), and nitidine (NIT) upon binding with the AP nanocavity. PAL is screened out as the most efficient fluorophore-switched probe to recognize the AP nanocavity over the fully matched DNA. Its fluorescence enhancement occurs for all of the AP nanocavity sequence environments, which has not been achieved by the previously used probes. The bridged π conjugation effect should partially contribute to the AP nanocavity-specific fluorescence, as opposed to the solvent effect. Due to the strong binding with the AP nanocavity, PAL will find wide applications in the DNA damage recognition and sensor development.

Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

2003-06-01

OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less

Crystal structures of the M 1 and M 4 muscarinic acetylcholine receptors

DOE PAGES

Thal, David M.; Sun, Bingfa; Feng, Dan; ...

2016-03-09

Muscarinic M1–M5 acetylcholine receptors are G-protein-coupled receptors that regulate many vital functions of the central and peripheral nervous systems. In particular, the M1 and M4 receptor subtypes have emerged as attractive drug targets for treatments of neurological disorders, such as Alzheimer’s disease and schizophrenia, but the high conservation of the acetylcholine-binding pocket has spurred current research into targeting allosteric sites on these receptors. In this paper, we report the crystal structures of the M1 and M4 muscarinic receptors bound to the inverse agonist, tiotropium. Comparison of these structures with each other, as well as with the previously reported M2 andmore » M3 receptor structures, reveals differences in the orthosteric and allosteric binding sites that contribute to a role in drug selectivity at this important receptor family. Finally, we also report identification of a cluster of residues that form a network linking the orthosteric and allosteric sites of the M4 receptor, which provides new insight into how allosteric modulation may be transmitted between the two spatially distinct domains.« less

Crystal structures of the M 1 and M 4 muscarinic acetylcholine receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thal, David M.; Sun, Bingfa; Feng, Dan

Muscarinic M1–M5 acetylcholine receptors are G-protein-coupled receptors that regulate many vital functions of the central and peripheral nervous systems. In particular, the M1 and M4 receptor subtypes have emerged as attractive drug targets for treatments of neurological disorders, such as Alzheimer’s disease and schizophrenia, but the high conservation of the acetylcholine-binding pocket has spurred current research into targeting allosteric sites on these receptors. In this paper, we report the crystal structures of the M1 and M4 muscarinic receptors bound to the inverse agonist, tiotropium. Comparison of these structures with each other, as well as with the previously reported M2 andmore » M3 receptor structures, reveals differences in the orthosteric and allosteric binding sites that contribute to a role in drug selectivity at this important receptor family. Finally, we also report identification of a cluster of residues that form a network linking the orthosteric and allosteric sites of the M4 receptor, which provides new insight into how allosteric modulation may be transmitted between the two spatially distinct domains.« less

Structure-based CoMFA as a predictive model - CYP2C9 inhibitors as a test case.

PubMed

Yasuo, Kazuya; Yamaotsu, Noriyuki; Gouda, Hiroaki; Tsujishita, Hideki; Hirono, Shuichi

2009-04-01

In this study, we tried to establish a general scheme to create a model that could predict the affinity of small compounds to their target proteins. This scheme consists of a search for ligand-binding sites on a protein, a generation of bound conformations (poses) of ligands in each of the sites by docking, identifications of the correct poses of each ligand by consensus scoring and MM-PBSA analysis, and a construction of a CoMFA model with the obtained poses to predict the affinity of the ligands. By using a crystal structure of CYP 2C9 and the twenty known CYP inhibitors as a test case, we obtained a CoMFA model with a good statistics, which suggested that the classification of the binding sites as well as the predicted bound poses of the ligands should be reasonable enough. The scheme described here would give a method to predict the affinity of small compounds with a reasonable accuracy, which is expected to heighten the value of computational chemistry in the drug design process.

Hierarchy within the mammary STAT5-driven Wap super-enhancer.

PubMed

Shin, Ha Youn; Willi, Michaela; HyunYoo, Kyung; Zeng, Xianke; Wang, Chaochen; Metser, Gil; Hennighausen, Lothar

2016-08-01

Super-enhancers comprise dense transcription factor platforms highly enriched for active chromatin marks. A paucity of functional data led us to investigate the role of super-enhancers in the mammary gland, an organ characterized by exceptional gene regulatory dynamics during pregnancy. ChIP-seq analysis for the master regulator STAT5A, the glucocorticoid receptor, H3K27ac and MED1 identified 440 mammary-specific super-enhancers, half of which were associated with genes activated during pregnancy. We interrogated the Wap super-enhancer, generating mice carrying mutations in STAT5-binding sites within its constituent enhancers. Individually, the most distal site displayed the greatest enhancer activity. However, combinatorial mutation analysis showed that the 1,000-fold induction in gene expression during pregnancy relied on all enhancers. Disabling the binding sites of STAT5, NFIB and ELF5 in the proximal enhancer incapacitated the entire super-enhancer. Altogether, these data suggest a temporal and functional enhancer hierarchy. The identification of mammary-specific super-enhancers and the mechanistic exploration of the Wap locus provide insights into the regulation of cell-type-specific expression of hormone-sensing genes.

G-quadruplex RNA binding and recognition by the lysine-specific histone demethylase-1 enzyme.

PubMed

Hirschi, Alexander; Martin, William J; Luka, Zigmund; Loukachevitch, Lioudmila V; Reiter, Nicholas J

2016-08-01

Lysine-specific histone demethylase 1 (LSD1) is an essential epigenetic regulator in metazoans and requires the co-repressor element-1 silencing transcription factor (CoREST) to efficiently catalyze the removal of mono- and dimethyl functional groups from histone 3 at lysine positions 4 and 9 (H3K4/9). LSD1 interacts with over 60 regulatory proteins and also associates with lncRNAs (TERRA, HOTAIR), suggesting a regulatory role for RNA in LSD1 function. We report that a stacked, intramolecular G-quadruplex (GQ) forming TERRA RNA (GG[UUAGGG]8UUA) binds tightly to the functional LSD1-CoREST complex (Kd ≈ 96 nM), in contrast to a single GQ RNA unit ([UUAGGG]4U), a GQ DNA ([TTAGGG]4T), or an unstructured single-stranded RNA. Stabilization of a parallel-stranded GQ RNA structure by monovalent potassium ions (K(+)) is required for high affinity binding to the LSD1-CoREST complex. These data indicate that LSD1 can distinguish between RNA and DNA as well as structured versus unstructured nucleotide motifs. Further, cross-linking mass spectrometry identified the primary location of GQ RNA binding within the SWIRM/amine oxidase domain (AOD) of LSD1. An ssRNA binding region adjacent to this GQ binding site was also identified via X-ray crystallography. This RNA binding interface is consistent with kinetic assays, demonstrating that a GQ-forming RNA can serve as a noncompetitive inhibitor of LSD1-catalyzed demethylation. The identification of a GQ RNA binding site coupled with kinetic data suggests that structured RNAs can function as regulatory molecules in LSD1-mediated mechanisms. © 2016 Hirschi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

G-quadruplex RNA binding and recognition by the lysine-specific histone demethylase-1 enzyme

PubMed Central

Hirschi, Alexander; Martin, William J.; Luka, Zigmund; Loukachevitch, Lioudmila V.; Reiter, Nicholas J.

2016-01-01

Lysine-specific histone demethylase 1 (LSD1) is an essential epigenetic regulator in metazoans and requires the co-repressor element-1 silencing transcription factor (CoREST) to efficiently catalyze the removal of mono- and dimethyl functional groups from histone 3 at lysine positions 4 and 9 (H3K4/9). LSD1 interacts with over 60 regulatory proteins and also associates with lncRNAs (TERRA, HOTAIR), suggesting a regulatory role for RNA in LSD1 function. We report that a stacked, intramolecular G-quadruplex (GQ) forming TERRA RNA (GG[UUAGGG]8UUA) binds tightly to the functional LSD1–CoREST complex (Kd ≈ 96 nM), in contrast to a single GQ RNA unit ([UUAGGG]4U), a GQ DNA ([TTAGGG]4T), or an unstructured single-stranded RNA. Stabilization of a parallel-stranded GQ RNA structure by monovalent potassium ions (K+) is required for high affinity binding to the LSD1–CoREST complex. These data indicate that LSD1 can distinguish between RNA and DNA as well as structured versus unstructured nucleotide motifs. Further, cross-linking mass spectrometry identified the primary location of GQ RNA binding within the SWIRM/amine oxidase domain (AOD) of LSD1. An ssRNA binding region adjacent to this GQ binding site was also identified via X-ray crystallography. This RNA binding interface is consistent with kinetic assays, demonstrating that a GQ-forming RNA can serve as a noncompetitive inhibitor of LSD1-catalyzed demethylation. The identification of a GQ RNA binding site coupled with kinetic data suggests that structured RNAs can function as regulatory molecules in LSD1-mediated mechanisms. PMID:27277658

Binding of uridine 5'-diphosphate in the "basic patch" of the zinc deacetylase LpxC and implications for substrate binding.

PubMed

Gennadios, Heather A; Christianson, David W

2006-12-26

LpxC is a zinc metalloenzyme that catalyzes the first committed step in the biosynthesis of lipid A, a vital component of the outer membrane of Gram-negative bacteria. Accordingly, the inhibition of LpxC is an attractive strategy for the treatment of Gram-negative bacterial infections. Here, we report the 2.7 A resolution X-ray crystal structure of LpxC from Aquifex aeolicus complexed with uridine 5'-diphosphate (UDP), and the 3.1 A resolution structure of LpxC complexed with pyrophosphate. The X-ray crystal structure of the LpxC-UDP complex provides the first view of interactions likely to be exploited by the substrate UDP group in the "basic patch" of the active site. The diphosphate group of UDP makes hydrogen bond interactions with strictly conserved residue K239 as well as solvent molecules. The ribose moiety of UDP interacts with partially conserved residue E197. The UDP uracil group hydrogen bonds with both the backbone NH group and the backbone carbonyl group of E160, and with the backbone NH group of K162 through an intervening water molecule. Finally, the alpha-phosphate and uracil groups of UDP interact with R143 and R262 through intervening water molecules. The structure of LpxC complexed with pyrophosphate reveals generally similar intermolecular interactions in the basic patch. Unexpectedly, diphosphate binding in both complexes is accompanied by coordination to an additional zinc ion, resulting in the identification of a new metal-binding site termed the E-site. The structures of the LpxC-UDP and LpxC-pyrophosphate complexes provide new insights with regard to substrate recognition in the basic patch and metal ion coordination in the active site of LpxC.

Dynamics Govern Specificity of a Protein-Protein Interface: Substrate Recognition by Thrombin.

PubMed

Fuchs, Julian E; Huber, Roland G; Waldner, Birgit J; Kahler, Ursula; von Grafenstein, Susanne; Kramer, Christian; Liedl, Klaus R

2015-01-01

Biomolecular recognition is crucial in cellular signal transduction. Signaling is mediated through molecular interactions at protein-protein interfaces. Still, specificity and promiscuity of protein-protein interfaces cannot be explained using simplistic static binding models. Our study rationalizes specificity of the prototypic protein-protein interface between thrombin and its peptide substrates relying solely on binding site dynamics derived from molecular dynamics simulations. We find conformational selection and thus dynamic contributions to be a key player in biomolecular recognition. Arising entropic contributions complement chemical intuition primarily reflecting enthalpic interaction patterns. The paradigm "dynamics govern specificity" might provide direct guidance for the identification of specific anchor points in biomolecular recognition processes and structure-based drug design.

Molecular mechanisms of floral organ specification by MADS domain proteins.

PubMed

Yan, Wenhao; Chen, Dijun; Kaufmann, Kerstin

2016-02-01

Flower development is a model system to understand organ specification in plants. The identities of different types of floral organs are specified by homeotic MADS transcription factors that interact in a combinatorial fashion. Systematic identification of DNA-binding sites and target genes of these key regulators show that they have shared and unique sets of target genes. DNA binding by MADS proteins is not based on 'simple' recognition of a specific DNA sequence, but depends on DNA structure and combinatorial interactions. Homeotic MADS proteins regulate gene expression via alternative mechanisms, one of which may be to modulate chromatin structure and accessibility in their target gene promoters. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification of the Regulon of AphB and Its Essential Roles in LuxR and Exotoxin Asp Expression in the Pathogen Vibrio alginolyticus.

PubMed

Gao, Xiating; Liu, Yang; Liu, Huan; Yang, Zhen; Liu, Qin; Zhang, Yuanxing; Wang, Qiyao

2017-10-15

In Vibrio species, AphB is essential to activate virulence cascades by sensing low-pH and anaerobiosis signals; however, its regulon remains largely unknown. Here, AphB is found to be a key virulence regulator in Vibrio alginolyticus , a pathogen for marine animals and humans. Chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq) enabled the detection of 20 loci in the V. alginolyticus genome that contained AphB-binding peaks. An AphB-specific binding consensus was confirmed by electrophoretic mobility shift assays (EMSAs), and the regulation of genes flanking such binding sites was demonstrated using quantitative real-time PCR analysis. AphB binds directly to its own promoter and positively controls its own expression in later growth stages. AphB also activates the expression of the exotoxin Asp by binding directly to the promoter regions of asp and the master quorum-sensing (QS) regulator luxR DNase I footprinting analysis uncovered distinct AphB-binding sites (BBS) in these promoters. Furthermore, a BBS in the luxR promoter region overlaps that of LuxR-binding site I, which mediates the positive control of luxR promoter activity by AphB. This study provides new insights into the AphB regulon and reveals the mechanisms underlying AphB regulation of physiological adaptation and QS-controlled virulence in V. alginolyticus IMPORTANCE In this work, AphB is determined to play essential roles in the expression of genes associated with QS, physiology, and virulence in V. alginolyticus , a pathogen for marine animals and humans. AphB was found to bind directly to 20 genes and control their expression by a 17-bp consensus binding sequence. Among the 20 genes, the aphB gene itself was identified to be positively autoregulated, and AphB also positively controlled asp and luxR expression. Taken together, these findings improve our understanding of the roles of AphB in controlling physiological adaptation and QS-controlled virulence gene expression. Copyright © 2017 American Society for Microbiology.

A genome-wide structure-based survey of nucleotide binding proteins in M. tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhagavat, Raghu; Kim, Heung -Bok; Kim, Chang -Yub

Nucleoside tri-phosphates (NTP) form an important class of small molecule ligands that participate in, and are essential to a large number of biological processes. Here, we seek to identify the NTP binding proteome (NTPome) in M. tuberculosis (M.tb), a deadly pathogen. Identifying the NTPome is useful not only for gaining functional insights of the individual proteins but also for identifying useful drug targets. From an earlier study, we had structural models of M.tb at a proteome scale from which a set of 13,858 small molecule binding pockets were identified. We use a set of NTP binding sub-structural motifs derived frommore » a previous study and scan the M.tb pocketome, and find that 1,768 proteins or 43% of the proteome can theoretically bind NTP ligands. Using an experimental proteomics approach involving dye-ligand affinity chromatography, we confirm NTP binding to 47 different proteins, of which 4 are hypothetical proteins. Our analysis also provides the precise list of binding site residues in each case, and the probable ligand binding pose. In conclusion, as the list includes a number of known and potential drug targets, the identification of NTP binding can directly facilitate structure-based drug design of these targets.« less

Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

PubMed Central

Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

2010-01-01

The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

A genome-wide structure-based survey of nucleotide binding proteins in M. tuberculosis

DOE PAGES

Bhagavat, Raghu; Kim, Heung -Bok; Kim, Chang -Yub; ...

2017-10-02

Nucleoside tri-phosphates (NTP) form an important class of small molecule ligands that participate in, and are essential to a large number of biological processes. Here, we seek to identify the NTP binding proteome (NTPome) in M. tuberculosis (M.tb), a deadly pathogen. Identifying the NTPome is useful not only for gaining functional insights of the individual proteins but also for identifying useful drug targets. From an earlier study, we had structural models of M.tb at a proteome scale from which a set of 13,858 small molecule binding pockets were identified. We use a set of NTP binding sub-structural motifs derived frommore » a previous study and scan the M.tb pocketome, and find that 1,768 proteins or 43% of the proteome can theoretically bind NTP ligands. Using an experimental proteomics approach involving dye-ligand affinity chromatography, we confirm NTP binding to 47 different proteins, of which 4 are hypothetical proteins. Our analysis also provides the precise list of binding site residues in each case, and the probable ligand binding pose. In conclusion, as the list includes a number of known and potential drug targets, the identification of NTP binding can directly facilitate structure-based drug design of these targets.« less

Identification of a New cry1I-Type Gene as a Candidate for Gene Pyramiding in Corn To Control Ostrinia Species Larvae

PubMed Central

Zhao, Can; Abdelgaffar, Heba M.; Pan, Hongyu; Song, Fuping

2015-01-01

Pyramiding of diverse cry toxin genes from Bacillus thuringiensis with different modes of action is a desirable strategy to delay the evolution of resistance in the European corn borer (Ostrinia nubilalis). Considering the dependency of susceptibility to Cry toxins on toxin binding to receptors in the midgut of target pests, a diverse mode of action is commonly defined as recognition of unique binding sites in the target insect. In this study, we present a novel cry1Ie toxin gene (cry1Ie2) as a candidate for pyramiding with Cry1Ab or Cry1Fa in corn to control Ostrinia species larvae. The new toxin gene encodes an 81-kDa protein that is processed to a protease-resistant core form of approximately 55 kDa by trypsin digestion. The purified protoxin displayed high toxicity to Ostrinia furnacalis and O. nubilalis larvae but low to no activity against Spodoptera or heliothine species or the coleopteran Tenebrio molitor. Results of binding assays with 125I-labeled Cry1Ab toxin and brush border membrane vesicles from O. nubilalis larvae demonstrated that Cry1Ie2 does not recognize the Cry1Ab binding sites in that insect. Reciprocal competition binding assays with biotin-labeled Cry1Ie2 confirmed the lack of shared sites with Cry1Ab or Cry1Fa in O. nubilalis brush border membrane vesicles. These data support Cry1Ie2 as a good candidate for pyramiding with Cry1Ab or Cry1Fa in corn to increase the control of O. nubilalis and reduce the risk of resistance evolution. PMID:25795679

Identification of a New cry1I-Type Gene as a Candidate for Gene Pyramiding in Corn To Control Ostrinia Species Larvae.

PubMed

Zhao, Can; Jurat-Fuentes, Juan Luis; Abdelgaffar, Heba M; Pan, Hongyu; Song, Fuping; Zhang, Jie

2015-06-01

Pyramiding of diverse cry toxin genes from Bacillus thuringiensis with different modes of action is a desirable strategy to delay the evolution of resistance in the European corn borer (Ostrinia nubilalis). Considering the dependency of susceptibility to Cry toxins on toxin binding to receptors in the midgut of target pests, a diverse mode of action is commonly defined as recognition of unique binding sites in the target insect. In this study, we present a novel cry1Ie toxin gene (cry1Ie2) as a candidate for pyramiding with Cry1Ab or Cry1Fa in corn to control Ostrinia species larvae. The new toxin gene encodes an 81-kDa protein that is processed to a protease-resistant core form of approximately 55 kDa by trypsin digestion. The purified protoxin displayed high toxicity to Ostrinia furnacalis and O. nubilalis larvae but low to no activity against Spodoptera or heliothine species or the coleopteran Tenebrio molitor. Results of binding assays with (125)I-labeled Cry1Ab toxin and brush border membrane vesicles from O. nubilalis larvae demonstrated that Cry1Ie2 does not recognize the Cry1Ab binding sites in that insect. Reciprocal competition binding assays with biotin-labeled Cry1Ie2 confirmed the lack of shared sites with Cry1Ab or Cry1Fa in O. nubilalis brush border membrane vesicles. These data support Cry1Ie2 as a good candidate for pyramiding with Cry1Ab or Cry1Fa in corn to increase the control of O. nubilalis and reduce the risk of resistance evolution. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

PubMed Central

Damienikan, Aliaksandr U.

2016-01-01

The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

Direct labelling of the human P2X7 receptor and identification of positive and negative cooperativity of binding.

PubMed

Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P

2007-05-01

The P2X(7) receptor exhibits complex pharmacological properties. In this study, binding of a [(3)H]-labelled P2X(7) receptor antagonist to human P2X(7) receptors has been examined to further understand ligand interactions with this receptor. The P2X(7) receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.1(3,7)]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X(7) receptors. Binding of [(3)H]-compound-17 was higher in membranes prepared from cells expressing P2X(7) receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X(7) receptors. Binding was reversible, saturable and modulated by P2X(7) receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. These data demonstrate that human P2X(7) receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X(7) receptor complex enhances subsequent binding to other P2X(7) subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X(7) receptor.

Direct labelling of the human P2X7 receptor and identification of positive and negative cooperativity of binding

PubMed Central

Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P

2007-01-01

Background and Purpose: The P2X7 receptor exhibits complex pharmacological properties. In this study, binding of a [3H]-labelled P2X7 receptor antagonist to human P2X7 receptors has been examined to further understand ligand interactions with this receptor. Experimental Approach: The P2X7 receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.13,7]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X7 receptors. Key Results: Binding of [3H]-compound-17 was higher in membranes prepared from cells expressing P2X7 receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X7 receptors. Binding was reversible, saturable and modulated by P2X7 receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. Conclusions: These data demonstrate that human P2X7 receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X7 receptor complex enhances subsequent binding to other P2X7 subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X7 receptor. PMID:17339830

Identification of a New Zinc Binding Chemotype by Fragment Screening.

PubMed

Chrysanthopoulos, Panagiotis K; Mujumdar, Prashant; Woods, Lucy A; Dolezal, Olan; Ren, Bin; Peat, Thomas S; Poulsen, Sally-Ann

2017-09-14

The discovery of a new zinc binding chemotype from screening a nonbiased fragment library is reported. Using the orthogonal fragment screening methods of native state mass spectrometry and surface plasmon resonance a 3-unsubstituted 2,4-oxazolidinedione fragment was found to have low micromolar binding affinity to the zinc metalloenzyme carbonic anhydrase II (CA II). This affinity approached that of fragment sized primary benzenesulfonamides, the classical zinc binding group found in most CA II inhibitors. Protein X-ray crystallography established that 3-unsubstituted 2,4-oxazolidinediones bound to CA II via an interaction of the acidic ring nitrogen with the CA II active site zinc, as well as two hydrogen bonds between the oxazolidinedione ring oxygen and the CA II protein backbone. Furthermore, 3-unsubstituted 2,4-oxazolidinediones appear to be a viable starting point for the development of an alternative class of CA inhibitor, wherein the medicinal chemistry pedigree of primary sulfonamides has dominated for several decades.

L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

PubMed Central

Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi

2017-01-01

The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer. PMID:28245558

Consensus Induced Fit Docking (cIFD): methodology, validation, and application to the discovery of novel Crm1 inhibitors

NASA Astrophysics Data System (ADS)

Kalid, Ori; Toledo Warshaviak, Dora; Shechter, Sharon; Sherman, Woody; Shacham, Sharon

2012-11-01

We present the Consensus Induced Fit Docking (cIFD) approach for adapting a protein binding site to accommodate multiple diverse ligands for virtual screening. This novel approach results in a single binding site structure that can bind diverse chemotypes and is thus highly useful for efficient structure-based virtual screening. We first describe the cIFD method and its validation on three targets that were previously shown to be challenging for docking programs (COX-2, estrogen receptor, and HIV reverse transcriptase). We then demonstrate the application of cIFD to the challenging discovery of irreversible Crm1 inhibitors. We report the identification of 33 novel Crm1 inhibitors, which resulted from the testing of 402 purchased compounds selected from a screening set containing 261,680 compounds. This corresponds to a hit rate of 8.2 %. The novel Crm1 inhibitors reveal diverse chemical structures, validating the utility of the cIFD method in a real-world drug discovery project. This approach offers a pragmatic way to implicitly account for protein flexibility without the additional computational costs of ensemble docking or including full protein flexibility during virtual screening.

Structural basis for ligand recognition at the benzodiazepine binding site of GABAA alpha 3 receptor, and pharmacophore-based virtual screening approach.

PubMed

Vijayan, R S K; Ghoshal, Nanda

2008-10-01

Given the heterogeneity of GABA(A) receptor, the pharmacological significance of identifying subtype selective modulators is increasingly being recognized. Thus, drugs selective for GABA(A) alpha(3) receptors are expected to display fewer side effects than the drugs presently in clinical use. Hence we carried out 3D QSAR (three-dimensional quantitative structure-activity relationship) studies on a series of novel GABA(A) alpha(3) subtype selective modulators to gain more insight into subtype affinity. To identify the 3D functional attributes required for subtype selectivity, a chemical feature-based pharmacophore, primarily based on selective ligands representing diverse structural classes was generated. The obtained pseudo receptor model of the benzodiazepine binding site revealed a binding mode akin to "Message-Address" concept. Scaffold hopping was carried out across multi-conformational May Bridge database for the identification of novel chemotypes. Further a focused data reduction approach was employed to choose a subset of enriched compounds based on "Drug likeness" and "Similarity-based" methods. These results taken together could provide impetus for rational design and optimization of more selective and high affinity leads with a potential to have decreased adverse effects.

Scan for Motifs: a webserver for the analysis of post-transcriptional regulatory elements in the 3' untranslated regions (3' UTRs) of mRNAs.

PubMed

Biswas, Ambarish; Brown, Chris M

2014-06-08

Gene expression in vertebrate cells may be controlled post-transcriptionally through regulatory elements in mRNAs. These are usually located in the untranslated regions (UTRs) of mRNA sequences, particularly the 3'UTRs. Scan for Motifs (SFM) simplifies the process of identifying a wide range of regulatory elements on alignments of vertebrate 3'UTRs. SFM includes identification of both RNA Binding Protein (RBP) sites and targets of miRNAs. In addition to searching pre-computed alignments, the tool provides users the flexibility to search their own sequences or alignments. The regulatory elements may be filtered by expected value cutoffs and are cross-referenced back to their respective sources and literature. The output is an interactive graphical representation, highlighting potential regulatory elements and overlaps between them. The output also provides simple statistics and links to related resources for complementary analyses. The overall process is intuitive and fast. As SFM is a free web-application, the user does not need to install any software or databases. Visualisation of the binding sites of different classes of effectors that bind to 3'UTRs will facilitate the study of regulatory elements in 3' UTRs.

DROMPA: easy-to-handle peak calling and visualization software for the computational analysis and validation of ChIP-seq data.

PubMed

Nakato, Ryuichiro; Itoh, Tahehiko; Shirahige, Katsuhiko

2013-07-01

Chromatin immunoprecipitation with high-throughput sequencing (ChIP-seq) can identify genomic regions that bind proteins involved in various chromosomal functions. Although the development of next-generation sequencers offers the technology needed to identify these protein-binding sites, the analysis can be computationally challenging because sequencing data sometimes consist of >100 million reads/sample. Herein, we describe a cost-effective and time-efficient protocol that is generally applicable to ChIP-seq analysis; this protocol uses a novel peak-calling program termed DROMPA to identify peaks and an additional program, parse2wig, to preprocess read-map files. This two-step procedure drastically reduces computational time and memory requirements compared with other programs. DROMPA enables the identification of protein localization sites in repetitive sequences and efficiently identifies both broad and sharp protein localization peaks. Specifically, DROMPA outputs a protein-binding profile map in pdf or png format, which can be easily manipulated by users who have a limited background in bioinformatics. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

EBP1 is a novel E2F target gene regulated by transforming growth factor-β.

PubMed

Judah, David; Chang, Wing Y; Dagnino, Lina

2010-11-10

Regulation of gene expression requires transcription factor binding to specific DNA elements, and a large body of work has focused on the identification of such sequences. However, it is becoming increasingly clear that eukaryotic transcription factors can exhibit widespread, nonfunctional binding to genomic DNA sites. Conversely, some of these proteins, such as E2F, can also modulate gene expression by binding to non-consensus elements. E2F comprises a family of transcription factors that play key roles in a wide variety of cellular functions, including survival, differentiation, activation during tissue regeneration, metabolism, and proliferation. E2F factors bind to the Erb3-binding protein 1 (EBP1) promoter in live cells. We now show that E2F binding to the EBP1 promoter occurs through two tandem DNA elements that do not conform to typical consensus E2F motifs. Exogenously expressed E2F1 activates EBP1 reporters lacking one, but not both sites, suggesting a degree of redundancy under certain conditions. E2F1 increases the levels of endogenous EBP1 mRNA in breast carcinoma and other transformed cell lines. In contrast, in non-transformed primary epidermal keratinocytes, E2F, together with the retinoblastoma family of proteins, appears to be involved in decreasing EBP1 mRNA abundance in response to growth inhibition by transforming growth factor-β1. Thus, E2F is likely a central coordinator of multiple responses that culminate in regulation of EBP1 gene expression, and which may vary depending on cell type and context.

Identification of the target DNA sequence and characterization of DNA binding features of HlyU, and suggestion of a redox switch for hlyA expression in the human pathogen Vibrio cholerae from in silico studies.

PubMed

Mukherjee, Debadrita; Pal, Aritrika; Chakravarty, Devlina; Chakrabarti, Pinak

2015-02-18

HlyU, a transcriptional regulator common in many Vibrio species, activates the hemolysin gene hlyA in Vibrio cholerae, the rtxA1 operon in Vibrio vulnificus and the genes of plp-vah1 and rtxACHBDE gene clusters in Vibrio anguillarum. The protein is also proposed to be a potential global virulence regulator for V. cholerae and V. vulnificus. Mechanisms of gene control by HlyU in V. vulnificus and V. anguillarum are reported. However, detailed elucidation of the interaction of HlyU in V. cholerae with its target DNA at the molecular level is not available. Here we report a 17-bp imperfect palindrome sequence, 5'-TAATTCAGACTAAATTA-3', 173 bp upstream of hlyA promoter, as the binding site of HlyU. This winged helix-turn-helix protein binds necessarily as a dimer with the recognition helices contacting the major grooves and the β-sheet wings, the minor grooves. Such interactions enhance hlyA promoter activity in vivo. Mutations affecting dimerization as well as those in the DNA-protein interface hamper DNA binding and transcription regulation. Molecular dynamic simulations show hydrogen bonding patterns involving residues at the mutation sites and confirmed their importance in DNA binding. On binding to HlyU, DNA deviates by ∼68º from linearity. Dynamics also suggest a possible redox control in HlyU. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genome wide approaches to identify protein-DNA interactions.

PubMed

Ma, Tao; Ye, Zhenqing; Wang, Liguo

2018-05-29

Transcription factors are DNA-binding proteins that play key roles in many fundamental biological processes. Unraveling their interactions with DNA is essential to identify their target genes and understand the regulatory network. Genome-wide identification of their binding sites became feasible thanks to recent progress in experimental and computational approaches. ChIP-chip, ChIP-seq, and ChIP-exo are three widely used techniques to demarcate genome-wide transcription factor binding sites. This review aims to provide an overview of these three techniques including their experiment procedures, computational approaches, and popular analytic tools. ChIP-chip, ChIP-seq, and ChIP-exo have been the major techniques to study genome-wide in vivo protein-DNA interaction. Due to the rapid development of next-generation sequencing technology, array-based ChIP-chip is deprecated and ChIP-seq has become the most widely used technique to identify transcription factor binding sites in genome-wide. The newly developed ChIP-exo further improves the spatial resolution to single nucleotide. Numerous tools have been developed to analyze ChIP-chip, ChIP-seq and ChIP-exo data. However, different programs may employ different mechanisms or underlying algorithms thus each will inherently include its own set of statistical assumption and bias. So choosing the most appropriate analytic program for a given experiment needs careful considerations. Moreover, most programs only have command line interface so their installation and usage will require basic computation expertise in Unix/Linux. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Molecular identification and transcriptional regulation of porcine IFIT2 gene.

PubMed

Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

2018-04-06

IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

Crystal Structure of PhnF, a GntR-Family Transcriptional Regulator of Phosphate Transport in Mycobacterium smegmatis

PubMed Central

Busby, Jason N.; Fritz, Georg; Moreland, Nicole J.; Cook, Gregory M.; Lott, J. Shaun; Baker, Edward N.

2014-01-01

Bacterial uptake of phosphate is usually accomplished via high-affinity transporters that are commonly regulated by two-component systems, which are activated when the concentration of phosphate is low. Mycobacterium smegmatis possesses two such transporters, the widely distributed PstSCAB system and PhnDCE, a transporter that in other bacteria mediates the uptake of alternative phosphorus sources. We previously reported that the transcriptional regulator PhnF controls the production of the Phn system, acting as a repressor under high-phosphate conditions. Here we show that the phnDCE genes are common among environmental mycobacteria, where they are often associated with phnF-like genes. In contrast, pathogenic mycobacteria were not found to encode Phn-like systems but instead were found to possess multiple copies of the pst genes. A detailed biochemical analysis of PhnF binding to its identified binding sites in the phnD-phnF intergenic region of M. smegmatis has allowed us to propose a quantitative model for repressor binding, which shows that a PhnF dimer binds independently to each site. We present the crystal structure of M. smegmatis PhnF at 1.8-Å resolution, showing a homodimer with a helix-turn-helix N-terminal domain and a C-terminal domain with a UbiC transcription regulator-associated fold. The C-terminal domain crystallized with a bound sulfate ion instead of the so far unidentified physiological ligand, allowing the identification of residues involved in effector binding. Comparison of the positioning of the DNA binding domains in PhnF with that in homologous proteins suggests that its DNA binding activity is regulated via a conformational change in the linker region, triggering a movement of the N-terminal domains. PMID:25049090

Identification of a second binding site on the TRIM25 B30.2 domain.

PubMed

D'Cruz, Akshay A; Kershaw, Nadia J; Hayman, Thomas J; Linossi, Edmond M; Chiang, Jessica J; Wang, May K; Dagley, Laura F; Kolesnik, Tatiana B; Zhang, Jian-Guo; Masters, Seth L; Griffin, Michael D W; Gack, Michaela U; Murphy, James M; Nicola, Nicos A; Babon, Jeffrey J; Nicholson, Sandra E

2018-01-23

The r etinoic acid- i nducible g ene- I (RIG-I) receptor recognizes short 5'-di- and triphosphate base-paired viral RNA and is a critical mediator of the innate immune response against viruses such as influenza A, Ebola, HIV and hepatitis C. This response is reported to require an orchestrated interaction with the tri partite m otif 25 (TRIM25) B30.2 protein-interaction domain. Here, we present a novel second RIG-I-binding interface on the TRIM25 B30.2 domain that interacts with CARD1 and CARD2 ( c aspase a ctivation and r ecruitment d omains) of RIG-I and is revealed by the removal of an N-terminal α-helix that mimics dimerization of the full-length protein. Further characterization of the TRIM25 coiled-coil and B30.2 regions indicated that the B30.2 domains move freely on a flexible tether, facilitating RIG-I CARD recruitment. The identification of a dual binding mode for the TRIM25 B30.2 domain is a first for the SPRY/B30.2 domain family and may be a feature of other SPRY/B30.2 family members. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Identification and characterization of a nuclear localization signal of TRIM28 that overlaps with the HP1 box

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moriyama, Tetsuji; Sangel, Percival; Yamaguchi, Hiroki

2015-07-03

Tripartite motif-containing 28 (TRIM28) is a transcription regulator, which forms a repressor complex containing heterochromatin protein 1 (HP1). Here, we report identification of a nuclear localization signal (NLS) within the 462-494 amino acid region of TRIM28 that overlaps with its HP1 binding site, HP1 box. GST-pulldown experiments revealed the interaction of the arginine-rich TRIM28 NLS with various importin α subtypes (α1, α2 and α4). In vitro transport assay demonstrated that nuclear localization of GFP-TRIM28 NLS is mediated by importin αs, in conjunction with importin β1 and Ran. Further, we demonstrated that HP1 and importin αs compete for binding to TRIM28. Together,more » our findings suggest that importin α has an essential role in the nuclear delivery and preferential HP1 interaction of TRIM28. - Highlights: • TRIM28 contains an NLS within the 462-494 amino acid region. • The nuclear import of TRIM28 is mediated by importin α/importin β1. • TRIM28 NLS overlaps with HP1 Box. • HP1 and importin α compete for binding to TRIM28.« less

Identification of a Src kinase SH3 binding site in the C-terminal domain of the human ErbB2 receptor tyrosine kinase.

PubMed

Bornet, Olivier; Nouailler, Matthieu; Feracci, Michaël; Sebban-Kreuzer, Corinne; Byrne, Deborah; Halimi, Hubert; Morelli, Xavier; Badache, Ali; Guerlesquin, Françoise

2014-06-05

Overexpression of the ErbB2 receptor tyrosine kinase is associated with most aggressive tumors in breast cancer patients and is thus one of the main investigated therapeutic targets. Human ErbB2 C-terminal domain is an unstructured anchor that recruits specific adaptors for signaling cascades resulting in cell growth, differentiation and migration. Herein, we report the presence of a SH3 binding motif in the proline rich unfolded ErbB2 C-terminal region. NMR analysis of this motif supports a PPII helix conformation and the binding to Fyn-SH3 domain. The interaction of a kinase of the Src family with ErbB2 C-terminal domain could contribute to synergistic intracellular signaling and enhanced oncogenesis. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

Identification of Novel Fusion Inhibitors of Influenza A Virus by Chemical Genetics

PubMed Central

Lai, Kin Kui; Cheung, Nam Nam; Yang, Fang; Dai, Jun; Liu, Li; Chen, Zhiwei; Sze, Kong Hung; Chen, Honglin

2015-01-01

ABSTRACT A previous screening of more than 50,000 compounds led to the identification of a pool of bioactive small molecules with inhibitory effect on the influenza A virus. One of these compounds, now widely known as nucleozin, is a small molecule that targets the influenza A virus nucleoprotein. Here we identify and characterize two structurally different novel fusion inhibitors of the influenza A virus group 1 hemagglutinin (HA), FA-583 and FA-617, with low nanomolar activities. Escape mutants that are highly resistant to each of these compounds were generated, and both were found to carry mutations localized in close proximity to the B-loop of the hemagglutinin 2 protein, which plays a crucial role in the virion-host cell fusion process. Recombinant virus, generated through reverse genetics, confirmed the resistance phenotype. In addition, the proposed binding pockets predicted by molecular docking studies are in accordance with the resistance-bearing mutation sites. We show through mechanistic studies that FA-583 and FA-617 act as fusion inhibitors by prohibiting the low-pH-induced conformational change of hemagglutinin. Our study has offered concrete biological and mechanistic explorations for the strategic development of novel fusion inhibitors of influenza A viruses. IMPORTANCE Here we report two structurally distinctive novel fusion inhibitors of influenza A virus that act by interfering with the structural change of HA at acidic pH, a process necessary for successful entry of the virus. Mutational and molecular docking studies have identified their binding pockets situated in close proximity to the B-loop region of hemagglutinin 2. The reduced sensitivity of FA-583- or FA-617-associated mutants to another compound suggests a close proximity and even partial overlap of their binding sites on hemagglutinin. Amino acid sequence alignments and crystal structure analyses of group 1 and group 2 hemagglutinins have shed light on the possible binding mode of these two compounds. This report offers new lead compounds for the design of fusion inhibitors for influenza A viruses and further shows that analysis by forward chemical genetics is a highly effective approach for the identification of novel compounds that can perturb the infectivity of viruses and to probe new druggable targets or druggable domains in various viruses. PMID:26676787

Structure of aryl O -demethylase offers molecular insight into a catalytic tyrosine-dependent mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kohler, Amanda C.; Mills, Matthew J. L.; Adams, Paul D.

Some strains of soil and marine bacteria have evolved intricate metabolic pathways for using environmentally derived aromatics as a carbon source. Many of these metabolic pathways go through intermediates such as vanillate, 3-O-methylgallate, and syringate. Demethylation of these compounds is essential for downstream aryl modification, ring opening, and subsequent assimilation of these compounds into the tricarboxylic acid (TCA) cycle, and, correspondingly, there are a variety of associated aryl demethylase systems that vary in complexity. Intriguingly, only a basic understanding of the least complex system, the tetrahydrofolate-dependent aryl demethylase LigM from Sphingomonas paucimobilis, a bacterial strain that metabolizes lignin-derived aromatics, wasmore » previously available. LigM-catalyzed demethylation enables further modification and rin g opening of the single-ring aromatics vanillate and 3-Omethylgallate, which are common byproducts of biofuel production. We characterize aryl O-demethylation by LigM and report its 1.81-Å crystal structure, revealing a unique demethylase fold and a canonical folate-binding domain. Structural homology and geometry optimization calculations enabled the identification of LigM's tetrahydrofolate-binding site and protein-folate interactions. Computationally guided mutagenesis and kinetic analyses allowed the identification of the enzyme's aryl-binding site location and determination of its unique, catalytic tyrosine-dependent reaction mechanism. This work defines LigM as a distinct demethylase, both structurally and functionally, and provides insight into demethylation and its reaction requirements. Our results afford the mechanistic details required for efficient utilization of LigM as a tool for aryl O-demethylation and as a component of synthetic biology efforts to valorize previously underused aromatic compounds.« less

Estimation of relative free energies of binding using pre-computed ensembles based on the single-step free energy perturbation and the site-identification by Ligand competitive saturation approaches.

PubMed

Raman, E Prabhu; Lakkaraju, Sirish Kaushik; Denny, Rajiah Aldrin; MacKerell, Alexander D

2017-06-05

Accurate and rapid estimation of relative binding affinities of ligand-protein complexes is a requirement of computational methods for their effective use in rational ligand design. Of the approaches commonly used, free energy perturbation (FEP) methods are considered one of the most accurate, although they require significant computational resources. Accordingly, it is desirable to have alternative methods of similar accuracy but greater computational efficiency to facilitate ligand design. In the present study relative free energies of binding are estimated for one or two non-hydrogen atom changes in compounds targeting the proteins ACK1 and p38 MAP kinase using three methods. The methods include standard FEP, single-step free energy perturbation (SSFEP) and the site-identification by ligand competitive saturation (SILCS) ligand grid free energy (LGFE) approach. Results show the SSFEP and SILCS LGFE methods to be competitive with or better than the FEP results for the studied systems, with SILCS LGFE giving the best agreement with experimental results. This is supported by additional comparisons with published FEP data on p38 MAP kinase inhibitors. While both the SSFEP and SILCS LGFE approaches require a significant upfront computational investment, they offer a 1000-fold computational savings over FEP for calculating the relative affinities of ligand modifications once those pre-computations are complete. An illustrative example of the potential application of these methods in the context of screening large numbers of transformations is presented. Thus, the SSFEP and SILCS LGFE approaches represent viable alternatives for actively driving ligand design during drug discovery and development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Structure of aryl O -demethylase offers molecular insight into a catalytic tyrosine-dependent mechanism

DOE PAGES

Kohler, Amanda C.; Mills, Matthew J. L.; Adams, Paul D.; ...

2017-04-03

Some strains of soil and marine bacteria have evolved intricate metabolic pathways for using environmentally derived aromatics as a carbon source. Many of these metabolic pathways go through intermediates such as vanillate, 3-O-methylgallate, and syringate. Demethylation of these compounds is essential for downstream aryl modification, ring opening, and subsequent assimilation of these compounds into the tricarboxylic acid (TCA) cycle, and, correspondingly, there are a variety of associated aryl demethylase systems that vary in complexity. Intriguingly, only a basic understanding of the least complex system, the tetrahydrofolate-dependent aryl demethylase LigM from Sphingomonas paucimobilis, a bacterial strain that metabolizes lignin-derived aromatics, wasmore » previously available. LigM-catalyzed demethylation enables further modification and rin g opening of the single-ring aromatics vanillate and 3-Omethylgallate, which are common byproducts of biofuel production. We characterize aryl O-demethylation by LigM and report its 1.81-Å crystal structure, revealing a unique demethylase fold and a canonical folate-binding domain. Structural homology and geometry optimization calculations enabled the identification of LigM's tetrahydrofolate-binding site and protein-folate interactions. Computationally guided mutagenesis and kinetic analyses allowed the identification of the enzyme's aryl-binding site location and determination of its unique, catalytic tyrosine-dependent reaction mechanism. This work defines LigM as a distinct demethylase, both structurally and functionally, and provides insight into demethylation and its reaction requirements. Our results afford the mechanistic details required for efficient utilization of LigM as a tool for aryl O-demethylation and as a component of synthetic biology efforts to valorize previously underused aromatic compounds.« less

Inhibition and Larvicidal Activity of Phenylpropanoids from Piper sarmentosum on Acetylcholinesterase against Mosquito Vectors and Their Binding Mode of Interaction.

PubMed

Hematpoor, Arshia; Liew, Sook Yee; Chong, Wei Lim; Azirun, Mohd Sofian; Lee, Vannajan Sanghiran; Awang, Khalijah

2016-01-01

Aedes aegypti, Aedes albopictus and Culex quinquefasciatus are vectors of dengue fever and West Nile virus diseases. This study was conducted to determine the toxicity, mechanism of action and the binding interaction of three active phenylpropanoids from Piper sarmentosum (Piperaceae) toward late 3rd or early 4th larvae of above vectors. A bioassay guided-fractionation on the hexane extract from the roots of Piper sarmentosum led to the isolation and identification of three active phenylpropanoids; asaricin 1, isoasarone 2 and trans-asarone 3. The current study involved evaluation of the toxicity and acetylcholinesterase (AChE) inhibition of these compounds against Aedes aegypti, Aedes albopictus and Culex quinquefasciatus larvae. Asaricin 1 and isoasarone 2 were highly potent against Aedes aegypti, Aedes albopictus and Culex quinquefasciatus larvae causing up to 100% mortality at ≤ 15 μg/mL concentration. The ovicidal activity of asaricin 1, isoasarone 2 and trans-asarone 3 were evaluated through egg hatching. Asaricin 1 and isoasarone 2 showed potent ovicidal activity. Ovicidal activity for both compounds was up to 95% at 25μg/mL. Asaricin 1 and isoasarone 2 showed strong inhibition on acetylcholinesterase with relative IC50 values of 0.73 to 1.87 μg/mL respectively. These findings coupled with the high AChE inhibition may suggest that asaricin 1 and isoasarone 2 are neuron toxic compounds toward Aedes aegypti, Aedes albopictus and Culex quinquefasciatus. Further computational docking with Autodock Vina elaborates the possible interaction of asaricin 1 and isoasarone 2 with three possible binding sites of AChE which includes catalytic triads (CAS: S238, E367, H480), the peripheral sites (PAS: E72, W271) and anionic binding site (W83). The binding affinity of asaricin 1 and isoasarone 2 were relatively strong with asaricin 1 showed a higher binding affinity in the anionic pocket.

Identification of the binding sites for ubiquinone and inhibitors in the Na+-pumping NADH-ubiquinone oxidoreductase from Vibrio cholerae by photoaffinity labeling

PubMed Central

Ito, Takeshi; Ninokura, Satoshi; Kitazumi, Yuki; Mezic, Katherine G.; Cress, Brady F.; Koffas, Mattheos A. G.; Morgan, Joel E.; Barquera, Blanca; Miyoshi, Hideto

2017-01-01

The Na+-pumping NADH-quinone oxidoreductase (Na+-NQR) is the first enzyme of the respiratory chain and the main ion transporter in many marine and pathogenic bacteria, including Vibrio cholerae. The V. cholerae Na+-NQR has been extensively studied, but its binding sites for ubiquinone and inhibitors remain controversial. Here, using a photoreactive ubiquinone PUQ-3 as well as two aurachin-type inhibitors [125I]PAD-1 and [125I]PAD-2 and photoaffinity labeling experiments on the isolated enzyme, we demonstrate that the ubiquinone ring binds to the NqrA subunit in the regions Leu-32–Met-39 and Phe-131–Lys-138, encompassing the rear wall of a predicted ubiquinone-binding cavity. The quinolone ring and alkyl side chain of aurachin bound to the NqrB subunit in the regions Arg-43–Lys-54 and Trp-23–Gly-89, respectively. These results indicate that the binding sites for ubiquinone and aurachin-type inhibitors are in close proximity but do not overlap one another. Unexpectedly, although the inhibitory effects of PAD-1 and PAD-2 were almost completely abolished by certain mutations in NqrB (i.e. G140A and E144C), the binding reactivities of [125I]PAD-1 and [125I]PAD-2 to the mutated enzymes were unchanged compared with those of the wild-type enzyme. We also found that photoaffinity labeling by [125I]PAD-1 and [125I]PAD-2, rather than being competitively suppressed in the presence of other inhibitors, is enhanced under some experimental conditions. To explain these apparently paradoxical results, we propose models for the catalytic reaction of Na+-NQR and its interactions with inhibitors on the basis of the biochemical and biophysical results reported here and in previous work. PMID:28298441

Identification of residues in the insulin molecule important for binding to insulin-degrading enzyme.

PubMed

Affholter, J A; Cascieri, M A; Bayne, M L; Brange, J; Casaretto, M; Roth, R A

1990-08-21

Insulin-degrading enzyme (IDE) hydrolyzes insulin at a limited number of sites. Although the positions of these cleavages are known, the residues of insulin important in its binding to IDE have not been defined. To this end, we have studied the binding of a variety of insulin analogues to the protease in a solid-phase binding assay using immunoimmobilized IDE. Since IDE binds insulin with 600-fold greater affinity than it does insulin-like growth factor I (25 nM and approximately 16,000 nM, respectively), the first set of analogues studied were hybrid molecules of insulin and IGF I. IGF I mutants [insB1-17,17-70]IGF I, [Tyr55,Gln56]IGF I, and [Phe23,Phe24,Tyr25]IGF I have been synthesized and share the property of having insulin-like amino acids at positions corresponding to primary sites of cleavage of insulin by IDE. Whereas the first two exhibit affinities for IDE similar to that of wild type IGF I, the [Phe23,Phe24,Tyr25]IGF I analogue has a 32-fold greater affinity for the immobilized enzyme. Replacement of Phe-23 by Ser eliminates this increase. Removal of the eight amino acid D-chain region of IGF I (which has been predicted to interfere with binding to the 23-25 region) results in a 25-fold increase in affinity for IDE, confirming the importance of residues 23-25 in the high-affinity recognition of IDE. A similar role for the corresponding (B24-26) residues of insulin is supported by the use of site-directed mutant and semisynthetic insulin analogues. Insulin mutants [B25-Asp]insulin and [B25-His]insulin display 16- and 20-fold decreases in IDE affinity versus wild-type insulin.(ABSTRACT TRUNCATED AT 250 WORDS)

Rapid identification of fluorochrome modification sites in proteins by LC ESI-Q-TOF mass spectrometry.

PubMed

Manikwar, Prakash; Zimmerman, Tahl; Blanco, Francisco J; Williams, Todd D; Siahaan, Teruna J

2011-07-20

Conjugation of either a fluorescent dye or a drug molecule to the ε-amino groups of lysine residues of proteins has many applications in biology and medicine. However, this type of conjugation produces a heterogeneous population of protein conjugates. Because conjugation of fluorochrome or drug molecule to a protein may have deleterious effects on protein function, the identification of conjugation sites is necessary. Unfortunately, the identification process can be time-consuming and laborious; therefore, there is a need to develop a rapid and reliable way to determine the conjugation sites of the fluorescent label or drug molecule. In this study, the sites of conjugation of fluorescein-5'-isothiocyanate and rhodamine-B-isothiocyanate to free amino groups on the insert-domain (I-domain) protein derived from the α-subunit of lymphocyte function-associated antigen-1 (LFA-1) were determined by electrospray ionization quadrupole time-of-flight mass spectrometry (ESI-Q-TOF MS) along with peptide mapping using trypsin digestion. A reporter fragment of the fluorochrome moiety that is generated in the collision cell of the Q-TOF without explicit MS/MS precursor selection was used to identify the conjugation site. Selected ion plots of the reporter ion readily mark modified peptides in chromatograms of the complex digest. Interrogation of theses spectra reveals a neutral loss/precursor pair that identifies the modified peptide. The results show that one to seven fluorescein molecules or one to four rhodamine molecules were attached to the lysine residue(s) of the I-domain protein. No modifications were found in the metal ion-dependent adhesion site (MIDAS), which is an important binding region of the I-domain.

Odilorhabdins, Antibacterial Agents that Cause Miscoding by Binding at a New Ribosomal Site.

PubMed

Pantel, Lucile; Florin, Tanja; Dobosz-Bartoszek, Malgorzata; Racine, Emilie; Sarciaux, Matthieu; Serri, Marine; Houard, Jessica; Campagne, Jean-Marc; de Figueiredo, Renata Marcia; Midrier, Camille; Gaudriault, Sophie; Givaudan, Alain; Lanois, Anne; Forst, Steve; Aumelas, André; Cotteaux-Lautard, Christelle; Bolla, Jean-Michel; Vingsbo Lundberg, Carina; Huseby, Douglas L; Hughes, Diarmaid; Villain-Guillot, Philippe; Mankin, Alexander S; Polikanov, Yury S; Gualtieri, Maxime

2018-04-05

Growing resistance of pathogenic bacteria and shortage of antibiotic discovery platforms challenge the use of antibiotics in the clinic. This threat calls for exploration of unconventional sources of antibiotics and identification of inhibitors able to eradicate resistant bacteria. Here we describe a different class of antibiotics, odilorhabdins (ODLs), produced by the enzymes of the non-ribosomal peptide synthetase gene cluster of the nematode-symbiotic bacterium Xenorhabdus nematophila. ODLs show activity against Gram-positive and Gram-negative pathogens, including carbapenem-resistant Enterobacteriaceae, and can eradicate infections in animal models. We demonstrate that the bactericidal ODLs interfere with protein synthesis. Genetic and structural analyses reveal that ODLs bind to the small ribosomal subunit at a site not exploited by current antibiotics. ODLs induce miscoding and promote hungry codon readthrough, amino acid misincorporation, and premature stop codon bypass. We propose that ODLs' miscoding activity reflects their ability to increase the affinity of non-cognate aminoacyl-tRNAs to the ribosome. Copyright © 2018 Elsevier Inc. All rights reserved.

PredictProtein—an open resource for online prediction of protein structural and functional features

PubMed Central

Yachdav, Guy; Kloppmann, Edda; Kajan, Laszlo; Hecht, Maximilian; Goldberg, Tatyana; Hamp, Tobias; Hönigschmid, Peter; Schafferhans, Andrea; Roos, Manfred; Bernhofer, Michael; Richter, Lothar; Ashkenazy, Haim; Punta, Marco; Schlessinger, Avner; Bromberg, Yana; Schneider, Reinhard; Vriend, Gerrit; Sander, Chris; Ben-Tal, Nir; Rost, Burkhard

2014-01-01

PredictProtein is a meta-service for sequence analysis that has been predicting structural and functional features of proteins since 1992. Queried with a protein sequence it returns: multiple sequence alignments, predicted aspects of structure (secondary structure, solvent accessibility, transmembrane helices (TMSEG) and strands, coiled-coil regions, disulfide bonds and disordered regions) and function. The service incorporates analysis methods for the identification of functional regions (ConSurf), homology-based inference of Gene Ontology terms (metastudent), comprehensive subcellular localization prediction (LocTree3), protein–protein binding sites (ISIS2), protein–polynucleotide binding sites (SomeNA) and predictions of the effect of point mutations (non-synonymous SNPs) on protein function (SNAP2). Our goal has always been to develop a system optimized to meet the demands of experimentalists not highly experienced in bioinformatics. To this end, the PredictProtein results are presented as both text and a series of intuitive, interactive and visually appealing figures. The web server and sources are available at http://ppopen.rostlab.org. PMID:24799431

In silico identification of potent pancreatic triacylglycerol lipase inhibitors from traditional Chinese medicine.

PubMed

Chen, Kuan-Yu; Chang, Su-Sen; Chen, Calvin Yu-Chian

2012-01-01

Pancreatic triacylglycerol lipase (PNLIP) are primary lipases that are critical for triacylglyceride digestion in human. Since reduced metabolism of triacylglyceride might be a plausible concept for weight loss, we screened for potential PNLIP inhibitors from traditional Chinese medicine (TCM) with the aim to identify weight loss candidate compounds. TCM candidates Aurantiamide, Cnidiadin, and 2-hexadecenoic acid exhibited higher Dock Scores than the commercial drug Orlistat, and were also predicted to have inhibitory characteristics against PNLIP using constructed MLR (R(2) = 0.8664) and SVM (R(2) = 0.9030) models. Molecular dynamics indicated that the TCM-PNLIP complexes formed were stable. We identified that the PNLIP binding site has several residues that can serve as anchors, and a hydrophobic corridor that provides additional stability to the complex. Aurantiamide, Cnidiadin, and 2-hexadecenoic acid all have features that correspond to these binding site features, indicating their potential as candidates for PNLIP inhibitors. The information presented in this study may provide helpful insights to designing novel weight-control drugs.

Cell type-selective disease-association of genes under high regulatory load

PubMed Central

Galhardo, Mafalda; Berninger, Philipp; Nguyen, Thanh-Phuong; Sauter, Thomas; Sinkkonen, Lasse

2015-01-01

We previously showed that disease-linked metabolic genes are often under combinatorial regulation. Using the genome-wide ChIP-Seq binding profiles for 93 transcription factors in nine different cell lines, we show that genes under high regulatory load are significantly enriched for disease-association across cell types. We find that transcription factor load correlates with the enhancer load of the genes and thereby allows the identification of genes under high regulatory load by epigenomic mapping of active enhancers. Identification of the high enhancer load genes across 139 samples from 96 different cell and tissue types reveals a consistent enrichment for disease-associated genes in a cell type-selective manner. The underlying genes are not limited to super-enhancer genes and show several types of disease-association evidence beyond genetic variation (such as biomarkers). Interestingly, the high regulatory load genes are involved in more KEGG pathways than expected by chance, exhibit increased betweenness centrality in the interaction network of liver disease genes, and carry longer 3′ UTRs with more microRNA (miRNA) binding sites than genes on average, suggesting a role as hubs integrating signals within regulatory networks. In summary, epigenetic mapping of active enhancers presents a promising and unbiased approach for identification of novel disease genes in a cell type-selective manner. PMID:26338775

Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

1991-01-01

Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

NASA Astrophysics Data System (ADS)

Lengyel, Iván M.; Morelli, Luis G.

2017-04-01

Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

Comparative Bioinformatic Analysis of Active Site Structures in Evolutionarily Remote Homologues of α,β-Hydrolase Superfamily Enzymes.

PubMed

Suplatov, D A; Arzhanik, V K; Svedas, V K

2011-01-01

Comparative bioinformatic analysis is the cornerstone of the study of enzymes' structure-function relationship. However, numerous enzymes that derive from a common ancestor and have undergone substantial functional alterations during natural selection appear not to have a sequence similarity acceptable for a statistically reliable comparative analysis. At the same time, their active site structures, in general, can be conserved, while other parts may largely differ. Therefore, it sounds both plausible and appealing to implement a comparative analysis of the most functionally important structural elements - the active site structures; that is, the amino acid residues involved in substrate binding and the catalytic mechanism. A computer algorithm has been developed to create a library of enzyme active site structures based on the use of the PDB database, together with programs of structural analysis and identification of functionally important amino acid residues and cavities in the enzyme structure. The proposed methodology has been used to compare some α,β-hydrolase superfamily enzymes. The insight has revealed a high structural similarity of catalytic site areas, including the conservative organization of a catalytic triad and oxyanion hole residues, despite the wide functional diversity among the remote homologues compared. The methodology can be used to compare the structural organization of the catalytic and substrate binding sites of various classes of enzymes, as well as study enzymes' evolution and to create of a databank of enzyme active site structures.

Inhibitor candidates's identification of HCV's RNA polymerase NS5B using virtual screening against iPPI-library

NASA Astrophysics Data System (ADS)

Sulistyawati, Indah; Sulistyo Dwi K., P.; Ichsan, Mochammad

2016-03-01

Hepatitis C is one of the major causes of chronic liver failure that caused by Hepatitis C Virus (HCV). Preventing the progression of HCV's replication through the inhibition of The RNA polymerase NS5B of Hepatitis C virus (NS5B) can be achieved via 4 binding regions: Site I (Thumb I), Site II (Thumb II), Site III (Palm I), and Site IV (Palm II). The aim of this research is to identify a candidate of NS5B inhibitor as an alternative for Hepatitis C treatment. An NS5B's 3D structure (PDB ID = 3D5M) used in this study has met some criteria of a good model to be used in virtual screening againts iPPI-lib using MTiOpenScreen webserver. The top two natural compounds resulted here then docked using Pyrix 0.8 and discovered trans-6-Benzamido-2-methyldecahydroisoquinoline (-9,1kcal/mol) and 2,4-dichloro-5-[4-(2 methoxyphenyl) piperazine-1-carbonyl]-N-[3-(trifluoromethyl)phenyl] benzenesulfonamide (9,4 kcal/mol) can bind to Tyr448 similar with all three established inhibitors, such as setrobuvir (-11,4 kcal/mol; site 3 inhibitor), CHEMBL379677 (-9,1 kcal/mol; site 1 inhibitor), and nesbuvir (-7,7 kcal/mol; site 4 inhibitor). The results of this study are relatively still needs to be tested, both in vitro and in vivo, in order to obtain more comprehensive knowledges as a follow-up of this predictive study.

Dynamics Govern Specificity of a Protein-Protein Interface: Substrate Recognition by Thrombin

PubMed Central

Fuchs, Julian E.; Huber, Roland G.; Waldner, Birgit J.; Kahler, Ursula; von Grafenstein, Susanne; Kramer, Christian; Liedl, Klaus R.

2015-01-01

Biomolecular recognition is crucial in cellular signal transduction. Signaling is mediated through molecular interactions at protein-protein interfaces. Still, specificity and promiscuity of protein-protein interfaces cannot be explained using simplistic static binding models. Our study rationalizes specificity of the prototypic protein-protein interface between thrombin and its peptide substrates relying solely on binding site dynamics derived from molecular dynamics simulations. We find conformational selection and thus dynamic contributions to be a key player in biomolecular recognition. Arising entropic contributions complement chemical intuition primarily reflecting enthalpic interaction patterns. The paradigm “dynamics govern specificity” might provide direct guidance for the identification of specific anchor points in biomolecular recognition processes and structure-based drug design. PMID:26496636

Structural basis for selective inhibition of Cyclooxygenase-1 (COX-1) by diarylisoxazoles mofezolac and 3-(5-chlorofuran-2-yl)-5-methyl-4-phenylisoxazole (P6).

PubMed

Cingolani, Gino; Panella, Andrea; Perrone, Maria Grazia; Vitale, Paola; Di Mauro, Giuseppe; Fortuna, Cosimo G; Armen, Roger S; Ferorelli, Savina; Smith, William L; Scilimati, Antonio

2017-09-29

The diarylisoxazole molecular scaffold is found in several NSAIDs, especially those with high selectivity for COX-1. Here, we have determined the structural basis for COX-1 binding to two diarylisoxazoles: mofezolac, which is polar and ionizable, and 3-(5-chlorofuran-2-yl)-5-methyl-4-phenylisoxazole (P6) that has very low polarity. X-ray analysis of the crystal structures of COX-1 bound to mofezolac and 3-(5-chlorofuran-2-yl)-5-methyl-4-phenylisoxazole allowed the identification of specific binding determinants within the enzyme active site, relevant to generate structure/activity relationships for diarylisoxazole NSAIDs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Identification and structural characterization of heme binding in a novel dye-decolorizing peroxidase, TyrA.

PubMed

Zubieta, Chloe; Joseph, Rosanne; Krishna, S Sri; McMullan, Daniel; Kapoor, Mili; Axelrod, Herbert L; Miller, Mitchell D; Abdubek, Polat; Acosta, Claire; Astakhova, Tamara; Carlton, Dennis; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C; Duan, Lian; Elias, Ylva; Elsliger, Marc-André; Feuerhelm, Julie; Grzechnik, Slawomir K; Hale, Joanna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Kumar, Abhinav; Marciano, David; Morse, Andrew T; Murphy, Kevin D; Nigoghossian, Edward; Okach, Linda; Oommachen, Silvya; Reyes, Ron; Rife, Christopher L; Schimmel, Paul; Trout, Christina V; van den Bedem, Henry; Weekes, Dana; White, Aprilfawn; Xu, Qingping; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

2007-11-01

TyrA is a member of the dye-decolorizing peroxidase (DyP) family, a new family of heme-dependent peroxidase recently identified in fungi and bacteria. Here, we report the crystal structure of TyrA in complex with iron protoporphyrin (IX) at 2.3 A. TyrA is a dimer, with each monomer exhibiting a two-domain, alpha/beta ferredoxin-like fold. Both domains contribute to the heme-binding site. Co-crystallization in the presence of an excess of iron protoporphyrin (IX) chloride allowed for the unambiguous location of the active site and the specific residues involved in heme binding. The structure reveals a Fe-His-Asp triad essential for heme positioning, as well as a novel conformation of one of the heme propionate moieties compared to plant peroxidases. Structural comparison to the canonical DyP family member, DyP from Thanatephorus cucumeris (Dec 1), demonstrates conservation of this novel heme conformation, as well as residues important for heme binding. Structural comparisons with representative members from all classes of the plant, bacterial, and fungal peroxidase superfamily demonstrate that TyrA, and by extension the DyP family, adopts a fold different from all other structurally characterized heme peroxidases. We propose that a new superfamily be added to the peroxidase classification scheme to encompass the DyP family of heme peroxidases. (c) 2007 Wiley-Liss, Inc.

In-silico identification of the binding mode of synthesized adamantyl derivatives inside cholinesterase enzymes

PubMed Central

Al-Aboudi, Amal; Al-Qawasmeh, Raed A; Shahwan, Alaa; Mahmood, Uzma; Khalid, Asaad; Ul-Haq, Zaheer

2015-01-01

Aim: To investigate the binding mode of synthesized adamantly derivatives inside of cholinesterase enzymes using molecular docking simulations. Methods: A series of hybrid compounds containing adamantane and hydrazide moieties was designed and synthesized. Their inhibitory activities against acetylcholinesterase (AChE) and (butyrylcholinesterase) BChE were assessed in vitro. The binding mode of the compounds inside cholinesterase enzymes was investigated using Surflex-Dock package of Sybyl7.3 software. Results: A total of 26 adamantyl derivatives were synthesized. Among them, adamantane-1-carboxylic acid hydrazide had an almost equal inhibitory activity towards both enzymes, whereas 10 other compounds exhibited moderate inhibitory activity against BChE. The molecular docking studies demonstrated that hydrophobic interactions between the compounds and their surrounding residues in the active site played predominant roles, while hydrophilic interactions were also found. When the compounds were docked inside each enzyme, they exhibited stronger interactions with BChE over AChE, possibly due to the larger active site of BChE. The binding affinities of the compounds for BChE and AChE estimated were in agreement with the experimental data. Conclusion: The new adamantly derivatives selectively inhibit BChE with respect to AChE, thus making them good candidates for testing the hypothesis that BChE inhibitors would be more efficient and better tolerated than AChE inhibitors in the treatment of Alzheimer's disease. PMID:25937631

Insights into the molecular basis for substrate binding and specificity of the wild-type L-arginine/agmatine antiporter AdiC.

PubMed

Ilgü, Hüseyin; Jeckelmann, Jean-Marc; Gapsys, Vytautas; Ucurum, Zöhre; de Groot, Bert L; Fotiadis, Dimitrios

2016-09-13

Pathogenic enterobacteria need to survive the extreme acidity of the stomach to successfully colonize the human gut. Enteric bacteria circumvent the gastric acid barrier by activating extreme acid-resistance responses, such as the arginine-dependent acid resistance system. In this response, l-arginine is decarboxylated to agmatine, thereby consuming one proton from the cytoplasm. In Escherichia coli, the l-arginine/agmatine antiporter AdiC facilitates the export of agmatine in exchange of l-arginine, thus providing substrates for further removal of protons from the cytoplasm and balancing the intracellular pH. We have solved the crystal structures of wild-type AdiC in the presence and absence of the substrate agmatine at 2.6-Å and 2.2-Å resolution, respectively. The high-resolution structures made possible the identification of crucial water molecules in the substrate-binding sites, unveiling their functional roles for agmatine release and structure stabilization, which was further corroborated by molecular dynamics simulations. Structural analysis combined with site-directed mutagenesis and the scintillation proximity radioligand binding assay improved our understanding of substrate binding and specificity of the wild-type l-arginine/agmatine antiporter AdiC. Finally, we present a potential mechanism for conformational changes of the AdiC transport cycle involved in the release of agmatine into the periplasmic space of E. coli.

The Baculovirus-Expressed Binding Region of Plasmodium falciparum EBA-140 Ligand and Its Glycophorin C Binding Specificity

PubMed Central

Rydzak, Joanna; Kaczmarek, Radoslaw; Czerwinski, Marcin; Lukasiewicz, Jolanta; Tyborowska, Jolanta; Szewczyk, Boguslaw; Jaskiewicz, Ewa

2015-01-01

The erythrocyte binding ligand 140 (EBA-140) is a member of the Plasmodium falciparum DBL family of erythrocyte binding proteins, which are considered as prospective candidates for malaria vaccine development. The EBA-140 ligand is a paralogue of the well-characterized P. falciparum EBA-175 protein. They share homology of domain structure, including Region II, which consists of two homologous F1 and F2 domains and is responsible for ligand-erythrocyte receptor interaction during invasion. In this report we describe, for the first time, the glycophorin C specificity of the recombinant, baculovirus-expressed binding region (Region II) of P. falciparum EBA-140 ligand. It was found that the recombinant EBA-140 Region II binds to the endogenous and recombinant glycophorin C, but does not bind to Gerbich-type glycophorin C, neither normal nor recombinant, which lacks amino acid residues 36–63 of its polypeptide chain. Our results emphasize the crucial role of this glycophorin C region in EBA-140 ligand binding. Moreover, the EBA-140 Region II did not bind either to glycophorin D, the truncated form of glycophorin C lacking the N-glycan or to desialylated GPC. These results draw attention to the role of glycophorin C glycans in EBA-140 binding. The full identification of the EBA-140 binding site on glycophorin C molecule, consisting most likely of its glycans and peptide backbone, may help to design therapeutics or vaccines that target the erythrocyte binding merozoite ligands. PMID:25588042

Accurate pan-specific prediction of peptide-MHC class II binding affinity with improved binding core identification.

PubMed

Andreatta, Massimo; Karosiene, Edita; Rasmussen, Michael; Stryhn, Anette; Buus, Søren; Nielsen, Morten

2015-11-01

A key event in the generation of a cellular response against malicious organisms through the endocytic pathway is binding of peptidic antigens by major histocompatibility complex class II (MHC class II) molecules. The bound peptide is then presented on the cell surface where it can be recognized by T helper lymphocytes. NetMHCIIpan is a state-of-the-art method for the quantitative prediction of peptide binding to any human or mouse MHC class II molecule of known sequence. In this paper, we describe an updated version of the method with improved peptide binding register identification. Binding register prediction is concerned with determining the minimal core region of nine residues directly in contact with the MHC binding cleft, a crucial piece of information both for the identification and design of CD4(+) T cell antigens. When applied to a set of 51 crystal structures of peptide-MHC complexes with known binding registers, the new method NetMHCIIpan-3.1 significantly outperformed the earlier 3.0 version. We illustrate the impact of accurate binding core identification for the interpretation of T cell cross-reactivity using tetramer double staining with a CMV epitope and its variants mapped to the epitope binding core. NetMHCIIpan is publicly available at http://www.cbs.dtu.dk/services/NetMHCIIpan-3.1 .

Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

PubMed

Kang, J J; Yokoi, T J; Holland, M J

1995-12-01

The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

Identification, Characterization, and Natural Selection of Mutations Driving Airborne Transmission of A/H5N1 virus

PubMed Central

Linster, Martin; van Boheemen, Sander; de Graaf, Miranda; Schrauwen, Eefje J. A.; Lexmond, Pascal; Mänz, Benjamin; Bestebroer, Theo M.; Baumann, Jan; van Riel, Debby; Rimmelzwaan, Guus F.; Osterhaus, Albert D.M.E.; Matrosovich, Mikhail; Fouchier, Ron A. M.; Herfst, Sander

2014-01-01

SUMMARY Recently, A/H5N1 influenza viruses were shown to acquire airborne transmissibility between ferrets upon targeted mutagenesis and virus passage. The critical genetic changes in airborne A/Indonesia/5/05 were not yet identified. Here, five substitutions proved to be sufficient to determine this airborne transmission phenotype. Substitutions in PB1 and PB2 collectively caused enhanced transcription and virus replication. One substitution increased HA thermostability and lowered the pH of membrane fusion. Two substitutions independently changed HA binding preference from α2,3 linked to α2,6 linked sialic acid receptors. The loss of a glycosylation site in HA enhanced overall binding to receptors. The acquired substitutions emerged early during ferret passage as minor variants and became dominant rapidly. Identification of substitutions that are essential for airborne transmission of avian influenza viruses between ferrets and their associated phenotypes advances our fundamental understanding of virus transmission and will increase the value of future surveillance programs and public health risk assessments. PMID:24725402

ASPeak: an abundance sensitive peak detection algorithm for RIP-Seq.

PubMed

Kucukural, Alper; Özadam, Hakan; Singh, Guramrit; Moore, Melissa J; Cenik, Can

2013-10-01

Unlike DNA, RNA abundances can vary over several orders of magnitude. Thus, identification of RNA-protein binding sites from high-throughput sequencing data presents unique challenges. Although peak identification in ChIP-Seq data has been extensively explored, there are few bioinformatics tools tailored for peak calling on analogous datasets for RNA-binding proteins. Here we describe ASPeak (abundance sensitive peak detection algorithm), an implementation of an algorithm that we previously applied to detect peaks in exon junction complex RNA immunoprecipitation in tandem experiments. Our peak detection algorithm yields stringent and robust target sets enabling sensitive motif finding and downstream functional analyses. ASPeak is implemented in Perl as a complete pipeline that takes bedGraph files as input. ASPeak implementation is freely available at https://sourceforge.net/projects/as-peak under the GNU General Public License. ASPeak can be run on a personal computer, yet is designed to be easily parallelizable. ASPeak can also run on high performance computing clusters providing efficient speedup. The documentation and user manual can be obtained from http://master.dl.sourceforge.net/project/as-peak/manual.pdf.

Discovery of 12-mer peptides that bind to wood lignin

PubMed Central

Yamaguchi, Asako; Isozaki, Katsuhiro; Nakamura, Masaharu; Takaya, Hikaru; Watanabe, Takashi

2016-01-01

Lignin, an abundant terrestrial polymer, is the only large-volume renewable feedstock composed of an aromatic skeleton. Lignin has been used mostly as an energy source during paper production; however, recent interest in replacing fossil fuels with renewable resources has highlighted its potential value in providing aromatic chemicals. Highly selective degradation of lignin is pivotal for industrial production of paper, biofuels, chemicals, and materials. However, few studies have examined natural and synthetic molecular components recognizing the heterogeneous aromatic polymer. Here, we report the first identification of lignin-binding peptides possessing characteristic sequences using a phage display technique. The consensus sequence HFPSP was found in several lignin-binding peptides, and the outer amino acid sequence affected the binding affinity of the peptides. Substitution of phenylalanine7 with Ile in the lignin-binding peptide C416 (HFPSPIFQRHSH) decreased the affinity of the peptide for softwood lignin without changing its affinity for hardwood lignin, indicating that C416 recognised structural differences between the lignins. Circular dichroism spectroscopy demonstrated that this peptide adopted a highly flexible random coil structure, allowing key residues to be appropriately arranged in relation to the binding site in lignin. These results provide a useful platform for designing synthetic and biological catalysts selectively bind to lignin. PMID:26903196

A major integral protein of the plant plasma membrane binds flavin.

PubMed

Lorenz, Astrid; Kaldenhoff, Ralf; Hertel, Rainer

2003-05-01

Abundant flavin binding sites have been found in membranes of plants and fungi. With flavin mononucleotide-agarose affinity columns, riboflavin-binding activity from microsomes of Cucurbita pepoL. hypocotyls was purified and identified as a specific PIP1-homologous protein of the aquaporin family. Sequences such as gi|2149955 in Phaseolus vulgaris, PIP1b of Arabidopsis thaliana, and NtAQP1 of tobacco are closely related. The identification as a riboflavin-binding protein was confirmed by binding tests with an extract of Escherichia coli cells expressing the tobacco NtAQP1 as well as leaves of transgenic tobacco plants that overexpress NtAQP1 or were inhibited in PIP1 expression by antisense constructs. When binding was assayed in the presence of dithionite, the reduced flavin formed a relatively stable association with the protein. Upon dilution under oxidizing conditions, the adduct was resolved, and free flavin reappeared with a half time of about 30 min. Such an association can also be induced photochemically, with oxidized flavin by blue light at 450 nm, in the presence of an electron donor. Several criteria, localization in the plasma membrane, high abundance, affinity to roseoflavin, and photochemistry, argue for a role of the riboflavin-binding protein PIP1 as a photoreceptor.

Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation.

PubMed

Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro

2011-01-30

During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own promoter suggests the presence of autoregulation for RIN expression. ChIP-based analyses identified a novel RIN-binding CArG-box site that harbors a gene associated with RIN expression in its flanking region. These findings clarify the crucial role of RIN in the transcriptional regulation of ripening initiation and progression.

Investigation of the Causes of Breast Cancer at the Cellular Level: Isolation of In Vivo Binding Sites of the Human Origin Recognition Complex

DTIC Science & Technology

2002-08-01

We study the process of DNA replication in proliferating human cells. Our efforts are directed to the identification and characterization of proteins...that promote DNA replication (initiators) as well as the DNA sequences recognized by them (replicators) . We have focused in a group of initiator...to be a critical factor for the coordination of DNA replication with the cell division cycle. hOrclp levels are higher between the exit of mitosis and

Photoreactive Stapled BH3 Peptides to Dissect the BCL-2 Family Interactome

PubMed Central

Braun, Craig R.; Mintseris, Julian; Gavathiotis, Evripidis; Bird, Gregory H.; Gygi, Steven P.; Walensky, Loren D.

2010-01-01

SUMMARY Defining protein interactions forms the basis for discovery of biological pathways, disease mechanisms, and opportunities for therapeutic intervention. To harness the robust binding affinity and selectivity of structured peptides for interactome discovery, we engineered photoreactive stapled BH3 peptide helices that covalently capture their physiologic BCL-2 family targets. The crosslinking α-helices covalently trap both static and dynamic protein interactors, and enable rapid identification of interaction sites, providing a critical link between interactome discovery and targeted drug design. PMID:21168768

Virtual Lead Identification of Farnesyltransferase Inhibitors Based on Ligand and Structure-Based Pharmacophore Techniques

PubMed Central

Al-Balas, Qosay A.; Amawi, Haneen A.; Hassan, Mohammad A.; Qandil, Amjad M.; Almaaytah, Ammar M.; Mhaidat, Nizar M.

2013-01-01

Farnesyltransferase enzyme (FTase) is considered an essential enzyme in the Ras signaling pathway associated with cancer. Thus, designing inhibitors for this enzyme might lead to the discovery of compounds with effective anticancer activity. In an attempt to obtain effective FTase inhibitors, pharmacophore hypotheses were generated using structure-based and ligand-based approaches built in Discovery Studio v3.1. Knowing the presence of the zinc feature is essential for inhibitor’s binding to the active site of FTase enzyme; further customization was applied to include this feature in the generated pharmacophore hypotheses. These pharmacophore hypotheses were thoroughly validated using various procedures such as ROC analysis and ligand pharmacophore mapping. The validated pharmacophore hypotheses were used to screen 3D databases to identify possible hits. Those which were both high ranked and showed sufficient ability to bind the zinc feature in active site, were further refined by applying drug-like criteria such as Lipiniski’s “rule of five” and ADMET filters. Finally, the two candidate compounds (ZINC39323901 and ZINC01034774) were allowed to dock using CDOCKER and GOLD in the active site of FTase enzyme to optimize hit selection. PMID:24276257

Virtual lead identification of farnesyltransferase inhibitors based on ligand and structure-based pharmacophore techniques.

PubMed

Al-Balas, Qosay A; Amawi, Haneen A; Hassan, Mohammad A; Qandil, Amjad M; Almaaytah, Ammar M; Mhaidat, Nizar M

2013-05-27

Farnesyltransferase enzyme (FTase) is considered an essential enzyme in the Ras signaling pathway associated with cancer. Thus, designing inhibitors for this enzyme might lead to the discovery of compounds with effective anticancer activity. In an attempt to obtain effective FTase inhibitors, pharmacophore hypotheses were generated using structure-based and ligand-based approaches built in Discovery Studio v3.1. Knowing the presence of the zinc feature is essential for inhibitor's binding to the active site of FTase enzyme; further customization was applied to include this feature in the generated pharmacophore hypotheses. These pharmacophore hypotheses were thoroughly validated using various procedures such as ROC analysis and ligand pharmacophore mapping. The validated pharmacophore hypotheses were used to screen 3D databases to identify possible hits. Those which were both high ranked and showed sufficient ability to bind the zinc feature in active site, were further refined by applying drug-like criteria such as Lipiniski's "rule of five" and ADMET filters. Finally, the two candidate compounds (ZINC39323901 and ZINC01034774) were allowed to dock using CDOCKER and GOLD in the active site of FTase enzyme to optimize hit selection.

Identification of tyrosine phosphorylation sites in human Gab-1 protein by EGF receptor kinase in vitro.

PubMed

Lehr, S; Kotzka, J; Herkner, A; Klein, E; Siethoff, C; Knebel, B; Noelle, V; Brüning, J C; Klein, H W; Meyer, H E; Krone, W; Müller-Wieland, D

1999-01-05

Grb2-associated binder-1 (Gab-1) has been identified recently in a cDNA library of glioblastoma tumors and appears to play a central role in cellular growth response, transformation, and apoptosis. Structural and functional features indicate that Gab-1 is a multisubstrate docking protein downstream in the signaling pathways of different receptor tyrosine kinases, including the epidermal growth factor receptor (EGFR). Therefore, the aim of the study was to characterize the phosphorylation of recombinant human Gab-1 (hGab-1) protein by EGFR in vitro. Using the pGEX system to express the entire protein and different domains of hGab-1 as glutathione S-transferase proteins, kinetic data for phosphorylation of these proteins by wheat germ agglutinine-purified EGFR and the recombinant EGFR (rEGFR) receptor kinase domain were determined. Our data revealed similar affinities of hGab-1-C for both receptor preparations (KM = 2.7 microM for rEGFR vs 3.2 microM for WGA EGFR) as well as for the different recombinant hGab-1 domains. To identify the specific EGFR phosphorylation sites, hGab-1-C was sequenced by Edman degradation and mass spectrometry. The entire protein was phosphorylated by rEGFR at eight tyrosine residues (Y285, Y373, Y406, Y447, Y472, Y619, Y657, and Y689). Fifty percent of the identified radioactivity was incorporated in tyrosine Y657 as the predominant peak in HPLC analysis, a site exhibiting features of a potential Syp (PTP1D) binding site. Accordingly, GST-pull down assays with A431 and HepG2 cell lysates showed that phosphorylated intact hGab-1 was able to bind Syp. This binding appears to be specific, because it was abolished by changing the Y657 of hGab-1 to F657. These results demonstrate that hGab-1 is a high-affinity substrate for the EGFR and the major tyrosine phosphorylation site Y657 in the C terminus is a specific binding site for the tyrosine phosphatase Syp.

Feature Binding in Visual Working Memory Evaluated by Type Identification Paradigm

ERIC Educational Resources Information Center

Saiki, Jun; Miyatsuji, Hirofumi

2007-01-01

Memory for feature binding comprises a key ingredient in coherent object representations. Previous studies have been equivocal about human capacity for objects in the visual working memory. To evaluate memory for feature binding, a type identification paradigm was devised and used with a multiple-object permanence tracking task. Using objects…

Characterization of the adenosine receptor in cultured embryonic chick atrial myocytes: Coupling to modulation of contractility and adenylate cyclase activity and identification by direct radioligand binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, B.T.

1989-06-01

Adenosine receptors in a spontaneously contracting atrial myocyte culture from 14-day chick embryos were characterized by radioligand binding studies and by examining the involvement of G-protein in coupling these receptors to a high-affinity state and to the adenylate cyclase and the myocyte contractility. Binding of the antagonist radioligand (3H)-8-cyclopentyl-1,3-diproylxanthine ((3H)CPX) was rapid, reversible and saturable and was to a homogeneous population of sites with a Kd value of 2.1 +/- 0.2 nM and an apparent maximum binding of 26.2 +/- 3 fmol/mg of protein (n = 10, +/- S.E.). Guanyl-5-yl-(beta, gamma-imido)diphosphate had no effect on either the Kd or themore » maximum binding and CPX reversed the N6-R-phenyl-2-propyladenosine-induced inhibition of adenylate cyclase activity and contractility, indicating that (3H) CPX is an antagonist radioligand. Competition curves for (3H) CPX binding by a series of reference adenosine agonists were consistent with labeling of an A1 adenosine receptor and were better fit by a two-site model than by a one-site model. ADP-ribosylation of the G-protein by the endogenous NAD+ in the presence of pertussis toxin shifted the competition curves from bi to monophasic with Ki values similar to those of the KL observed in the absence of prior pertussis intoxication. The adenosine agonists were capable of inhibiting both the adenylate cyclase activity and myocyte contractility in either the absence or the presence of isoproterenol. The A1 adenosine receptor-selective antagonist CPX reversed these agonist effects. The order of ability of the reference adenosine receptor agonists in causing these inhibitory effects was similar to the order of potency of the same agonists in inhibiting the specific (3H)CPX binding (N6-R-phenyl-2-propyladenosine greater than N6-S-phenyl-2-propyladenosine or N-ethyladenosine-5'-uronic acid).« less

Gene cloning, expression and functional characterization of a proliferation-inducing ligand (APRIL) from hedgehog (Erinaceus europaeus).

PubMed

Cui, Xian-Wei; Xiao, Wen; Ji, Chen-Bo; Tian, Ai-Ying; Zhang, Jie; Zhang, Shuang-Quan

2012-05-01

Here we describe the identification of the hedgehog Erinaceus europaeus homologue of a proliferation-inducing ligand (APRIL) of the TNF family (designated heAPRIL). Hedgehog APRIL contains two cysteine residues (Cys(196) and Cys(211)), a furin protease cleavage site and a conserved putative N-glycosylation site (Asn(124)). Real-time quantitative PCR (qPCR) analysis revealed that heAPRIL could be detected in various tissues. MTT assays and flow cytometric analysis revealed that Nus-hesAPRIL and hesAPRIL could promote the survival/proliferation of splenic B cells. Laser scanning confocal microscopy analysis showed GFP-hesAPRIL could successfully bind to the APRIL receptors of lymphocytes.

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Molecular basis of pollen-related food allergy: identification of a second cross-reactive IgE epitope on Pru av 1, the major cherry (Prunus avium) allergen

PubMed Central

2004-01-01

Birch (Betula verrucosa) pollen-associated food allergy is a well-characterized syndrome, which is due to the cross-reactivity of IgE antibodies to homologous allergens in various foods. One crossreacting area on the major birch pollen allergen Bet v 1 and its homologue in cherry (Prunus avium) Pru av 1 has already been identified. This is the so-called ‘P-loop’ region, which encompasses amino acid residues around position 45 and is found on the two virtually identical tertiary protein structures. We tried to determine an additional IgE cross-reacting patch on Pru av 1 and Bet v 1. The putative IgE-binding region on Pru av 1 was localized with a mAb (monoclonal antibody) that was generated against Bet v 1, and cross-reacts with several Bet v 1 homologues in food and inhibits the binding of patients' IgE to Pru av 1. mAb reactivity pattern was analysed and amino acid positions 28 and 108 of Pru av 1 were selected and mutated by site-directed mutagenesis. The Pru av 1 mutants were produced as recombinant proteins and characterized for their folding, mAb- and IgE-binding capacity and allergenic potency with a cellular assay using the humanized rat basophilic leukaemia cell line RBL-25/30. Amino acid position 28 is involved in a second major IgE-binding region on Pru av 1 and probably on Bet v 1. The identification of this second major IgE-binding region is an essential prerequisite to understand the phenomenon of cross-reactivity and its clinical consequences, and to produce hypoallergenic proteins for an improved immunotherapy of type I allergy. PMID:15330760

Molecular basis of pollen-related food allergy: identification of a second cross-reactive IgE epitope on Pru av 1, the major cherry (Prunus avium) allergen.

PubMed

Wiche, Regina; Gubesch, Michaela; König, Herbert; Fötisch, Kay; Hoffmann, Andreas; Wangorsch, Andrea; Scheurer, Stephan; Vieths, Stefan

2005-01-01

Birch (Betula verrucosa) pollen-associated food allergy is a well-characterized syndrome, which is due to the cross-reactivity of IgE antibodies to homologous allergens in various foods. One crossreacting area on the major birch pollen allergen Bet v 1 and its homologue in cherry (Prunus avium) Pru av 1 has already been identified. This is the so-called 'P-loop' region, which encompasses amino acid residues around position 45 and is found on the two virtually identical tertiary protein structures. We tried to determine an additional IgE cross-reacting patch on Pru av 1 and Bet v 1. The putative IgE-binding region on Pru av 1 was localized with a mAb (monoclonal antibody) that was generated against Bet v 1, and cross-reacts with several Bet v 1 homologues in food and inhibits the binding of patients' IgE to Pru av 1. mAb reactivity pattern was analysed and amino acid positions 28 and 108 of Pru av 1 were selected and mutated by site-directed mutagenesis. The Pru av 1 mutants were produced as recombinant proteins and characterized for their folding, mAb- and IgE-binding capacity and allergenic potency with a cellular assay using the humanized rat basophilic leukaemia cell line RBL-25/30. Amino acid position 28 is involved in a second major IgE-binding region on Pru av 1 and probably on Bet v 1. The identification of this second major IgE-binding region is an essential prerequisite to understand the phenomenon of cross-reactivity and its clinical consequences, and to produce hypoallergenic proteins for an improved immunotherapy of type I allergy.

Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

USDA-ARS?s Scientific Manuscript database

Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

Identification and Characterization of Influenza Virus Entry Inhibitors through Dual Myxovirus High-Throughput Screening.

PubMed

Weisshaar, Marco; Cox, Robert; Morehouse, Zachary; Kumar Kyasa, Shiva; Yan, Dan; Oberacker, Phil; Mao, Shuli; Golden, Jennifer E; Lowen, Anice C; Natchus, Michael G; Plemper, Richard K

2016-08-15

Influenza A virus (IAV) infections cause major morbidity and mortality, generating an urgent need for novel antiviral therapeutics. We recently established a dual myxovirus high-throughput screening protocol that combines a fully replication-competent IAV-WSN strain and a respiratory syncytial virus reporter strain for the simultaneous identification of IAV-specific, paramyxovirus-specific, and broad-spectrum inhibitors. In the present study, this protocol was applied to a screening campaign to assess a diverse chemical library with over 142,000 entries. Focusing on IAV-specific hits, we obtained a hit rate of 0.03% after cytotoxicity testing and counterscreening. Three chemically distinct hit classes with nanomolar potency and favorable cytotoxicity profiles were selected. Time-of-addition, minigenome, and viral entry studies demonstrated that these classes block hemagglutinin (HA)-mediated membrane fusion. Antiviral activity extends to an isolate from the 2009 pandemic and, in one case, another group 1 subtype. Target identification through biolayer interferometry confirmed binding of all hit compounds to HA. Resistance profiling revealed two distinct escape mechanisms: primary resistance, associated with reduced compound binding, and secondary resistance, associated with unaltered binding. Secondary resistance was mediated, unusually, through two different pairs of cooperative mutations, each combining a mutation eliminating the membrane-proximal stalk N-glycan with a membrane-distal change in HA1 or HA2. Chemical synthesis of an analog library combined with in silico docking extracted a docking pose for the hit classes. Chemical interrogation spotlights IAV HA as a major druggable target for small-molecule inhibition. Our study identifies novel chemical scaffolds with high developmental potential, outlines diverse routes of IAV escape from entry inhibition, and establishes a path toward structure-aided lead development. This study is one of the first to apply a fully replication-competent third-generation IAV reporter strain to a large-scale high-throughput screen (HTS) drug discovery campaign, allowing multicycle infection and screening in physiologically relevant human respiratory cells. A large number of potential druggable targets was thus chemically interrogated, but mechanistic characterization, positive target identification, and resistance profiling demonstrated that three chemically promising and structurally distinct hit classes selected for further analysis all block HA-mediated membrane fusion. Viral escape from inhibition could be achieved through primary and secondary resistance mechanisms. In silico docking predicted compound binding to a microdomain located at the membrane-distal site of the prefusion HA stalk that was also previously suggested as a target site for chemically unrelated HA inhibitors. This study identifies an unexpected chemodominance of the HA stalk microdomain for small-molecule inhibitors in IAV inhibitor screening campaigns and highlights a novel mechanism of cooperative resistance to IAV entry blockers. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Identification and Characterization of Influenza Virus Entry Inhibitors through Dual Myxovirus High-Throughput Screening

PubMed Central

Weisshaar, Marco; Cox, Robert; Morehouse, Zachary; Kumar Kyasa, Shiva; Yan, Dan; Oberacker, Phil; Mao, Shuli; Lowen, Anice C.; Natchus, Michael G.

2016-01-01

ABSTRACT Influenza A virus (IAV) infections cause major morbidity and mortality, generating an urgent need for novel antiviral therapeutics. We recently established a dual myxovirus high-throughput screening protocol that combines a fully replication-competent IAV-WSN strain and a respiratory syncytial virus reporter strain for the simultaneous identification of IAV-specific, paramyxovirus-specific, and broad-spectrum inhibitors. In the present study, this protocol was applied to a screening campaign to assess a diverse chemical library with over 142,000 entries. Focusing on IAV-specific hits, we obtained a hit rate of 0.03% after cytotoxicity testing and counterscreening. Three chemically distinct hit classes with nanomolar potency and favorable cytotoxicity profiles were selected. Time-of-addition, minigenome, and viral entry studies demonstrated that these classes block hemagglutinin (HA)-mediated membrane fusion. Antiviral activity extends to an isolate from the 2009 pandemic and, in one case, another group 1 subtype. Target identification through biolayer interferometry confirmed binding of all hit compounds to HA. Resistance profiling revealed two distinct escape mechanisms: primary resistance, associated with reduced compound binding, and secondary resistance, associated with unaltered binding. Secondary resistance was mediated, unusually, through two different pairs of cooperative mutations, each combining a mutation eliminating the membrane-proximal stalk N-glycan with a membrane-distal change in HA1 or HA2. Chemical synthesis of an analog library combined with in silico docking extracted a docking pose for the hit classes. Chemical interrogation spotlights IAV HA as a major druggable target for small-molecule inhibition. Our study identifies novel chemical scaffolds with high developmental potential, outlines diverse routes of IAV escape from entry inhibition, and establishes a path toward structure-aided lead development. IMPORTANCE This study is one of the first to apply a fully replication-competent third-generation IAV reporter strain to a large-scale high-throughput screen (HTS) drug discovery campaign, allowing multicycle infection and screening in physiologically relevant human respiratory cells. A large number of potential druggable targets was thus chemically interrogated, but mechanistic characterization, positive target identification, and resistance profiling demonstrated that three chemically promising and structurally distinct hit classes selected for further analysis all block HA-mediated membrane fusion. Viral escape from inhibition could be achieved through primary and secondary resistance mechanisms. In silico docking predicted compound binding to a microdomain located at the membrane-distal site of the prefusion HA stalk that was also previously suggested as a target site for chemically unrelated HA inhibitors. This study identifies an unexpected chemodominance of the HA stalk microdomain for small-molecule inhibitors in IAV inhibitor screening campaigns and highlights a novel mechanism of cooperative resistance to IAV entry blockers. PMID:27252534

Great interactions: How binding incorrect partners can teach us about protein recognition and function.

PubMed

Vamparys, Lydie; Laurent, Benoist; Carbone, Alessandra; Sacquin-Mora, Sophie

2016-10-01

Protein-protein interactions play a key part in most biological processes and understanding their mechanism is a fundamental problem leading to numerous practical applications. The prediction of protein binding sites in particular is of paramount importance since proteins now represent a major class of therapeutic targets. Amongst others methods, docking simulations between two proteins known to interact can be a useful tool for the prediction of likely binding patches on a protein surface. From the analysis of the protein interfaces generated by a massive cross-docking experiment using the 168 proteins of the Docking Benchmark 2.0, where all possible protein pairs, and not only experimental ones, have been docked together, we show that it is also possible to predict a protein's binding residues without having any prior knowledge regarding its potential interaction partners. Evaluating the performance of cross-docking predictions using the area under the specificity-sensitivity ROC curve (AUC) leads to an AUC value of 0.77 for the complete benchmark (compared to the 0.5 AUC value obtained for random predictions). Furthermore, a new clustering analysis performed on the binding patches that are scattered on the protein surface show that their distribution and growth will depend on the protein's functional group. Finally, in several cases, the binding-site predictions resulting from the cross-docking simulations will lead to the identification of an alternate interface, which corresponds to the interaction with a biomolecular partner that is not included in the original benchmark. Proteins 2016; 84:1408-1421. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.

Structural basis for norovirus neutralization by an HBGA blocking human IgA antibody.

PubMed

Shanker, Sreejesh; Czakó, Rita; Sapparapu, Gopal; Alvarado, Gabriela; Viskovska, Maria; Sankaran, Banumathi; Atmar, Robert L; Crowe, James E; Estes, Mary K; Prasad, B V Venkataram

2016-10-04

Human noroviruses (HuNoVs) cause sporadic and epidemic gastroenteritis worldwide. They are classified into two major genogroups (GI and GII), with each genogroup further divided into multiple genotypes. Susceptibility to these viruses is influenced by genetically determined histo-blood group antigen (HBGA) expression. HBGAs function as cell attachment factors by binding to a surface-exposed region in the protruding (P) domain of the capsid protein. Sequence variations in this region that result in differential HBGA binding patterns and antigenicity are suggested to form a basis for strain diversification. Recent studies show that serum antibodies that block HBGA binding correlate with protection against illness. Although genogroup-dependent variation in HBGA binding specificity is structurally well characterized, an understanding of how antibodies block HBGA binding and how genotypic variations affect such blockade is lacking. Our crystallographic studies of the GI.1 P domain in complex with the Fab fragment of a human IgA monoclonal antibody (IgA 5I2) with HBGA blocking activity show that the antibody recognizes a conformational epitope formed by two surface-exposed loop clusters in the P domain. The antibody engulfs the HBGA binding site but does not affect its structural integrity. An unusual feature of the antigen recognition by IgA 5I2 is the predominant involvement of the CDR light chain 1 in contrast to the commonly observed CDR heavy chain 3, providing a unique perspective into antibody diversity in antigen recognition. Identification of the antigenic site in the P domain shows how genotypic variations might allow escape from antibody neutralization and exemplifies the interplay between antigenicity and HBGA specificity in HuNoV evolution.

Modulation of the conformational state of the SV2A protein by an allosteric mechanism as evidenced by ligand binding assays

PubMed Central

Daniels, V; Wood, M; Leclercq, K; Kaminski, R M; Gillard, M

2013-01-01

Background and Purpose Synaptic vesicle protein 2A (SV2A) is the specific binding site of the anti-epileptic drug levetiracetam (LEV) and its higher affinity analogue UCB30889. Moreover, the protein has been well validated as a target for anticonvulsant therapy. Here, we report the identification of UCB1244283 acting as a SV2A positive allosteric modulator of UCB30889. Experimental Approach UCB1244283 was characterized in vitro using radioligand binding assays with [3H]UCB30889 on recombinant SV2A expressed in HEK cells and on rat cortex. In vivo, the compound was tested in sound-sensitive mice. Key Results Saturation binding experiments in the presence of UCB1244283 demonstrated a fivefold increase in the affinity of [3H]UCB30889 for human recombinant SV2A, combined with a twofold increase of the total number of binding sites. Similar results were obtained on rat cortex. In competition binding experiments, UCB1244283 potentiated the affinity of UCB30889 while the affinity of LEV remained unchanged. UCB1244283 significantly slowed down both the association and dissociation kinetics of [3H]UCB30889. Following i.c.v. administration in sound-sensitive mice, UCB1244283 showed a clear protective effect against both tonic and clonic convulsions. Conclusions and Implications These results indicate that UCB1244283 can modulate the conformation of SV2A, thereby inducing a higher affinity state for UCB30889. Our results also suggest that the conformation of SV2A per se might be an important determinant of its functioning, especially during epileptic seizures. Therefore, agents that act on the conformation of SV2A might hold great potential in the search for new SV2A-based anticonvulsant therapies. PMID:23530581

Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

PubMed

Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

2006-07-01

Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

PAINT: a promoter analysis and interaction network generation tool for gene regulatory network identification.

PubMed

Vadigepalli, Rajanikanth; Chakravarthula, Praveen; Zak, Daniel E; Schwaber, James S; Gonye, Gregory E

2003-01-01

We have developed a bioinformatics tool named PAINT that automates the promoter analysis of a given set of genes for the presence of transcription factor binding sites. Based on coincidence of regulatory sites, this tool produces an interaction matrix that represents a candidate transcriptional regulatory network. This tool currently consists of (1) a database of promoter sequences of known or predicted genes in the Ensembl annotated mouse genome database, (2) various modules that can retrieve and process the promoter sequences for binding sites of known transcription factors, and (3) modules for visualization and analysis of the resulting set of candidate network connections. This information provides a substantially pruned list of genes and transcription factors that can be examined in detail in further experimental studies on gene regulation. Also, the candidate network can be incorporated into network identification methods in the form of constraints on feasible structures in order to render the algorithms tractable for large-scale systems. The tool can also produce output in various formats suitable for use in external visualization and analysis software. In this manuscript, PAINT is demonstrated in two case studies involving analysis of differentially regulated genes chosen from two microarray data sets. The first set is from a neuroblastoma N1E-115 cell differentiation experiment, and the second set is from neuroblastoma N1E-115 cells at different time intervals following exposure to neuropeptide angiotensin II. PAINT is available for use as an agent in BioSPICE simulation and analysis framework (www.biospice.org), and can also be accessed via a WWW interface at www.dbi.tju.edu/dbi/tools/paint/.

Identification of a DNA sequence motif required for expression of iron-regulated genes in pseudomonads.

PubMed

Rombel, I T; McMorran, B J; Lamont, I L

1995-02-20

Many bacteria respond to a lack of iron in the environment by synthesizing siderophores, which act as iron-scavenging compounds. Fluorescent pseudomonads synthesize strain-specific but chemically related siderophores called pyoverdines or pseudobactins. We have investigated the mechanisms by which iron controls expression of genes involved in pyoverdine metabolism in Pseudomonas aeruginosa. Transcription of these genes is repressed by the presence of iron in the growth medium. Three promoters from these genes were cloned and the activities of the promoters were dependent on the amounts of iron in the growth media. Two of the promoters were sequenced and the transcriptional start site were identified by S1 nuclease analysis. Sequences similar to the consensus binding site for the Fur repressor protein, which controls expression of iron-repressible genes in several gram-negative species, were not present in the promoters, suggesting that they are unlikely to have a high affinity for Fur. However, comparison of the promoter sequences with those of iron-regulated genes from other Pseudomonas species and also the iron-regulated exotoxin gene of P. aeruginosa allowed identification of a shared sequence element, with the consensus sequence (G/C)CTAAAT-CCC, which is likely to act as a binding site for a transcriptional activator protein. Mutations in this sequence greatly reduced the activities of the promoters characterized here as well as those of other iron-regulated promoters. The requirement for this motif in the promoters of iron-regulated genes of different Pseudomonas species indicates that similar mechanisms are likely to be involved in controlling expression of a range of iron-regulated genes in pseudomonads.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Discovery of Nigri/nox and Panto/pox site-specific recombinase systems facilitates advanced genome engineering.

PubMed

Karimova, Madina; Splith, Victoria; Karpinski, Janet; Pisabarro, M Teresa; Buchholz, Frank

2016-07-22

Precise genome engineering is instrumental for biomedical research and holds great promise for future therapeutic applications. Site-specific recombinases (SSRs) are valuable tools for genome engineering due to their exceptional ability to mediate precise excision, integration and inversion of genomic DNA in living systems. The ever-increasing complexity of genome manipulations and the desire to understand the DNA-binding specificity of these enzymes are driving efforts to identify novel SSR systems with unique properties. Here, we describe two novel tyrosine site-specific recombination systems designated Nigri/nox and Panto/pox. Nigri originates from Vibrio nigripulchritudo (plasmid VIBNI_pA) and recombines its target site nox with high efficiency and high target-site selectivity, without recombining target sites of the well established SSRs Cre, Dre, Vika and VCre. Panto, derived from Pantoea sp. aB, is less specific and in addition to its native target site, pox also recombines the target site for Dre recombinase, called rox. This relaxed specificity allowed the identification of residues that are involved in target site selectivity, thereby advancing our understanding of how SSRs recognize their respective DNA targets.

Identification and properties of steroid-binding proteins in nesting Chelonia mydas plasma.

PubMed

Ikonomopoulou, M P; Bradley, A J; Whittier, J M; Ibrahim, K

2006-11-01

We report for the first time the presence of a sex steroid-binding protein in the plasma of green sea turtles Chelonia mydas, which provides an insight into reproductive status. A high affinity, low capacity sex hormone steroid-binding protein was identified in nesting C. mydas and its thermal profile was established. In nesting C. mydas testosterone and oestradiol bind at 4 degrees C with high affinity (K (a) = 1.49 +/- 0.09 x 10(9) M(-1); 0.17 +/- 0.02 x 10(7) M(-1)) and low binding capacity (B (max) = 3.24 +/- 0.84 x 10(-5) M; 0.33 +/- 0.06 x 10(-4) M). The binding affinity and capacity of testosterone at 23 and 36 degrees C, respectively were similar to those determined at 4 degrees C. However, oestradiol showed no binding activity at 36 degrees C. With competition studies we showed that oestradiol and oestrone do not compete for binding sites. Furthermore, in nesting C. mydas plasma no high-affinity binding was observed for adrenocortical steroids (cortisol and corticosterone) and progesterone. Our results indicate that in nesting C. mydas plasma temperature has a minimal effect on the high-affinity binding of testosterone to sex steroid-binding protein, however, the high affinity binding of oestradiol to sex steroid-binding protein is abolished at a hypothetically high (36 degrees C) sea/ambient/body temperature. This suggests that at high core body temperatures most of the oestradiol becomes biologically available to the tissues rather than remaining bound to a high-affinity carrier.

Identification of the Doublesex protein binding sites that activate expression of lozenge in the female genital disc in Drosophila melanogaster.

PubMed

Wagamitsu, Shunsuke; Takase, Dan; Aoki, Fugaku; Suzuki, Masataka G

2017-02-01

Normal sexual differentiation in the genital organs is essential for the animal species that use sexual reproduction. Although it is known that doublesex (dsx) is required for the sexual development of the genitalia in various insect species, the direct target genes responsible for the sexual differentiation of the genitalia have not been identified. The lozenge (lz) gene is expressed in the female genital disc and is essential for developments of spermathecae and accessory glands in Drosophila melanogaster. The female-specific isoform of DSX (DSXF) is required for activating lz expression in the female genital disc. However, it still remains unclear whether the DSXF directly activates the transcription of lz in the female genital disc. In this study, we found two sequences (lz-DBS1 and lz-DBS2) within lz locus that showed high homoloty to the DSX binding motif identified previously. Competition assays using recombinant DSX DNA-binding domain (DSX-DBD) protein verified that the DSX-DBD protein bound to lz-DBS1 and lz-DBS2 in a sequence-specific manner with lower affinity than to the known DSX binding site in the bric-à-brac 1 (bab1) gene. Reporter gene analyses revealed that a 2.5-kbp lz genomic fragment containing lz-DBS1 and lz-DBS2 drove reporter gene (EGFP) expression in a manner similar to endogenous lz expression in the female genital disc. Mutations in lz-DBS1 alone significantly reduced the area of EGFP-expressing region, while EGFP expression in the female genital disc was abolished when both sites were mutated. These results demonstrated that DSX directly activates female-specific lz expression in the genital disc through lz-DBS1 and lz-DBS2. Copyright © 2017 Elsevier B.V. All rights reserved.

Multiple grid arrangement improves ligand docking with unknown binding sites: Application to the inverse docking problem.

PubMed

Ban, Tomohiro; Ohue, Masahito; Akiyama, Yutaka

2018-04-01

The identification of comprehensive drug-target interactions is important in drug discovery. Although numerous computational methods have been developed over the years, a gold standard technique has not been established. Computational ligand docking and structure-based drug design allow researchers to predict the binding affinity between a compound and a target protein, and thus, they are often used to virtually screen compound libraries. In addition, docking techniques have also been applied to the virtual screening of target proteins (inverse docking) to predict target proteins of a drug candidate. Nevertheless, a more accurate docking method is currently required. In this study, we proposed a method in which a predicted ligand-binding site is covered by multiple grids, termed multiple grid arrangement. Notably, multiple grid arrangement facilitates the conformational search for a grid-based ligand docking software and can be applied to the state-of-the-art commercial docking software Glide (Schrödinger, LLC). We validated the proposed method by re-docking with the Astex diverse benchmark dataset and blind binding site situations, which improved the correct prediction rate of the top scoring docking pose from 27.1% to 34.1%; however, only a slight improvement in target prediction accuracy was observed with inverse docking scenarios. These findings highlight the limitations and challenges of current scoring functions and the need for more accurate docking methods. The proposed multiple grid arrangement method was implemented in Glide by modifying a cross-docking script for Glide, xglide.py. The script of our method is freely available online at http://www.bi.cs.titech.ac.jp/mga_glide/. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

FISim: A new similarity measure between transcription factor binding sites based on the fuzzy integral

PubMed Central

Garcia, Fernando; Lopez, Francisco J; Cano, Carlos; Blanco, Armando

2009-01-01

Background Regulatory motifs describe sets of related transcription factor binding sites (TFBSs) and can be represented as position frequency matrices (PFMs). De novo identification of TFBSs is a crucial problem in computational biology which includes the issue of comparing putative motifs with one another and with motifs that are already known. The relative importance of each nucleotide within a given position in the PFMs should be considered in order to compute PFM similarities. Furthermore, biological data are inherently noisy and imprecise. Fuzzy set theory is particularly suitable for modeling imprecise data, whereas fuzzy integrals are highly appropriate for representing the interaction among different information sources. Results We propose FISim, a new similarity measure between PFMs, based on the fuzzy integral of the distance of the nucleotides with respect to the information content of the positions. Unlike existing methods, FISim is designed to consider the higher contribution of better conserved positions to the binding affinity. FISim provides excellent results when dealing with sets of randomly generated motifs, and outperforms the remaining methods when handling real datasets of related motifs. Furthermore, we propose a new cluster methodology based on kernel theory together with FISim to obtain groups of related motifs potentially bound by the same TFs, providing more robust results than existing approaches. Conclusion FISim corrects a design flaw of the most popular methods, whose measures favour similarity of low information content positions. We use our measure to successfully identify motifs that describe binding sites for the same TF and to solve real-life problems. In this study the reliability of fuzzy technology for motif comparison tasks is proven. PMID:19615102

Identification of a novel cell binding site of periostin involved in tumour growth.

PubMed

Orecchia, Paola; Conte, Romana; Balza, Enrica; Castellani, Patrizia; Borsi, Laura; Zardi, Luciano; Mingari, Maria Cristina; Carnemolla, Barbara

2011-09-01

Periostin (PN), a member of the fasciclin family of proteins, is a TGF-β-induced extracellular matrix protein involved in cell survival, angiogenesis, invasion and metastasis. It is considered a potent angiogenic factor and a marker of tumour progression in many types of human cancer. Many different kinds of cells bind to PN by means of the integrins αvβ3 and αvβ5, but the periostin epitope recognised by these integrins is not formally demonstrated. The aim of our study was to identify which domain of PN could be involved in cell adhesion and its potential role in tumour growth. We generated the monoclonal antibody OC-20 (mAb OC-20) by hybridoma technology. Different PN recombinant fragments were used to characterise the periostin epitope recognised by the mAb OC-20 and to localise a new cell binding site of the protein. A murine model of human melanoma was used in the preclinical in vivo experiments. We formally demonstrate that the periostin epitope recognised by OC-20 is a new binding site for the integrins αvβ3 and αvβ5, localised in the second FAS1 domain (FAS1-2) of the protein. Moreover the in vivo use of this antibody significantly inhibits tumour growth and angiogenesis. Our results show that the FAS1-2 domain of PN plays a role in tumour progression. Moreover this novel antibody may likewise prove to be very useful in clarifying the role of PN in angiogenesis and may contribute to the design of novel anti-angiogenesis drugs. Copyright © 2011 Elsevier Ltd. All rights reserved.

Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

PubMed

Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

2003-12-01

p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

Role of the RNA polymerase α subunits in CII-dependent activation of the bacteriophage λ pE promoter: identification of important residues and positioning of the α C-terminal domains

PubMed Central

Kedzierska, Barbara; Lee, David J.; Węgrzyn, Grzegorz; Busby, Stephen J. W.; Thomas, Mark S.

2004-01-01

The bacteriophage λ CII protein stimulates the activity of three phage promoters, pE, pI and paQ, upon binding to a site overlapping the –35 element at each promoter. Here we used preparations of RNA polymerase carrying a DNA cleavage reagent attached to specific residues in the C-terminal domain of the RNA polymerase α subunit (αCTD) to demonstrate that one αCTD binds near position –41 at pE, whilst the other αCTD binds further upstream. The αCTD bound near position –41 is oriented such that its 261 determinant is in close proximity to σ70. The location of αCTD in CII-dependent complexes at the pE promoter is very similar to that found at many activator-independent promoters, and represents an alternative configuration for αCTD at promoters where activators bind sites overlapping the –35 region. We also used an in vivo alanine scan analysis to show that the DNA-binding determinant of αCTD is involved in stimulation of the pE promoter by CII, and this was confirmed by in vitro transcription assays. We also show that whereas the K271E substitution in αCTD results in a drastic decrease in CII-dependent activation of pE, the pI and paQ promoters are less sensitive to this substitution, suggesting that the role of αCTD at the three lysogenic promoters may be different. PMID:14762211

An Electrostatic Funnel in the GABA-Binding Pathway

PubMed Central

Lightstone, Felice C.

2016-01-01

The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

PubMed Central

Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

2013-01-01

Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

In Silico Detection of Sequence Variations Modifying Transcriptional Regulation

PubMed Central

Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob

2008-01-01

Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

NASA Astrophysics Data System (ADS)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

PubMed

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

PubMed Central

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

2011-01-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

Identification and Structure-Activity Relationship of HDAC6 Zinc-Finger Ubiquitin Binding Domain Inhibitors.

PubMed

Ferreira de Freitas, Renato; Harding, Rachel J; Franzoni, Ivan; Ravichandran, Mani; Mann, Mandeep K; Ouyang, Hui; Lautens, Mark; Santhakumar, Vijayaratnam; Arrowsmith, Cheryl H; Schapira, Matthieu

2018-05-24

HDAC6 plays a central role in the recruitment of protein aggregates for lysosomal degradation and is a promising target for combination therapy with proteasome inhibitors in multiple myeloma. Pharmacologically displacing ubiquitin from the zinc-finger ubiquitin-binding domain (ZnF-UBD) of HDAC6 is an underexplored alternative to catalytic inhibition. Here, we present the discovery of an HDAC6 ZnF-UBD-focused chemical series and its progression from virtual screening hits to low micromolar inhibitors. A carboxylate mimicking the C-terminal extremity of ubiquitin, and an extended aromatic system stacking with W1182 and R1155, are necessary for activity. One of the compounds induced a conformational remodeling of the binding site where the primary binding pocket opens up onto a ligand-able secondary pocket that may be exploited to increase potency. The preliminary structure-activity relationship accompanied by nine crystal structures should enable further optimization into a chemical probe to investigate the merit of targeting the ZnF-UBD of HDAC6 in multiple myeloma and other diseases.

Solution NMR Spectroscopy in Target-Based Drug Discovery.

PubMed

Li, Yan; Kang, Congbao

2017-08-23

Solution NMR spectroscopy is a powerful tool to study protein structures and dynamics under physiological conditions. This technique is particularly useful in target-based drug discovery projects as it provides protein-ligand binding information in solution. Accumulated studies have shown that NMR will play more and more important roles in multiple steps of the drug discovery process. In a fragment-based drug discovery process, ligand-observed and protein-observed NMR spectroscopy can be applied to screen fragments with low binding affinities. The screened fragments can be further optimized into drug-like molecules. In combination with other biophysical techniques, NMR will guide structure-based drug discovery. In this review, we describe the possible roles of NMR spectroscopy in drug discovery. We also illustrate the challenges encountered in the drug discovery process. We include several examples demonstrating the roles of NMR in target-based drug discoveries such as hit identification, ranking ligand binding affinities, and mapping the ligand binding site. We also speculate the possible roles of NMR in target engagement based on recent processes in in-cell NMR spectroscopy.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

Identification of key residues for protein conformational transition using elastic network model.

PubMed

Su, Ji Guo; Xu, Xian Jin; Li, Chun Hua; Chen, Wei Zu; Wang, Cun Xin

2011-11-07

Proteins usually undergo conformational transitions between structurally disparate states to fulfill their functions. The large-scale allosteric conformational transitions are believed to involve some key residues that mediate the conformational movements between different regions of the protein. In the present work, a thermodynamic method based on the elastic network model is proposed to predict the key residues involved in protein conformational transitions. In our method, the key functional sites are identified as the residues whose perturbations largely influence the free energy difference between the protein states before and after transition. Two proteins, nucleotide binding domain of the heat shock protein 70 and human/rat DNA polymerase β, are used as case studies to identify the critical residues responsible for their open-closed conformational transitions. The results show that the functionally important residues mainly locate at the following regions for these two proteins: (1) the bridging point at the interface between the subdomains that control the opening and closure of the binding cleft; (2) the hinge region between different subdomains, which mediates the cooperative motions between the corresponding subdomains; and (3) the substrate binding sites. The similarity in the positions of the key residues for these two proteins may indicate a common mechanism in their conformational transitions.

Identification and expression analysis of a putative fatty acidbinding protein gene in the Asian honeybee, Apis cerana cerana.

PubMed

Yu, Xiaoli; Kang, Mingjiang; Liu, Li; Guo, Xingqi; Xu, Baohua

2013-01-01

Fatty acid-binding proteins (FABPs) play pivotal roles in cellular signaling, gene transcription, and lipid metabolism in vertebrates and invertebrates. In this study, a putative FABP gene, referred to as AccFABP, was isolated from the Asian honeybee, Apis cerana cerana Fabricius (Hymenoptera: Apidae). The full-length cDNA consisted of 725 bp, and encoded a protein of 204 amino acids. Homology and phylogenetic analysis indicated that AccFABP was a member of the FABP multifamily. The genomic structure of this gene, which was common among FABP multifamily members, spanned 1,900 bp, and included four exons and three introns. Gene expression analysis revealed that AccFABP was highly expressed in the dark-pigmented phase of pupal development, with peak expression observed in the fat bodies of the dark-pigmented phase pupae. The AccFABP transcripts in the fat body were upregulated by exposure to dietary fatty acids such as conjugated linoleic acid, docosahexaenoic acid, and arachidonic acid. Transcription factor binding sites for Caudal-Related Homeobox and functional CCAAT/enhancer binding site, which were respectively associated with tissue expression and lipid metabolism, were detected in the 5' promoter sequence. The evidence provided in the present study suggests that AccFABP may regulate insect growth and development, and lipid metabolism.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jun-Hao; Liu, Shun; Zheng, Ling-Ling

Long non-coding RNAs (lncRNAs) are emerging as important regulatory molecules in developmental, physiological, and pathological processes. However, the precise mechanism and functions of most of lncRNAs remain largely unknown. Recent advances in high-throughput sequencing of immunoprecipitated RNAs after cross-linking (CLIP-Seq) provide powerful ways to identify biologically relevant protein–lncRNA interactions. In this study, by analyzing millions of RNA-binding protein (RBP) binding sites from 117 CLIP-Seq datasets generated by 50 independent studies, we identified 22,735 RBP–lncRNA regulatory relationships. We found that one single lncRNA will generally be bound and regulated by one or multiple RBPs, the combination of which may coordinately regulatemore » gene expression. We also revealed the expression correlation of these interaction networks by mining expression profiles of over 6000 normal and tumor samples from 14 cancer types. Our combined analysis of CLIP-Seq data and genome-wide association studies data discovered hundreds of disease-related single nucleotide polymorphisms resided in the RBP binding sites of lncRNAs. Finally, we developed interactive web implementations to provide visualization, analysis, and downloading of the aforementioned large-scale datasets. Our study represented an important step in identification and analysis of RBP–lncRNA interactions and showed that these interactions may play crucial roles in cancer and genetic diseases.« less

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

PubMed

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

Identification of an Inhibitory Alcohol Binding Site in GABAA ρ1 Receptors

PubMed Central

Borghese, Cecilia M.; Ruiz, Carlos I.; Lee, Ui S.; Cullins, Madeline A.; Bertaccini, Edward J.; Trudell, James R.; Harris, R. Adron

2016-01-01

Alcohols inhibit γ-aminobutyric acid type A ρ1 receptor function. After introducing mutations in several positions of the second transmembrane helix in ρ1, we studied the effects of ethanol and hexanol on GABA responses using two-electrode voltage clamp electrophysiology in Xenopus laevis oocytes. The 6′ mutations produced the following effects on ethanol and hexanol responses: small increase or no change (T6′M), increased inhibition (T6′V) and small potentiation (T6′Y and T6′F). The 5′ mutations produced mainly increases in hexanol inhibition. Other mutations produced small (3′ and 9′) or no changes (2′ and L277 in the first transmembrane domain) in alcohol effects. These results suggest an inhibitory alcohol binding site near the 6′ position. Homology models of ρ1 receptors based on the X-ray structure of GluCl showed that the 2′, 5′, 6’ and 9′ residues were easily accessible from the ion pore, with 5′ and 6′ residues from neighboring subunits facing each other; L3′ and L277 also faced the neighboring subunit. We tested ethanol through octanol on single and double mutated ρ1 receptors [ρ1(I15′S), ρ1(T6′Y) and ρ1(T6′Y,I15′S)] to further characterize the inhibitory alcohol pocket in the wild-type ρ1 receptor. The pocket can only bind relatively short-chain alcohols and is eliminated by introducing Y in the 6’ position. Replacing the bulky 15′ residue with a smaller side chain introduced a potentiating binding site, more sensitive to long-chain than to short-chain alcohols. In conclusion, the net alcohol effect on the ρ1 receptor is determined by the sum of its actions on inhibitory and potentiating sites. PMID:26571107

Evolutionarily conserved TCR binding sites, identification of T cells in primary lymphoid tissues, and surprising trans-rearrangements in nurse shark.

PubMed

Criscitiello, Michael F; Ohta, Yuko; Saltis, Mark; McKinney, E Churchill; Flajnik, Martin F

2010-06-15

Cartilaginous fish are the oldest animals that generate RAG-based Ag receptor diversity. We have analyzed the genes and expressed transcripts of the four TCR chains for the first time in a cartilaginous fish, the nurse shark (Ginglymostoma cirratum). Northern blotting found TCR mRNA expression predominantly in lymphoid and mucosal tissues. Southern blotting suggested translocon-type loci encoding all four chains. Based on diversity of V and J segments, the expressed combinatorial diversity for gamma is similar to that of human, alpha and beta may be slightly lower, and delta diversity is the highest of any organism studied to date. Nurse shark TCRdelta have long CDR3 loops compared with the other three chains, creating binding site topologies comparable to those of mammalian TCR in basic paratope structure; additionally, nurse shark TCRdelta CDR3 are more similar to IgH CDR3 in length and heterogeneity than to other TCR chains. Most interestingly, several cDNAs were isolated that contained IgM or IgW V segments rearranged to other gene segments of TCRdelta and alpha. Finally, in situ hybridization experiments demonstrate a conservation of both alpha/beta and gamma/delta T cell localization in the thymus across 450 million years of vertebrate evolution, with gamma/delta TCR expression especially high in the subcapsular region. Collectively, these data make the first cellular identification of TCR-expressing lymphocytes in a cartilaginous fish.

Identification of discrete sites in Yip1A necessary for regulation of endoplasmic reticulum structure.

PubMed

Dykstra, Kaitlyn M; Ulengin, Idil; Delrose, Nicholas; Lee, Tina H

2013-01-01

The endoplasmic reticulum (ER) of specialized cells can undergo dramatic changes in structural organization, including formation of concentric whorls. We previously reported that depletion of Yip1A, an integral membrane protein conserved between yeast and mammals, caused ER whorl formation reminiscent of that seen in specialized cells. Yip1A and its yeast homologue Yip1p cycle between the ER and early Golgi, have been implicated in a number of distinct trafficking steps, and interact with a conserved set of binding partners including Yif1p/Yif1A and the Ypt1/Ypt31 Rab GTPases. Here, we carried out a mutational analysis of Yip1A to obtain insight into how it regulates ER whorl formation. Most of the Yip1A cytoplasmic domain was dispensable, whereas the transmembrane (TM) domain, especially residues within predicted TM helices 3 and 4, were sensitive to mutagenesis. Comprehensive analysis revealed two discrete functionally required determinants. One was E95 and flanking residues L92 and L96 within the cytoplasmic domain; the other was K146 and nearby residue V152 within the TM domain. Notably, the identified determinants correspond closely to two sites previously found to be essential for yeast viability (E76 and K130 in Yip1p corresponding to E95 and K146 in Yip1A, respectively). In contrast, a third site (E89) also essential for yeast viability (E70 in Yip1p) was dispensable for regulation of whorl formation. Earlier work showed that E76 (E95) was dispensable for binding Yif1p or Ypt1p/Ypt31p, whereas E70 (E89) was required. Collectively, these findings suggest that the ability of Yip1A to bind its established binding partners may be uncoupled from its ability to control ER whorl formation. In support, Yif1A knockdown did not cause ER whorl formation. Thus Yip1A may use the sites identified herein to interact with a novel binding partner to regulate ER membrane organization.

Mutations in FLNB cause boomerang dysplasia

PubMed Central

Bicknell, L; Morgan, T; Bonafe, L; Wessels, M; Bialer, M; Willems, P; Cohn, D; Krakow, D; Robertson, S

2005-01-01

Boomerang dysplasia (BD) is a perinatal lethal osteochondrodysplasia, characterised by absence or underossification of the limb bones and vertebrae. The BD phenotype is similar to a group of disorders including atelosteogenesis I, atelosteogenesis III, and dominantly inherited Larsen syndrome that we have recently shown to be associated with mutations in FLNB, the gene encoding the actin binding cytoskeletal protein, filamin B. We report the identification of mutations in FLNB in two unrelated individuals with boomerang dysplasia. The resultant substitutions, L171R and S235P, lie within the calponin homology 2 region of the actin binding domain of filamin B and occur at sites that are evolutionarily well conserved. These findings expand the phenotypic spectrum resulting from mutations in FLNB and underline the central role this protein plays during skeletogenesis in humans. PMID:15994868

Mutations in FLNB cause boomerang dysplasia.

PubMed

Bicknell, L S; Morgan, T; Bonafé, L; Wessels, M W; Bialer, M G; Willems, P J; Cohn, D H; Krakow, D; Robertson, S P

2005-07-01

Boomerang dysplasia (BD) is a perinatal lethal osteochondrodysplasia, characterised by absence or underossification of the limb bones and vertebrae. The BD phenotype is similar to a group of disorders including atelosteogenesis I, atelosteogenesis III, and dominantly inherited Larsen syndrome that we have recently shown to be associated with mutations in FLNB, the gene encoding the actin binding cytoskeletal protein, filamin B. We report the identification of mutations in FLNB in two unrelated individuals with boomerang dysplasia. The resultant substitutions, L171R and S235P, lie within the calponin homology 2 region of the actin binding domain of filamin B and occur at sites that are evolutionarily well conserved. These findings expand the phenotypic spectrum resulting from mutations in FLNB and underline the central role this protein plays during skeletogenesis in humans.

Identification and functional validation of novel autoantigens in equine uveitis.

PubMed

Deeg, Cornelia A; Pompetzki, Dirk; Raith, Albert J; Hauck, Stefanie M; Amann, Barbara; Suppmann, Sabine; Goebel, Thomas W F; Olazabal, Ursula; Gerhards, Hartmut; Reese, Sven; Stangassinger, Manfred; Kaspers, Bernd; Ueffing, Marius

2006-08-01

The development, progression, and recurrence of autoimmune diseases are frequently driven by a group of participatory autoantigens. We identified and characterized novel autoantigens by analyzing the autoantibody binding pattern from horses affected by spontaneous equine recurrent uveitis to the retinal proteome. Cellular retinaldehyde-binding protein (cRALBP) had not been described previously as autoantigen, but subsequent characterization in equine recurrent uveitis horses revealed B and T cell autoreactivity to this protein and established a link to epitope spreading. We further immunized healthy rats and horses with cRALBP and observed uveitis in both species with typical tissue lesions at cRALBP expression sites. The autoantibody profiling outlined here could be used in various autoimmune diseases to detect autoantigens involved in the dynamic spreading cascade or serve as predictive markers.

Identification of pathways directly regulated by SHORT VEGETATIVE PHASE during vegetative and reproductive development in Arabidopsis

PubMed Central

2013-01-01

Background MADS-domain transcription factors play important roles during plant development. The Arabidopsis MADS-box gene SHORT VEGETATIVE PHASE (SVP) is a key regulator of two developmental phases. It functions as a repressor of the floral transition during the vegetative phase and later it contributes to the specification of floral meristems. How these distinct activities are conferred by a single transcription factor is unclear, but interactions with other MADS domain proteins which specify binding to different genomic regions is likely one mechanism. Results To compare the genome-wide DNA binding profile of SVP during vegetative and reproductive development we performed ChIP-seq analyses. These ChIP-seq data were combined with tiling array expression analysis, induction experiments and qRT-PCR to identify biologically relevant binding sites. In addition, we compared genome-wide target genes of SVP with those published for the MADS domain transcription factors FLC and AP1, which interact with SVP during the vegetative and reproductive phases, respectively. Conclusions Our analyses resulted in the identification of pathways that are regulated by SVP including those controlling meristem development during vegetative growth and flower development whereas floral transition pathways and hormonal signaling were regulated predominantly during the vegetative phase. Thus, SVP regulates many developmental pathways, some of which are common to both of its developmental roles whereas others are specific to only one of them. PMID:23759218

SInCRe—structural interactome computational resource for Mycobacterium tuberculosis

PubMed Central

Metri, Rahul; Hariharaputran, Sridhar; Ramakrishnan, Gayatri; Anand, Praveen; Raghavender, Upadhyayula S.; Ochoa-Montaño, Bernardo; Higueruelo, Alicia P.; Sowdhamini, Ramanathan; Chandra, Nagasuma R.; Blundell, Tom L.; Srinivasan, Narayanaswamy

2015-01-01

We have developed an integrated database for Mycobacterium tuberculosis H37Rv (Mtb) that collates information on protein sequences, domain assignments, functional annotation and 3D structural information along with protein–protein and protein–small molecule interactions. SInCRe (Structural Interactome Computational Resource) is developed out of CamBan (Cambridge and Bangalore) collaboration. The motivation for development of this database is to provide an integrated platform to allow easily access and interpretation of data and results obtained by all the groups in CamBan in the field of Mtb informatics. In-house algorithms and databases developed independently by various academic groups in CamBan are used to generate Mtb-specific datasets and are integrated in this database to provide a structural dimension to studies on tuberculosis. The SInCRe database readily provides information on identification of functional domains, genome-scale modelling of structures of Mtb proteins and characterization of the small-molecule binding sites within Mtb. The resource also provides structure-based function annotation, information on small-molecule binders including FDA (Food and Drug Administration)-approved drugs, protein–protein interactions (PPIs) and natural compounds that bind to pathogen proteins potentially and result in weakening or elimination of host–pathogen protein–protein interactions. Together they provide prerequisites for identification of off-target binding. Database URL: http://proline.biochem.iisc.ernet.in/sincre PMID:26130660

Identification of both NK1 and NK2 receptors in guinea-pig airways.

PubMed Central

McKee, K. T.; Millar, L.; Rodger, I. W.; Metters, K. M.

1993-01-01

1. NK1 and NK2 receptors have been characterized in guinea-pig lung membrane preparations by use of [125I-Tyr8]-substance P and [125I]-neurokinin A binding assays in conjunction with tachykinin-receptor selective agonists ([Sar9Met(O2)11]substance P for NK1 and [beta Ala8]neurokinin A (4-10) for NK2) and antagonists (CP-99,994 for NK1 and SR48968 for NK2). 2. The presence of high affinity, G-protein-coupled NK1 receptors in guinea-pig lung parenchymal membranes has been confirmed. The rank order of affinity for competing tachykinins was as predicted for an NK1 receptor: substance P = [Sar9Met(O2)11]substance P > substance P-methyl ester = physalaemin > neurokinin A = neurokinin B >> [beta Ala8]neurokinin A (4-10). The novel NK1 antagonist CP-99,994 has a Ki of 0.4 nM at this NK1 site. 3. In order to characterize [125I]-neurokinin A binding to guinea-pig lung, the number of [125I]-neurokinin A specific binding sites was increased 3-4 fold by purification of the parenchymal membranes over discontinuous sucrose gradients. The rank order of affinity determined for NK1- and NK2-receptor agonists and antagonists in competition for these sites showed that the majority (80%) of [125I]-neurokinin A specific binding was also to the NK1 receptor. 4. Under conditions where the guinea-pig lung parenchymal NK1 receptor was fully occupied by a saturating concentration of either [Sar9Met(O2)11]substance P (1 microM) or CP-99,994 (2.7 microM), residual [125I]-neurokinin A specific binding was inhibited in a concentration-dependent manner by both [beta Ala8]neurokinin A and SR48968. This result shows that the NK2 receptor is also present in these preparations.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7694756

Identification of a divalent metal cation binding site in herpes simplex virus 1 (HSV-1) ICP8 required for HSV replication.

PubMed

Bryant, Kevin F; Yan, Zhipeng; Dreyfus, David H; Knipe, David M

2012-06-01

Herpes simplex virus 1 (HSV-1) ICP8 is a single-stranded DNA-binding protein that is necessary for viral DNA replication and exhibits recombinase activity in vitro. Alignment of the HSV-1 ICP8 amino acid sequence with ICP8 homologs from other herpesviruses revealed conserved aspartic acid (D) and glutamic acid (E) residues. Amino acid residue D1087 was conserved in every ICP8 homolog analyzed, indicating that it is likely critical for ICP8 function. We took a genetic approach to investigate the functions of the conserved ICP8 D and E residues in HSV-1 replication. The E1086A D1087A mutant form of ICP8 failed to support the replication of an ICP8 mutant virus in a complementation assay. E1086A D1087A mutant ICP8 bound DNA, albeit with reduced affinity, demonstrating that the protein is not globally misfolded. This mutant form of ICP8 was also recognized by a conformation-specific antibody, further indicating that its overall structure was intact. A recombinant virus expressing E1086A D1087A mutant ICP8 was defective in viral replication, viral DNA synthesis, and late gene expression in Vero cells. A class of enzymes called DDE recombinases utilize conserved D and E residues to coordinate divalent metal cations in their active sites. We investigated whether the conserved D and E residues in ICP8 were also required for binding metal cations and found that the E1086A D1087A mutant form of ICP8 exhibited altered divalent metal binding in an in vitro iron-induced cleavage assay. These results identify a novel divalent metal cation-binding site in ICP8 that is required for ICP8 functions during viral replication.

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

Extensive investigation of the IGF2/H19 imprinting control region reveals novel OCT4/SOX2 binding site defects associated with specific methylation patterns in Beckwith-Wiedemann syndrome.

PubMed

Abi Habib, Walid; Azzi, Salah; Brioude, Frédéric; Steunou, Virginie; Thibaud, Nathalie; Das Neves, Cristina; Le Jule, Marilyne; Chantot-Bastaraud, Sandra; Keren, Boris; Lyonnet, Stanislas; Michot, Caroline; Rossi, Massimiliano; Pasquier, Laurent; Gicquel, Christine; Rossignol, Sylvie; Le Bouc, Yves; Netchine, Irène

2014-11-01

Isolated gain of methylation (GOM) at the IGF2/H19 imprinting control region 1 (ICR1) accounts for about 10% of patients with BWS. A subset of these patients have genetic defects within ICR1, but the frequency of these defects has not yet been established in a large cohort of BWS patients with isolated ICR1 GOM. Here, we carried out a genetic analysis in a large cohort of 57 BWS patients with isolated ICR1 GOM and analyzed the methylation status of the entire domain. We found a new point mutation in two unrelated families and a 21 bp deletion in another unrelated child, both of which were maternally inherited and affected the OCT4/SOX2 binding site in the A2 repeat of ICR1. Based on data from this and previous studies, we estimate that cis genetic defects account for about 20% of BWS patients with isolated ICR1 GOM. Methylation analysis at eight loci of the IGF2/H19 domain revealed that sites surrounding OCT4/SOX2 binding site mutations were fully methylated and methylation indexes declined as a function of distance from these sites. This was not the case in BWS patients without genetic defects identified. Thus, GOM does not spread uniformly across the IGF2/H19 domain, suggesting that OCT4/SOX2 protects against methylation at local sites. These findings add new insights to the mechanism of the regulation of the ICR1 domain. Our data show that mutations and deletions within ICR1 are relatively common. Systematic identification is therefore necessary to establish appropriate genetic counseling for BWS patients with isolated ICR1 GOM. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

NASA Astrophysics Data System (ADS)

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-01

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

PubMed

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-05

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Allosteric binding sites in Rab11 for potential drug candidates

PubMed Central

2018-01-01

Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, A.M.; Vandesande, F.; Orban, G.A.

1991-03-08

The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

Cell type-selective disease-association of genes under high regulatory load.

PubMed

Galhardo, Mafalda; Berninger, Philipp; Nguyen, Thanh-Phuong; Sauter, Thomas; Sinkkonen, Lasse

2015-10-15

We previously showed that disease-linked metabolic genes are often under combinatorial regulation. Using the genome-wide ChIP-Seq binding profiles for 93 transcription factors in nine different cell lines, we show that genes under high regulatory load are significantly enriched for disease-association across cell types. We find that transcription factor load correlates with the enhancer load of the genes and thereby allows the identification of genes under high regulatory load by epigenomic mapping of active enhancers. Identification of the high enhancer load genes across 139 samples from 96 different cell and tissue types reveals a consistent enrichment for disease-associated genes in a cell type-selective manner. The underlying genes are not limited to super-enhancer genes and show several types of disease-association evidence beyond genetic variation (such as biomarkers). Interestingly, the high regulatory load genes are involved in more KEGG pathways than expected by chance, exhibit increased betweenness centrality in the interaction network of liver disease genes, and carry longer 3' UTRs with more microRNA (miRNA) binding sites than genes on average, suggesting a role as hubs integrating signals within regulatory networks. In summary, epigenetic mapping of active enhancers presents a promising and unbiased approach for identification of novel disease genes in a cell type-selective manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Mutations in Elongation Factor Ef-1α Affect the Frequency of Frameshifting and Amino Acid Misincorporation in Saccharomyces Cerevisiae

PubMed Central

Sandbaken, M. G.; Culbertson, M. R.

1988-01-01

A mutational analysis of the eukaryotic elongation factor EF-1α indicates that this protein functions to limit the frequency of errors during genetic code translation. We found that both amino acid misincorporation and reading frame errors are controlled by EF-1α. In order to examine the function of this protein, the TEF2 gene, which encodes EF-1α in Saccharomyces cerevisiae, was mutagenized in vitro with hydroxylamine. Sixteen independent TEF2 alleles were isolated by their ability to suppress frameshift mutations. DNA sequence analysis identified eight different sites in the EF-1α protein that elevate the frequency of mistranslation when mutated. These sites are located in two different regions of the protein. Amino acid substitutions located in or near the GTP-binding and hydrolysis domain of the protein cause suppression of frameshift and nonsense mutations. These mutations may effect mistranslation by altering the binding or hydrolysis of GTP. Amino acid substitutions located adjacent to a putative aminoacyl-tRNA binding region also suppress frameshift and nonsense mutations. These mutations may alter the binding of aminoacyl-tRNA by EF-1α. The identification of frameshift and nonsense suppressor mutations in EF-1α indicates a role for this protein in limiting amino acid misincorporation and reading frame errors. We suggest that these types of errors are controlled by a common mechanism or closely related mechanisms. PMID:3066688

Alterations in Hemagglutinin Receptor-Binding Specificity Accompany the Emergence of Highly Pathogenic Avian Influenza Viruses

PubMed Central

Mochalova, Larisa; Harder, Timm; Tuzikov, Alexander; Bovin, Nicolai; Wolff, Thorsten; Matrosovich, Mikhail; Schweiger, Brunhilde

2015-01-01

ABSTRACT Highly pathogenic avian influenza viruses (HPAIVs) of hemagglutinin H5 and H7 subtypes emerge after introduction of low-pathogenic avian influenza viruses (LPAIVs) from wild birds into poultry flocks, followed by subsequent circulation and evolution. The acquisition of multiple basic amino acids at the endoproteolytical cleavage site of the hemagglutinin (HA) is a molecular indicator for high pathogenicity, at least for infections of gallinaceous poultry. Apart from the well-studied significance of the multibasic HA cleavage site, there is only limited knowledge on other alterations in the HA and neuraminidase (NA) molecules associated with changes in tropism during the emergence of HPAIVs from LPAIVs. We hypothesized that changes in tropism may require alterations of the sialyloligosaccharide specificities of HA and NA. To test this hypothesis, we compared a number of LPAIVs and HPAIVs for their HA-mediated binding and NA-mediated desialylation of a set of synthetic receptor analogs, namely, α2-3-sialylated oligosaccharides. NA substrate specificity correlated with structural groups of NAs and did not correlate with pathogenic potential of the virus. In contrast, all HPAIVs differed from LPAIVs by a higher HA receptor-binding affinity toward the trisaccharides Neu5Acα2-3Galβ1-4GlcNAcβ (3′SLN) and Neu5Acα2-3Galβ1-3GlcNAcβ (SiaLec) and by the ability to discriminate between the nonfucosylated and fucosylated sialyloligosaccharides 3′SLN and Neu5Acα2-3Galβ1-4(Fucα1-3)GlcNAcβ (SiaLex), respectively. These results suggest that alteration of the receptor-binding specificity accompanies emergence of the HPAIVs from their low-pathogenic precursors. IMPORTANCE Here, we have found for the first time correlations of receptor-binding properties of the HA with a highly pathogenic phenotype of poultry viruses. Our study suggests that enhanced receptor-binding affinity of HPAIVs for a typical “poultry-like” receptor, 3′SLN, is provided by substitutions in the receptor-binding site of HA which appeared in HA of LPAIVs in the course of transmission of LPAIVs from wild waterfowl into poultry flocks, with subsequent adaptation in poultry. The identification of LPAIVs with receptor characteristics of HPAIVs argues that the sialic acid-binding specificity of the HA may be used as a novel phenotypic marker of HPAIVs. PMID:25741006

Opposing effects of estradiol- and testosterone-membrane binding sites on T47D breast cancer cell apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kampa, Marilena; Nifli, Artemissia-Phoebe; Charalampopoulos, Ioannis

Classical steroid mode of action involves binding to intracellular receptors, the later acting as ligand-activated nuclear transcription factors. Recently, membrane sites for different steroids have been also identified, mediating rapid, non-genomic, steroid actions. Membrane sites for estrogen and androgen have been found in a number of different cell types, bearing or not classical intracellular receptors. In the present study, with the use of radioligand binding, flow cytometry and confocal laser microscopy, we report that T47D human breast cancer cells express specific and saturable membrane receptors for both estrogen (K {sub D} 4.06 {+-} 3.31 nM) and androgen (K {sub D}more » 7.64 {+-} 3.15 nM). Upon activation with BSA-conjugated, non-permeable ligands (E{sub 2}-BSA and testosterone-BSA), membrane estrogen receptors protect cells from serum-deprivation-induced apoptosis, while androgen receptors induce apoptosis in serum-supplemented T47D cells. In addition, co-incubation of cells with a fixed concentration of one steroid and varying concentrations of the other reversed the abovementioned effect (apoptosis for androgen, and anti-apoptosis for E{sub 2}), suggesting that the fate of the cell depends on the relative concentration of either steroid in the culture medium. We also report the identification of membrane receptors for E{sub 2} and androgen in biopsy slides from breast cancer patients. Both sites are expressed, with the staining for membrane E{sub 2} being strongly present in ER-negative, less differentiated, more aggressive tumors. These findings suggest that aromatase inhibitors may exert their beneficial effects on breast cancer by also propagating the metabolism of local steroids towards androgen, inducing thus cell apoptosis through membrane androgen receptor activation.« less

Identification of N-methyl-D-aspartic acid (NMDA) receptor subtype-specific binding sites that mediate direct interactions with scaffold protein PSD-95.

PubMed

Cousins, Sarah L; Stephenson, F Anne

2012-04-13

N-methyl-D-aspartate (NMDA) neurotransmitter receptors and the postsynaptic density-95 (PSD-95) membrane-associated guanylate kinase (MAGUK) family of scaffolding proteins are integral components of post-synaptic macromolecular signaling complexes that serve to propagate glutamate responses intracellularly. Classically, NMDA receptor NR2 subunits associate with PSD-95 MAGUKs via a conserved ES(E/D)V amino acid sequence located at their C termini. We previously challenged this dogma to demonstrate a second non-ES(E/D)V PSD-95-binding site in both NMDA receptor NR2A and NR2B subunits. Here, using a combination of co-immunoprecipitations from transfected mammalian cells, yeast two-hybrid interaction assays, and glutathione S-transferase (GST) pulldown assays, we show that NR2A subunits interact directly with PSD-95 via the C-terminal ESDV motif and additionally via an Src homology 3 domain-binding motif that associates with the Src homology 3 domain of PSD-95. Peptide inhibition of co-immunoprecipitations of NR2A and PSD-95 demonstrates that both the ESDV and non-ESDV sites are required for association in native brain tissue. Furthermore, we refine the non-ESDV site within NR2B to residues 1149-1157. These findings provide a molecular basis for the differential association of NMDA receptor subtypes with PSD-95 MAGUK scaffold proteins. These selective interactions may contribute to the organization, lateral mobility, and ultimately the function of NMDA receptor subtypes at synapses. Furthermore, they provide a more general molecular mechanism by which the scaffold, PSD-95, may discriminate between potential interacting partner proteins.

Identification of N-Methyl-d-aspartic Acid (NMDA) Receptor Subtype-specific Binding Sites That Mediate Direct Interactions with Scaffold Protein PSD-95*

PubMed Central

Cousins, Sarah L.; Stephenson, F. Anne

2012-01-01

N-methyl-d-aspartate (NMDA) neurotransmitter receptors and the postsynaptic density-95 (PSD-95) membrane-associated guanylate kinase (MAGUK) family of scaffolding proteins are integral components of post-synaptic macromolecular signaling complexes that serve to propagate glutamate responses intracellularly. Classically, NMDA receptor NR2 subunits associate with PSD-95 MAGUKs via a conserved ES(E/D)V amino acid sequence located at their C termini. We previously challenged this dogma to demonstrate a second non-ES(E/D)V PSD-95-binding site in both NMDA receptor NR2A and NR2B subunits. Here, using a combination of co-immunoprecipitations from transfected mammalian cells, yeast two-hybrid interaction assays, and glutathione S-transferase (GST) pulldown assays, we show that NR2A subunits interact directly with PSD-95 via the C-terminal ESDV motif and additionally via an Src homology 3 domain-binding motif that associates with the Src homology 3 domain of PSD-95. Peptide inhibition of co-immunoprecipitations of NR2A and PSD-95 demonstrates that both the ESDV and non-ESDV sites are required for association in native brain tissue. Furthermore, we refine the non-ESDV site within NR2B to residues 1149–1157. These findings provide a molecular basis for the differential association of NMDA receptor subtypes with PSD-95 MAGUK scaffold proteins. These selective interactions may contribute to the organization, lateral mobility, and ultimately the function of NMDA receptor subtypes at synapses. Furthermore, they provide a more general molecular mechanism by which the scaffold, PSD-95, may discriminate between potential interacting partner proteins. PMID:22375001

Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

PubMed Central

Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

1993-01-01

The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone

NASA Technical Reports Server (NTRS)

Umayahara, Y.; Ji, C.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

1997-01-01

Insulin-like growth factor-I (IGF-I) plays a key role in skeletal growth by stimulating bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other cAMP-activating agents enhanced IGF-I gene transcription in cultured primary rat osteoblasts through promoter 1, the major IGF-I promoter, and identified a short segment of the promoter, termed HS3D, that was essential for hormonal regulation of IGF-I gene expression. We now demonstrate that CCAAT/enhancer-binding protein (C/EBP) delta is a major component of a PGE2-stimulated DNA-protein complex involving HS3D and find that C/EBPdelta transactivates IGF-I promoter 1 through this site. Competition gel shift studies first indicated that a core C/EBP half-site (GCAAT) was required for binding of a labeled HS3D oligomer to osteoblast nuclear proteins. Southwestern blotting and UV-cross-linking studies showed that the HS3D probe recognized a approximately 35-kDa nuclear protein, and antibody supershift assays indicated that C/EBPdelta comprised most of the PGE2-activated gel-shifted complex. C/EBPdelta was detected by Western immunoblotting in osteoblast nuclear extracts after treatment of cells with PGE2. An HS3D oligonucleotide competed effectively with a high affinity C/EBP site from the rat albumin gene for binding to osteoblast nuclear proteins. Co-transfection of osteoblast cell cultures with a C/EBPdelta expression plasmid enhanced basal and PGE2-activated IGF-I promoter 1-luciferase activity but did not stimulate a reporter gene lacking an HS3D site. By contrast, an expression plasmid for the related protein, C/EBPbeta, did not alter basal IGF-I gene activity but did increase the response to PGE2. In osteoblasts and in COS-7 cells, C/EBPdelta, but not C/EBPbeta, transactivated a reporter gene containing four tandem copies of HS3D fused to a minimal promoter; neither transcription factor stimulated a gene with four copies of an HS3D mutant that was unable to bind osteoblast nuclear proteins. These results identify C/EBPdelta as a hormonally activated inducer of IGF-I gene transcription in osteoblasts and show that the HS3D element within IGF-I promoter 1 is a high affinity binding site for this protein.

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

Identification of regulatory targets for the bacterial Nus factor complex.

PubMed

Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

2017-12-11

Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

YY1 as a controlling factor for the Peg3 and Gnas imprinted domains

PubMed Central

Kim, Jeong Do; Hinz, Angela K.; Choo, Jung Ha; Stubbs, Lisa; Kim, Joomyeong

2007-01-01

Imprinting Control Regions (ICRs) often harbor tandem arrays of transcription factor binding sites, as demonstrated by the identification of multiple YY1 binding sites within the ICRs of Peg3, Nespas, and Xist/Tsix domains. In the current study, we have sought to characterize possible roles of YY1 in transcriptional control and epigenetic modification of these imprinted domains. RNA interference-based knockdown experiments in Neuro2A cells resulted in overall transcriptional up-regulation of most of the imprinted genes within the Peg3 domain and also, concomitantly, caused significant loss in the DNA methylation of Peg3-DMR (Differentially Methylated Regions). A similar overall and coordinated expression change was also observed for the imprinted genes of the Gnas domain: up-regulation of Nespas and down-regulation of Nesp and Gnasxl. YY1 knockdown also resulted in changes in the expression levels of Xist and Snrpn. These results support the idea that YY1 plays a major role, as a trans factor, for the control of these imprinted domains. PMID:17067777

Regulatory Features for Odorant Receptor Genes in the Mouse Genome.

PubMed

Degl'Innocenti, Andrea; D'Errico, Anna

2017-01-01

The odorant receptor genes, seven transmembrane receptor genes constituting the vastest mammalian gene multifamily, are expressed monogenically and monoallelicaly in each sensory neuron in the olfactory epithelium. This characteristic, often referred to as the one neuron-one receptor rule, is driven by mostly uncharacterized molecular dynamics, generally named odorant receptor gene choice . Much attention has been paid by the scientific community to the identification of sequences regulating the expression of odorant receptor genes within their loci , where related genes are usually arranged in genomic clusters. A number of studies identified transcription factor binding sites on odorant receptor promoter sequences. Similar binding sites were also found on a number of enhancers that regulate in cis their transcription, but have been proposed to form interchromosomal networks. Odorant receptor gene choice seems to occur via the local removal of strongly repressive epigenetic markings, put in place during the maturation of the sensory neuron on each odorant receptor locus . Here we review the fast-changing state of art for the study of regulatory features for odorant receptor genes.

Identification and molecular characterization of a new ovarian cancer susceptibility locus at 17q21.31

PubMed Central

Permuth-Wey, Jennifer; Lawrenson, Kate; Shen, Howard C.; Velkova, Aneliya; Tyrer, Jonathan P.; Chen, Zhihua; Lin, Hui-Yi; Chen, Y. Ann; Tsai, Ya-Yu; Qu, Xiaotao; Ramus, Susan J.; Karevan, Rod; Lee, Janet; Lee, Nathan; Larson, Melissa C.; Aben, Katja K.; Anton-Culver, Hoda; Antonenkova, Natalia; Antoniou, Antonis; Armasu, Sebastian M.; Bacot, François; Baglietto, Laura; Bandera, Elisa V.; Barnholtz-Sloan, Jill; Beckmann, Matthias W.; Birrer, Michael J.; Bloom, Greg; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Brown, Robert; Butzow, Ralf; Cai, Qiuyin; Campbell, Ian; Chang-Claude, Jenny; Chanock, Stephen; Chenevix-Trench, Georgia; Cheng, Jin Q.; Cicek, Mine S.; Coetzee, Gerhard A.; Cook, Linda S.; Couch, Fergus J.; Cramer, Daniel W.; Cunningham, Julie M.; Dansonka-Mieszkowska, Agnieszka; Despierre, Evelyn; Doherty, Jennifer A; Dörk, Thilo; du Bois, Andreas; Dürst, Matthias; Easton, Douglas F; Eccles, Diana; Edwards, Robert; Ekici, Arif B.; Fasching, Peter A.; Fenstermacher, David A.; Flanagan, James M.; Garcia-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind M.; Gonzalez-Bosquet, Jesus; Goodman, Marc T.; Gore, Martin; Górski, Bohdan; Gronwald, Jacek; Hall, Per; Halle, Mari K.; Harter, Philipp; Heitz, Florian; Hillemanns, Peter; Hoatlin, Maureen; Høgdall, Claus K.; Høgdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Jim, Heather; Kalli, Kimberly R.; Karlan, Beth Y.; Kaye, Stanley B.; Kelemen, Linda E.; Kiemeney, Lambertus A.; Kikkawa, Fumitaka; Konecny, Gottfried E.; Krakstad, Camilla; Kjaer, Susanne Krüger; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Lancaster, Johnathan M.; Le, Nhu D.; Leminen, Arto; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lin, Jie; Lissowska, Jolanta; Lu, Karen H.; Lubiński, Jan; Lurie, Galina; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; Menon, Usha; Modugno, Francesmary; Moysich, Kirsten B.; Nakanishi, Toru; Narod, Steven A.; Nedergaard, Lotte; Ness, Roberta B.; Nevanlinna, Heli; Nickels, Stefan; Noushmehr, Houtan; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Raska, Paola; Renner, Stefan P.; Risch, Harvey A.; Rodriguez-Rodriguez, Lorna; Rossing, Mary Anne; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schwaab, Ira; Severi, Gianluca; Shridhar, Vijayalakshmi; Shu, Xiao-Ou; Shvetsov, Yurii B.; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Stram, Daniel; Sutphen, Rebecca; Teo, Soo-Hwang; Terry, Kathryn L.; Tessier, Daniel C.; Thompson, Pamela J.; Tworoger, Shelley S.; van Altena, Anne M.; Vergote, Ignace; Vierkant, Robert A.; Vincent, Daniel; Vitonis, Allison F.; Wang-Gohrke, Shan; Weber, Rachel Palmieri; Wentzensen, Nicolas; Whittemore, Alice S.; Wik, Elisabeth; Wilkens, Lynne R.; Winterhoff, Boris; Woo, Yin Ling; Wu, Anna H.; Xiang, Yong-Bing; Yang, Hannah P.; Zheng, Wei; Ziogas, Argyrios; Zulkifli, Famida; Phelan, Catherine M.; Iversen, Edwin; Schildkraut, Joellen M.; Berchuck, Andrew; Fridley, Brooke L.; Goode, Ellen L.; Pharoah, Paul D. P.; Monteiro, Alvaro N.A.; Sellers, Thomas A.; Gayther, Simon A.

2013-01-01

Epithelial ovarian cancer (EOC) has a heritable component that remains to be fully characterized. Most identified common susceptibility variants lie in non-protein-coding sequences. We hypothesized that variants in the 3′ untranslated region at putative microRNA (miRNA) binding sites represent functional targets that influence EOC susceptibility. Here, we evaluate the association between 767 miRNA binding site single nucleotide polymorphisms (miRSNPs) and EOC risk in 18,174 EOC cases and 26,134 controls from 43 studies genotyped through the Collaborative Oncological Gene-environment Study. We identify several miRSNPs associated with invasive serous EOC risk (OR=1.12, P=10−8) mapping to an inversion polymorphism at 17q21.31. Additional genotyping of non-miRSNPs at 17q21.31 reveals stronger signals outside the inversion (P=10−10). Variation at 17q21.31 associates with neurological diseases, and our collaboration is the first to report an association with EOC susceptibility. An integrated molecular analysis in this region provides evidence for ARHGAP27 and PLEKHM1 as candidate EOC susceptibility genes. PMID:23535648

Design, synthesis and evaluation of photoactivatable derivatives of microtubule (MT)-active [1,2,4]triazolo[1,5-a]pyrimidines.

PubMed

Oukoloff, Killian; Kovalevich, Jane; Cornec, Anne-Sophie; Yao, Yuemang; Owyang, Zachary A; James, Michael; Trojanowski, John Q; Lee, Virginia M-Y; Smith, Amos B; Brunden, Kurt R; Ballatore, Carlo

2018-05-05

The [1,2,4]triazolo[1,5-a]pyrimidines comprise a promising class of non-naturally occurring microtubule (MT)-active compounds. Prior studies revealed that different triazolopyrimidine substitutions can yield molecules that either promote MT stabilization or disrupt MT integrity. These differences can have important ramifications in the therapeutic applications of triazolopyrimidines and suggest that different analogues may exhibit different binding modes within the same site or possibly interact with tubulin/MTs at alternative binding sites. To help discern these possibilities, a series of photoactivatable triazolopyrimidine congeners was designed, synthesized and evaluated in cellular assays with the goal of identifying candidate probes for photoaffinity labeling experiments. These studies led to the identification of different derivatives that incorporate a diazirine ring in the amine substituent at position 7 of the triazolopyrimidine heterocycle, resulting in molecules that either promote stabilization of MTs or disrupt MT integrity. These photoactivatable candidate probes hold promise to investigate the mode of action of MT-active triazolopyrimidines. Copyright © 2018 Elsevier Ltd. All rights reserved.

Revised annotation of Plutella xylostella microRNAs and their genome-wide target identification.

PubMed

Etebari, K; Asgari, S

2016-12-01

The diamondback moth, Plutella xylostella, is the most devastating pest of brassica crops worldwide. Although 128 mature microRNAs (miRNAs) have been annotated from this species in miRBase, there is a need to extend and correct the current P. xylostella miRNA repertoire as a result of its recently improved genome assembly and more available small RNA sequence data. We used our new ultra-deep sequence data and bioinformatics to re-annotate the P. xylostella genome for high confidence miRNAs with the correct 5p and 3p arm features. Furthermore, all the P. xylostella annotated genes were also screened to identify potential miRNA binding sites using three target-predicting algorithms. In total, 203 mature miRNAs were annotated, including 33 novel miRNAs. We identified 7691 highly confident binding sites for 160 pxy-miRNAs. The data provided here will facilitate future studies involving functional analyses of P. xylostella miRNAs as a platform to introduce novel approaches for sustainable management of this destructive pest. © 2016 The Royal Entomological Society.

Molecular basis of Williams-Beuren syndrome: TFII-I regulated targets involved in craniofacial development.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2011-01-01

The aim of this study is to identify gene targets of TFII-I transcription factors involved in craniofacial development. Recent findings in individuals with Williams-Beuren syndrome who show facial dysmorphism and cognitive defects have pointed to TFII-I genes (GTF2I and GTF2IRD1) as the prime candidates responsible for these clinical features. However, TFII-I proteins are multifunctional transcriptional factors regulating a number of genes during development, and how their haploinsufficiency leads to the Williams-Beuren syndrome phenotype is currently unknown. Here we report the identification of three genes with a well-established relevance to craniofacial development as direct TFII-I targets. These genes, craniofacial development protein 1 (Cfdp1), Sec23 homolog A (Sec23a), and nuclear receptor binding SET domain protein 1 (Nsd1), contain consensus TFII-I binding sites in their proximal promoters; the chromatin immunoprecipitation analysis showed that TFII-I transcription factors are recruited to these sites in vivo. The results suggest that transcriptional regulation of these genes by TFII-I proteins could provide a possible genotype-phenotype link in Williams-Beuren syndrome.

Characterization and Structural Studies of the Plasmodium falciparum Ubiquitin and Nedd8 Hydrolase UCHL3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Artavanis-Tsakonas, Katerina; Weihofen, Wilhelm A.; Antos, John M.

Like their human hosts, Plasmodium falciparum parasites rely on the ubiquitin-proteasome system for survival. We previously identified PfUCHL3, a deubiquitinating enzyme, and here we characterize its activity and changes in active site architecture upon binding to ubiquitin. We find strong evidence that PfUCHL3 is essential to parasite survival. The crystal structures of both PfUCHL3 alone and in complex with the ubiquitin-based suicide substrate UbVME suggest a rather rigid active site crossover loop that likely plays a role in restricting the size of ubiquitin adduct substrates. Molecular dynamics simulations of the structures and a model of the PfUCHL3-PfNedd8 complex allowed themore » identification of shared key interactions of ubiquitin and PfNedd8 with PfUCHL3, explaining the dual specificity of this enzyme. Distinct differences observed in ubiquitin binding between PfUCHL3 and its human counterpart make it likely that the parasitic DUB can be selectively targeted while leaving the human enzyme unaffected.« less

In Silico Identification of Potent Pancreatic Triacylglycerol Lipase Inhibitors from Traditional Chinese Medicine

PubMed Central

Chen, Kuan-Yu; Chang, Su-Sen; Chen, Calvin Yu-Chian

2012-01-01

Pancreatic triacylglycerol lipase (PNLIP) are primary lipases that are critical for triacylglyceride digestion in human. Since reduced metabolism of triacylglyceride might be a plausible concept for weight loss, we screened for potential PNLIP inhibitors from traditional Chinese medicine (TCM) with the aim to identify weight loss candidate compounds. TCM candidates Aurantiamide, Cnidiadin, and 2-hexadecenoic acid exhibited higher Dock Scores than the commercial drug Orlistat, and were also predicted to have inhibitory characteristics against PNLIP using constructed MLR (R2 = 0.8664) and SVM (R2 = 0.9030) models. Molecular dynamics indicated that the TCM-PNLIP complexes formed were stable. We identified that the PNLIP binding site has several residues that can serve as anchors, and a hydrophobic corridor that provides additional stability to the complex. Aurantiamide, Cnidiadin, and 2-hexadecenoic acid all have features that correspond to these binding site features, indicating their potential as candidates for PNLIP inhibitors. The information presented in this study may provide helpful insights to designing novel weight-control drugs. PMID:22970152

Oxime amides as a novel zinc binding group in histone deacetylase inhibitors: synthesis, biological activity, and computational evaluation.

PubMed

Botta, Cinzia B; Cabri, Walter; Cini, Elena; De Cesare, Lucia; Fattorusso, Caterina; Giannini, Giuseppe; Persico, Marco; Petrella, Antonello; Rondinelli, Francesca; Rodriquez, Manuela; Russo, Adele; Taddei, Maurizio

2011-04-14

Several oxime containing molecules, characterized by a SAHA-like structure, were explored to select a potentially new biasing binding element for the zinc in HDAC catalytic site. All compounds were evaluated for their in vitro inhibitory activity against the 11 human HDACs isoforms. After identification of a "hit" molecule, a programmed variation at the cap group and at the linker was carried out in order to increase HDAC inhibition and/or paralogue selectivity. Some of the new derivatives showed increased activity against a number of HDAC isoforms, even if their overall activity range is still far from the inhibition values reported for SAHA. Moreover, different from what was reported for their hydroxamic acid analogues the new α-oxime amide derivatives do not select between class I and class II HDACs; rather they target specific isoforms in each class. These somehow contradictory results were finally rationalized by a computational assisted SAR, which gave us the chance to understand how the oxime derivatives interact with the catalytic site and justify the observed activity profile.

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.