Sample records for binding site resulted

  1. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  2. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  3. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  4. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  5. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  6. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  7. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  8. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  9. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  10. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  11. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  12. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  13. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  14. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  15. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  16. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  17. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  18. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  19. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  20. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  1. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  2. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  3. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  4. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  5. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  6. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  7. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  8. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  9. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  10. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  11. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  13. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  14. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  15. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  16. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  17. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  18. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  19. Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

    NASA Astrophysics Data System (ADS)

    Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

    1992-09-01

    Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

  20. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  2. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  3. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  4. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

    2010-01-01

    The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

  6. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  7. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  8. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  9. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  10. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  11. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  12. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  13. Core Binding Site of a Thioflavin-T-Derived Imaging Probe on Amyloid β Fibrils Predicted by Computational Methods.

    PubMed

    Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi

    2018-05-16

    Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.

  14. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  16. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  17. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  18. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  19. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  20. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  1. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  2. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  3. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

    2015-01-01

    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  4. Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Aalberts, Daniel P.; Garland, Jeffrey A.

    2004-03-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  5. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    2016-10-01

    The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  6. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  7. Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

    PubMed

    Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

    2009-01-01

    Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

  8. Negatively Cooperative Binding of High Density Lipoprotein to the HDL Receptor SR-BI†

    PubMed Central

    Nieland, Thomas J.F.; Xu, Shangzhe; Penman, Marsha; Krieger, Monty

    2011-01-01

    Scavenger receptor class B, type I (SR-BI) is a high-density lipoprotein (HDL) receptor, which also binds low density lipoprotein (LDL), and mediates the cellular selective uptake of cholesteryl esters from lipoproteins. SR-BI also is a co-receptor for hepatitis C virus and a signaling receptor that regulates cell metabolism. Many investigators have reported that lipoproteins bind to SR-BI via a single class of independent (not interacting), high affinity binding sites (one site model). We have re-investigated the ligand concentration dependence of 125I-HDL binding to SR-BI and SR-BI-mediated specific uptake of [3H]CE from [3H]CE-HDL using an expanded range of ligand concentrations (<1 µg protein/ml, lower than previously reported). Scatchard and non-linear least squares model fitting analyses of the binding and uptake data were both inconsistent with a single class of independent binding sites binding univalent lipoprotein ligands. The data are best fit by models in which SR-BI has either two independent classes of binding sites, or one class of sites exhibiting negative cooperativity due to either classic allostery or ensemble effects (‘ lattice model’). Similar results were observed for LDL. Application of the ‘infinite dilution’ dissociation rate method established that the binding of 125I-HDL to SR-BI at 4 °C exhibits negative cooperativity. The unexpected complexity of the interactions of lipoproteins with SR-BI should be taken into account when interpreting the results of experiments that explore the mechanism(s) by which SR-BI mediates ligand binding, lipid transport and cell signaling. PMID:21254782

  9. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  10. In silico investigation into the interactions between murine 5-HT3 receptor and the principle active compounds of ginger (Zingiber officinale).

    PubMed

    Lohning, Anna E; Marx, Wolfgang; Isenring, Liz

    2016-11-01

    Gingerols and shogaols are the primary non-volatile actives within ginger (Zingiber officinale). These compounds have demonstrated in vitro to exert 5-HT 3 receptor antagonism which could benefit chemotherapy-induced nausea and vomiting (CINV). The site and mechanism of action by which these compounds interact with the 5-HT 3 receptor is not fully understood although research indicates they may bind to a currently unidentified allosteric binding site. Using in silico techniques, such as molecular docking and GRID analysis, we have characterized the recently available murine 5-HT 3 receptor by identifying sites of strong interaction with particular functional groups at both the orthogonal (serotonin) site and a proposed allosteric binding site situated at the interface between the transmembrane region and the extracellular domain. These were assessed concurrently with the top-scoring poses of the docked ligands and included key active gingerols, shogaols and dehydroshogaols as well as competitive antagonists (e.g. setron class of pharmacologically active drugs), serotonin and its structural analogues, curcumin and capsaicin, non-competitive antagonists and decoys. Unexpectedly, we found that the ginger compounds and their structural analogs generally outscored other ligands at both sites. Our results correlated well with previous site-directed mutagenesis studies in identifying key binding site residues. We have identified new residues important for binding the ginger compounds. Overall, the results suggest that the ginger compounds and their structural analogues possess a high binding affinity to both sites. Notwithstanding the limitations of such theoretical analyses, these results suggest that the ginger compounds could act both competitively or non-competitively as has been shown for palonosetron and other modulators of CYS loop receptors. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  12. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  14. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  15. Thermodynamic and structural insights into CSL-DNA complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Friedmann, David R.; Kovall, Rhett A.

    The Notch pathway is an intercellular signaling mechanism that plays important roles in cell fates decisions throughout the developing and adult organism. Extracellular complexation of Notch receptors with ligands ultimately results in changes in gene expression, which is regulated by the nuclear effector of the pathway, CSL (C-promoter binding factor 1 (CBF-1), suppressor of hairless (Su(H)), lin-12 and glp-1 (Lag-1)). CSL is a DNA binding protein that is involved in both repression and activation of transcription from genes that are responsive to Notch signaling. One well-characterized Notch target gene is hairy and enhancer of split-1 (HES-1), which is regulated bymore » a promoter element consisting of two CSL binding sites oriented in a head-to-head arrangement. Although previous studies have identified in vivo and consensus binding sites for CSL, and crystal structures of these complexes have been determined, to date, a quantitative description of the energetics that underlie CSL-DNA binding is unknown. Here, we provide a thermodynamic and structural analysis of the interaction between CSL and the two individual sites that comprise the HES-1 promoter element. Our comprehensive studies that analyze binding as a function of temperature, salt, and pH reveal moderate, but distinct, differences in the affinities of CSL for the two HES-1 binding sites. Similarly, our structural results indicate that overall CSL binds both DNA sites in a similar manner; however, minor changes are observed in both the conformation of CSL and DNA. Taken together, our results provide a quantitative and biophysical basis for understanding how CSL interacts with DNA sites in vivo.« less

  16. Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

    PubMed Central

    Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

    2014-01-01

    Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

  17. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  18. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  19. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  20. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  1. Ion Binding Energies Determining Functional Transport of ClC Proteins

    NASA Astrophysics Data System (ADS)

    Yu, Tao; Guo, Xu; Zou, Xian-Wu; Sang, Jian-Ping

    2014-06-01

    The ClC-type proteins, a large family of chloride transport proteins ubiquitously expressed in biological organisms, have been extensively studied for decades. Biological function of ClC proteins can be reflected by analyzing the binding situation of Cl- ions. We investigate ion binding properties of ClC-ec1 protein with the atomic molecular dynamics simulation approach. The calculated electrostatic binding energy results indicate that Cl- at the central binding site Scen has more binding stability than the internal binding site Sint. Quantitative comparison between the latest experimental heat release data isothermal titration calorimetry (ITC) and our calculated results demonstrates that chloride ions prefer to bind at Scen than Sint in the wild-type ClC-ec1 structure and prefer to bind at Sext and Scen than Sint in mutant E148A/E148Q structures. Even though the chloride ions make less contribution to heat release when binding to Sint and are relatively unstable in the Cl- pathway, they are still part contributors for the Cl- functional transport. This work provides a guide rule to estimate the importance of Cl- at the binding sites and how chloride ions have influences on the function of ClC proteins.

  2. The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.

    PubMed

    Wang, Jinling; de Montellano, Paul R Ortiz

    2003-05-30

    Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.

  3. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  4. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  5. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  6. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  7. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  8. Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

    PubMed

    Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

    2009-04-01

    Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

  9. Activation of phenylalanine hydroxylase by phenylalanine does not require binding in the active site.

    PubMed

    Roberts, Kenneth M; Khan, Crystal A; Hinck, Cynthia S; Fitzpatrick, Paul F

    2014-12-16

    Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein's regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The k(cat)/K(phe) value is down 10⁴ for the mutant enzyme, and the K(m) value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain.

  10. Activation of Phenylalanine Hydroxylase by Phenylalanine Does Not Require Binding in the Active Site

    PubMed Central

    2015-01-01

    Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein’s regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The kcat/Kphe value is down 104 for the mutant enzyme, and the Km value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain. PMID:25453233

  11. Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

    PubMed Central

    Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

    2011-01-01

    Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

  12. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  13. Functional characterization of transcription factor binding sites for HNF1-alpha, HNF3-beta (FOXA2), HNF4-alpha, Sp1 and Sp3 in the human prothrombin gene enhancer.

    PubMed

    Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L

    2003-08-01

    Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.

  14. Engineering Nucleotide Specificity of Succinyl-CoA Synthetase in Blastocystis: The Emerging Role of Gatekeeper Residues.

    PubMed

    Vashisht, Kapil; Verma, Sonia; Gupta, Sunita; Lynn, Andrew M; Dixit, Rajnikant; Mishra, Neelima; Valecha, Neena; Hamblin, Karleigh A; Maytum, Robin; Pandey, Kailash C; van der Giezen, Mark

    2017-01-24

    Charged, solvent-exposed residues at the entrance to the substrate binding site (gatekeeper residues) produce electrostatic dipole interactions with approaching substrates, and control their access by a novel mechanism called "electrostatic gatekeeper effect". This proof-of-concept study demonstrates that the nucleotide specificity can be engineered by altering the electrostatic properties of the gatekeeper residues outside the binding site. Using Blastocystis succinyl-CoA synthetase (SCS, EC 6.2.1.5), we demonstrated that the gatekeeper mutant (ED) resulted in ATP-specific SCS to show high GTP specificity. Moreover, nucleotide binding site mutant (LF) had no effect on GTP specificity and remained ATP-specific. However, via combination of the gatekeeper mutant with the nucleotide binding site mutant (ED+LF), a complete reversal of nucleotide specificity was obtained with GTP, but no detectable activity was obtained with ATP. This striking result of the combined mutant (ED+LF) was due to two changes; negatively charged gatekeeper residues (ED) favored GTP access, and nucleotide binding site residues (LF) altered ATP binding, which was consistent with the hypothesis of the "electrostatic gatekeeper effect". These results were further supported by molecular modeling and simulation studies. Hence, it is imperative to extend the strategy of the gatekeeper effect in a different range of crucial enzymes (synthetases, kinases, and transferases) to engineer substrate specificity for various industrial applications and substrate-based drug design.

  15. Mycobacterium tuberculosis cAMP Receptor Protein (Rv3676) Differs from the Escherichia coli Paradigm in Its cAMP Binding and DNA Binding Properties and Transcription Activation Properties*

    PubMed Central

    Stapleton, Melanie; Haq, Ihtshamul; Hunt, Debbie M.; Arnvig, Kristine B.; Artymiuk, Peter J.; Buxton, Roger S.; Green, Jeffrey

    2010-01-01

    The pathogen Mycobacterium tuberculosis produces a burst of cAMP upon infection of macrophages. Bacterial cyclic AMP receptor proteins (CRP) are transcription factors that respond to cAMP by binding at target promoters when cAMP concentrations increase. Rv3676 (CRPMt) is a CRP family protein that regulates expression of genes (rpfA and whiB1) that are potentially involved in M. tuberculosis persistence and/or emergence from the dormant state. Here, the CRPMt homodimer is shown to bind two molecules of cAMP (one per protomer) at noninteracting sites. Furthermore, cAMP binding by CRPMt was relatively weak, entropy driven, and resulted in a relatively small enhancement in DNA binding. Tandem CRPMt-binding sites (CRP1 at −58.5 and CRP2 at −37.5) were identified at the whiB1 promoter (PwhiB1). In vitro transcription reactions showed that CRP1 is an activating site and that CRP2, which was only occupied in the presence of cAMP or at high CRPMt concentrations in the absence of cAMP, is a repressing site. Binding of CRPMt to CRP1 was not essential for open complex formation but was required for transcription activation. Thus, these data suggest that binding of CRPMt to the PwhiB1 CRP1 site activates transcription at a step after open complex formation. In contrast, high cAMP concentrations allowed occupation of both CRP1 and CRP2 sites, resulting in inhibition of open complex formation. Thus, M. tuberculosis CRP has evolved several distinct characteristics, compared with the Escherichia coli CRP paradigm, to allow it to regulate gene expression against a background of high concentrations of cAMP. PMID:20028978

  16. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  17. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  18. Investigation of copper(II) binding to the protein precursor of Non-Amyloid-Beta Component of Alzheimer Disease Amyloid Plaque

    NASA Astrophysics Data System (ADS)

    Rose, Francis; Hodak, Miroslav; Bernholc, Jerry

    2007-03-01

    The Non-Amyloid-Beta Component Precursor (NACP) is a natively unfolded synaptic protein that is implicated in Alzheimers and Parkinsons diseases. Its aggregation into fibrillar structures is accelerated by the binding of copper(II). Experimental studies suggest that the dominant copper binding site is located at the histidine residue in NACP. Based on this evidence we assembled a model fragment of the binding site and used DFT to analyze the conformational details of the most probable binding motifs. We investigated the overall conformational effects with classical MD by constraining the copper binding site to the most energetically favorable geometry obtained from the DFT calculations. These results are compared and contrasted with those of the unbound NACP.

  19. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  20. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  1. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  2. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  3. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  4. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  5. Influence of myristic acid on furosemide binding to bovine serum albumin. Comparison with furosemide-human serum albumin complex

    NASA Astrophysics Data System (ADS)

    Bojko, B.; Sułkowska, A.; Maciążek-Jurczyk, M.; Równicka, J.; Sułkowski, W. W.

    2010-06-01

    Fluorescence studies on furosemide (FUR) binding to bovine serum albumin (BSA) showed the existence of three or four binding sites in the tertiary structure of the protein. Two of them are located in subdomain IIA, while the others in subdomains IB and/or IIIA. Furosemide binding in subdomain IB is postulated on the basis of run of Stern-Volmer plot indicating the existence of two populations of tryptophans involved in the interaction with FUR. In turn, the significant participation of tyrosil residues in complex formation leads to the consideration of the subdomain IIIA as furosemide low-affinity binding site. The effect of increasing concentration of fatty acid on FUR binding in all studied binding sites was also investigated and compared with the previous results obtained for human serum albumin (HSA). For BSA the lesser impact of fatty acid on affinity between drug and albumin was observed. This is probably a result of more significant role of tyrosines in the complex formation and different polarity of microenvironment of the fluorophores when compared HSA and BSA. The most distinct differences between FUR-BSA and FUR-HSA binding parameters are observed when third fatty acid molecule is bound with the protein and rotation of domains I and II occurs. However these structural changes mostly affect FUR low affinity binding sites.

  6. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  7. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  8. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  9. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  10. Self-Assembly of Coordinative Supramolecular Polygons with Open Binding Sites

    PubMed Central

    Zheng, Yao-Rong; Wang, Ming; Kobayashi, Shiho; Stang, Peter J.

    2011-01-01

    The design and synthesis of coordinative supramolecular polygons with open binding sites is described. Coordination-driven self-assembly of 2,6-bis(pyridin-4-ylethynyl)pyridine with 60° and 120° organoplatinum acceptors results in quantitative formation of a supramolecular rhomboid and hexagon, respectively, both bearing open pyridyl binding sites. The structures were determined by multinuclear (31P and 1H) NMR spectroscopy and electrospray ionization (ESI) mass spectrometry, along with a computational study. PMID:21516167

  11. Self-Assembly of Coordinative Supramolecular Polygons with Open Binding Sites.

    PubMed

    Zheng, Yao-Rong; Wang, Ming; Kobayashi, Shiho; Stang, Peter J

    2011-04-27

    The design and synthesis of coordinative supramolecular polygons with open binding sites is described. Coordination-driven self-assembly of 2,6-bis(pyridin-4-ylethynyl)pyridine with 60° and 120° organoplatinum acceptors results in quantitative formation of a supramolecular rhomboid and hexagon, respectively, both bearing open pyridyl binding sites. The structures were determined by multinuclear ((31)P and (1)H) NMR spectroscopy and electrospray ionization (ESI) mass spectrometry, along with a computational study.

  12. Experimental determination and modeling of arsenic complexation with humic and fulvic acids.

    PubMed

    Fakour, Hoda; Lin, Tsair-Fuh

    2014-08-30

    The complexation of humic acid (HA) and fulvic acid (FA) with arsenic (As) in water was studied. Experimental results indicate that arsenic may form complexes with HA and FA with a higher affinity for arsenate than for arsenite. With the presence of iron oxide based adsorbents, binding of arsenic to HA/FA in water was significantly suppressed, probably due to adsorption of As and HA/FA. A two-site ligand binding model, considering only strong and weak site types of binding affinity, was successfully developed to describe the complexation of arsenic on the two natural organic fractions. The model showed that the numbers of weak sites were more than 10 times those of strong sites on both HA and FA for both arsenic species studied. The numbers of both types of binding sites were found to be proportional to the HA concentrations, while the apparent stability constants, defined for describing binding affinity between arsenic and the sites, are independent of the HA concentrations. To the best of our knowledge, this is the first study to characterize the impact of HA concentrations on the applicability of the ligand binding model, and to extrapolate the model to FA. The obtained results may give insights on the complexation of arsenic in HA/FA laden groundwater and on the selection of more effective adsorption-based treatment methods for natural waters. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Characterization of angiotensin-binding sites in the bovine adrenal and the rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rogulja, I.

    1989-01-01

    The first study was designed to determine whether systemically administered MSG affects neurons in the CVOs that are potentially important in mediating angiotensin-dependent responses. Rats were pretreated with MSG and the receptors for angiotensin II were assayed by radioligand binding in brain homogenates from the septum anteroventral third ventricular region (AV3V) and the thalamus/hypothalamus region using {sup 125}I-angiotensin II as the radioligand. The results of this experiment indicate that systematically administered MSG in the rat significantly reduced the number (Bmax) of Ang II receptors in a tissue sample which contained both extra blood-brain barrier organs as well as tissue withinmore » the blood-brain barrier with no change in the affinity (Kd) of the binding sites. The second chapter reports the successful solubilization of bovine adrenal {sup 125}I Ang II and {sup 125}I Sar{sup 1},Ile{sup 8}-Ang II binding sites with the detergent CHAPS. The results of our studies indicate the presence of two angiotensin binding sites. The one site is specific for naturally occurring angiotensins as well as sarcosine-1 substituted angiotensin analogues. The other site which can be optimally stabilized be re-addition of 0.3% CHAPS into the incubation assay binds sarcosine-1 substituted angiotensins exclusively. Hydrophobic interaction chromatography experiments suggest that these sites, possibly, represent distinct proteins. The third chapter discusses the successful solubilization and partial characterization of the rat brain angiotensin receptor.« less

  14. Characterization of Conserved Tandem Donor Sites and Intronic Motifs Required for Alternative Splicing in Corticosteroid Receptor Genes

    PubMed Central

    Qian, Xiaoxiao; Matthews, Laura; Lightman, Stafford; Ray, David; Norman, Michael

    2015-01-01

    Alternative splicing events from tandem donor sites result in mRNA variants coding for additional amino acids in the DNA binding domain of both the glucocorticoid (GR) and mineralocorticoid (MR) receptors. We now show that expression of both splice variants is extensively conserved in mammalian species, providing strong evidence for their functional significance. An exception to the conservation of the MR tandem splice site (an A at position +5 of the MR+12 donor site in the mouse) was predicted to decrease U1 small nuclear RNA binding. In accord with this prediction, we were unable to detect the MR+12 variant in this species. The one exception to the conservation of the GR tandem splice site, an A at position +3 of the platypus GRγ donor site that was predicted to enhance binding of U1 snRNA, was unexpectedly associated with decreased expression of the variant from the endogenous gene as well as a minigene. An intronic pyrimidine motif present in both GR and MR genes was found to be critical for usage of the downstream donor site, and overexpression of TIA1/TIAL1 RNA binding proteins, which are known to bind such motifs, led to a marked increase in the proportion of GRγ and MR+12. These results provide striking evidence for conservation of a complex splicing mechanism that involves processes other than stochastic spliceosome binding and identify a mechanism that would allow regulation of variant expression. PMID:19819975

  15. Glucostatic regulation of (+)-(/sup 3/H)amphetamine binding in the hypothalamus: correlation with Na/sup +/, K/sup +/-ATPase activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Angel, I.; Hauger, R.L.; Luu, M.D.

    1985-09-01

    Preincubation of rat hypothalamic slices in glucose-free Krebs-Ringer buffer (37/sup 0/C) resulted in a time-dependent decrease in specific (+)-(/sup 3/H)amphetamine binding in the crude synaptosomal fraction prepared from these slices. The addition of D-glucose resulted in a dose- and time-dependent stimulation of (+)-(/sup 3/H)amphetamine binding, whereas incubations with L-glucose, 2-deoxy-D-glucose, or 3-O-methyl-D-glucose failed to increase the number of (+)-(/sup 3/H)amphetamine binding sites. Ouabain potently inhibited the glucose-induced stimulation of (+)-(/sup 3/H)amphetamine binding, suggesting the involvement of Na/sup +/, K/sup +/-ATPase. Preincubation of hypothalamic slices with glucose also resulted in an increase in Na/sup +/,K/sup +/-ATPase activity and the number ofmore » specific high-affinity binding sites for (/sup 3/H)ouabain, and a good correlation was observed between the glucose-stimulated increase in (+)-(/sup 3/H)amphetamine and (/sup 3/H)ouabain binding. These data suggest that the (+)-(/sup 3/H)amphetamine binding site in hypothalamus, previously linked to the anorectic actions of various phenylethylamines, is regulated both in vitro and in vivo by physiological concentrations of glucose. Glucose and amphetamine appear to interact at common sites in the hypothalamus to stimulate Na/sup +/,K/sup +/-ATPase activity, and the latter may be involved in the glucostatic regulation of appetite.« less

  16. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  17. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  18. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  19. ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data

    PubMed Central

    2010-01-01

    Background Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) or ChIP followed by genome tiling array analysis (ChIP-chip) have become standard technologies for genome-wide identification of DNA-binding protein target sites. A number of algorithms have been developed in parallel that allow identification of binding sites from ChIP-seq or ChIP-chip datasets and subsequent visualization in the University of California Santa Cruz (UCSC) Genome Browser as custom annotation tracks. However, summarizing these tracks can be a daunting task, particularly if there are a large number of binding sites or the binding sites are distributed widely across the genome. Results We have developed ChIPpeakAnno as a Bioconductor package within the statistical programming environment R to facilitate batch annotation of enriched peaks identified from ChIP-seq, ChIP-chip, cap analysis of gene expression (CAGE) or any experiments resulting in a large number of enriched genomic regions. The binding sites annotated with ChIPpeakAnno can be viewed easily as a table, a pie chart or plotted in histogram form, i.e., the distribution of distances to the nearest genes for each set of peaks. In addition, we have implemented functionalities for determining the significance of overlap between replicates or binding sites among transcription factors within a complex, and for drawing Venn diagrams to visualize the extent of the overlap between replicates. Furthermore, the package includes functionalities to retrieve sequences flanking putative binding sites for PCR amplification, cloning, or motif discovery, and to identify Gene Ontology (GO) terms associated with adjacent genes. Conclusions ChIPpeakAnno enables batch annotation of the binding sites identified from ChIP-seq, ChIP-chip, CAGE or any technology that results in a large number of enriched genomic regions within the statistical programming environment R. Allowing users to pass their own annotation data such as a different Chromatin immunoprecipitation (ChIP) preparation and a dataset from literature, or existing annotation packages, such as GenomicFeatures and BSgenome, provides flexibility. Tight integration to the biomaRt package enables up-to-date annotation retrieval from the BioMart database. PMID:20459804

  20. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  1. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  2. Interactions of cephalexin with bovine serum albumin: displacement reaction and molecular docking.

    PubMed

    Hamishehkar, Hamed; Hosseini, Soheila; Naseri, Abdolhossein; Safarnejad, Azam; Rasoulzadeh, Farzaneh

    2016-01-01

    Introduction: The drug-plasma protein interaction is a fundamental issue in guessing and checking the serious drug side effects related with other drugs. The purpose of this research was to study the interaction of cephalexin with bovine serum albumin (BSA) and displacement reaction using site probes. Methods: The interaction mechanism concerning cephalexin (CPL) with BSA was investigated using various spectroscopic methods and molecular modeling method. The binding sites number, n, apparent binding constant, K, and thermodynamic parameters, ΔG 0 , ΔH 0 , and ΔS 0 were considered at different temperatures. To evaluate the experimental results, molecular docking modeling was calculated. Results: The distance, r=1.156 nm between BSA and CPL were found in accordance with the Forster theory of non-radiation energy transfer (FRET) indicating energy transfer occurs between BSA and CPL. According to the binding parameters and ΔG 0 = negative values and ΔS 0 = 28.275 j mol -1 K -1 , a static quenching process is effective in the CPL-BSA interaction spontaneously. ΔG 0 for the CPL-BSA complex obtained from the docking simulation is -28.99 kj mol -1 , which is close to experimental ΔG of binding, -21.349 kj mol -1 that indicates a good agreement between the results of docking methods and experimental data. Conclusion: The outcomes of spectroscopic methods revealed that the conformation of BSA changed during drug-BSA interaction. The results of FRET propose that CPL quenches the fluorescence of BSA by static quenching and FRET. The displacement study showed that phenylbutazon and ketoprofen displaced CPL, indicating that its binding site on albumin is site I and Gentamicin cannot be displaced from the binding site of CPL. All results of molecular docking method agreed with the results of experimental data.

  3. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  4. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  5. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  6. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  7. Characterization of the interaction between furosemide and bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Zhou, Neng; Liang, Yi-Zeng; Wang, Ping

    2008-01-01

    The interaction of furosemide (FU), one kind of potent diuretic, with bovine serum albumin (BSA) has been investigated at physiological acidity (pH 7.40) by fluorescent technique. Displacement experiment with site markers and Synchronous fluorescence clearly reveal that there are non-specific binding sites of FU with BSA. This conclusion was supported by the binding studies in the presence of the hydrophobic probe 1-anilinonaphthalene-8-sulfonic acid (ANS) and in different ionic strength. The binding sites number n and binding constant K were measured. The thermodynamic parameters Δ H°, Δ G°, Δ S° at different temperatures were calculated. The effects of other four diuretics, some common metal ions and bioactive components from herbal medicine on the binding are also considered. The results show only bumetanide has strong effect on FU's binding. Moreover, several data processing methods presently used were evaluated with Data of the same set. Quite different results were obtained from these methods suggesting more attention should be paid to the data processing methods.

  8. Specific strychnine binding sites on acrosome-associated membranes of golden hamster spermatozoa.

    PubMed

    Llanos, Miguel N; Ronco, Ana M; Aguirre, María C

    2003-06-27

    This study demonstrates for the first time, that membrane vesicles originated from the hamster sperm head after the occurrence of the acrosome reaction, possess specific strychnine binding sites. [3H]Strychnine binding was saturable and reversible, being displaced by unlabeled strychnine (IC(50)=26.7+/-2.3 microM). Kinetic analysis revealed one binding site with K(d)=120nM and B(max)=142fmol/10(6) spermatozoa. Glycine receptor agonists beta-alanine and taurine inhibited strychnine binding by 20-30%. Surprisingly, glycine stimulated binding by about 40-50%. Results obtained in this study strongly suggest the presence of glycine receptors-with distinctive kinetic properties on the periacrosomal plasma membrane of hamster spermatozoa. Localization of this receptor fits well with its previously proposed role in acrosomal exocytosis during mammalian fertilization.

  9. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Stoichiometry of maltodextrin-binding sites in LamB, an outer membrane protein from Escherichia coli.

    PubMed Central

    Gehring, K; Cheng, C H; Nikaido, H; Jap, B K

    1991-01-01

    We have directly measured the stoichiometry of maltodextrin-binding sites in LamB. Scatchard plots and computer fitting of flow dialysis (rate-of-dialysis) experiments clearly establish three independent binding sites per LamB trimer, with a dissociation constant of approximately 60 microM for maltoheptaose. The current model for LamB's function as a specific pore is discussed with respect to the symmetry in LamB's kinetic properties and the implications of our results. Images PMID:2001992

  11. Massive GGAAs in genomic repetitive sequences serve as a nuclear reservoir of NF-κB.

    PubMed

    Wu, Jian; Wang, Qiao; Dai, Wei; Wang, Wei; Yue, Ming; Wang, Jinke

    2018-04-13

    Nuclear factor κB (NF-κB) is a DNA-binding transcription factor. Characterizing its genomic binding sites is crucial for understanding its gene regulatory function and mechanism in cells. This study characterized the binding sites of NF-κB RelA/p65 in the tumor neurosis factor-α (TNFα) stimulated HeLa cells by a precise chromatin immunoprecipitation-sequencing (ChIP-seq). The results revealed that NF-κB binds nontraditional motifs (nt-motifs) containing conserved GGAA quadruplet. Moreover, nt-motifs mainly distribute in the peaks nearby centromeres that contain a larger number of repetitive elements such as satellite, simple repeats and short interspersed nuclear elements (SINEs). This intracellular binding pattern was then confirmed by the in vitro detection, indicating that NF-κB dimers can bind the nontraditional κB (nt-κB) sites with low affinity. However, this binding hardly activates transcription. This study thus deduced that NF-κB binding nt-motifs may realize functions other than gene regulation as NF-κB binding traditional motifs (t-motifs). To testify the deduction, many ChIP-seq data of other cell lines were then analyzed. The results indicate that NF-κB binding nt-motifs is also widely present in other cells. The ChIP-seq data analysis also revealed that nt-motifs more widely distribute in the peaks with low-fold enrichment. Importantly, it was also found that NF-κB binding nt-motifs is mainly present in the resting cells, whereas NF-κB binding t-motifs is mainly present in the stimulated cells. Astonishingly, no known function was enriched by the gene annotation of nt-motif peaks. Based on these results, this study proposed that the nt-κB sites that extensively distribute in larger numbers of repeat elements function as a nuclear reservoir of NF-κB. The nuclear NF-κB proteins stored at nt-κB sites in the resting cells may be recruited to the t-κB sites for regulating its target genes upon stimulation. Copyright © 2018 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  12. Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

    PubMed

    Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

    2016-06-01

    The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  13. Arabidopsis Polycomb Repressive Complex 2 binding sites contain putative GAGA factor binding motifs within coding regions of genes

    PubMed Central

    2013-01-01

    Background Polycomb Repressive Complex 2 (PRC2) is an essential regulator of gene expression that maintains genes in a repressed state by marking chromatin with trimethylated Histone H3 lysine 27 (H3K27me3). In Arabidopsis, loss of PRC2 function leads to pleiotropic effects on growth and development thought to be due to ectopic expression of seed and embryo-specific genes. While there is some understanding of the mechanisms by which specific genes are targeted by PRC2 in animal systems, it is still not clear how PRC2 is recruited to specific regions of plant genomes. Results We used ChIP-seq to determine the genome-wide distribution of hemagglutinin (HA)-tagged FERTLIZATION INDEPENDENT ENDOSPERM (FIE-HA), the Extra Sex Combs homolog protein present in all Arabidopsis PRC2 complexes. We found that the FIE-HA binding sites co-locate with a subset of the H3K27me3 sites in the genome and that the associated genes were more likely to be de-repressed in mutants of PRC2 components. The FIE-HA binding sites are enriched for three sequence motifs including a putative GAGA factor binding site that is also found in Drosophila Polycomb Response Elements (PREs). Conclusions Our results suggest that PRC2 binding sites in plant genomes share some sequence features with Drosophila PREs. However, unlike Drosophila PREs which are located in promoters and devoid of H3K27me3, Arabidopsis FIE binding sites tend to be in gene coding regions and co-localize with H3K27me3. PMID:24001316

  14. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

    2004-08-06

    Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

  15. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  16. Chelate effects in sulfate binding by amide/urea-based ligands.

    PubMed

    Jia, Chuandong; Wang, Qi-Qiang; Begum, Rowshan Ara; Day, Victor W; Bowman-James, Kristin

    2015-07-07

    The influence of chelate and mini-chelate effects on sulfate binding was explored for six amide-, amide/amine-, urea-, and urea/amine-based ligands. Two of the urea-based hosts were selective for SO4(2-) in water-mixed DMSO-d6 systems. Results indicated that the mini-chelate effect provided by a single urea group with two NH binding sites appears to provide enhanced binding over two amide groups. Furthermore, additional urea binding sites incorporated into the host framework appeared to overcome to some extent competing hydration effects with increasing water content.

  17. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  18. DNA binding sites characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, Alexandre; Vallverdu, Montserrat; Claria, Francesc; Soria, José Manuel; Caminal, Pere

    2006-01-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measure such as Renyi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency based Renyi measures. Results are reported in this manuscript comparing transition frequencies (i.e. dinucelotides) and base frequencies for Shannon and parametric Renyi for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that, for the evaluated datasets, the information provided by both approaches is not redundant, as they evolve differently under increasing Renyi orders.

  19. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  20. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  1. Down-regulation of sup 3 H-imipramine binding sites in rat cerebral cortex prenatal exposure to antidepressants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Montero, D.; de Ceballos, M.L.; Del Rio, J.

    1990-01-01

    Several antidepressant drugs were given to pregnant rats in the last 15 days of gestation and {sup 3}H-imipramine binding ({sup 3}H-IMI) was subsequently measured in the cerebral cortex of the offspring. The selective serotonin (5-HT) uptake blockers chlorimipramine and fluoxetine as well as the selective monoamine oxidase (MAO) inhibitors clorgyline and deprenyl induced, after prenatal exposure, a down-regulation of {sup 3}H-IMI binding sites at postnatal day 25. The density of these binding sites was still reduced at postnatal day 90 in rats exposed in utero to the MAO inhibitors. The antidepressants desipramine and nomifensine were ineffective in this respect. Aftermore » chronic treatment of adult animals, only chlorimipramine was able to down-regulate the {sup 3}H-IMI binding sites. Consequently, prenatal exposure of rats to different antidepressant drugs affecting predominantly the 5-HT systems induces more marked and long-lasting effects on cortical {sup 3}H-IMI binding sites. The results suggest that the developing brain is more susceptible to the actions of antidepressants.« less

  2. Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

    PubMed Central

    Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

    2007-01-01

    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

  3. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    PubMed

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  5. A Bioinformatics Approach to the Identification of Variants Associated with Type 1 and Type 2 Diabetes Mellitus that Reside in Functionally Validated miRNAs Binding Sites.

    PubMed

    Ghaedi, Hamid; Bastami, Milad; Jahani, Mohammad Mehdi; Alipoor, Behnam; Tabasinezhad, Maryam; Ghaderi, Omar; Nariman-Saleh-Fam, Ziba; Mirfakhraie, Reza; Movafagh, Abolfazl; Omrani, Mir Davood; Masotti, Andrea

    2016-06-01

    The present work is aimed at finding variants associated with Type 1 and Type 2 diabetes mellitus (DM) that reside in functionally validated miRNAs binding sites and that can have a functional role in determining diabetes and related pathologies. Using bioinformatics analyses we obtained a database of validated polymorphic miRNA binding sites which has been intersected with genes related to DM or to variants associated and/or in linkage disequilibrium (LD) with it and is reported in genome-wide association studies (GWAS). The workflow we followed allowed us to find variants associated with DM that also reside in functional miRNA binding sites. These data have been demonstrated to have a functional role by impairing the functions of genes implicated in biological processes linked to DM. In conclusion, our work emphasized the importance of SNPs located in miRNA binding sites. The results discussed in this work may constitute the basis of further works aimed at finding functional candidates and variants affecting protein structure and function, transcription factor binding sites, and non-coding epigenetic variants, contributing to widen the knowledge about the pathogenesis of this important disease.

  6. The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

    DOE PAGES

    Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

    2017-06-24

    In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

  7. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  8. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  9. Elucidation of the Hsp90 C-terminal Inhibitor Binding Site

    PubMed Central

    Matts, Robert L.; Dixit, Anshuman; Peterson, Laura B.; Sun, Liang; Voruganti, Sudhakar; Kalyanaraman, Palgunan; Hartson, Steve D.; Verkhivker, Gennady M.; Blagg, Brian S. J.

    2011-01-01

    The Hsp90 chaperone machine is required for the folding, activation and/or stabilization of more than 50 proteins directly related to malignant progression. Hsp90 contains small molecule binding sites at both its N- and C-terminal domains, however, limited structural and biochemical data regarding the C-terminal binding site is available. In this report, the small molecule binding site in the Hsp90 C-terminal domain was revealed by protease fingerprinting and photoaffinity labeling utilizing LC-MS/MS. The identified site was characterized by generation of a homology model for hHsp90α using the SAXS open structure of HtpG and docking the bioactive conformation of NB into the generated model. The resulting model for the bioactive conformation of NB bound to Hsp90α is presented herein. PMID:21548602

  10. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  11. Localizing Carbohydrate Binding Sites in Proteins Using Hydrogen/Deuterium Exchange Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Zhang, Jingjing; Kitova, Elena N.; Li, Jun; Eugenio, Luiz; Ng, Kenneth; Klassen, John S.

    2016-01-01

    The application of hydrogen/deuterium exchange mass spectrometry (HDX-MS) to localize ligand binding sites in carbohydrate-binding proteins is described. Proteins from three bacterial toxins, the B subunit homopentamers of Cholera toxin and Shiga toxin type 1 and a fragment of Clostridium difficile toxin A, and their interactions with native carbohydrate receptors, GM1 pentasaccharides (β-Gal-(1→3)-β-GalNAc-(1→4)[α-Neu5Ac-(2→3)]-β-Gal-(1→4)-Glc), Pk trisaccharide (α-Gal-(1→4)-β-Gal-(1→4)-Glc) and CD-grease (α-Gal-(1→3)-β-Gal-(1→4)-β-GlcNAcO(CH2)8CO2CH3), respectively, served as model systems for this study. Comparison of the differences in deuterium uptake for peptic peptides produced in the absence and presence of ligand revealed regions of the proteins that are protected against deuterium exchange upon ligand binding. Notably, protected regions generally coincide with the carbohydrate binding sites identified by X-ray crystallography. However, ligand binding can also result in increased deuterium exchange in other parts of the protein, presumably through allosteric effects. Overall, the results of this study suggest that HDX-MS can serve as a useful tool for localizing the ligand binding sites in carbohydrate-binding proteins. However, a detailed interpretation of the changes in deuterium exchange upon ligand binding can be challenging because of the presence of ligand-induced changes in protein structure and dynamics.

  12. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  13. The involvement of the sodium-potassium pump in postjunctional supersensitivity of the guinea-pig vas deferens as assessed by [3H]ouabain binding.

    PubMed

    Wong, S K; Westfall, D P; Fedan, J S; Fleming, W W

    1981-10-01

    Previous evidence has suggested that postjunctional supersensitivity of the guinea-pig vas deferens results, in part, from partial depolarization of the cell membrane. The depolarization is believed to result from a reduction in the activity of the Na-K pump. Indeed, the Na, K+ -adenosine triphosphatase activity of subcellular fractions from supersensitive vas deferens is reduced. In order to determine whether the biochemical alteration seen in subcellular fractions correlate with Na-K pump sites in intact tissues, we have studied the binding of [3H] ouabain to intact vas deferens. [3H]ouabain binds to membrane sites which have the characteristics expected of Na+, K+ - adenosine triphosphatase. Specific binding was saturable and reversible. Scatchard analysis of ouabain-binding in control tissues yielded a single class of binding sites with a dissociation constant (KD) of 156 +/- 7 nM and a maximum number of binding sites (Bmax) of 558.7 +/- 15.6 fmol/mg wet wt. [3H]Ouabain binding was displaceable by several cardiac glycosides and aglycones, but not by steroid hormones or sodium vanadate. Alteration of concentrations of Na+ and K+ markedly affected ouabain binding. Denervation (with 6-hydroxydopamine), decentralization or reserpine treatment for 1 day, which do not produce supersensitivity, did not alter the Bmax, whereas 5 to 7 days after these procedures, when supersensitivity was present, the Bmax was significantly reduced by 20 to 40%. The KD was not changed by any of the treatments. These data provide additional support for the concept that a reduction in the NaK pump sites contributes to postjunctional supersensitivity.

  14. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  15. [Interaction of human factor X with thromboplastin].

    PubMed

    Kiselev, S V; Zubairov, D M; Timarbaev, V N

    2003-01-01

    The binding of 125I-labeled human factor X to native and papaine-treated tissue tromboplastin in the presence of CaCl2 or EDTA was studied. The Scatchard analysis suggests the existence of high (Kd=l,8 x10(-9) M) and low affinity binding sites on the thromboplastin surface. The removal of Ca2+ reduced affinity of factor X to the high affinity sites. This was accompanied by some increase of their number. Proteolysis by papaine decreased affinity of high affinity sites and caused the increase of their number in the presence of Ca2+. In the absence of Ca2+ the affinity remained unchanged, but the number of sites decreased. At low concentrations of factor X positive cooperativity for high affinity binding sites was observed. It did not depend on the presence of Ca2+. The results indirectly confirm the role of hydrophobic interactons in Ca2+ dependent binding of factor X to thromboplastin and the fact that heterogeneity of this binding is determined by mesophase structure of the thromboplastin phospholipids.

  16. Validating metal binding sites in macromolecule structures using the CheckMyMetal web server

    PubMed Central

    Zheng, Heping; Chordia, Mahendra D.; Cooper, David R.; Chruszcz, Maksymilian; Müller, Peter; Sheldrick, George M.

    2015-01-01

    Metals play vital roles in both the mechanism and architecture of biological macromolecules. Yet structures of metal-containing macromolecules where metals are misidentified and/or suboptimally modeled are abundant in the Protein Data Bank (PDB). This shows the need for a diagnostic tool to identify and correct such modeling problems with metal binding environments. The "CheckMyMetal" (CMM) web server (http://csgid.org/csgid/metal_sites/) is a sophisticated, user-friendly web-based method to evaluate metal binding sites in macromolecular structures in respect to 7350 metal binding sites observed in a benchmark dataset of 2304 high resolution crystal structures. The protocol outlines how the CMM server can be used to detect geometric and other irregularities in the structures of metal binding sites and alert researchers to potential errors in metal assignment. The protocol also gives practical guidelines for correcting problematic sites by modifying the metal binding environment and/or redefining metal identity in the PDB file. Several examples where this has led to meaningful results are described in the anticipated results section. CMM was designed for a broad audience—biomedical researchers studying metal-containing proteins and nucleic acids—but is equally well suited for structural biologists to validate new structures during modeling or refinement. The CMM server takes the coordinates of a metal-containing macromolecule structure in the PDB format as input and responds within a few seconds for a typical protein structure modeled with a few hundred amino acids. PMID:24356774

  17. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  18. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  19. Structure of Bacillus subtilis γ-glutamyltranspeptidase in complex with acivicin: diversity of the binding mode of a classical and electrophilic active-site-directed glutamate analogue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ida, Tomoyo; Suzuki, Hideyuki; Fukuyama, Keiichi

    2014-02-01

    The binding modes of acivicin, a classical and an electrophilic active-site-directed glutamate analogue, to bacterial γ-glutamyltranspeptidases were found to be diverse. γ-Glutamyltranspeptidase (GGT) is an enzyme that plays a central role in glutathione metabolism, and acivicin is a classical inhibitor of GGT. Here, the structure of acivicin bound to Bacillus subtilis GGT determined by X-ray crystallography to 1.8 Å resolution is presented, in which it binds to the active site in a similar manner to that in Helicobacter pylori GGT, but in a different binding mode to that in Escherichia coli GGT. In B. subtilis GGT, acivicin is bound covalentlymore » through its C3 atom with sp{sup 2} hybridization to Thr403 O{sup γ}, the catalytic nucleophile of the enzyme. The results show that acivicin-binding sites are common, but the binding manners and orientations of its five-membered dihydroisoxazole ring are diverse in the binding pockets of GGTs.« less

  20. Crystal structures of botulinum neurotoxin DC in complex with its protein receptors synaptotagmin I and II.

    PubMed

    Berntsson, Ronnie Per-Arne; Peng, Lisheng; Svensson, Linda Marie; Dong, Min; Stenmark, Pål

    2013-09-03

    Botulinum neurotoxins (BoNTs) can cause paralysis at exceptionally low concentrations and include seven serotypes (BoNT/A-G). The chimeric BoNT/DC toxin has a receptor binding domain similar to the same region in BoNT/C. However, BoNT/DC does not share protein receptor with BoNT/C. Instead, it shares synaptotagmin (Syt) I and II as receptors with BoNT/B, despite their low sequence similarity. Here, we present the crystal structures of the binding domain of BoNT/DC in complex with the recognition domains of its protein receptors, Syt-I and Syt-II. The structures reveal that BoNT/DC possesses a Syt binding site, distinct from the established Syt-II binding site in BoNT/B. Structure-based mutagenesis further shows that hydrophobic interactions play a key role in Syt binding. The structures suggest that the BoNT/DC ganglioside binding sites are independent of the protein receptor binding site. Our results reveal the remarkable versatility in the receptor recognition of the BoNTs. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site

    PubMed Central

    Chan, I-San; Al-Sarraj, Taufik; Shahravan, S. Hesam; Fedorova, Anna V.; Shin, Jumi A.

    2012-01-01

    Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4-bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR), and that 5H-LR comprises two 4-bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explored how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP–DNA interactions at a number of full-sites that contain 5H-LR vs. either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo. PMID:22856882

  2. The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site.

    PubMed

    Chan, I-San; Al-Sarraj, Taufik; Shahravan, S Hesam; Fedorova, Anna V; Shin, Jumi A

    2012-08-21

    Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4 bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR) and that 5H-LR comprises two 4 bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explore how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP-DNA interactions at a number of full-sites that contain 5H-LR versus either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo.

  3. Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

    PubMed Central

    Jayasena, S D; Johnston, B H

    1992-01-01

    tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

  4. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  5. Bacillus thuringiensis delta-endotoxin binding to brush border membrane vesicles of rice stem borers.

    PubMed

    Alcantara, Edwin P; Aguda, Remedios M; Curtiss, April; Dean, Donald H; Cohen, Michael B

    2004-04-01

    The receptor binding step in the molecular mode of action of five delta-endotoxins (Cry1Ab, Cry1Ac, Cry1C, Cry2A, and Cry9C) from Bacillus thuringiensis was examined to find toxins with different receptor sites in the midgut of the striped stem borer (SSB) Chilo suppressalis (Walker) and yellow stem borer (YSB) Scirpophaga incertulas (Walker) (Lepidoptera: Pyralidae). Homologous competition assays were used to estimate binding affinities (K(com)) of (125)I-labelled toxins to brush border membrane vesicles (BBMV). The SSB BBMV affinities in decreasing order was: Cry1Ab = Cry1Ac > Cry9C > Cry2A > Cry1C. In YSB, the order of decreasing affinities was: Cry1Ac > Cry1Ab > Cry9C = Cry2A > Cry1C. The number of binding sites (B(max)) estimated by homologous competition binding among the Cry toxins did not affect toxin binding affinity (K(com)) to both insect midgut BBMVs. Results of the heterologous competition binding assays suggest that Cry1Ab and Cry1Ac compete for the same binding sites in SSB and YSB. Other toxins bind with weak (Cry1C, Cry2A) or no affinity (Cry9C) to Cry1Ab and Cry1Ac binding sites in both species. Cry2A had the lowest toxicity to 10-day-old SSB and Cry1Ab and Cry1Ac were the most toxic. Taken together, the results of this study show that Cry1Ab or Cry1Ac could be combined with either Cry1C, Cry2A, or Cry9C for more durable resistance in transgenic rice. Cry1Ab should not be used together with Cry1Ac because a mutation in one receptor site could diminish binding of both toxins. Copyright 2004 Wiley-Liss, Inc.

  6. Binding of ATP by pertussis toxin and isolated toxin subunits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hausman, S.Z.; Manclark, C.R.; Burns, D.L.

    1990-07-03

    The binding of ATP to pertussis toxin and its components, the A subunit and B oligomer, was investigated. Whereas, radiolabeled ATP bound to the B oligomer and pertussis toxin, no binding to the A subunit was observed. The binding of ({sup 3}H)ATP to pertussis toxin and the B oligomer was inhibited by nucleotides. The relative effectiveness of the nucleotides was shown to be ATP > GTP > CTP > TTP for pertussis toxin and ATP > GTP > TTP > CTP for the B oligomer. Phosphate ions inhibited the binding of ({sup 3}H)ATP to pertussis toxin in a competitive manner;more » however, the presence of phosphate ions was essential for binding of ATP to the B oligomer. The toxin substrate, NAD, did not affect the binding of ({sup 3}H)ATP to pertussis toxin, although the glycoprotein fetuin significantly decreased binding. These results suggest that the binding site for ATP is located on the B oligomer and is distinct from the enzymatically active site but may be located near the eukaryotic receptor binding site.« less

  7. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  9. Comprehensive meta-analysis of Signal Transducers and Activators of Transcription (STAT) genomic binding patterns discerns cell-specific cis-regulatory modules

    PubMed Central

    2013-01-01

    Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription) family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM), which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors. PMID:23324445

  10. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

    PubMed

    Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

    2010-08-03

    Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  11. Effects of Iron Deficiency on Iron Binding and Internalization into Acidic Vacuoles in Dunaliella salina1[W][OA

    PubMed Central

    Paz, Yakov; Shimoni, Eyal; Weiss, Meira; Pick, Uri

    2007-01-01

    Uptake of iron in the halotolerant alga Dunaliella salina is mediated by a transferrin-like protein (TTf), which binds and internalizes Fe3+ ions. Recently, we found that iron deficiency induces a large enhancement of iron binding, which is associated with accumulation of three other plasma membrane proteins that associate with TTf. In this study, we characterized the kinetic properties of iron binding and internalization and identified the site of iron internalization. Iron deficiency induces a 4-fold increase in Fe binding, but only 50% enhancement in the rate of iron uptake and also increases the affinity for iron and bicarbonate, a coligand for iron binding. These results indicate that iron deprivation leads to accumulation and modification of iron-binding sites. Iron uptake in iron-sufficient cells is preceded by an apparent time lag, resulting from prebound iron, which can be eliminated by unloading iron-binding sites. Iron is tightly bound to surface-exposed sites and hardly exchanges with medium iron. All bound iron is subsequently internalized. Accumulation of iron inhibits further iron binding and internalization. The vacuolar inhibitor bafilomycin inhibits iron uptake and internalization. Internalized iron was localized by electron microscopy within vacuolar structures that were identified as acidic vacuoles. Iron internalization is accompanied by endocytosis of surface proteins into these acidic vacuoles. A novel kinetic mechanism for iron uptake is proposed, which includes two pools of bound/compartmentalized iron separated by a rate-limiting internalization stage. The major parameter that is modulated by iron deficiency is the iron-binding capacity. We propose that excessive iron binding in iron-deficient cells serves as a temporary reservoir for iron that is subsequently internalized. This mechanism is particularly suitable for organisms that are exposed to large fluctuations in iron availability. PMID:17513481

  12. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  13. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  14. NF-kappaB binds to a polymorphic repressor element in the MMP-3 promoter.

    PubMed

    Borghaei, Ruth C; Rawlings, P Lyle; Javadi, Masoud; Woloshin, Joanna

    2004-03-26

    A 5T/6T polymorphic site in the matrix metalloproteinase-3 (MMP-3) promoter has been identified as a repressor element involved in inhibiting induction of MMP-3 transcription by interleukin 1; and the 6T allele has been associated with decreased expression of MMP-3 as compared to the 5T allele. Zinc-binding protein-89 (ZBP-89) was cloned from a yeast one-hybrid assay via its ability to interact with this site, but when the protein was over-expressed, it resulted in activation of the MMP-3 promoter rather than repression. Here we show that in nuclear extracts isolated from human gingival fibroblasts stimulated with IL-1, this site is bound by p50 and p65 components of NF-kappaB in addition to ZBP-89, and that recombinant p50 binds preferentially to the 6T binding site. These results are consistent with a role for NF-kappaB in limiting the cytokine induced expression of MMP-3.

  15. Protein-protein docking with binding site patch prediction and network-based terms enhanced combinatorial scoring.

    PubMed

    Gong, Xinqi; Wang, Panwen; Yang, Feng; Chang, Shan; Liu, Bin; He, Hongqiu; Cao, Libin; Xu, Xianjin; Li, Chunhua; Chen, Weizu; Wang, Cunxin

    2010-11-15

    Protein-protein docking has made much progress in recent years, but challenges still exist. Here we present the application of our docking approach HoDock in CAPRI. In this approach, a binding site prediction is implemented to reduce docking sampling space and filter out unreasonable docked structures, and a network-based enhanced combinatorial scoring function HPNCscore is used to evaluate the decoys. The experimental information was combined with the predicted binding site to pick out the most likely key binding site residues. We applied the HoDock method in the recent rounds of the CAPRI experiments, and got good results as predictors on targets 39, 40, and 41. We also got good results as scorers on targets 35, 37, 40, and 41. This indicates that our docking approach can contribute to the progress of protein-protein docking methods and to the understanding of the mechanism of protein-protein interactions. © 2010 Wiley-Liss, Inc.

  16. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  17. Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

    USGS Publications Warehouse

    Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

    2002-01-01

    The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

  18. A global optimization algorithm for protein surface alignment

    PubMed Central

    2010-01-01

    Background A relevant problem in drug design is the comparison and recognition of protein binding sites. Binding sites recognition is generally based on geometry often combined with physico-chemical properties of the site since the conformation, size and chemical composition of the protein surface are all relevant for the interaction with a specific ligand. Several matching strategies have been designed for the recognition of protein-ligand binding sites and of protein-protein interfaces but the problem cannot be considered solved. Results In this paper we propose a new method for local structural alignment of protein surfaces based on continuous global optimization techniques. Given the three-dimensional structures of two proteins, the method finds the isometric transformation (rotation plus translation) that best superimposes active regions of two structures. We draw our inspiration from the well-known Iterative Closest Point (ICP) method for three-dimensional (3D) shapes registration. Our main contribution is in the adoption of a controlled random search as a more efficient global optimization approach along with a new dissimilarity measure. The reported computational experience and comparison show viability of the proposed approach. Conclusions Our method performs well to detect similarity in binding sites when this in fact exists. In the future we plan to do a more comprehensive evaluation of the method by considering large datasets of non-redundant proteins and applying a clustering technique to the results of all comparisons to classify binding sites. PMID:20920230

  19. The allosteric citalopram binding site differentially interferes with neuronal firing rate and SERT trafficking in serotonergic neurons.

    PubMed

    Matthäus, Friederike; Haddjeri, Nasser; Sánchez, Connie; Martí, Yasmina; Bahri, Senda; Rovera, Renaud; Schloss, Patrick; Lau, Thorsten

    2016-11-01

    Citalopram is a clinically applied selective serotonin re-uptake inhibitor for antidepressant pharmacotherapy. It consists of two enantiomers, S-citalopram (escitalopram) and R-citalopram, of which escitalopram exerts the antidepressant therapeutic effect and has been shown to be one of the most efficient antidepressants, while R-citalopram antagonizes escitalopram via an unknown molecular mechanism that may depend on binding to a low-affinity allosteric binding site of the serotonin transporter. However, the precise mechanism of antidepressant regulation of the serotonin transporter by citalopram enantiomers still remains elusive. Here we investigate escitalopram׳s acute effect on (1) serotonergic neuronal firing in transgenic mice that express the human serotonin transporter without and with a mutation that disables the allosteric binding site, and (2) regulation of the serotonin transporter׳s cell surface localization in stem cell-derived serotonergic neurons. Our results demonstrate that escitalopram inhibited neuronal firing less potently in the mouse line featuring a mutation that abolishes the function of the allosteric binding site and induced serotonin transporter internalization independently of the allosteric binding site mechanism. Furthermore, citalopram enantiomers dose-dependently induced serotonin transporter internalization. In conclusion, this study provides new insight into antidepressant effects exerted by citalopram enantiomers in presence and absence of a functional allosteric binding site. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.

  20. Binding of nucleotides by T4 DNA ligase and T4 RNA ligase: optical absorbance and fluorescence studies.

    PubMed Central

    Cherepanov, A V; de Vries, S

    2001-01-01

    The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015

  1. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  2. Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

    PubMed

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-04-01

    Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

  3. The correlation between ouabain binding and potassium pump inhibition in human and sheep erythrocytes.

    PubMed Central

    Joiner, C H; Lauf, P K

    1978-01-01

    1. [3H]Ouabain binding to human and sheep red blood cells was shown to be specific for receptors associated with Na/K transport. Virtually all tritium binding was abolished by dilution with unlabelled drug. Saturation levels of binding were independent of glycoside concentration and were identical to those associated with 100% inhibition of K pumping. 2. [3H]Ouabain binding and 42K influx were measured simultaneously in order to correlate the degree of K pump inhibition with the amount of glycoside bound. Results by this method agreed exactly with those obtained by pre-exposing cells to drug, followed by washing and then measuring K influx. 3. Plots of [3H]oubain binding vs. K pump inhibition were rectilinear for human and low K (LK) sheep red cells, indicating one glycoside receptor per K pump site and functional homogeneity of pump sites. High K (HK) sheep red cells exhibited curved plots of binding versus inhibition, which were best explained in terms of one receptor per pump, but a heterogeneous population of pump sites. 4. External K reduced the rate of glycoside binding, but did not alter the relationship between binding and inhibition. 5. The number of K pump sites was estimated as 450--500 per human cell and 30--50 per LK sheep cell. HK sheep cells had 90--130 sites per cell, of which eighty to ninety were functionally dominant. The number of K pump sites on LK sheep cells was not changed by anti-L, although the maximum velocity of pump turnover was increased. PMID:722573

  4. Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

    PubMed Central

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-01-01

    Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

  5. ProMateus—an open research approach to protein-binding sites analysis

    PubMed Central

    Neuvirth, Hani; Heinemann, Uri; Birnbaum, David; Tishby, Naftali; Schreiber, Gideon

    2007-01-01

    The development of bioinformatic tools by individual labs results in the abundance of parallel programs for the same task. For example, identification of binding site regions between interacting proteins is done using: ProMate, WHISCY, PPI-Pred, PINUP and others. All servers first identify unique properties of binding sites and then incorporate them into a predictor. Obviously, the resulting prediction would improve if the most suitable parameters from each of those predictors would be incorporated into one server. However, because of the variation in methods and databases, this is currently not feasible. Here, the protein-binding site prediction server is extended into a general protein-binding sites research tool, ProMateus. This web tool, based on ProMate's infrastructure enables the easy exploration and incorporation of new features and databases by the user, providing an evaluation of the benefit of individual features and their combination within a set framework. This transforms the individual research into a community exercise, bringing out the best from all users for optimized predictions. The analysis is demonstrated on a database of protein protein and protein-DNA interactions. This approach is basically different from that used in generating meta-servers. The implications of the open-research approach are discussed. ProMateus is available at http://bip.weizmann.ac.il/promate. PMID:17488838

  6. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  7. Interaction of flavonols with human serum albumin: a biophysical study showing structure-activity relationship and enhancement when coated on silver nanoparticles.

    PubMed

    Das, Pratyusa; Chaudhari, Sunil Kumar; Das, Asmita; Kundu, Somashree; Saha, Chabita

    2018-04-24

    Binding affinities of flavonols namely quercetin, myricetin, and kaempferol to human serum albumin (HSA) were determined fluorimetrically and the order was observed to be myricetin > quercetin > kaempferol demonstrating structure-activity relationship. Quercetin-coated silver nanoparticles (AgNPs) show higher binding affinity to HSA compared to free quercetin with binding constants 6.04 × 10 7  M -1 and 4.2 × 10 6  M -1 , respectively. Using site-specific markers it is concluded that free quercetin and that coated on AgNPs bind at different sites. Significant structural changes in circular dichroism (CD) spectra of HSA were recorded with quercetin-coated AgNPs compared to free quercetin. These results were further substantiated by time-resolved fluorescence spectroscopy where fluorescence life time of the tryptophan residue in HSA-quercetin-coated AgNPs complex decreased to 3.63 ns from 4.22 ns in HSA-quercetin complex. Isothermal calorimetric studies reveal two binding modes for quercetin-coated AgNPs and also higher binding constants compared to free quercetin. These higher binding affinities are attributed to altered properties of quercetin when coated on AgNPs enabling it to reach the binding sites other than site II where free quercetin mainly binds.

  8. Elucidation of the binding sites of sodium dodecyl sulfate to β-lactoglobulin using hydrogen/deuterium exchange mass spectrometry combined with docking simulation.

    PubMed

    Hu, Wenbing; Liu, Jianan; Luo, Qun; Han, Yumiao; Wu, Kui; Lv, Shuang; Xiong, Shaoxiang; Wang, Fuyi

    2011-05-30

    Hydrogen/deuterium exchange mass spectrometry (H/DX MS) has become a powerful tool to investigate protein-protein and protein-ligand interactions, but it is still challenging to localize the interaction regions/sites of ligands with pepsin-resistant proteins such as lipocalins. β-Lactoglobulin (BLG), a member of the lipocalin family, can bind a variety of small hydrophobic molecules including retinols, retinoic acids, and long linear fatty acids. However, whether the binding site of linear molecules locates in the external groove or internal cavity of BLG is controversial. In this study we used H/DX MS combined with docking simulation to localize the interaction sites of a tested ligand, sodium dodecyl sulfate (SDS), binding to BLG. H/DX MS results indicated that SDS can bind to both the external and the internal sites in BLG. However, neither of the sites is saturated with SDS, allowing a dynamic ligand exchange to occur between the sites at equilibrium state. Docking studies revealed that SDS forms H-bonds with Lys69 in the internal site and Lys138 and Lys141 in the external site in BLG via the sulfate group, and interacts with the hydrophobic residues valine, leucine, isoleucine and methionine within both of the sites via its hydrocarbon tail, stabilizing the BLG-SDS complex. Copyright © 2011 John Wiley & Sons, Ltd.

  9. Lanthanide ions induce hydrolysis of hemoglobin-bound 2,3-diphosphoglycerate (2,3-DPG), conformational changes of globin and bidirectional changes of 2,3-DPG-hemoglobin's oxygen affinity.

    PubMed

    Cheng, Y; Lin, H; Xue, D; Li, R; Wang, K

    2001-02-14

    The changes in structure and function of 2,3-diphosphoglycerate-hemoglobin (2,3-DPG-Hb) induced by Ln(3+) binding were studied by spectroscopic methods. The binding of lanthanide cations to 2,3-DPG is prior to that to Hb. Ln(3+) binding causes the hydrolysis of either one from the two phosphomonoester bonds in 2,3-DPG non-specifically. The results using the ultrafiltration method indicate that Ln(3+) binding sites for Hb can be classified into three categories: i.e. positive cooperative sites (N(I)), non-cooperative strong sites (N(S)) and non-cooperative weak sites (N(W)) with binding constants in decreasing order: K(I)>K(S)>K(W). The total number of binding sites amounts to about 65 per Hb tetramer. Information on reaction kinetics was obtained from the change of intrinsic fluorescence in Hb monitored by stopped-flow fluorometry. Fluctuation of fluorescence dependent on Ln(3+) concentration and temperature was observed and can be attributed to the successive conformational changes induced by Ln(3+) binding. The results also reveal the bidirectional changes of the oxygen affinity of Hb in the dependence on Ln(3+) concentration. At the range of [Ln(3+)]/[Hb]<2, the marked increase of oxygen affinity (P(50) decrease) with the Ln(3+) concentration can be attributed to the hydrolysis of 2,3-DPG, while the slight rebound of oxygen affinity in higher Ln(3+) concentration can be interpreted by the transition to the T-state of the Hb tetramer induced by Ln(3+) binding. This was indicated by the changes in secondary structure characterized by the decrease of alpha-helix content.

  10. The binding sites for benztropines and dopamine in the dopamine transporter overlap

    PubMed Central

    Bisgaard, Heidi; Larsen, M. Andreas B.; Mazier, Sonia; Beuming, Thijs; Newman, Amy Hauck; Weinstein, Harel; Shi, Lei; Loland, Claus J.; Gether, Ulrik

    2013-01-01

    Analogues of benztropines (BZTs) are potent inhibitors of the dopamine transporter (DAT) but are less effective than cocaine as behavioral stimulants. As a result, there have been efforts to evaluate these compounds as leads for potential medication for cocaine addiction. Here we use computational modeling together with site-directed mutagenesis to characterize the binding site for BZTs in DAT. Docking into molecular models based on the structure of the bacterial homologue LeuT supported a BZT binding site that overlaps with the substrate binding pocket. In agreement, mutations of residues within the pocket, including Val1523.46* to Ala or Ile, Ser4228.60 to Ala and Asn1573.51 to Cys or Ala, resulted in decreased affinity for BZT and the analog JHW007, as assessed in [3H]dopamine uptake inhibition assays and/or [3H]CFT competition binding assay. A putative polar interaction of one of the phenyl ring fluorine substituents in JHW007 with Asn1573.51 was used as a criterion for determining likely binding poses and establish a structural context for the mutagenesis findings. The analysis positioned the other fluorine substituted phenyl ring of JHW007 in close proximity to Ala47910.51/Ala48010.52 in transmembrane segment (TM) 10. The lack of such an interaction for BZT led to a more tilted orientation, as compared to JHW007, bringing one of the phenyl rings even closer to Ala47910.51/Ala48010.52. Mutation of Ala47910.51 and Ala48010.52 to valines supported these predictions with a larger decrease in the affinity for BZT than for JHW007. Summarized, our data suggest that BZTs display a classical competitive binding mode with binding sites overlapping those of cocaine and dopamine. PMID:20816875

  11. Binding modes of environmental endocrine disruptors to human serum albumin: insights from STD-NMR, ITC, spectroscopic and molecular docking studies.

    PubMed

    Yang, Hongqin; Huang, Yanmei; Liu, Jiuyang; Tang, Peixiao; Sun, Qiaomei; Xiong, Xinnuo; Tang, Bin; He, Jiawei; Li, Hui

    2017-09-11

    Given that bisphenols have an endocrine-disrupting effect on human bodies, thoroughly exposing their potential effects at the molecular level is important. Saturation transfer difference (STD) NMR-based binding studies were performed to investigate the binding potential of two bisphenol representatives, namely, bisphenol B (BPB) and bisphenol E (BPE), toward human serum albumin (HSA). The relative STD (%) suggested that BPB and BPE show similar binding modes and orientations, in which the phenolic rings were spatially close to HSA binding site. ITC analysis results showed that BPB and BPE were bound to HSA with moderately strong binding affinity through electrostatic interactions and hydrogen bonds. The order of binding affinity of HSA for two test bisphenols is as follows: BPE > BPB. The results of fluorescence competitive experiments using 5-dimethylaminonaphthalene-1-sulfonamide and dansylsarcosine as competitors, combined with molecular docking indicated that both bisphenols are prone to attach to the binding site II in HSA. Spectroscopic results (FT-IR, CD, synchronous and 3D fluorescence spectra) showed that BPB/BPE induces different degrees of microenvironmental and conformational changes to HSA.

  12. Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1

    PubMed Central

    Malina, Jaroslav; Scott, Peter; Brabec, Viktor

    2015-01-01

    Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo–helical ‘flexicate’ complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3]4+ incorporating the common NN–NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo–helical complexes for cancer chemotherapy. PMID:25940617

  13. Investigation of the binding sites and orientation of caffeine on human serum albumin by surface-enhanced Raman scattering and molecular docking

    NASA Astrophysics Data System (ADS)

    Wang, Weinan; Zhang, Wei; Duan, Yaokai; Jiang, Yong; Zhang, Liangren; Zhao, Bing; Tu, Pengfei

    2013-11-01

    Fluorescence, normal Raman and surface-enhanced Raman scattering (SERS) were introduced to explore the absorptive geometry of caffeine on Human Serum Albumin (HSA) at physiological condition. The molecular docking was also employed to make a better understanding of the interaction between caffeine and HSA as well as to elucidate the detailed information of the major binding site. The results showed that caffeine could bind to HSA via the hydrophobic force of aromatic stacking and the main binding group on caffeine could be the pyrimidine ring. In addition, a consecutive set of changes in the orientation of caffeine molecule had been demonstrated during the process of caffeine binding to HSA, and the primary binding site was considered to be a hydrophobic cavity formed by Leu198, Lys199, Ser202, Phe211, Trp214, Val344, Ser454 and Leu481 in domain II.

  14. Identical linkage and cooperativity of oxygen and carbon monoxide binding to Octopus dofleini hemocyanin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Connelly, P.R.; Gill, S.J.; Miller, K.I.

    1989-02-21

    Employment of high-precision thin-layer methods has enabled detailed functional characterization of oxygen and carbon monoxide binding for (1) the fully assembled form with 70 binding sites and (2) the isolated chains with 7 binding sites of octopus dofleini hemocyanin. The striking difference in the cooperativities of the two ligands for the assembled decamer is revealed through an examination of the binding capacities and the partition coefficient, determined as functions of the activities of both ligands. A global analysis of the data sets supported by a two-state allosteric model assuming an allosteric unit of 7. Higher level allosteric interactions were notmore » indicated. This contrasts to results obtained for arthropod hemocyanins. Oxygen and carbon monoxide experiments performed on the isolated subunit chain confirmed the presence of functional heterogeneity reported previously. The analysis shows two types of binding sites in the ratio of 4:3.« less

  15. Evaluation of a novel virtual screening strategy using receptor decoy binding sites.

    PubMed

    Patel, Hershna; Kukol, Andreas

    2016-08-23

    Virtual screening is used in biomedical research to predict the binding affinity of a large set of small organic molecules to protein receptor targets. This report shows the development and evaluation of a novel yet straightforward attempt to improve this ranking in receptor-based molecular docking using a receptor-decoy strategy. This strategy includes defining a decoy binding site on the receptor and adjusting the ranking of the true binding-site virtual screen based on the decoy-site screen. The results show that by docking against a receptor-decoy site with Autodock Vina, improved Receiver Operator Characteristic Enrichment (ROCE) was achieved for 5 out of fifteen receptor targets investigated, when up to 15 % of a decoy site rank list was considered. No improved enrichment was seen for 7 targets, while for 3 targets the ROCE was reduced. The extent to which this strategy can effectively improve ligand prediction is dependent on the target receptor investigated.

  16. The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

    PubMed Central

    Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

    2013-01-01

    The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

  17. Evidence that the novobiocin-sensitive ATP-binding site of the heat shock protein 90 (hsp90) is necessary for its autophosphorylation.

    PubMed

    Langer, T; Schlatter, H; Fasold, H

    2002-01-01

    The 90kDa heat shock protein (Hsp90) is one of the most abundant protein and essential for all eukaryotic cells. Many proteins require the interaction with Hsp90 for proper function. Upon heat stress the expression level of Hsp90 is even enhanced. It is assumed, that under these conditions Hsp90 is required to protect other proteins from aggregation. One property of Hsp90 is its ability to undergo autophosphorylation. The N-terminal domain of Hsp90 has been shown to contain an unusual ATP-binding site. A well-known inhibitor of Hsp90 function is geldanamycin binding to the N-terminal ATP-binding site with high affinity. Recently it was shown that Hsp90 possesses a second ATP-binding site in the C-terminal region, which can be competed with novobiocin. Autophosphorylation of Hsp90 was analysed by incubation with gamma(32)P-ATP. Addition of geldanamycin did not interfere with the capability for autophosphorylation, while novobiocin indeed did. These results suggest that the C-terminal ATP-binding site is required for autophosphorylation of Hsp90.

  18. Facilitated dissociation of transcription factors from single DNA binding sites

    PubMed Central

    Kamar, Ramsey I.; Banigan, Edward J.; Erbas, Aykut; Giuntoli, Rebecca D.; Olvera de la Cruz, Monica; Johnson, Reid C.; Marko, John F.

    2017-01-01

    The binding of transcription factors (TFs) to DNA controls most aspects of cellular function, making the understanding of their binding kinetics imperative. The standard description of bimolecular interactions posits that TF off rates are independent of TF concentration in solution. However, recent observations have revealed that proteins in solution can accelerate the dissociation of DNA-bound proteins. To study the molecular basis of facilitated dissociation (FD), we have used single-molecule imaging to measure dissociation kinetics of Fis, a key Escherichia coli TF and major bacterial nucleoid protein, from single dsDNA binding sites. We observe a strong FD effect characterized by an exchange rate ∼1×104 M−1s−1, establishing that FD of Fis occurs at the single-binding site level, and we find that the off rate saturates at large Fis concentrations in solution. Although spontaneous (i.e., competitor-free) dissociation shows a strong salt dependence, we find that FD depends only weakly on salt. These results are quantitatively explained by a model in which partially dissociated bound proteins are susceptible to invasion by competitor proteins in solution. We also report FD of NHP6A, a yeast TF with structure that differs significantly from Fis. We further perform molecular dynamics simulations, which indicate that FD can occur for molecules that interact far more weakly than those that we have studied. Taken together, our results indicate that FD is a general mechanism assisting in the local removal of TFs from their binding sites and does not necessarily require cooperativity, clustering, or binding site overlap. PMID:28364020

  19. Alcohol binding in the C1 (C1A + C1B) domain of protein kinase C epsilon

    PubMed Central

    Pany, Satyabrata; Das, Joydip

    2015-01-01

    Background Alcohol regulates the expression and function of protein kinase C epsilon (PKCε). In a previous study we identified an alcohol binding site in the C1B, one of the twin C1 subdomains of PKCε. Methods In this study, we investigated alcohol binding in the entire C1 domain (combined C1A and C1B) of PKCε. Fluorescent phorbol ester, SAPD and fluorescent diacylglycerol (DAG) analog, dansyl-DAG were used to study the effect of ethanol, butanol, and octanol on the ligand binding using fluorescence resonance energy transfer (FRET). To identify alcohol binding site(s), PKCεC1 was photolabeled with 3-azibutanol and 3-azioctanol, and analyzed by mass spectrometry. The effects of alcohols and the azialcohols on PKCε were studied in NG108-15 cells. Results In the presence of alcohol, SAPD and dansyl-DAG showed different extent of FRET, indicating differential effects of alcohol on the C1A and C1B subdomains. Effects of alcohols and azialcohols on PKCε in NG108-15 cells were comparable. Azialcohols labeled Tyr-176 of C1A and Tyr-250 of C1B. Inspection of the model structure of PKCεC1 reveals that these residues are 40 Å apart from each other indicating that these residues form two different alcohol binding sites. Conclusions The present results provide evidence for the presence of multiple alcohol-binding sites on PKCε and underscore the importance of targeting this PKC isoform in developing alcohol antagonists. PMID:26210390

  20. Protein docking prediction using predicted protein-protein interface.

    PubMed

    Li, Bin; Kihara, Daisuke

    2012-01-10

    Many important cellular processes are carried out by protein complexes. To provide physical pictures of interacting proteins, many computational protein-protein prediction methods have been developed in the past. However, it is still difficult to identify the correct docking complex structure within top ranks among alternative conformations. We present a novel protein docking algorithm that utilizes imperfect protein-protein binding interface prediction for guiding protein docking. Since the accuracy of protein binding site prediction varies depending on cases, the challenge is to develop a method which does not deteriorate but improves docking results by using a binding site prediction which may not be 100% accurate. The algorithm, named PI-LZerD (using Predicted Interface with Local 3D Zernike descriptor-based Docking algorithm), is based on a pair wise protein docking prediction algorithm, LZerD, which we have developed earlier. PI-LZerD starts from performing docking prediction using the provided protein-protein binding interface prediction as constraints, which is followed by the second round of docking with updated docking interface information to further improve docking conformation. Benchmark results on bound and unbound cases show that PI-LZerD consistently improves the docking prediction accuracy as compared with docking without using binding site prediction or using the binding site prediction as post-filtering. We have developed PI-LZerD, a pairwise docking algorithm, which uses imperfect protein-protein binding interface prediction to improve docking accuracy. PI-LZerD consistently showed better prediction accuracy over alternative methods in the series of benchmark experiments including docking using actual docking interface site predictions as well as unbound docking cases.

  1. Differential effects of short- and long-term zolpidem treatment on recombinant α1β2γ2s subtype of GABAA receptors in vitro

    PubMed Central

    Vlainić, Josipa; Jembrek, Maja Jazvinšćak; Vlainić, Toni; Štrac, Dubravka Švob; Peričić, Danka

    2012-01-01

    Aim: Zolpidem is a non-benzodiazepine agonist at benzodiazepine binding site in GABAA receptors, which is increasingly prescribed. Recent studies suggest that prolonged zolpidem treatment induces tolerance. The aim of this study was to explore the adaptive changes in GABAA receptors following short and long-term exposure to zolpidem in vitro. Methods: Human embryonic kidney (HEK) 293 cells stably expressing recombinant α1β2γ2s GABAA receptors were exposed to zolpidem (1 and 10 μmol/L) for short-term (2 h daily for 1, 2, or 3 consecutive days) or long-term (continuously for 48 h). Radioligand binding studies were used to determine the parameters of [3H]flunitrazepam binding sites. Results: A single (2 h) or repeated (2 h daily for 2 or 3 d) short-term exposure to zolpidem affected neither the maximum number of [3H]flunitrazepam binding sites nor the affinity. In both control and short-term zolpidem treated groups, addition of GABA (1 nmol/L–1 mmol/L) enhanced [3H]flunitrazepam binding in a concentration-dependent manner. The maximum enhancement of [3H]flunitrazepam binding in short-term zolpidem treated group was not significantly different from that in the control group. In contrast, long-term exposure to zolpidem resulted in significantly increase in the maximum number of [3H]flunitrazepam binding sites without changing the affinity. Furthermore, long-term exposure to zolpidem significantly decreased the ability of GABA to stimulate [3H]flunitrazepam binding. Conclusion: The results suggest that continuous, but not intermittent and short-term, zolpidem-exposure is able to induce adaptive changes in GABAA receptors that could be related to the development of tolerance and dependence. PMID:22922343

  2. Ab initio study of the binding of Trichostatin A (TSA) in the active site of histone deacetylase like protein (HDLP).

    PubMed

    Vanommeslaeghe, Kenno; Van Alsenoy, Christian; De Proft, Frank; Martins, José C; Tourwé, Dirk; Geerlings, Paul

    2003-08-21

    Histone deacetylase (HDAC) inhibitors have recently attracted considerable interest because of their therapeutic potential for the treatment of cell proliferative diseases. An X-ray structure of a very potent inhibitor, Trichostatin A (TSA), bound to HDLP (an HDAC analogue isolated from Aquifex aeolicus), is available. From this structure, an active site model (322 atoms), relevant for the binding of TSA and structural analogues, has been derived, and TSA has been minimized in this active site at HF 3-21G* level. The resulting conformation is in excellent accordance with the X-ray structure, and indicates a deprotonation of the hydroxamic acid in TSA by His 131. Also, a water molecule was minimized in the active site. In addition to a similar deprotonation, in accordance with a possible catalytic mechanism of HDAC as proposed by Finnin et al. (M. S. Finnin, J. R. Donigian, A. Cohen, V. M. Richon, R. A. Rifkind and P. A. Marks, Nature, 1999, 401, 188-193), a displacement of the resulting OH- ion in the active site was observed. Based on these results, the difference in energy of binding between TSA and water was calculated. The resulting value is realistic in respect to experimental binding affinities. Furthermore, the mechanism of action of the His 131-Asp 166 charge relay system was investigated. Although the Asp residue in this motif is known to substantially increase the basicity of the His residue, no proton transfer from His 131 to Asp 166 was observed on binding of TSA or water. However, in the empty protonated active site, this proton transfer does occur.

  3. Insights into the binding behavior of native and non-native cytochromes to photosystem I from Thermosynechococcus elongatus.

    PubMed

    Kölsch, Adrian; Hejazi, Mahdi; Stieger, Kai R; Feifel, Sven C; Kern, Jan F; Müh, Frank; Lisdat, Fred; Lokstein, Heiko; Zouni, Athina

    2018-06-08

    The binding of photosystem I (PS I) from Thermosynechococcus elongatus to the native cytochrome (cyt) c 6 and cyt c from horse heart (cyt c HH ) was analyzed by oxygen consumption measurements, isothermal titration calorimetry (ITC), and rigid body docking combined with electrostatic computations of binding energies. Although PS I has a higher affinity for cyt c HH than for cyt c 6 , the influence of ionic strength and pH on binding is different in the two cases. ITC and theoretical computations revealed the existence of unspecific binding sites for cyt c HH besides one specific binding site close to P 700 Binding to PS I was found to be the same for reduced and oxidized cyt c HH Based on this information, suitable conditions for cocrystallization of cyt c HH with PS I were found, resulting in crystals with a PS I:cyt c HH ratio of 1:1. A crystal structure at 3.4-Å resolution was obtained, but cyt c HH cannot be identified in the electron density map because of unspecific binding sites and/or high flexibility at the specific binding site. Modeling the binding of cyt c 6 to PS I revealed a specific binding site where the distance and orientation of cyt c 6 relative to P 700 are comparable with cyt c 2 from purple bacteria relative to P 870 This work provides new insights into the binding modes of different cytochromes to PS I, thus facilitating steps toward solving the PS I-cyt c costructure and a more detailed understanding of natural electron transport processes.

  4. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  5. Warfarin and Flavonoids Do Not Share the Same Binding Region in Binding to the IIA Subdomain of Human Serum Albumin.

    PubMed

    Rimac, Hrvoje; Dufour, Claire; Debeljak, Željko; Zorc, Branka; Bojić, Mirza

    2017-07-11

    Human serum albumin (HSA) binds a variety of xenobiotics, including flavonoids and warfarin. The binding of another ligand to the IIA binding site on HSA can cause warfarin displacement and potentially the elevation of its free concentration in blood. Studies dealing with flavonoid-induced warfarin displacement from HSA provided controversial results: estimated risk of displacement ranged from none to serious. To resolve these controversies, in vitro study of simultaneous binding of warfarin and eight different flavonoid aglycons and glycosides to HSA was carried out by fluorescence spectroscopy as well as molecular docking. Results show that warfarin and flavonoids do not share the same binding region in binding to HSA. Interactions were only observed at high warfarin concentrations not attainable under recommended dosing regimes. Docking experiments show that flavonoid aglycons and glycosides do not bind at warfarin high affinity sites, but rather to different regions within the IIA HSA subdomain. Thus, the risk of clinically significant warfarin-flavonoid interaction in binding to HSA should be regarded as negligible.

  6. Stoichiometry of the Cre recombinase bound to the lox recombining site.

    PubMed Central

    Mack, A; Sauer, B; Abremski, K; Hoess, R

    1992-01-01

    The site-specific recombinase Cre from bacteriophage P1 binds and carries out recombination at a 34 bp lox site. The lox site consists of two 13 bp inverted repeats, separated by an 8 bp spacer region. Both the palindromic nature of the site and the results of footprinting and band shift experiments suggest that a minimum of two Cre molecules bind to a lox site. We report here experiments that demonstrate the absolute stoichiometry of the Cre-lox complex to be one molecule of Cre bound per inverted repeat, or two molecules per lox site. Images PMID:1408747

  7. Sex Differences in Serotonin 1 Receptor Binding in Rat Brain

    NASA Astrophysics Data System (ADS)

    Fischette, Christine T.; Biegon, Anat; McEwen, Bruce S.

    1983-10-01

    Male and female rats exhibit sex differences in binding by serotonin 1 receptors in discrete areas of the brain, some of which have been implicated in the control of ovulation and of gonadotropin release. The sex-specific changes in binding, which occur in response to the same hormonal (estrogenic) stimulus, are due to changes in the number of binding sites. Castration alone also affects the number of binding sites in certain areas. The results lead to the conclusion that peripheral hormones modulate binding by serotonin 1 receptors. The status of the serotonin receptor system may affect the reproductive capacity of an organism and may be related to sex-linked emotional disturbances in humans.

  8. The Receptor-Binding Site of the Measles Virus Hemagglutinin Protein Itself Constitutes a Conserved Neutralizing Epitope

    PubMed Central

    Ohno, Shinji; Sakai, Kouji; Ito, Yuri; Fukuhara, Hideo; Komase, Katsuhiro; Brindley, Melinda A.; Rota, Paul A.; Plemper, Richard K.; Maenaka, Katsumi; Takeda, Makoto

    2013-01-01

    Here, we provide direct evidence that the receptor-binding site of measles virus (MV) hemagglutinin protein itself forms an effective conserved neutralizing epitope (CNE). Several receptor-interacting residues constitute the CNE. Thus, viral escape from neutralization has to be associated with loss of receptor-binding activity. Since interactions with both the signaling lymphocyte activation molecule (SLAM) and nectin4 are critical for MV pathogenesis, its escape, which results from loss of receptor-binding activity, should not occur in nature. PMID:23283964

  9. An Inductive Logic Programming Approach to Validate Hexose Binding Biochemical Knowledge.

    PubMed

    Nassif, Houssam; Al-Ali, Hassan; Khuri, Sawsan; Keirouz, Walid; Page, David

    2010-01-01

    Hexoses are simple sugars that play a key role in many cellular pathways, and in the regulation of development and disease mechanisms. Current protein-sugar computational models are based, at least partially, on prior biochemical findings and knowledge. They incorporate different parts of these findings in predictive black-box models. We investigate the empirical support for biochemical findings by comparing Inductive Logic Programming (ILP) induced rules to actual biochemical results. We mine the Protein Data Bank for a representative data set of hexose binding sites, non-hexose binding sites and surface grooves. We build an ILP model of hexose-binding sites and evaluate our results against several baseline machine learning classifiers. Our method achieves an accuracy similar to that of other black-box classifiers while providing insight into the discriminating process. In addition, it confirms wet-lab findings and reveals a previously unreported Trp-Glu amino acids dependency.

  10. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    PubMed

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  11. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  12. Modulation of enrofloxacin binding in OmpF by Mg2+ as revealed by the analysis of fast flickering single-porin current

    PubMed Central

    Brauser, Annemarie; Schroeder, Indra; Gutsmann, Thomas; Cosentino, Cristian; Moroni, Anna; Winterhalter, Mathias

    2012-01-01

    One major determinant of the efficacy of antibiotics on Gram-negative bacteria is the passage through the outer membrane. During transport of the fluoroquinolone enrofloxacin through the trimeric outer membrane protein OmpF of Escherichia coli, the antibiotic interacts with two binding sites within the pore, thus partially blocking the ionic current. The modulation of one affinity site by Mg2+ reveals further details of binding sites and binding kinetics. At positive membrane potentials, the slow blocking events induced by enrofloxacin in Mg2+-free media are converted to flickery sojourns at the highest apparent current level (all three pores flickering). This indicates weaker binding in the presence of Mg2+. Analysis of the resulting amplitude histograms with β distributions revealed the rate constants of blocking (kOB) and unblocking (kBO) in the range of 1,000 to 120,000 s−1. As expected for a bimolecular reaction, kOB was proportional to blocker concentration and kBO independent of it. kOB was approximately three times lower for enrofloxacin coming from the cis side than from the trans side. The block was not complete, leading to a residual conductivity of the blocked state being ∼25% of that of the open state. Interpretation of the results has led to the following model: fast flickering as caused by interaction of Mg2+ and enrofloxacin is related to the binding site at the trans side, whereas the cis site mediates slow blocking events which are also found without Mg2+. The difference in the accessibility of the binding sites also explains the dependency of kOB on the side of enrofloxacin addition and yields a means of determining the most plausible orientation of OmpF in the bilayer. The voltage dependence suggests that the dipole of the antibiotic has to be adequately oriented to facilitate binding. PMID:22689827

  13. Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

    PubMed Central

    Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

    2011-01-01

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

  14. Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

    PubMed

    Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

    2011-01-14

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

  15. Step-By-Step In Vitro Mutagenesis: Lessons From Fucose-Binding Lectin PA-IIL.

    PubMed

    Mrázková, Jana; Malinovská, Lenka; Wimmerová, Michaela

    2017-01-01

    Site-directed mutagenesis is a powerful technique which is used to understand the basis of interactions between proteins and their binding partners, as well as to modify these interactions. Methods of rational design that are based on detailed knowledge of the structure of a protein of interest are often used for preliminary investigations of the possible outcomes which can result from the practical application of site-directed mutagenesis. Also, random mutagenesis can be used in tandem with site-directed mutagenesis for an examination of amino acid "hotspots."Lectins are sugar-binding proteins which, among other functions, mediate the recognition of host cells by a pathogen and its adhesion to the host cell surface. Hence, lectins and their binding properties are studied and engineered using site-directed mutagenesis.In this chapter, we describe a site-directed mutagenesis method used for investigating the sugar binding pattern of the PA-IIL lectin from the pathogenic bacterium Pseudomonas aeruginosa. Moreover, procedures for the production and purification of PA-IIL mutants are described, and several basic methods for characterizing the mutants are discussed.

  16. Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III.

    PubMed

    Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok

    2011-02-01

    RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Recognition of AT-Rich DNA Binding Sites by the MogR Repressor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shen, Aimee; Higgins, Darren E.; Panne, Daniel

    2009-07-22

    The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity.more » The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.« less

  18. Expression of Ulex europaeus agglutinin I lectin-binding sites in squamous cell carcinomas and their absence in basal cell carcinomas. Indicator of tumor type and differentiation.

    PubMed

    Heng, M C; Fallon-Friedlander, S; Bennett, R

    1992-06-01

    Lectins bind tightly to carbohydrate moieties on cell surfaces. Alterations in lectin binding have been reported to accompany epidermal cell differentiation, marking alterations in membrane sugars during this process. The presence of UEA I (Ulex europaeus agglutinin I) L-fucose-specific lectin-binding sites has been used as a marker for terminally differentiated (committed) keratinocytes. In this article, we report the presence of UEA-I-binding sites on squamous keratinocytes of well-differentiated squamous cell carcinomas, with patchy loss of UEA I positivity on poorly differentiated cells of squamous cell carcinomas, suggesting a possible use for this technique in the rapid assessment of less differentiated areas within the squamous cell tumor. The absence of UEA-I-binding sites on basal cell carcinomas may be related to an inability of cells comprising this tumor to convert the L-D-pyranosyl moiety on basal cells to the L-fucose moiety, resulting in an inability of basal cell carcinoma cell to undergo terminal differentiation into a committed keratinocyte.

  19. A molecular dynamics simulation study of the association of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate enantiomers with a chiral molecular micelle

    NASA Astrophysics Data System (ADS)

    Morris, Kevin F.; Billiot, Eugene J.; Billiot, Fereshteh H.; Gladis, Ashley A.; Lipkowitz, Kenny B.; Southerland, William M.; Fang, Yayin

    2014-08-01

    Molecular dynamics (MD) simulations were used to investigate the binding of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate (BNP) enantiomers to the molecular micelle poly-(sodium undecyl-(L,L)-leucine-valine) (poly(SULV)). Poly(SULV) is used as a chiral selector in capillary electrophoresis separations. Four poly(SULV) binding pockets were identified and either (R)-BNP or (S)-BNP were docked into each pocket. MD simulations were then used to identify the preferred BNP binding site. Within the preferred site, both enantiomers formed hydrogen bonds with poly(SULV) and penetrated into the poly(SULV) core. Comparisons of BNP enantiomer binding to the preferred poly(SULV) pocket showed that (S)-BNP formed stronger hydrogen bonds, moved deeper into the binding site, and had a lower poly(SULV) binding free energy than the (R) enantiomer. Finally, MD simulation results were in agreement with capillary electrophoresis and NMR experiments. Each technique showed (S)-BNP interacted more strongly with poly(SULV) than (R)-BNP and that the site of chiral recognition was near the poly(SULV) leucine chiral center.

  20. Binding-Site Assessment by Virtual Fragment Screening

    PubMed Central

    Huang, Niu; Jacobson, Matthew P.

    2010-01-01

    The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules) would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock ∼11000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors. PMID:20404926

  1. Modulation of the NMDA receptor by polyamines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, K.; Romano, C.; Dichter, M.A.

    1991-01-01

    Results of recent biochemical and electrophysiological studies have suggested that a recognition site for polyamines exists as part of the NMDA receptor complex. The endogenous polyamines spermine and spermidine increase the binding of open-channel blockers and increase NMDA-elicited currents in cultured neutrons. These polyamines have been termed agonists at the polyamine recognition site. Studies of the effects of natural and synthetic polyamines on the binding of ({sup 3}H)MK-801 and on NMDA-elicited currents in cultured neurons have led to the identification of compounds classified as partial agonists, antagonists, and inverse agonists at the polyamine recognition site. Polyamines have also been foundmore » to affect the binding of ligands to the recognition sites for glutamate and glycine. However, these effects may be mediated at a site distinct from that at which polyamines act to modulate the binding of open-channel blockers. Endogenous polyamines may modulate excitatory synaptic transmission by acting at the polyamine recognition site of the NMDA receptor. This site could represent a novel therapeutic target for the treatment of ischemia-induced neurotoxicity, epilepsy, and neurodegenerative diseases.« less

  2. Understanding the in vivo uptake kinetics of a phosphatidylethanolamine-binding agent 99mTc-Duramycin

    PubMed Central

    Audi, Said; Li, Zhixin; Capacete, Joseph; Liu, Yu; Fang, Wei; Shu, Laura G.; Zhao, Ming

    2013-01-01

    Introduction 99mTc-Duramycin is a peptide-based molecular probe that binds specifically to phosphatidylethanolamine (PE). The goal was to characterize the kinetics of molecular interactions between 99mTc-Duramycin and the target tissue. Methods High level of accessible PE is induced in cardiac tissues by myocardial ischemia (30 min) and reperfusion (120 min) in Sprague Dawley rats. Target binding and biodistribution of 99mTc-duramycin was captured using SPECT/CT. To quantify the binding kinetics, the presence of radioactivity in ischemic versus normal cardiac tissues was measured by gamma counting at 3, 10, 20, 60 and 180 min after injection. A partially inactivated form of 99mTc-Duramycin was analyzed in the same fashion. A compartment model was developed to quantify the uptake kinetics of 99mTc-Duramycin in normal and ischemic myocardial tissue. Results 99mTc-duramycin binds avidly to the damaged tissue with a high target-to-background radio. Compartment modeling shows that accessibility of binding sites in myocardial tissue to 99mTc-Duramycin is not a limiting factor and the rate constant of target binding in the target tissue is at 2.2 ml/nmol/min/g. The number of available binding sites for 99mTc-Duramycin in ischemic myocardium was estimated at 0.14 nmol/g. Covalent modification of D15 resulted in a 9 fold reduction in binding affinity. Conclusion 99mTc-Duramycin accumulates avidly in target tissues in a PE-dependent fashion. Model results reflect an efficient uptake mechanism, consistent with the low molecular weight of the radiopharmaceutical and the relatively high density of available binding sites. These data help better define the imaging utilities of 99mTc-Duramycin as a novel PE-binding agent. PMID:22534031

  3. Structures of Receptor Complexes of a North American H7N2 Influenza Hemagglutinin with a Loop Deletion in the Receptor Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Hua; Chen, Li-Mei; Carney, Paul J.

    2012-02-21

    Human infections with subtype H7 avian influenza viruses have been reported as early as 1979. In 1996, a genetically stable 24-nucleotide deletion emerged in North American H7 influenza virus hemagglutinins, resulting in an eight amino acid deletion in the receptor-binding site. The continuous circulation of these viruses in live bird markets, as well as its documented ability to infect humans, raises the question of how these viruses achieve structural stability and functionality. Here we report a detailed molecular analysis of the receptor binding site of the North American lineage subtype H7N2 virus A/New York/107/2003 (NY107), including complexes with an avianmore » receptor analog (3'-sialyl-N-acetyllactosamine, 3'SLN) and two human receptor analogs (6'-sialyl-N-acetyllactosamine, 6'SLN; sialyllacto-N-tetraose b, LSTb). Structural results suggest a novel mechanism by which residues Arg220 and Arg229 (H3 numbering) are used to compensate for the deletion of the 220-loop and form interactions with the receptor analogs. Glycan microarray results reveal that NY107 maintains an avian-type ({alpha}2-3) receptor binding profile, with only moderate binding to human-type ({alpha}2-6) receptor. Thus despite its dramatically altered receptor binding site, this HA maintains functionality and confirms a need for continued influenza virus surveillance of avian and other animal reservoirs to define their zoonotic potential.« less

  4. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  5. Exploration of gated ligand binding recognizes an allosteric site for blocking FABP4-protein interaction.

    PubMed

    Li, Yan; Li, Xiang; Dong, Zigang

    2015-12-28

    Fatty acid binding protein 4 (FABP4), reversibly binding to fatty acids and other lipids with high affinities, is a potential target for treatment of cancers. The binding site of FABP4 is buried in an interior cavity and thereby ligand binding/unbinding is coupled with opening/closing of FABP4. It is a difficult task both experimentally and computationally to illuminate the entry or exit pathway, especially with the conformational gating. In this report we combine extensive computer simulations, clustering analysis, and the Markov state model to investigate the binding mechanism of FABP4 and troglitazone. Our simulations capture spontaneous binding and unbinding events as well as the conformational transition of FABP4 between the open and closed states. An allosteric binding site on the protein surface is recognized for the development of novel FABP4 inhibitors. The binding affinity is calculated and compared with the experimental value. The kinetic analysis suggests that ligand residence on the protein surface may delay the binding process. Overall, our results provide a comprehensive picture of ligand diffusion on the protein surface, ligand migration into the buried cavity, and the conformational change of FABP4 at an atomic level.

  6. Equivalence of two approaches for modeling ion permeation through a transmembrane channel with an internal binding site

    NASA Astrophysics Data System (ADS)

    Zhou, Huan-Xiang

    2011-04-01

    Ion permeation through transmembrane channels has traditionally been modeled using two different approaches. In one approach, the translocation of the permeant ion through the channel pore is modeled as continuous diffusion and the rate of ion transport is obtained from solving the steady-state diffusion equation. In the other approach, the translocation of the permeant ion through the pore is modeled as hopping along a discrete set of internal binding sites and the rate of ion transport is obtained from solving a set of steady-state rate equations. In a recent work [Zhou, J. Phys. Chem. Lett. 1, 1973 (2010)], the rate constants for binding to an internal site were further calculated by modeling binding as diffusion-influenced reactions. That work provided the foundation for bridging the two approaches. Here we show that, by representing a binding site as an energy well, the two approaches indeed give the same result for the rate of ion transport.

  7. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  8. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  9. Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

    2011-07-29

    Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

  10. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  11. p65 fragments, homologous to the C2 region of protein kinase C, bind to the intracellular receptors for protein kinase C.

    PubMed

    Mochly-Rosen, D; Miller, K G; Scheller, R H; Khaner, H; Lopez, J; Smith, B L

    1992-09-08

    Receptors for activated protein kinase C (RACKs) have been isolated from the particulate cell fraction of heart and brain. We previously demonstrated that binding of protein kinase C (PKC) to RACKs requires PKC activators and is via a site on PKC that is distinct from the substrate binding site. Here, we examine the possibility that the C2 region in the regulatory domain of PKC is involved in binding of PKC to RACKs. The synaptic vesicle-specific p65 protein contains two regions homologous to the C2 region of PKC. We found that three p65 fragments, containing either one or two of these PKC C2 homologous regions, bound to highly purified RACKs. Binding of the p65 fragments and PKC to RACKs was mutually exclusive; preincubation of RACKs with the p65 fragments inhibited PKC binding, and preincubation of RACKs with PKC inhibited binding of the p65 fragments. Preincubation of the p65 fragments with a peptide resembling the PKC binding site on RACKs also inhibited p65 binding to RACKs, suggesting that PKC and p65 bind to the same or nearby regions on RACKs. Since the only homologous region between PKC and the p65 fragments is the C2 region, these results suggest that the C2 region on PKC contains at least part of the RACK binding site.

  12. aPPRove: An HMM-Based Method for Accurate Prediction of RNA-Pentatricopeptide Repeat Protein Binding Events

    PubMed Central

    Harrison, Thomas; Ruiz, Jaime; Sloan, Daniel B.; Ben-Hur, Asa; Boucher, Christina

    2016-01-01

    Pentatricopeptide repeat containing proteins (PPRs) bind to RNA transcripts originating from mitochondria and plastids. There are two classes of PPR proteins. The P class contains tandem P-type motif sequences, and the PLS class contains alternating P, L and S type sequences. In this paper, we describe a novel tool that predicts PPR-RNA interaction; specifically, our method, which we call aPPRove, determines where and how a PLS-class PPR protein will bind to RNA when given a PPR and one or more RNA transcripts by using a combinatorial binding code for site specificity proposed by Barkan et al. Our results demonstrate that aPPRove successfully locates how and where a PPR protein belonging to the PLS class can bind to RNA. For each binding event it outputs the binding site, the amino-acid-nucleotide interaction, and its statistical significance. Furthermore, we show that our method can be used to predict binding events for PLS-class proteins using a known edit site and the statistical significance of aligning the PPR protein to that site. In particular, we use our method to make a conjecture regarding an interaction between CLB19 and the second intronic region of ycf3. The aPPRove web server can be found at www.cs.colostate.edu/~approve. PMID:27560805

  13. Regulation of Hippocampal Glutamate Receptors: Evidence for the Involvement of a Calcium-Activated Protease

    NASA Astrophysics Data System (ADS)

    Baudry, Michel; Lynch, Gary

    1980-04-01

    Specific [3H]glutamate binding to rat hippocampal membranes and the calcium-induced increase in this binding are markedly temperature-sensitive and are inhibited by alkylating or reducing agents as well as by various protease inhibitors. N-Ethylmaleimide, chloromethyl ketone derivatives of lysine and phenylalanine, and tosylarginine methyl ester decrease the maximum number of [3H]glutamate binding sites without changing their affinity for glutamate. Preincubation of the membranes with glutamate does not protect the glutamate ``receptors'' from the suppressive effects of these agents. The proteases trypsin and α -chymotrypsin increase the maximum number of [3H]glutamate binding sites. The effects of calcium on glutamate binding are different across brain regions. Cerebellar membranes are almost insensitive whereas hippocampal and striatal membranes exhibit a strong increase in the number of binding sites after exposure to even low concentrations of calcium. These results suggest that an endogenous membrane-associated thiol protease regulates the number of [3H]glutamate binding sites in hippocampal membranes and that this is the mechanism by which calcium stimulates glutamate binding. The possibility is discussed that the postulated mechanisms participate in synaptic physiology and in particular may be related to the long-term potentiation of transmission found in hippocampus under certain conditions.

  14. Control of Ion Selectivity in LeuT: Two Na+ Binding Sites with two different mechanisms

    PubMed Central

    Noskov, Sergei Y.; Roux, Benoît

    2016-01-01

    The x-ray structure of LeuT, a bacterial homologue of Na+/Cl−-dependent neurotransmitter transporter, provides a great opportunity to better understand the molecular basis of monovalent cation selectivity in ion-coupled transporters. LeuT possesses two ion-binding sites, NA1 and NA2, which are highly selective for Na+. Extensive all-atom free energy molecular dynamics simulations of LeuT embedded in an explicit membrane are performed at different temperatures and various occupancy states of the binding sites to dissect the molecular mechanism of ion selectivity. The results show that the two binding sites display robust selectivity for Na+ over K+ or Li+, the competing ions of most similar radii. Of particular interest, the mechanism primarily responsible for selectivity for each of the two binding sites appears to be different. In site NA1, selectivity for Na+ over K+ arises predominantly from the strong electrostatic field arising from the negatively charged carboxylate group of the leucine substrate coordinating the ion directly. In site NA2, which comprises only neutral ligands, selectivity for Na+ is enforced by the local structural restraints arising from the hydrogen-bonding network and the covalent connectivity of the poly-peptide chain surrounding the ion according to a snug-fit mechanism. PMID:18280500

  15. Cd and proton adsorption onto bacterial consortia grown from industrial wastes and contaminated geologic settings.

    PubMed

    Borrok, David M; Fein, Jeremy B; Kulpa, Charles F

    2004-11-01

    To model the effects of bacterial metal adsorption in contaminated environments, results from metal adsorption experiments involving individual pure stains of bacteria must be extrapolated to systems in which potentially dozens of bacterial species are present. This extrapolation may be made easier because bacterial consortia from natural environments appear to exhibit similar metal binding properties. However, bacteria that thrive in highly perturbed contaminated environments may exhibit significantly different adsorptive behavior. Here we measure proton and Cd adsorption onto a range of bacterial consortia grown from heavily contaminated industrial wastes, groundwater, and soils. We model the results using a discrete site surface complexation approach to determine binding constants and site densities for each consortium. The results demonstrate that bacterial consortia from different contaminated environments exhibit a range of total site densities (approximately a 3-fold difference) and Cd-binding constants (approximately a 10-fold difference). These ranges for Cd binding constants may be small enough to suggest that bacteria-metal adsorption in contaminated environments can be described using relatively few "averaged" bacteria-metal binding constants (in conjunction with the necessary binding constants for competing surfaces and ligands). However, if additional precision is necessary, modeling parameters must be developed separately for each contaminated environment of interest.

  16. Competitive binding of (-)-epigallocatechin-3-gallate and 5-fluorouracil to human serum albumin: A fluorescence and circular dichroism study

    NASA Astrophysics Data System (ADS)

    Yuan, Lixia; Liu, Min; Liu, Guiqin; Li, Dacheng; Wang, Zhengping; Wang, Bingquan; Han, Jun; Zhang, Min

    2017-02-01

    Combination therapy with more than one therapeutic agent can improve therapeutic efficiency and decrease drug resistance. In this study, the interactions of human serum albumin (HSA) with individual or combined anticancer drugs, (-)-epigallocatechin-3-gallate (EGCG) and 5-fluorouracil (FU), were investigated by fluorescence and circular dichroism (CD) spectroscopy. The results demonstrated that the interaction of EGCG or FU with HSA is a process of static quenching and EGCG formed a more stable complex. The competitive experiments of site markers suggested that both anti-carcinogens mainly bound to site I (subdomain IIA). The interaction forces which play important roles in the binding process were discussed based on enthalpy and entropy changes. Moreover, the competition binding model for a ternary system was proposed so as to precisely calculate the binding parameters. The results demonstrated that one drug decreased the binding affinity of another drug with HSA, resulting in the increasing free drug concentration at the action sites. CD studies indicated that there was an alteration in HSA secondary structure due to the binding of EGCG and FU. It can be concluded that the combination of EGCG with FU may enhance anticancer efficacy. This finding may provide a theoretical basis for clinical treatments.

  17. SKF 525-A and cytochrome P-450 ligands inhibit with high affinity the binding of ( sup 3 H)dextromethorphan and. sigma. ligands to guinea pig brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Klein, M.; Canoll, P.D.; Musacchio, J.M.

    1991-01-01

    The DM{sub 1}/{sigma}{sub 1} site binds dextromethorphan (DM) and {sigma} receptor ligands. The broad binding specificity of this site and its peculiar subcellular distribution prompted us to explore the possibility that this site is a member of the cytochrome P-450 superfamily of enzymes. We tested the effects of the liver microsomal monooxygenase inhibitor SKF 525-A (Proadifen), and other P-450 substrates on the binding of ({sup 3}H)dextromethorphan, ({sup 3}H)3- (3-Hydroxyphenyl) -N- (1-propyl) piperidine and (+)-({sup 3}H)1,3-Di-o-tolyl-guanidine (({sup 3}H)DTG) to the guinea pig brain. SKF 525-A, l-lobeline and GBR-12909 inhibited the binding of the three labeled ligands with nM affinity. Each drugmore » has identical nM K{sub i} values for the high-affinity site labeled by the three ligands. This indicated that they displaced the labeled ligands from the common DM{sub 1}{sigma}{sub 1} site. Debrisoquine and sparteine, prototypical substrates for liver debrisoquine 4-hydroxylase, displayed K{sub i} values of 9-13 and 3-4 {mu}M respectively against the three labeled ligands. These results, the broad specificity of the DM{sub 1}/{sigma}{sub 1} binding site, and its peculiar subcellular distribution, raises the possibility that this binding site is a member of the cytochrome P-450 superfamily of isozymes, rather than a neurotransmitter receptor.« less

  18. Use of 2-(/sup 125/I)iodomelatonin to characterize melatonin binding sites in chicken retina

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dubocovich, M.L.; Takahashi, J.S.

    2-(/sup 125/I)Iodomelatonin binds with high affinity to a site possessing the pharmacological characteristics of a melatonin receptor in chicken retinal membranes. The specific binding of 2-(/sup 125/I)iodomelatonin is stable, saturable, and reversible. Saturation experiments indicated that 2-(/sup 125/I)iodomelatonin labeled a single class of sites with an affinity constant (Kd) of 434 +/- 56 pM and a total number of binding sites (Bmax) of 74.0 +/- 13.6 fmol/mg of protein. The affinity constant obtained from kinetic analysis was in close agreement with that obtained in saturation experiments. Competition experiments showed a monophasic reduction of 2-(/sup 125/I)iodomelatonin binding with a pharmacological ordermore » of indole amine affinities characteristic of a melatonin receptor: 2-iodomelatonin greater than 6-chloromelatonin greater than or equal to melatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 6-hydroxymelatonin greater than or equal to 6-methoxymelatonin much greater than N-acetyltryptamine greater than N-acetyl-5-hydroxytryptamine greater than 5-methoxytryptamine greater than 5-hydroxytryptamine (inactive). The affinities of these melatonin analogs in competing for 2-(/sup 125/I)iodomelatonin binding sites were correlated closely with their potencies for inhibition of the calcium-dependent release of (3H)dopamine from chicken and rabbit retinas, indicating association of the binding site with a functional response regulated by melatonin. The results indicate that 2-(/sup 125/I)iodomelatonin is a selective, high-affinity radioligand for the identification and characterization of melatonin receptor sites.« less

  19. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

    2004-08-06

    The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

  20. Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

    PubMed

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-07-01

    The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

  1. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  2. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  3. Prediction of Ordered Water Molecules in Protein Binding Sites from Molecular Dynamics Simulations: The Impact of Ligand Binding on Hydration Networks.

    PubMed

    Rudling, Axel; Orro, Adolfo; Carlsson, Jens

    2018-02-26

    Water plays a major role in ligand binding and is attracting increasing attention in structure-based drug design. Water molecules can make large contributions to binding affinity by bridging protein-ligand interactions or by being displaced upon complex formation, but these phenomena are challenging to model at the molecular level. Herein, networks of ordered water molecules in protein binding sites were analyzed by clustering of molecular dynamics (MD) simulation trajectories. Locations of ordered waters (hydration sites) were first identified from simulations of high resolution crystal structures of 13 protein-ligand complexes. The MD-derived hydration sites reproduced 73% of the binding site water molecules observed in the crystal structures. If the simulations were repeated without the cocrystallized ligands, a majority (58%) of the crystal waters in the binding sites were still predicted. In addition, comparison of the hydration sites obtained from simulations carried out in the absence of ligands to those identified for the complexes revealed that the networks of ordered water molecules were preserved to a large extent, suggesting that the locations of waters in a protein-ligand interface are mainly dictated by the protein. Analysis of >1000 crystal structures showed that hydration sites bridged protein-ligand interactions in complexes with different ligands, and those with high MD-derived occupancies were more likely to correspond to experimentally observed ordered water molecules. The results demonstrate that ordered water molecules relevant for modeling of protein-ligand complexes can be identified from MD simulations. Our findings could contribute to development of improved methods for structure-based virtual screening and lead optimization.

  4. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

    PubMed Central

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-01-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  5. Toxic shock syndrome toxin 1 binds to major histocompatibility complex class II molecules.

    PubMed Central

    Scholl, P; Diez, A; Mourad, W; Parsonnet, J; Geha, R S; Chatila, T

    1989-01-01

    Toxic shock syndrome toxin 1 (TSST-1) is a 22-kDa exotoxin produced by strains of Staphylococcus aureus and implicated in the pathogenesis of toxic shock syndrome. In common with other staphylococcal exotoxins, TSST-1 has diverse immunological effects. These include the induction of interleukin 2 receptor expression, interleukin 2 synthesis, proliferation of human T lymphocytes, and stimulation of interleukin 1 synthesis by human monocytes. In the present study, we demonstrate that TSST-1 binds with saturation kinetics and with a dissociation constant of 17-43 nM to a single class of binding sites on human mononuclear cells. There was a strong correlation between the number of TSST-1 binding sites and the expression of major histocompatibility complex class II molecules, and interferon-gamma induced the expression of class II molecules as well as TSST-1 binding sites on human skin-derived fibroblasts. Monoclonal antibodies to HLA-DR, but not to HLA-DP or HLA-DQ, strongly inhibited TSST-1 binding. Affinity chromatography of 125I-labeled cell membranes over TSST-1-agarose resulted in the recovery of two bands of 35 kDa and 31 kDa that comigrated, respectively, with the alpha and beta chains of HLA-DR and that could be immunoprecipitated with anti-HLA-DR monoclonal antibodies. Binding of TSST-1 was demonstrated to HLA-DR and HLA-DQ L-cell transfectants. These results indicate that major histocompatibility complex class II molecules represent the major binding site for TSST-1 on human cells. Images PMID:2542966

  6. Identification of the Catalytic Ubiquinone-binding Site of Vibrio cholerae Sodium-dependent NADH Dehydrogenase

    PubMed Central

    Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar

    2017-01-01

    The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088

  7. Multi-spectroscopic and molecular modeling approaches to elucidate the binding interaction between bovine serum albumin and darunavir, a HIV protease inhibitor

    NASA Astrophysics Data System (ADS)

    Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

    2018-01-01

    Darunavir (DRV), a second-generation HIV protease inhibitor, is widely used across the world as an important component of HIV therapy. The interaction of DRV with bovine serum albumin (BSA), a major carrier protein, has been studied under simulated physiological conditions (pH 7.4) by multi-spectroscopic techniques in combination with molecular modeling. Fluorescence data revealed that the intrinsic fluorescence of BSA was quenched by DRV in terms of a static quenching procedure due to the formation of the DRV-BSA complex. The results indicated the presence of single weak affinity binding site ( 103 M- 1, 310 K) on protein. The thermodynamic parameters, namely enthalpy change (ΔH0), entropy change (ΔS0) and Gibbs free energy change (ΔG0) were calculated, which signified that the binding reaction was spontaneous, the main binding forces were hydrogen bonding and van der Waals forces. Importantly, competitive binding experiments with three site probes, phenylbutazone (in sub-domain IIA, site I), ibuprofen (in sub-domain IIIA, site II) and artemether (in the interface between sub-domain IIA and IIB, site II'), suggested that DRV was preferentially bound to the hydrophobic cavity in site II' of BSA, and this finding was validated by the docking results. Additionally, synchronous fluorescence, three-dimensional fluorescence and Resonance Rayleigh Scattering (RRS) spectroscopy gave qualitative information on the conformational changes of BSA upon adding DRV, while quantitative data were obtained with Fourier transform infrared spectroscopy (FT-IR).

  8. Evidence for in vivo phosphorylation of the Grb2 SH2-domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases.

    PubMed

    Schlaepfer, D D; Hunter, T

    1996-10-01

    Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.

  9. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  10. HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

    PubMed Central

    Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

    1996-01-01

    HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

  11. Botulinum neurotoxin serotype C associates with dual ganglioside receptors to facilitate cell entry.

    PubMed

    Karalewitz, Andrew P-A; Fu, Zhuji; Baldwin, Michael R; Kim, Jung-Ja P; Barbieri, Joseph T

    2012-11-23

    How botulinum neurotoxin serotype C (BoNT/C) enters neurons is unclear. BoNT/C utilizes dual gangliosides as host cell receptors. BoNT/C accesses gangliosides on the plasma membrane. Plasma membrane accessibility of the dual ganglioside receptors suggests synaptic vesicle exocytosis may not be necessary to expose BoNT/C receptors. Botulinum neurotoxins (BoNTs) cleave SNARE proteins in motor neurons that inhibits synaptic vesicle (SV) exocytosis, resulting in flaccid paralysis. There are seven BoNT serotypes (A-G). In current models, BoNTs initially bind gangliosides on resting neurons and upon SV exocytosis associate with the luminal domains of SV-associated proteins as a second receptor. The entry of BoNT/C is less clear. Characterizing the heavy chain receptor binding domain (HCR), BoNT/C was shown to utilize gangliosides as dual host receptors. Crystallographic and biochemical studies showed that the two ganglioside binding sites, termed GBP2 and Sia-1, were independent and utilized unique mechanisms to bind complex gangliosides. The GBP2 binding site recognized gangliosides that contained a sia5 sialic acid, whereas the Sia-1 binding site recognized gangliosides that contained a sia7 sialic acid and sugars within the backbone of the ganglioside. Utilizing gangliosides that uniquely recognized the GBP2 and Sia-1 binding sites, HCR/C entry into Neuro-2A cells required both functional ganglioside binding sites. HCR/C entered cells differently than the HCR of tetanus toxin, which also utilizes dual gangliosides as host receptors. A point-mutated HCR/C that lacked GBP2 binding potential retained the ability to bind and enter Neuro-2A cells. This showed that ganglioside binding at the Sia-1 site was accessible on the plasma membrane, suggesting that SV exocytosis may not be required to expose BoNT/C receptors. These studies highlight the utility of BoNT HCRs as probes to study the role of gangliosides in neurotransmission.

  12. Heat Capacity Changes and Disorder-to-Order Transitions in Allosteric Activation.

    PubMed

    Cressman, William J; Beckett, Dorothy

    2016-01-19

    Allosteric coupling in proteins is ubiquitous but incompletely understood, particularly in systems characterized by coupling over large distances. Binding of the allosteric effector, bio-5'-AMP, to the Escherichia coli biotin protein ligase, BirA, enhances the protein's dimerization free energy by -4 kcal/mol. Previous studies revealed that disorder-to-order transitions at the effector binding and dimerization sites, which are separated by 33 Å, are integral to functional coupling. Perturbations to the transition at the ligand binding site alter both ligand binding and coupled dimerization. Alanine substitutions in four loops on the dimerization surface yield a range of energetic effects on dimerization. A glycine to alanine substitution at position 142 in one of these loops results in a complete loss of allosteric coupling, disruption of the disorder-to-order transitions at both functional sites, and a decreased affinity for the effector. In this work, allosteric communication between the effector binding and dimerization surfaces in BirA was further investigated by performing isothermal titration calorimetry measurements on nine proteins with alanine substitutions in three dimerization surface loops. In contrast to BirAG142A, at 20 °C all variants bind to bio-5'-AMP with free energies indistinguishable from that measured for wild-type BirA. However, the majority of the variants exhibit altered heat capacity changes for effector binding. Moreover, the ΔCp values correlate with the dimerization free energies of the effector-bound proteins. These thermodynamic results, combined with structural information, indicate that allosteric activation of the BirA monomer involves formation of a network of intramolecular interactions on the dimerization surface in response to bio-5'-AMP binding at the distant effector binding site.

  13. CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

    PubMed Central

    Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

    2011-01-01

    The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

  14. Thermodynamic modeling of donor splice site recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Garland, Jeffrey A.; Aalberts, Daniel P.

    2004-04-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 small nuclear RNA with the donor ( 5' ) splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our “finding with binding” method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  15. Aging, estradiol and time of day differentially affect serotonin transporter binding in the central nervous system of female rats.

    PubMed

    Krajnak, Kristine; Rosewell, Katherine L; Duncan, Marilyn J; Wise, Phyllis M

    2003-11-14

    Estrogen-related changes in serotonergic neuronal transmission, including changes in the number of serotonin transporter (SERT) binding sites, have been cited as a possible cause for changes in mood, memory and sleep that occur during the menopausal transition. However, both aging and estradiol regulate SERT binding sites in the brain. The goal of this experiment was to determine how aging and estrogen interact to regulate SERT levels in the forebrain of young and reproductively senescent female Sprague-Dawley rats using [3H]paroxetine. The density of specific [3H]paroxetine binding in various brain regions was compared in young (2-4 months) and reproductively senescent (10-12 months) female rats at three times of day. In most brain regions examined, estrogen and aging independently increased the number of [3H]paroxetine binding sites. The only region that displayed a reduction in [3H]paroxetine binding with age was the suprachiasmatic nucleus (SCN). Time of day influenced [3H]paroxetine binding in the SCN and the paraventricular thalamus (PVT), two regions known to be involved in the regulation of circadian rhythms. Aging and/or estrogen also altered the pattern of binding in these regions. Thus, based on the results of this study, we conclude that aging and estrogen both act to regulate SERT binding sites in the forebrain of female rats, and that this regulation is region specific.

  16. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  17. Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1.

    PubMed

    Malina, Jaroslav; Scott, Peter; Brabec, Viktor

    2015-06-23

    Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo-helical 'flexicate' complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3](4+) incorporating the common NN-NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo-helical complexes for cancer chemotherapy. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Complex Structure and Biochemical Characterization of the Staphylococcus aureus Cyclic Diadenylate Monophosphate (c-di-AMP)-binding Protein PstA, the Founding Member of a New Signal Transduction Protein Family*

    PubMed Central

    Campeotto, Ivan; Zhang, Yong; Mladenov, Miroslav G.; Freemont, Paul S.; Gründling, Angelika

    2015-01-01

    Signaling nucleotides are integral parts of signal transduction systems allowing bacteria to cope with and rapidly respond to changes in the environment. The Staphylococcus aureus PII-like signal transduction protein PstA was recently identified as a cyclic diadenylate monophosphate (c-di-AMP)-binding protein. Here, we present the crystal structures of the apo- and c-di-AMP-bound PstA protein, which is trimeric in solution as well as in the crystals. The structures combined with detailed bioinformatics analysis revealed that the protein belongs to a new family of proteins with a similar core fold but with distinct features to classical PII proteins, which usually function in nitrogen metabolism pathways in bacteria. The complex structure revealed three identical c-di-AMP-binding sites per trimer with each binding site at a monomer-monomer interface. Although distinctly different from other cyclic-di-nucleotide-binding sites, as the half-binding sites are not symmetrical, the complex structure also highlighted common features for c-di-AMP-binding sites. A comparison between the apo and complex structures revealed a series of conformational changes that result in the ordering of two anti-parallel β-strands that protrude from each monomer and allowed us to propose a mechanism on how the PstA protein functions as a signaling transduction protein. PMID:25505271

  19. Systematic optimization model and algorithm for binding sequence selection in computational enzyme design

    PubMed Central

    Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan

    2013-01-01

    A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589

  20. Two nucleotide binding sites modulate ( sup 3 H) glyburide binding to rat cortex membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, D.E.; Gopalakrishnan, M.; Triggle, D.J.

    1991-03-11

    The effects of nucleotides on the binding of the ATP-dependent K{sup +}-channel antagonist ({sup 3}H)glyburide (GLB) to rat cortex membranes were examined. Nucleotide triphosphates (NTPs) and nucleotide diphosphate (NDPs) inhibited the binding of GLB. This effect was dependent on the presence of dithiothreitol (DTT). Inhibition of binding by NTPs, with the exception of ATP{gamma}S, was dependent on the presence of Mg{sup 2+}. GLB binding showed a biphasic response to ADP: up to 3 mM, ADP inhibited binding, and above this concentration GLB binding increased rapidly, and was restored to normal levels by 10 mM ADP. In the presence of Mg{supmore » 2+}, ADP did not stimulate binding. Saturation analysis in the presence of Mg{sup 2+} and increasing concentrations of ADP showed that ADP results primarily in a change of the B{sub max} for GLB binding. The differential effects of NTPS and NDPs indicate that two nucleotide binding sites regulate GLB binding.« less

  1. The effect of glycosylation on the transferrin structure: A molecular dynamic simulation analysis.

    PubMed

    Ghanbari, Z; Housaindokht, M R; Bozorgmehr, M R; Izadyar, M

    2016-09-07

    Transferrins have been defined by the highly cooperative binding of iron and a carbonate anion to form a Fe-CO3-Tf ternary complex. As such, the layout of the binding site residues affects transferrin function significantly; In contrast to N-lobe, C-lobe binding site of the transferrin structure has been less characterized and little research which surveyed the interaction of carbonate with transferrin in the C-lobe binding site has been found. In the present work, molecular dynamic simulation was employed to gain access into the molecular level understanding of carbonate binding site and their interactions in each lobe. Residues responsible for carbonate binding of transferrin structure were pointed out. In addition, native human transferrin is a glycoprotein that two N-linked complex glycan chains located in the C-lobe. Usually, in the molecular dynamic simulation for simplifying, glycan is removed from the protein structure. Here, we explore the effect of glycosylation on the transferrin structure. Glycosylation appears to have an effect on the layout of the binding site residue and transferrin structure. On the other hand, sometimes the entire transferrin formed by separated lobes that it allows the results to be interpreted in a straightforward manner rather than more parameters required for full length protein. But, it should be noted that there are differences between the separated lobe and full length transferrin, hence, a comparative analysis by the molecular dynamic simulation was performed to investigate such structural variations. Results revealed that separation in C-lobe caused a significant structural variation in comparison to N-lobe. Consequently, the separated lobes and the full length one are different, showing the importance of the interlobe communication and the impact of the lobes on each other in the transferrin structure. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Regulated expression of a repressor protein: FadR activates iclR.

    PubMed Central

    Gui, L; Sunnarborg, A; LaPorte, D C

    1996-01-01

    The control of the glyoxylate bypass operon (aceBAK) of Escherichia coli is mediated by two regulatory proteins, IclMR and FadR. IclMR is a repressor protein which has previously been shown to bind to a site which overlaps the aceBAK promoter. FAR is a repressor/activator protein which participates in control of the genes of fatty acid metabolism. A sequence just upstream of the iclR promoter bears a striking resemblance to FadR binding sites found in the fatty acid metabolic genes. The in vitro binding specificity of FadR, determined by oligonucleotide selection, was in good agreement with the sequences of these sites. The ability of FadR to bind to the site associated with iclR was demonstrated by gel shift and DNase I footprint analyses. Disruption of FadR or inactivation of the FadR binding site of iclR decreased the expression of an iclR::lacZ operon fusion, indicating that FadR activates the expression of iclR. It has been reported that disruption of fadR increases the expression of aceBAK. We observed a similar increase when we inactivated the FadR binding site of an iclR+ allele. This result suggests that FadR regulates aceBAK indirectly by altering the expression of IclR. PMID:8755903

  3. Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Zhongchuan; Xie, Tian; Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of

    2016-03-24

    The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature ofmore » CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.« less

  4. Immunological characterization of eristostatin and echistatin binding sites on alpha IIb beta 3 and alpha V beta 3 integrins.

    PubMed Central

    Marcinkiewicz, C; Rosenthal, L A; Mosser, D M; Kunicki, T J; Niewiarowski, S

    1996-01-01

    Two disintegrins with a high degree of amino acid sequence similarity, echistatin and eristostatin, showed a low level of interaction with Chinese hamster ovary (CHO) cells, but they bound to CHO cells transfected with alpha IIb beta 3 genes (A5 cells) and to CHO cells transfected with alpha v beta 3 genes (VNRC3 cells) in a reversible and saturable manner. Scatchard analysis revealed that eristostatin bound to 816000 sites per A5 cell (Kd 28 nM) and to 200000 sites (Kd 14 nM) per VNRC3 cell respectively. However, VNRC3 cells did not bind to immobilized eristostatin. Echistatin bound to 495000 sites (Kd 53 nM) per A5 cell and to 443000 sites (Kd 20 nM) per VNRC3 cell. As determined by flow cytometry, radiobinding assay and adhesion studies, binding of both disintegrins to A5 cells and resting platelets and binding of echistatin to VNRC3 cells resulted in the expression of ligand-induced binding sites (LIBS) on the beta 3 subunit. Eristostatin inhibited, more strongly than echistatin, the binding of three monoclonal antibodies: OPG2 (RGD motif dependent), A2A9 (alpha IIb beta 3 complex dependent) and 7E3 (alpha IIb beta 3 and alpha v beta 3 complex dependent) to A5 cells, to resting and to activated platelets and to purified alpha IIb beta 3. Experiments in which echistatin and eristostatin were used alone or in combination to inhibit the binding of 7E3 and OPG2 antibodies to resting platelets suggested that these two disintegrins bind to different but overlapping sites on alpha IIb beta 3 integrin. Monoclonal antibody LM 609 and echistatin seemed to bind to different sites on alpha v beta 3 integrin. However, echistatin inhibited binding of 7E3 antibody to VNRC3 cells and to purified alpha v beta 3 suggesting that alpha v beta 3 and alpha IIb beta 3 might share the same epitope to which both echistatin and 7E3 bind. Eristostatin had no effect in these systems, providing further evidence that it binds to a different epitope on alpha v beta 3. PMID:8760368

  5. Interaction of E. coli outer-membrane protein A with sugars on the receptors of the brain microvascular endothelial cells.

    PubMed

    Datta, Deepshikha; Vaidehi, Nagarajan; Floriano, Wely B; Kim, Kwang S; Prasadarao, Nemani V; Goddard, William A

    2003-02-01

    Esherichia coli, the most common gram-negative bacteria, can penetrate the brain microvascular endothelial cells (BMECs) during the neonatal period to cause meningitis with significant morbidity and mortality. Experimental studies have shown that outer-membrane protein A (OmpA) of E. coli plays a key role in the initial steps of the invasion process by binding to specific sugar moieties present on the glycoproteins of BMEC. These experiments also show that polymers of chitobiose (GlcNAcbeta1-4GlcNAc) block the invasion, while epitopes substituted with the L-fucosyl group do not. We used HierDock computational technique that consists of a hierarchy of coarse grain docking method with molecular dynamics (MD) to predict the binding sites and energies of interactions of GlcNAcbeta1-4GlcNAc and other sugars with OmpA. The results suggest two important binding sites for the interaction of carbohydrate epitopes of BMEC glycoproteins to OmpA. We identify one site as the binding pocket for chitobiose (GlcNAcbeta1-4GlcNAc) in OmpA, while the second region (including loops 1 and 2) may be important for recognition of specific sugars. We find that the site involving loops 1 and 2 has relative binding energies that correlate well with experimental observations. This theoretical study elucidates the interaction sites of chitobiose with OmpA and the binding site predictions made in this article are testable either by mutation studies or invasion assays. These results can be further extended in suggesting possible peptide antagonists and drug design for therapeutic strategies. Copyright 2002 Wiley-Liss, Inc.

  6. Genome-Wide Identification of Binding Sites Defines Distinct Functions for Caenorhabditis elegans PHA-4/FOXA in Development and Environmental Response

    PubMed Central

    Zhong, Mei; Niu, Wei; Lu, Zhi John; Sarov, Mihail; Murray, John I.; Janette, Judith; Raha, Debasish; Sheaffer, Karyn L.; Lam, Hugo Y. K.; Preston, Elicia; Slightham, Cindie; Hillier, LaDeana W.; Brock, Trisha; Agarwal, Ashish; Auerbach, Raymond; Hyman, Anthony A.; Gerstein, Mark; Mango, Susan E.; Kim, Stuart K.; Waterston, Robert H.; Reinke, Valerie; Snyder, Michael

    2010-01-01

    Transcription factors are key components of regulatory networks that control development, as well as the response to environmental stimuli. We have established an experimental pipeline in Caenorhabditis elegans that permits global identification of the binding sites for transcription factors using chromatin immunoprecipitation and deep sequencing. We describe and validate this strategy, and apply it to the transcription factor PHA-4, which plays critical roles in organ development and other cellular processes. We identified thousands of binding sites for PHA-4 during formation of the embryonic pharynx, and also found a role for this factor during the starvation response. Many binding sites were found to shift dramatically between embryos and starved larvae, from developmentally regulated genes to genes involved in metabolism. These results indicate distinct roles for this regulator in two different biological processes and demonstrate the versatility of transcription factors in mediating diverse biological roles. PMID:20174564

  7. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  8. Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

    PubMed

    Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

    2012-09-01

    Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

  9. Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carra,J.; McHugh, C.; Mulligan, S.

    2007-01-01

    We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding tomore » a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.« less

  10. Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

    PubMed

    Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

    2015-05-19

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

  11. Organization, development, and effects of infraorbital nerve transection on galanin binding sites in the trigeminal brainstem complex.

    PubMed

    Bodie, D; Bennett-Clarke, C A; Davis, K; Postelwaite, J P; Chiaia, N L; Rhoades, R W

    1997-01-01

    Previous experiments from this laboratory have indicated that transection of the infraorbital nerve (ION, the trigeminal [V] branch that supplies the mystacial vibrissae follicles) at birth and in adulthood has markedly different effects on galanin immunoreactivity in the V brainstem complex. Adult nerve transection increases galanin immunoreactivity in the superficial layers of V subnucleus caudalis (SpC) only, while neonatal nerve transection results in increased galanin expression in vibrissae-related primary afferents throughout the V brainstem complex. The present study describes the distribution of binding sites for this peptide in the mature and developing V ganglion and brainstem complex and determines the effects of neonatal and adult ION damage and the associated changes in galanin levels upon their distribution and density. Galanin binding sites are densely distributed in all V brainstem subnuclei and are particularly dense in V subnucleus interpolaris and the superficial layers of SpC. They are present at birth (P-0) and their distribution is similar to that in adult animals. Transection of the ION in adulthood and examination of brainstem 7 days later indicated marked reductions in the density of galanin binding sites in the V brainstem complex. With the exception of the superficial laminae of SpC, the same reduction in density remained apparent in rats that survived > 45 days after nerve cuts. Transection of the ION on P-0 resulted in no change in the density of galanin binding sites in the brainstem after either 7 or > 60 days survival. These results indicate that densely distributed galanin binding sites are present in the V brainstem complex of both neonatal and adult rats, that they are located in regions not innervated by galanin-positive axons, and that their density is not significantly influenced by large lesion-induced changes in the primary afferent content of their natural ligand.

  12. Insulator function and topological domain border strength scale with architectural protein occupancy

    PubMed Central

    2014-01-01

    Background Chromosome conformation capture studies suggest that eukaryotic genomes are organized into structures called topologically associating domains. The borders of these domains are highly enriched for architectural proteins with characterized roles in insulator function. However, a majority of architectural protein binding sites localize within topological domains, suggesting sites associated with domain borders represent a functionally different subclass of these regulatory elements. How topologically associating domains are established and what differentiates border-associated from non-border architectural protein binding sites remain unanswered questions. Results By mapping the genome-wide target sites for several Drosophila architectural proteins, including previously uncharacterized profiles for TFIIIC and SMC-containing condensin complexes, we uncover an extensive pattern of colocalization in which architectural proteins establish dense clusters at the borders of topological domains. Reporter-based enhancer-blocking insulator activity as well as endogenous domain border strength scale with the occupancy level of architectural protein binding sites, suggesting co-binding by architectural proteins underlies the functional potential of these loci. Analyses in mouse and human stem cells suggest that clustering of architectural proteins is a general feature of genome organization, and conserved architectural protein binding sites may underlie the tissue-invariant nature of topologically associating domains observed in mammals. Conclusions We identify a spectrum of architectural protein occupancy that scales with the topological structure of chromosomes and the regulatory potential of these elements. Whereas high occupancy architectural protein binding sites associate with robust partitioning of topologically associating domains and robust insulator function, low occupancy sites appear reserved for gene-specific regulation within topological domains. PMID:24981874

  13. ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

    PubMed Central

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

  14. Determination of the affinity of drugs toward serum albumin by measurement of the quenching of the intrinsic tryptophan fluorescence of the protein.

    PubMed

    Epps, D E; Raub, T J; Caiolfa, V; Chiari, A; Zamai, M

    1999-01-01

    Binding of new chemical entities to serum proteins is an issue confronting pharmaceutical companies during development of potential therapeutic agents. Most drugs bind to the most abundant plasma protein, human serum albumin (HSA), at two major binding sites. Excepting fluorescence spectroscopy, existing methods for assaying drug binding to serum albumin are insensitive to higher-affinity compounds and can be labour-intensive, time-consuming, and usually require compound-specific assays. This led us to examine alternative ways to measure drug-albumin interaction. One method described here uses fluorescence quenching of the single tryptophan (Trp) residue in HSA excited at 295 nm to measure drug-binding affinity. Unfortunately, many compounds absorb, fluoresce, or both, in this UV wavelength region of the spectrum. Several types of binding phenomenon and spectral interference were identified by use of six structurally unrelated compounds and the equations necessary to make corrections mathematically were derived and applied to calculate binding constants accurately. The general cases were: direct quenching of Trp fluorescence by optically transparent ligands with low or high affinities; binding of optically transparent, non-fluorescent ligands to two specific sites where both sites or only one site result in Trp fluorescence quenching; and chromophores whose absorption either overlaps the Trp emission and quenches by energy transfer or absorbs light at the Trp fluorescence excitation wavelength producing absorptive screening as well as fluorescence quenching. Unless identification of the site specificity of drug binding to serum albumin is desired, quenching of the Trp fluorescence of albumin by titration with ligand is a rapid and facile method for determining the binding affinities of drugs for serum albumin.

  15. The N-Terminal Domain of the Flo1 Flocculation Protein from Saccharomyces cerevisiae Binds Specifically to Mannose Carbohydrates ▿

    PubMed Central

    Goossens, Katty V. Y.; Stassen, Catherine; Stals, Ingeborg; Donohue, Dagmara S.; Devreese, Bart; De Greve, Henri; Willaert, Ronnie G.

    2011-01-01

    Saccharomyces cerevisiae cells possess a remarkable capacity to adhere to other yeast cells, which is called flocculation. Flocculation is defined as the phenomenon wherein yeast cells adhere in clumps and sediment rapidly from the medium in which they are suspended. These cell-cell interactions are mediated by a class of specific cell wall proteins, called flocculins, that stick out of the cell walls of flocculent cells. The N-terminal part of the three-domain protein is responsible for carbohydrate binding. We studied the N-terminal domain of the Flo1 protein (N-Flo1p), which is the most important flocculin responsible for flocculation of yeast cells. It was shown that this domain is both O and N glycosylated and is structurally composed mainly of β-sheets. The binding of N-Flo1p to d-mannose, α-methyl-d-mannoside, various dimannoses, and mannan confirmed that the N-terminal domain of Flo1p is indeed responsible for the sugar-binding activity of the protein. Moreover, fluorescence spectroscopy data suggest that N-Flo1p contains two mannose carbohydrate binding sites with different affinities. The carbohydrate dissociation constants show that the affinity of N-Flo1p for mono- and dimannoses is in the millimolar range for the binding site with low affinity and in the micromolar range for the binding site with high affinity. The high-affinity binding site has a higher affinity for low-molecular-weight (low-MW) mannose carbohydrates and no affinity for mannan. However, mannan as well as low-MW mannose carbohydrates can bind to the low-affinity binding site. These results extend the cellular flocculation model on the molecular level. PMID:21076009

  16. Characterization and autoradiographic localization of neurotensin binding sites in human sigmoid colon.

    PubMed

    Azriel, Y; Burcher, E

    2001-06-01

    Radioiodinated neurotensin ((125)I-NT) was used to characterize and localize NT binding sites in normal human sigmoid colon. Specimens were obtained from patients (30-77 years old) undergoing resection for colon carcinoma. Specific binding of (125)I-NT to sigmoid circular muscle membranes was enhanced by o-phenanthroline (1 mM) but other peptidase inhibitors were ineffective. (125)I-NT bound to a high-affinity site of K(d) = 0.88 +/- 0.09 nM and B(max) = 4.03 +/- 0.66 fmol/mg of wet weight tissue (n = 14), although in the majority of patients another site, of low but variable affinity, could also be detected. Specific binding of 50 pM (125)I-NT was inhibited by NT(8-13) > NT > SR142948A > or = neuromedin N > or = SR48692, consistent with binding to the NT1 receptor. In autoradiographic studies, dense specific binding of (125)I-NT was seen over myenteric and submucosal ganglia, moderate binding over circular muscle, and sparse binding over longitudinal muscle and taenia coli. Levocabastine, which has affinity for the NT2 receptor, did not inhibit specific binding of (125)I-NT in membrane competition or autoradiographic studies. NT contracted sigmoid colon circular muscle strips with a pD(2) value of 6.8 +/- 0.2 nM (n = 25). The contractile responses to NT were significantly potentiated in the presence of tetrodotoxin (1 microM), indicating a neural component. Results from functional studies support actions for NT on both muscle and enteric neurons, consistent with the presence of NT receptors on circular muscle and ganglia of human sigmoid colon. The lack of inhibition by levocabastine suggests that the second binding site detected does not correspond to the NT2 receptor.

  17. Characterization of the kinetics of Fe (II) binding by the R2 protein subunit of E. coli ribonucleotide reductase

    NASA Astrophysics Data System (ADS)

    Chaudhuri, Dipankar; , Joseph Martin Bollinger, Jr.

    2008-07-01

    The kinetics of Fe(II) binding to Escherichia coli Ribonucleotide reductase (R2) has been studied using rapid kinetics techniques including chemical quenched flow (CQF) Mössbauer spectroscopy. Based on the stopped flow absorption (SF-Abs) and CQF Mössbauer spectroscopy results, the pre-steady kinetics of binding of Fe(II) to the two sites A and B on R2 have been established with attendant conformational changes. Fe (II) binds to Site B tighter and faster and these and other results provide important information towards the di-iron cofactor assembly mechanism in R2 and could have possible implications for the development of modified and new anticancer and antiviral drugs.

  18. Identification of cation-binding sites on actin that drive polymerization and modulate bending stiffness

    PubMed Central

    Kang, Hyeran; Bradley, Michael J.; McCullough, Brannon R.; Pierre, Anaëlle; Grintsevich, Elena E.; Reisler, Emil; De La Cruz, Enrique M.

    2012-01-01

    The assembly of actin monomers into filaments and networks plays vital roles throughout eukaryotic biology, including intracellular transport, cell motility, cell division, determining cellular shape, and providing cells with mechanical strength. The regulation of actin assembly and modulation of filament mechanical properties are critical for proper actin function. It is well established that physiological salt concentrations promote actin assembly and alter the overall bending mechanics of assembled filaments and networks. However, the molecular origins of these salt-dependent effects, particularly if they involve nonspecific ionic strength effects or specific ion-binding interactions, are unknown. Here, we demonstrate that specific cation binding at two discrete sites situated between adjacent subunits along the long-pitch helix drive actin polymerization and determine the filament bending rigidity. We classify the two sites as “polymerization” and “stiffness” sites based on the effects that mutations at the sites have on salt-dependent filament assembly and bending mechanics, respectively. These results establish the existence and location of the cation-binding sites that confer salt dependence to the assembly and mechanics of actin filaments. PMID:23027950

  19. Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin

    PubMed Central

    Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K.; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga

    2015-01-01

    Insulators are multiprotein–DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. PMID:25342723

  20. Insights into the binding mode of sulphamates and sulphamides to hCA II: crystallographic studies and binding free energy calculations.

    PubMed

    De Simone, Giuseppina; Langella, Emma; Esposito, Davide; Supuran, Claudiu T; Monti, Simona Maria; Winum, Jean-Yves; Alterio, Vincenzo

    2017-12-01

    Sulphamate and sulphamide derivatives have been largely investigated as carbonic anhydrase inhibitors (CAIs) by means of different experimental techniques. However, the structural determinants responsible for their different binding mode to the enzyme active site were not clearly defined so far. In this paper, we report the X-ray crystal structure of hCA II in complex with a sulphamate inhibitor incorporating a nitroimidazole moiety. The comparison with the structure of hCA II in complex with its sulphamide analogue revealed that the two inhibitors adopt a completely different binding mode within the hCA II active site. Starting from these results, we performed a theoretical study on sulphamate and sulphamide derivatives, demonstrating that electrostatic interactions with residues within the enzyme active site play a key role in determining their binding conformation. These findings open new perspectives in the design of effective CAIs using the sulphamate and sulphamide zinc binding groups as lead compounds.

  1. Interaction of Flavonoids from Woodwardia unigemmata with Bovine Serum Albumin (BSA): Application of Spectroscopic Techniques and Molecular Modeling Methods.

    PubMed

    Ma, Rui; Pan, Hong; Shen, Tao; Li, Peng; Chen, Yanan; Li, Zhenyu; Di, Xiaxia; Wang, Shuqi

    2017-08-09

    Phytochemical investigation on the methanol extract of Woodwardia unigemmata resulted in the isolation of seven flavonoids, including one new flavonol acylglycoside ( 1 ). The structures of these compounds were elucidated on the basis of extensive spectroscopic analysis and comparison of literature data. The multidrug resistance (MDR) reversing activity was evaluated for the isolated compounds using doxorubicin-resistant K562/A02 cells model. Compound 6 showed comparable MDR reversing effect to verapamil. Furthermore, the interaction between compounds and bovine serum albumin (BSA) was investigated by spectroscopic methods, including steady-state fluorescence, synchronous fluorescence, circular dichroism (CD) spectroscopies, and molecular docking approach. The experimental results indicated that the seven flavonoids bind to BSA by static quenching mechanisms. The negative ΔH and ΔS values indicated that van der Waals interactions and hydrogen bonds contributed in the binding of compounds 2 - 6 to BSA. In the case of compounds 1 and 7 systems, the hydrophobic interactions play a major role. The binding of compounds to BSA causes slight changes in the secondary structure of BSA. There are two binding sites of compound 6 on BSA and site I is the main site according to the molecular docking studies and the site marker competitive binding assay.

  2. "In situ" observation of the role of chloride ion binding to monkey green sensitive visual pigment by ATR-FTIR spectroscopy.

    PubMed

    Katayama, Kota; Furutani, Yuji; Iwaki, Masayo; Fukuda, Tetsuya; Imai, Hiroo; Kandori, Hideki

    2018-01-31

    Long-wavelength-sensitive (LWS) pigment possesses a chloride binding site in its protein moiety. The binding of chloride alters the absorption spectra of LWS; this is known as the chloride effect. Although the two amino acid substitutions of His197 and Lys200 influence the chloride effect, the molecular mechanism of chloride binding, which underlies the spectral tuning, has yet to be clarified. In this study, we applied ATR-FTIR spectroscopy to monkey green (MG) pigment to gain structural information of the chloride binding site. The results suggest that chloride binding stabilizes the β-sheet structure on the extracellular side loop with perturbation of the retinal polyene chain, promotes a hydrogen bonding exchange with the hydroxyl group of Tyr, and alters the protonation state of carboxylate. Combining with the results of the binding analyses of various anions (Br - , I - and NO 3 - ), our findings suggest that the anion binding pocket is organized for only Cl - (or Br - ) to stabilize conformation around the retinal chromophore, which is functionally relevant with absorbing long wavelength light.

  3. Rapid evolution of cis-regulatory sequences via local point mutations

    NASA Technical Reports Server (NTRS)

    Stone, J. R.; Wray, G. A.

    2001-01-01

    Although the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the cis-regulatory regions that control transcription. Yet, changes in gene expression are likely to constitute an important component of phenotypic evolution. We simulated the evolution of new transcription factor binding sites via local point mutations. The results indicate that new binding sites appear and become fixed within populations on microevolutionary timescales under an assumption of neutral evolution. Even combinations of two new binding sites evolve very quickly. We predict that local point mutations continually generate considerable genetic variation that is capable of altering gene expression.

  4. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  5. pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families

    PubMed Central

    Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas

    2014-01-01

    The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248

  6. Interaction of Zn(II)bleomycin-A2 and Zn(II)peplomycin with a DNA hairpin containing the 5'-GT-3' binding site in comparison with the 5'-GC-3' binding site studied by NMR spectroscopy.

    PubMed

    Follett, Shelby E; Ingersoll, Azure D; Murray, Sally A; Reilly, Teresa M; Lehmann, Teresa E

    2017-10-01

    Bleomycins are a group of glycopeptide antibiotics synthesized by Streptomyces verticillus that are widely used for the treatment of various neoplastic diseases. These antibiotics have the ability to chelate a metal center, mainly Fe(II), and cause site-specific DNA cleavage. Bleomycins are differentiated by their C-terminal regions. Although this antibiotic family is a successful course of treatment for some types of cancers, it is known to cause pulmonary fibrosis. Previous studies have identified that bleomycin-related pulmonary toxicity is linked to the C-terminal region of these drugs. This region has been shown to closely interact with DNA. We examined the binding of Zn(II)peplomycin and Zn(II)bleomycin-A 2 to a DNA hairpin of sequence 5'-CCAGTATTTTTACTGG-3', containing the binding site 5'-GT-3', and compared the results with those obtained from our studies of the same MBLMs bound to a DNA hairpin containing the binding site 5'-GC-3'. We provide evidence that the DNA base sequence has a strong impact in the final structure of the drug-target complex.

  7. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  8. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  9. Searching for transcription factor binding sites in vector spaces

    PubMed Central

    2012-01-01

    Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338

  10. Locating the Binding Sites of Pb(II) Ion with Human and Bovine Serum Albumins

    PubMed Central

    Belatik, Ahmed; Hotchandani, Surat; Carpentier, Robert; Tajmir-Riahi, Heidar-Ali

    2012-01-01

    Lead is a potent environmental toxin that has accumulated above its natural level as a result of human activity. Pb cation shows major affinity towards protein complexation and it has been used as modulator of protein-membrane interactions. We located the binding sites of Pb(II) with human serum (HSA) and bovine serum albumins (BSA) at physiological conditions, using constant protein concentration and various Pb contents. FTIR, UV-visible, CD, fluorescence and X-ray photoelectron spectroscopic (XPS) methods were used to analyse Pb binding sites, the binding constant and the effect of metal ion complexation on HSA and BSA stability and conformations. Structural analysis showed that Pb binds strongly to HSA and BSA via hydrophilic contacts with overall binding constants of KPb-HSA = 8.2 (±0.8)×104 M−1 and KPb-BSA = 7.5 (±0.7)×104 M−1. The number of bound Pb cation per protein is 0.7 per HSA and BSA complexes. XPS located the binding sites of Pb cation with protein N and O atoms. Pb complexation alters protein conformation by a major reduction of α-helix from 57% (free HSA) to 48% (metal-complex) and 63% (free BSA) to 52% (metal-complex) inducing a partial protein destabilization. PMID:22574219

  11. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Fluorescence Spectroscopic Studies on the Complexation of Antidiabetic Drugs with Glycosylated Serum Albumin

    NASA Astrophysics Data System (ADS)

    Seedher, N.; Kanojia, M.

    2013-11-01

    Glycosylation decreases the association constant values and hence the binding affinity of human serum albumin (HSA) for the antidiabetic drugs under study. The percentage of HAS-bound drug at physiological temperature was only about 21-38 % as compared to 46-74 % for non-glycosylated HSA. Thus the percentage of free drug available for an antihyperglycemic effect was about double (62-79 %) compared to the values for non-glycosylated HSA. Much higher free drug concentrations available for pharmacological effect can lead to the risk of hypoglycemia. Hydrophobic interactions were predominantly involved in the binding. In the binding of gliclazide, hydrogen bonding and electrostatic interactions were involved. Site specificity for glycosylated HSA was the same as that for non-glycosylated HSA; gliclazide and repaglinide bind only at site II whereas glimepiride and glipizide bind at both sites I and II. Glycosylation, however, caused conformational changes in albumin, and the binding region within site II was different for glycosylated and non-glycosylated albumin. Stern-Volmer analysis also indicated the conformational changes in albumin as a result of glycosylation and showed that the dynamic quenching mechanism was valid for fluorescence of both glycosylated and non-glycosylated HSA.

  13. Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations.

    PubMed

    Wade, R C; Gabdoulline, R R; Lüdemann, S K; Lounnas, V

    1998-05-26

    To bind at an enzyme's active site, a ligand must diffuse or be transported to the enzyme's surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and beta-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as "ionic tethering." We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme's surroundings even when the substrate is nonpolar.

  14. Cyclophilin B binding to platelets supports calcium-dependent adhesion to collagen.

    PubMed

    Allain, F; Durieux, S; Denys, A; Carpentier, M; Spik, G

    1999-08-01

    We have recently reported that cyclophilin B (CyPB), a secreted cyclosporine-binding protein, could bind to T lymphocytes through interactions with two types of binding sites. The first ones, referred to as type I, involve interactions with the conserved domain of CyPB and promote the endocytosis of surface-bound ligand, while the second type of binding sites, termed type II, are represented by glycosaminoglycans (GAG). Here, we further investigated the interactions of CyPB with blood cell populations. In addition to lymphocytes, CyPB was found to interact mainly with platelets. The binding is specific, with a dissociation constant (kd) of 9 +/- 3 nmol/L and the number of sites estimated at 960 +/- 60 per cell. Platelet glycosaminoglycans are not required for the interactions, but the binding is dramatically reduced by active cyclosporine derivatives. We then analyzed the biologic effects of CyPB and found a significant increase in platelet adhesion to collagen. Concurrently, CyPB initiates a transmembranous influx of Ca(2+) and induces the phosphorylation of the P-20 light chains of myosin. Taken together, the present results demonstrate for the first time that extracellular CyPB specifically interacts with platelets through a functional receptor related to the lymphocyte type I binding sites and might act by regulating the activity of a receptor-operated membrane Ca(2+) channel.

  15. Membrane Modulates Affinity for Calcium Ion to Create an Apparent Cooperative Binding Response by Annexin a5

    PubMed Central

    Gauer, Jacob W.; Knutson, Kristofer J.; Jaworski, Samantha R.; Rice, Anne M.; Rannikko, Anika M.; Lentz, Barry R.; Hinderliter, Anne

    2013-01-01

    Isothermal titration calorimetry was used to characterize the binding of calcium ion (Ca2+) and phospholipid to the peripheral membrane-binding protein annexin a5. The phospholipid was a binary mixture of a neutral and an acidic phospholipid, specifically phosphatidylcholine and phosphatidylserine in the form of large unilamellar vesicles. To stringently define the mode of binding, a global fit of data collected in the presence and absence of membrane concentrations exceeding protein saturation was performed. A partition function defined the contribution of all heat-evolving or heat-absorbing binding states. We find that annexin a5 binds Ca2+ in solution according to a simple independent-site model (solution-state affinity). In the presence of phosphatidylserine-containing liposomes, binding of Ca2+ differentiates into two classes of sites, both of which have higher affinity compared with the solution-state affinity. As in the solution-state scenario, the sites within each class were described with an independent-site model. Transitioning from a solution state with lower Ca2+ affinity to a membrane-associated, higher Ca2+ affinity state, results in cooperative binding. We discuss how weak membrane association of annexin a5 prior to Ca2+ influx is the basis for the cooperative response of annexin a5 toward Ca2+, and the role of membrane organization in this response. PMID:23746516

  16. The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

    Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

  17. 'Unconventional' coordination chemistry by metal chelating fragments in a metalloprotein active site.

    PubMed

    Martin, David P; Blachly, Patrick G; Marts, Amy R; Woodruff, Tessa M; de Oliveira, César A F; McCammon, J Andrew; Tierney, David L; Cohen, Seth M

    2014-04-09

    The binding of three closely related chelators: 5-hydroxy-2-methyl-4H-pyran-4-thione (allothiomaltol, ATM), 3-hydroxy-2-methyl-4H-pyran-4-thione (thiomaltol, TM), and 3-hydroxy-4H-pyran-4-thione (thiopyromeconic acid, TPMA) to the active site of human carbonic anhydrase II (hCAII) has been investigated. Two of these ligands display a monodentate mode of coordination to the active site Zn(2+) ion in hCAII that is not recapitulated in model complexes of the enzyme active site. This unprecedented binding mode in the hCAII-thiomaltol complex has been characterized by both X-ray crystallography and X-ray spectroscopy. In addition, the steric restrictions of the active site force the ligands into a 'flattened' mode of coordination compared with inorganic model complexes. This change in geometry has been shown by density functional computations to significantly decrease the strength of the metal-ligand binding. Collectively, these data demonstrate that the mode of binding by small metal-binding groups can be significantly influenced by the protein active site. Diminishing the strength of the metal-ligand bond results in unconventional modes of metal coordination not found in typical coordination compounds or even carefully engineered active site models, and understanding these effects is critical to the rational design of inhibitors that target clinically relevant metalloproteins.

  18. Ubiquitin vinyl methyl ester binding orients the misaligned active site of the ubiquitin hydrolase UCHL1 into productive conformation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boudreaux, David A.; Maiti, Tushar K.; Davies, Christopher W.

    Ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is a Parkinson disease-associated, putative cysteine protease found abundantly and selectively expressed in neurons. The crystal structure of apo UCHL1 showed that the active-site residues are not aligned in a canonical form, with the nucleophilic cysteine being 7.7 {angstrom} from the general base histidine, an arrangement consistent with an inactive form of the enzyme. Here we report the crystal structures of the wild type and two Parkinson disease-associated variants of the enzyme, S18Y and I93M, bound to a ubiquitin-based suicide substrate, ubiquitin vinyl methyl ester. These structures reveal that ubiquitin vinyl methyl ester binds primarilymore » at two sites on the enzyme, with its carboxy terminus at the active site and with its amino-terminal {beta}-hairpin at the distal site - a surface-exposed hydrophobic crevice 17 {angstrom} away from the active site. Binding at the distal site initiates a cascade of side-chain movements in the enzyme that starts at a highly conserved, surface-exposed phenylalanine and is relayed to the active site resulting in the reorientation and proximal placement of the general base within 4 {angstrom} of the catalytic cysteine, an arrangement found in productive cysteine proteases. Mutation of the distal-site, surface-exposed phenylalanine to alanine reduces ubiquitin binding and severely impairs the catalytic activity of the enzyme. These results suggest that the activity of UCHL1 may be regulated by its own substrate.« less

  19. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  20. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  1. Testing Geometrical Discrimination within an Enzyme Active Site: Constrained Hydrogen Bonding in the Ketosteroid Isomerase Oxyanion Hole

    PubMed Central

    Sigala, Paul A.; Kraut, Daniel A.; Caaveiro, Jose M. M.; Pybus, Brandon; Ruben, Eliza A.; Ringe, Dagmar; Petsko, Gregory A.; Herschlag, Daniel

    2009-01-01

    Enzymes are classically proposed to accelerate reactions by binding substrates within active site environments that are structurally preorganized to optimize binding interactions with reaction transition states rather than ground states. This is a remarkably formidable task considering the limited 0.1 – 1 Å scale of most substrate rearrangements. The flexibility of active site functional groups along the coordinate of substrate rearrangement, the distance scale on which enzymes can distinguish structural rearrangement, and the energetic significance of discrimination on that scale remain open questions that are fundamental to a basic physical understanding of enzyme active sites and catalysis. We bring together high resolution X-ray crystallography, 1H and 19F NMR spectroscopy, quantum mechanical calculations, and transition state analog binding measurements to test the distance scale on which non-covalent forces can constrain side chain and ligand relaxation or translation along a specific coordinate and the energetic consequences of such geometric constraints within the active site of bacterial ketosteroid isomerase (KSI). Our results strongly suggest that packing and binding interactions within the KSI active site can constrain local side chain reorientation and prevent hydrogen bond shortening by 0.1 Å or less. Further, this constraint has substantial energetic effects on ligand binding and stabilization of negative charge within the oxyanion hole. These results provide evidence that subtle geometric effects, indistinguishable in most X-ray crystallographic structures, can have significant energetic consequences and highlight the importance of using synergistic experimental approaches to dissect enzyme function. PMID:18808119

  2. Multi-spectroscopic and molecular modeling approaches to elucidate the binding interaction between bovine serum albumin and darunavir, a HIV protease inhibitor.

    PubMed

    Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

    2018-01-05

    Darunavir (DRV), a second-generation HIV protease inhibitor, is widely used across the world as an important component of HIV therapy. The interaction of DRV with bovine serum albumin (BSA), a major carrier protein, has been studied under simulated physiological conditions (pH7.4) by multi-spectroscopic techniques in combination with molecular modeling. Fluorescence data revealed that the intrinsic fluorescence of BSA was quenched by DRV in terms of a static quenching procedure due to the formation of the DRV-BSA complex. The results indicated the presence of single weak affinity binding site (~10 3 M -1 , 310K) on protein. The thermodynamic parameters, namely enthalpy change (ΔH 0 ), entropy change (ΔS 0 ) and Gibbs free energy change (ΔG 0 ) were calculated, which signified that the binding reaction was spontaneous, the main binding forces were hydrogen bonding and van der Waals forces. Importantly, competitive binding experiments with three site probes, phenylbutazone (in sub-domain IIA, site I), ibuprofen (in sub-domain IIIA, site II) and artemether (in the interface between sub-domain IIA and IIB, site II'), suggested that DRV was preferentially bound to the hydrophobic cavity in site II' of BSA, and this finding was validated by the docking results. Additionally, synchronous fluorescence, three-dimensional fluorescence and Resonance Rayleigh Scattering (RRS) spectroscopy gave qualitative information on the conformational changes of BSA upon adding DRV, while quantitative data were obtained with Fourier transform infrared spectroscopy (FT-IR). Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Magnesium-adenosine diphosphate binding sites in wild-type creatine kinase and in mutants: role of aromatic residues probed by Raman and infrared spectroscopies.

    PubMed

    Hagemann, H; Marcillat, O; Buchet, R; Vial, C

    2000-08-08

    Two distinct methods were used to investigate the role of Trp residues during Mg-ADP binding to cytosolic creatine kinase (CK) from rabbit muscle: (1) Raman spectroscopy, which is very sensitive to the environment of aromatic side-chain residues, and (2) reaction-induced infrared difference spectroscopy (RIDS) and photolabile substrate (ADP[Et(PhNO(2))]), combined with site-directed mutagenesis on the four Trp residues of CK. Our Raman results indicated that the environment of Trp and of Tyr were not affected during Mg-ADP binding to CK. Analysis of RIDS of wild-type CK, inactive W227Y, and active W210,217,272Y mutants suggested that Trp227 was not involved in the stacking interactions. Results are consistent with Trp227 being essential to prevent water molecules from entering in the active site [as suggested by Gross, M., Furter-Graves, E. M., Wallimann, T., Eppenberger, H. M., and Furter, R. (1994) Protein Sci. 3, 1058-1068] and that another Trp could in addition help to steer the nucleotide in the binding site, although it is not essential for the activity of CK. Raman and infrared spectra indicated that Mg-ADP binding does not involve large secondary structure changes. Only 3-4 residues absorbing in the amide I region are directly implicated in the Mg-ADP binding (corresponding to secondary structure changes less than 1%), suggesting that movement of protein domains due to Mg-nucleotide binding do not promote large secondary structure changes.

  4. 2,3-DPG-Hb complex: a hypothesis for an asymmetric binding.

    PubMed

    Pomponi, M; Bertonati, C; Fuglei, E; Wiig, O; Derocher, A E

    2000-05-15

    This study was undertaken to test the symmetry of 2,3-diphosphoglycerate (2,3-DPG) binding site in hemoglobin (Hb). From Arnone's study [A. Arnone, Nature (London) 237 (1972) 146] the 2,3-DPG binding site is located at the top of the cavity, that runs through the center of the deoxy-Hb molecule. However, it is possible that this symmetry reported by Arnone, for crystals of 2,3-DPG-Hb complex, might not be conserved in solution. In this paper, we report the 31P nuclear magnetic resonances of the 2,3-DPG interaction with Hb. The 2,3-DPG chemical shifts of the P2 and P3 resonance are both pH- and hemoglobin-dependent [protein from man, polar bear (Ursus maritimus), Arctic fox (Alopex lagopus) and bovine]. 2,3-DPG binds tightly to deoxyhemoglobin and weakly, nevertheless significantly, to oxyhemoglobin. In particular, our results suggest similar spatial position of the binding site of 2,3-DPG in both forms of Hb in solutions. However, the most unexpected result was the apparent loss of symmetry in the binding site, which might correlate with the ability of the hemoglobin to modulate its functional behavior. The different interactions of the phosphate groups indicate small differences in the quaternary structure of the different deoxy forms of hemoglobin. Given the above structural perturbation an asymmetric binding in the complex could justify, at least in part, different physiological properties of Hb. Regardless, functionally relevant effects of 2,3-DPG seem to be measured and best elucidated through solution studies.

  5. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  6. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  7. Phosphorylated nitrate reductase and 14-3-3 proteins. Site of interaction, effects of ions, and evidence for an amp-binding site on 14-3-3 proteins.

    PubMed

    Athwal, G S; Huber, J L; Huber, S C

    1998-11-01

    The inactivation of phosphorylated nitrate reductase (NR) by the binding of 14-3-3 proteins is one of a very few unambiguous biological functions for 14-3-3 proteins. We report here that serine and threonine residues at the +6 to +8 positions, relative to the known regulatory binding site involving serine-543, are important in the interaction with GF14omega, a recombinant plant 14-3-3. Also shown is that an increase in ionic strength with KCl or inorganic phosphate, known physical effectors of NR activity, directly disrupts the binding of protein and peptide ligands to 14-3-3 proteins. Increased ionic strength attributable to KCl caused a change in conformation of GF14omega, resulting in reduced surface hydrophobicity, as visualized with a fluorescent probe. Similarly, it is shown that the 5' isomer of AMP was specifically able to disrupt the inactive phosphorylated NR:14-3-3 complex. Using the 5'-AMP fluorescent analog trinitrophenyl-AMP, we show that there is a probable AMP-binding site on GF14omega.

  8. Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

    PubMed

    Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

    2015-02-10

    Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

  9. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  10. A Single Amino Acid Substitution in the Active Site of Escherichia coli Aspartate Transcarbamoylase Prevents the Allosteric Transition

    PubMed Central

    Stieglitz, Kimberly A.; Pastra-Landis, Styliani C.; Xia, Jiarong; Tsuruta, Hiro; Kantrowitz, Evan R.

    2005-01-01

    Modeling of the tetrahedral intermediate within the active site of Escherichia coli aspartate transcarbamoylase revealed a specific interaction with the side chain of Gln137, an interaction not previously observed in the structure of the X-ray enzyme in the presence of N-phosphonacetyl-L-aspartate (PALA). Previous site-specific mutagenesis experiments showed that when Gln137 was replaced by alanine, the resulting mutant enzyme (Q137A) exhibited approximately 50-fold less activity than the wild-type enzyme, exhibited no homotropic cooperativity, and the binding of both carbamoyl phosphate and aspartate were extremely compromised. To elucidate the structural alterations in the mutant enzyme that might lead to such pronounced changes in kinetic and binding properties, the Q137A enzyme was studied by time-resolved small-angle X-ray scattering and its structure was determined in the presence of PALA to 2.7Å resolution. Time-resolved small-angle X-ray scattering established that the natural substrates, carbamoyl phosphate and L-aspartate, do not induce in the Q137A enzyme the same conformational changes as observed for the wild-type enzyme, although the scattering pattern of the Q137A and wild-type enzymes in the presence of PALA were identical. The overall structure of the Q137A enzyme is similar to that of the R-state structure of wild-type enzyme with PALA bound. However, there are differences in the manner by which the Q137A enzyme coordinates PALA, especially in the side chain positions of Arg105 and His134. The replacement of Gln137 by Ala also has a dramatic effect on the electrostatics of the active site. These data taken together suggest that the side chain of Gln137 in the wild-type enzyme is required for the binding of carbamoyl phosphate in the proper orientation so as to induce conformational changes required for the creation of the high-affinity aspartate binding site. The inability of carbamoyl phosphate to create the high-affinity binding site in the Q137A enzyme results in an enzyme locked in the low activity low affinity T state. These results emphasize the absolute requirement of the binding of carbamoyl phosphate for the creation of the high-affinity aspartate binding site and for inducing the homotropic cooperativity in aspartate transcarbamoylase. PMID:15890205

  11. Hydrogen bonding-assisted interaction between amitriptyline hydrochloride and hemoglobin: spectroscopic and molecular dynamics studies.

    PubMed

    Maurya, Neha; Maurya, Jitendra Kumar; Kumari, Meena; Khan, Abbul Bashar; Dohare, Ravins; Patel, Rajan

    2017-05-01

    Herein, we have explored the interaction between amitriptyline hydrochloride (AMT) and hemoglobin (Hb), using steady-state and time-resolved fluorescence spectroscopy, UV-visible spectroscopy, and circular dichroism spectroscopy, in combination with molecular docking and molecular dynamic (MD) simulation methods. The steady-state fluorescence reveals the static quenching mechanism in the interaction system, which was further confirmed by UV-visible and time-resolved fluorescence spectroscopy. The binding constant, number of binding sites, and thermodynamic parameters viz. ΔG, ΔH, ΔS are also considered; result confirms that the binding of the AMT with Hb is a spontaneous process, involving hydrogen bonding and van der Waals interactions with a single binding site, as also confirmed by molecular docking study. Synchronous fluorescence, CD data, and MD simulation results contribute toward understanding the effect of AMT on Hb to interpret the conformational change in Hb upon binding in aqueous solution.

  12. The pathogen-related yeast protein Pry1, a member of the CAP protein superfamily, is a fatty acid-binding protein

    PubMed Central

    Darwiche, Rabih; Mène-Saffrané, Laurent; Gfeller, David; Asojo, Oluwatoyin A.; Schneiter, Roger

    2017-01-01

    Members of the CAP superfamily (cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins), also known as SCP superfamily (sperm-coating proteins), have been implicated in many physiological processes, including immune defenses, venom toxicity, and sperm maturation. Their mode of action, however, remains poorly understood. Three proteins of the CAP superfamily, Pry1, -2, and -3 (pathogen related in yeast), are encoded in the Saccharomyces cerevisiae genome. We have shown previously that Pry1 binds cholesterol in vitro and that Pry function is required for sterol secretion in yeast cells, indicating that members of this superfamily may generally bind sterols or related small hydrophobic compounds. On the other hand, tablysin-15, a CAP protein from the horsefly Tabanus yao, has been shown to bind leukotrienes and free fatty acids in vitro. Therefore, here we assessed whether the yeast Pry1 protein binds fatty acids. Computational modeling and site-directed mutagenesis indicated that the mode of fatty acid binding is conserved between tablysin-15 and Pry1. Pry1 bound fatty acids with micromolar affinity in vitro, and its function was essential for fatty acid export in cells lacking the acyl-CoA synthetases Faa1 and Faa4. Fatty acid binding of Pry1 is independent of its capacity to bind sterols, and the two sterol- and fatty acid-binding sites are nonoverlapping. These results indicate that some CAP family members, such as Pry1, can bind different lipids, particularly sterols and fatty acids, at distinct binding sites, suggesting that the CAP domain may serve as a stable, secreted protein domain that can accommodate multiple ligand-binding sites. PMID:28365570

  13. Tb3+-cleavage assays reveal specific Mg2+ binding sites necessary to pre-fold the btuB riboswitch for AdoCbl binding

    NASA Astrophysics Data System (ADS)

    Choudhary, Pallavi K.; Gallo, Sofia; Sigel, Roland K. O.

    2017-03-01

    Riboswitches are RNA elements that bind specific metabolites in order to regulate the gene expression involved in controlling the cellular concentration of the respective molecule or ion. Ligand recognition is mostly facilitated by Mg2+ mediated pre-organization of the riboswitch to an active tertiary fold. To predict these specific Mg2+ induced tertiary interactions of the btuB riboswitch from E. coli, we here report Mg2+ binding pockets in its aptameric part in both, the ligand-free and the ligand-bound form. An ensemble of weak and strong metal ion binding sites distributed over the entire aptamer was detected by terbium(III) cleavage assays, Tb3+ being an established Mg2+ mimic. Interestingly many of the Mn+ (n = 2 or 3) binding sites involve conserved bases within the class of coenzyme B12-binding riboswitches. Comparison with the published crystal structure of the coenzyme B12 riboswitch of S. thermophilum aided in identifying a common set of Mn+ binding sites that might be crucial for tertiary interactions involved in the organization of the aptamer. Our results suggest that Mn+ binding at strategic locations of the btuB riboswitch indeed facilitates the assembly of the binding pocket needed for ligand recognition. Binding of the specific ligand, coenzyme B12 (AdoCbl), to the btuB aptamer does however not lead to drastic alterations of these Mn+ binding cores, indicating the lack of a major rearrangement within the three-dimensional structure of the RNA. This finding is strengthened by Tb3+ mediated footprints of the riboswitch's structure in its ligand-free and ligand-bound state indicating that AdoCbl indeed induces local changes rather than a global structural rearrangement.

  14. Structural and Biochemical Characterization of Organotin and Organolead Compounds Binding to the Organomercurial Lyase MerB Provide New Insights into Its Mechanism of Carbon–Metal Bond Cleavage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wahba, Haytham M.; Stevenson, Michael J.; Mansour, Ahmed

    2017-01-03

    The organomercurial lyase MerB has the unique ability to cleave carbon–Hg bonds, and structural studies indicate that three residues in the active site (C96, D99, and C159 in E. coli MerB) play important roles in the carbon–Hg bond cleavage. However, the role of each residue in carbon–metal bond cleavage has not been well-defined. To do so, we have structurally and biophysically characterized the interaction of MerB with a series of organotin and organolead compounds. Studies with two known inhibitors of MerB, dimethyltin (DMT) and triethyltin (TET), reveal that they inhibit by different mechanisms. In both cases the initial binding ismore » to D99, but DMT subsequently binds to C96, which induces a conformation change in the active site. In contrast, diethyltin (DET) is a substrate for MerB and the SnIV product remains bound in the active site in a coordination similar to that of HgII following cleavage of organomercurial compounds. The results with analogous organolead compounds are similar in that trimethyllead (TML) is not cleaved and binds only to D99, whereas diethyllead (DEL) is a substrate and the PbIV product remains bound in the active site. Binding and cleavage is an exothermic reaction, while binding to D99 has negligible net heat flow. These results show that initial binding of organometallic compounds to MerB occurs at D99 followed, in some cases, by cleavage and loss of the organic moieties and binding of the metal ion product to C96, D99, and C159. The N-terminus of MerA is able to extract the bound PbVI but not the bound SnIV. These results suggest that MerB could be utilized for bioremediation applications, but certain organolead and organotin compounds may present an obstacle by inhibiting the enzyme.« less

  15. Heterogeneity of binding of muscarinic receptor antagonists in rat brain homogenates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, J.H.; el-Fakahany, E.E.

    1985-06-01

    The binding properties of (-)-(/sup 3/H)quinuclidinyl benzilate and (/sup 3/H) N-methylscopolamine to muscarinic acetylcholine receptors have been investigated in rat brain homogenates. The binding of both antagonists demonstrated high affinity and saturability. Analysis of the binding data resulted in linear Scatchard plots. However, (-)-(/sup 3/H)quinuclidinyl benzilate showed a significantly higher maximal binding capacity than that of (/sup 3/H)N-methylscopolamine. Displacement of both ligands with several muscarinic receptor antagonists resulted in competition curves in accordance with the law of mass-action for quinuclidinyl benzilate, atropine and scopolamine. A similar profile was found for the quaternary ammonium analogs of atropine and scopolamine when (/supmore » 3/H)N-methylscopolamine was used to label the receptors. However, when these hydrophilic antagonists were used to displace (-)-(/sup 3/H) quinuclidinyl benzilate binding, they showed interaction with high- and low-affinity binding sites. On the other hand, the nonclassical muscarinic receptor antagonist, pirenzepine, was able to displace both ligands from two binding sites. The present data are discussed in terms of the relationship of this anomalous heterogenity of binding of these hydrophilic muscarinic receptor antagonists and the proposed M1 and M2 receptor subtypes.« less

  16. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  17. The identification of hydrophobic sites on the surface of proteins using absorption difference spectroscopy of bromophenol blue.

    PubMed

    Bertsch, M; Mayburd, A L; Kassner, R J

    2003-02-15

    Hydrophobic sites on the surface of protein molecules are thought to have important functional roles. The identification of such sites can provide information about the function and mode of interaction with other cellular components. While the fluorescence enhancement of polarity-sensitive dyes has been useful in identifying hydrophobic sites on a number of targets, strong intrinsic quenching of Nile red and ANSA dye fluorescence is observed on binding to a cytochrome c('). Fluorescence quenching is also observed to take place in the presence of a variety of other biologically important molecules which can compromise the quantitative determination of binding constants. Absorption difference spectroscopy is shown not to be sensitive to the presence of fluorescence quenchers but sensitive enough to measure binding constants. The dye BPB is shown to bind to the same hydrophobic sites on proteins as polarity-sensitive fluorescence probes. The absorption spectrum of BPB is also observed to be polarity sensitive. A binding constant of 3x10(6)M(-1) for BPB to BSA has been measured by absorption difference spectroscopy. An empirical correlation is observed between the shape of the absorption difference spectrum of BPB and the polarity of the environment. The results indicate that absorption difference spectroscopy of BPB provides a valuable supplement to fluorescence for determining the presence of hydrophobic sites on the surface of proteins as well as a method for measuring binding constants.

  18. The Influence of Spatial Variation in Chromatin Density Determined by X-Ray Tomograms on the Time to Find DNA Binding Sites

    PubMed Central

    Larabell, Carolyn A.; Le Gros, Mark A.; McQueen, David M.; Peskin, Charles S.

    2014-01-01

    In this work, we examine how volume exclusion caused by regions of high chromatin density might influence the time required for proteins to find specific DNA binding sites. The spatial variation of chromatin density within mouse olfactory sensory neurons is determined from soft X-ray tomography reconstructions of five nuclei. We show that there is a division of the nuclear space into regions of low-density euchromatin and high-density heterochromatin. Volume exclusion experienced by a diffusing protein caused by this varying density of chromatin is modeled by a repulsive potential. The value of the potential at a given point in space is chosen to be proportional to the density of chromatin at that location. The constant of proportionality, called the volume exclusivity, provides a model parameter that determines the strength of volume exclusion. Numerical simulations demonstrate that the mean time for a protein to locate a binding site localized in euchromatin is minimized for a finite, nonzero volume exclusivity. For binding sites in heterochromatin, the mean time is minimized when the volume exclusivity is zero (the protein experiences no volume exclusion). An analytical theory is developed to explain these results. The theory suggests that for binding sites in euchromatin there is an optimal level of volume exclusivity that balances a reduction in the volume searched in finding the binding site, with the height of effective potential barriers the protein must cross during the search process. PMID:23955281

  19. The transformed glucocorticoid receptor has a lower steroid-binding affinity than the nontransformed receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemoto, Takayuki; Ohara-Nemoto, Yuko; Denis, M.

    1990-02-20

    High-salt treatment of cytosolic glucocorticoid receptor (GR) preparations reduces the steroid-binding ability of the receptor and induces the conversion of the receptor from a nontransformed (non-DNA-binding) 9S form to a transformed (DNA-binding) 4S entity. Therefore, the authors decided to investigate the possible relationship between these two phenomena. The binding of ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) to the 9S form was almost saturated at a concentration of 20 nM, whereas ({sup 3}H)TA was hardly bound to the 4S form at this concentration. The 4S form was efficiently labeled at 200 nM. Scatchard analysis of the GR showed the presence of twomore » types of binding sites. In the absence of molybdate, the ratio of the lower affinity site was increased, but the total number of binding sites was not modified. The GR with the low ({sup 3}H)TA-binding affinity bound to DNA-cellulose even in its unliganded state, whereas the form with the high affinity did not. These results indicate that the transformed GR has a reduced ({sup 3}H)TA-binding affinity as compared to the nontransformed GR. The steroid-binding domain (amino acids 477-777) and the DNA- and steroid-binding domains (amino acids 415-777) of the human GR were expressed in Escherichia coli as protein A fused proteins. Taken together, these results suggest that the component(s) associating with the nontransformed GR, possibly the heat shock protein hsp 90, play(s) an important role in stabilizing the GR in a high-affinity state for steroids.« less

  20. 3- and 4-O-sulfoconjugated and methylated dopamine: highly reduced binding affinity to dopamine D2 receptors in rat striatal membranes.

    PubMed

    Werle, E; Lenz, T; Strobel, G; Weicker, H

    1988-07-01

    The binding properties of 3- and 4-O-sulfo-conjugated dopamine (DA-3-O-S, DA-4-O-S) as well as 3-O-methylated dopamine (MT) to rat striatal dopamine D2 receptors were investigated. 3H-spiperone was used as a radioligand in the binding studies. In saturation binding experiments (+)butaclamol, which has been reported to bind to dopaminergic D2 and serotoninergic 5HT2 receptors, was used in conjunction with ketanserin and sulpiride, which preferentially label 5HT2 and D2 receptors, respectively, in order to discriminate between 3H-spiperone binding to D2 and to 5HT2 receptors. Under our particular membrane preparation and assay conditions, 3H-spiperone binds to D2 and 5HT2 receptors with a maximal binding capacity (Bmax) of 340 fmol/mg protein in proportions of about 75%:25% with similar dissociation constants KD (35 pmol/l; 43 pmol/l). This result was verified by the biphasic competition curve of ketanserin, which revealed about 20% high (KD = 24 nmol/l) and 80% low (KD = 420 nmol/l) affinity binding sites corresponding to 5HT2 and D2 receptors, respectively. Therefore, all further competition experiments at a tracer concentration of 50 pmol/l were performed in the presence of 0.1 mumol/l ketanserin to mask the 5HT2 receptors. DA competition curves were best fitted assuming two binding sites, with high (KH = 0.12 mumol/l) and low (KL = 18 mumol/l) affinity, present in a ratio of 3:1. The high affinity binding sites were interconvertible by 100 mumol/l guanyl-5-yl imidodiphosphate [Gpp(NH)p], resulting in a homogenous affinity state of DA receptors (KD = 2.8 mumol/l).2+ off

  1. Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

    PubMed

    Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

    2017-03-14

    Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

  2. Studies on the cellular localization of spinal cord substance P receptors.

    PubMed

    Helke, C J; Charlton, C G; Wiley, R G

    1986-10-01

    Substance P-immunoreactivity and specific substance P binding sites are present in the spinal cord. Receptor autoradiography showed the discrete localization of substance P binding sites in both sensory and motor regions of the spinal cord and functional studies suggested an important role for substance P receptor activation in autonomic outflow, nociception, respiration and somatic motor function. In the current studies, we investigated the cellular localization of substance P binding sites in rat spinal cord using light microscopic autoradiography combined with several lesioning techniques. Unilateral injections of the suicide transport agent, ricin, into the superior cervical ganglion reduced substance P binding and cholinesterase-stained preganglionic sympathetic neurons in the intermediolateral cell column. However, unilateral electrolytic lesions of ventral medullary substance P neurons which project to the intermediolateral cell column did not alter the density of substance P binding in the intermediolateral cell column. Likewise, 6-hydroxydopamine and 5,7-dihydroxytryptamine, which destroy noradrenergic and serotonergic nerve terminals, did not reduce the substance P binding in the intermediolateral cell column. It appears, therefore, that the substance P binding sites are located postsynaptically on preganglionic sympathetic neurons rather than presynaptically on substance P-immunoreactive processes (i.e. as autoreceptors) or on monoamine nerve terminals. Unilateral injections of ricin into the phrenic nerve resulted in the unilateral destruction of phrenic motor neurons in the cervical spinal cord and caused a marked reduction in the substance P binding in the nucleus. Likewise, sciatic nerve injections of ricin caused a loss of associated motor neurons in the lateral portion of the ventral horn of the lumbar spinal cord and a reduction in the substance P binding. Sciatic nerve injections of ricin also destroyed afferent nerves of the associated dorsal root ganglia and increased the density of substance P binding in the dorsal horn. Capsaicin, which destroys small diameter primary sensory neurons, similarly increased the substance P binding in the dorsal horn. These studies show that the cellular localization of substance P binding sites can be determined by analysis of changes in substance P binding to discrete regions of spinal cord after selective lesions of specific groups of neurons. The data show the presence of substance P binding sites on preganglionic sympathetic neurons in the intermediolateral cell column and on somatic motor neurons in the ventral horn, including the phrenic motor nucleus.(ABSTRACT TRUNCATED AT 400 WORDS)

  3. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  4. Structural basis for allosteric cross-talk between the asymmetric nucleotide binding sites of a heterodimeric ABC exporter.

    PubMed

    Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A

    2014-07-29

    ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.

  5. Combining solvent thermodynamic profiles with functionality maps of the Hsp90 binding site to predict the displacement of water molecules.

    PubMed

    Haider, Kamran; Huggins, David J

    2013-10-28

    Intermolecular interactions in the aqueous phase must compete with the interactions between the two binding partners and their solvating water molecules. In biological systems, water molecules in protein binding sites cluster at well-defined hydration sites and can form strong hydrogen-bonding interactions with backbone and side-chain atoms. Displacement of such water molecules is only favorable when the ligand can form strong compensating hydrogen bonds. Conversely, water molecules in hydrophobic regions of protein binding sites make only weak interactions, and the requirements for favorable displacement are less stringent. The propensity of water molecules for displacement can be identified using inhomogeneous fluid solvation theory (IFST), a statistical mechanical method that decomposes the solvation free energy of a solute into the contributions from different spatial regions and identifies potential binding hotspots. In this study, we employed IFST to study the displacement of water molecules from the ATP binding site of Hsp90, using a test set of 103 ligands. The predicted contribution of a hydration site to the hydration free energy was found to correlate well with the observed displacement. Additionally, we investigated if this correlation could be improved by using the energetic scores of favorable probe groups binding at the location of hydration sites, derived from a multiple copy simultaneous search (MCSS) method. The probe binding scores were not highly predictive of the observed displacement and did not improve the predictivity when used in combination with IFST-based hydration free energies. The results show that IFST alone can be used to reliably predict the observed displacement of water molecules in Hsp90. However, MCSS can augment IFST calculations by suggesting which functional groups should be used to replace highly displaceable water molecules. Such an approach could be very useful in improving the hit-to-lead process for new drug targets.

  6. Analysis of flavin oxidation and electron-transfer inhibition in Plasmodium falciparum dihydroorotate dehydrogenase.

    PubMed

    Malmquist, Nicholas A; Gujjar, Ramesh; Rathod, Pradipsinh K; Phillips, Margaret A

    2008-02-26

    Plasmodium falciparum dihydroorotate dehydrogenase (pfDHODH) is a flavin-dependent mitochondrial enzyme that provides the only route to pyrimidine biosynthesis in the parasite. Clinically significant inhibitors of human DHODH (e.g., A77 1726) bind to a pocket on the opposite face of the flavin cofactor from dihydroorotate (DHO). This pocket demonstrates considerable sequence variability, which has allowed species-specific inhibitors of the malarial enzyme to be identified. Ubiquinone (CoQ), the physiological oxidant in the reaction, has been postulated to bind this site despite a lack of structural evidence. To more clearly define the residues involved in CoQ binding and catalysis, we undertook site-directed mutagenesis of seven residues in the structurally defined A77 1726 binding site, which we term the species-selective inhibitor site. Mutation of several of these residues (H185, F188, and F227) to Ala substantially decreased the affinity of pfDHODH-specific inhibitors (40-240-fold). In contrast, only a modest increase in the Kmapp for CoQ was observed, although mutation of Y528 in particular caused a substantial reduction in kcat (40-100-fold decrease). Pre-steady-state kinetic analysis by single wavelength stopped-flow spectroscopy showed that the mutations had no effect on the rate of the DHO-dependent reductive half-reaction, but most reduced the rate of the CoQ-dependent flavin oxidation step (3-20-fold decrease), while not significantly altering the Kdox for CoQ. As with the mutants, inhibitors that bind this site block the CoQ-dependent oxidative half-reaction without affecting the DHO-dependent step. These results identify residues involved in inhibitor binding and electron transfer to CoQ. Importantly, the data provide compelling evidence that the binding sites for CoQ and species-selective site inhibitors do not overlap, and they suggest instead that inhibitors act either by blocking the electron path between flavin and CoQ or by stabilizing a conformation that excludes CoQ binding.

  7. Two distinctive β subunits are separately involved in two binding sites of imidacloprid with different affinities in Locusta migratoria manilensis.

    PubMed

    Bao, Haibo; Liu, Yang; Zhang, Yixi; Liu, Zewen

    2017-08-01

    Due to great diversity of nicotinic acetylcholine receptor (nAChR) subtypes in insects, one β subunit may be contained in numerous nAChR subtypes. In the locust Locusta migratoria, a model insect species with agricultural importance, the third β subunits (Locβ3) was identified in this study, which reveals at least three β subunits in this insect species. Imidacloprid was found to bind nAChRs in L. migratoria central nervous system at two sites with different affinities, with K d values of 0.16 and 10.31nM. The specific antisera (L1-1, L2-1 and L3-1) were raised against fusion proteins at the large cytoplasmic loop of Locβ1, Locβ2 and Locβ3 respectively. Specific immunodepletion of Locβ1 with antiserum L1-1 resulted in the selective loss of the low affinity binding site for imidacloprid, whereas the immunodepletion of Locβ3 with L3-1 caused the selective loss of the high affinity site. Dual immunodepletion with L1-1 and L3-1 could completely abolish imidacloprid binding. In contrast, the immunodepletion of Locβ2 had no significant effect on the specific [ 3 H]imidacloprid binding. Taken together, these data indicated that Locβ1 and Locβ3 were respectively contained in the low- and high-affinity binding sites for imidacloprid in L. migratoria, which is different to the previous finding in Nilaparvata lugens that Nlβ1 was in two binding sites for imidacloprid. The involvement of two β subunits separately in two binding sites may decrease the risk of imidacloprid resistance due to putative point mutations in β subunits in L. migratoria. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Steiner, B.; Cousot, D.; Trzeciak, A.

    The platelet glycoprotein IIb-IIIa complex (GP IIb-IIIa) is a member of the integrin receptor family that recognizes adhesive proteins containing the Arg-Gly-Asp (RGD) sequence. In the present study the binding characteristics of the synthetic hexapeptide Tyr-Asn-Arg-Gly-Asp-Ser (YNRGDS, a sequence present in the fibrinogen alpha-chain at position 570-575) to purified GP IIb-IIIa were determined by equilibrium dialysis. The binding of 125I-YNRGDS to GP IIb-IIIa was specific, saturable, and reversible. The apparent dissociation constant was 1.0 +/- 0.2 microM, and the maximal binding capacity was 0.92 +/- 0.02 mol of 125I-YNRGDS/mol of GP IIb-IIIa, indicating that GP IIb-IIIa contains a single bindingmore » site for RGD peptides. The binding of 125I-YNRGDS to purified GP IIb-IIIa showed many of the characteristics of fibrinogen binding to activated platelets: the binding was inhibited by fibrinogen, by the monoclonal antibody A2A9, and by the dodecapeptide from the C terminus of the fibrinogen gamma-chain. In addition, the binding of 125I-YNRGDS to GP IIb-IIIa was divalent cation-dependent. Our data suggest that two divalent cation binding sites must be occupied for YNRGDS to bind: one site is specific for calcium and is saturated at 1 microM free Ca2+, whereas the other site is less specific and reaches saturation at millimolar concentrations of either Ca2+ or Mg2+. The results of the present study support the hypothesis that the RGD domains within the adhesive proteins are responsible for their binding to GP IIb-IIIa.« less

  9. Ligand deconstruction: Why some fragment binding positions are conserved and others are not

    PubMed Central

    Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

    2015-01-01

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

  10. Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

    PubMed Central

    2015-01-01

    The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

  11. The increased binding affinity of curcumin with human serum albumin in the presence of rutin and baicalin: A potential for drug delivery system

    NASA Astrophysics Data System (ADS)

    Liu, Bing-Mi; Zhang, Jun; Hao, Ai-Jun; Xu, Liang; Wang, Dan; Ji, Hui; Sun, Shi-Jie; Chen, Bo-Qi; Liu, Bin

    2016-02-01

    The impacts of rutin and baicalin on the interaction of curcumin (CU) with human serum albumin (HSA) were investigated by fluorescence and circular dichroism (CD) spectroscopies under imitated physiological conditions. The results showed that the fluorescence quenching of HSA by CU was a simultaneous static and dynamic quenching process, irrespective of the presence or absence of flavonoids. The binding constants between CU and HSA in the absence and presence of rutin and baicalin were 2.268 × 105 M- 1, 3.062 × 105 M- 1, and 3.271 × 105 M- 1, indicating that the binding affinity was increased in the case of two flavonoids. Furthermore, the binding distance determined according to Förster's theory was decreased in the presence of flavonoids. Combined with the fact that flavonoids and CU have the same binding site (site I), it can be concluded that they may simultaneously bind in different regions in site I, and formed a ternary complex of flavonoid-HSA-CU. Meanwhile, the results of fluorescence quenching, CD and three-dimensional fluorescence spectra revealed that flavonoids further strengthened the microenvironmental and conformational changes of HSA induced by CU binding. Therefore, it is possible to develop a novel complex involving CU, flavonoid and HSA for CU delivery. The work may provide some valuable information in terms of improving the poor bioavailabiliy of CU.

  12. Structure-activity relationship of ibogaine analogs interacting with nicotinic acetylcholine receptors in different conformational states.

    PubMed

    Arias, Hugo R; Feuerbach, Dominik; Targowska-Duda, Katarzyna M; Jozwiak, Krzysztof

    2011-09-01

    The interaction of ibogaine analogs with nicotinic acetylcholine receptors (AChRs) in different conformational states was studied by functional and structural approaches. The results established that ibogaine analogs: (a) inhibit (±)-epibatidine-induced Ca²⁺ influx in human embryonic muscle AChRs with the following potency sequence (IC(50) in μM): (±)-18-methylaminocoronaridine (5.9±0.3)∼(±)-18-methoxycoronaridine (18-MC) (6.8±0.8)>(-)-ibogaine (17±3)∼(+)-catharanthine (20±1)>(±)-albifloranine (46±13), (b) bind to the [³H]TCP binding site with higher affinity when the Torpedo AChR is in the desensitized state compared to that in the resting state. Similar results were obtained using [³H]18-MC. These and docking results suggest a steric interaction between TCP and ibogaine analogs for the same site, (c) enhance [³H]cytisine binding to resting but not to desensitized AChRs, with desensitizing potencies (apparent EC₅₀) that correlate very well with the pK(i) values in the desensitized state, and (d) there are good bilinear correlations between the ligand molecular volumes and their affinities in the desensitized and resting states, with an optimal volume of ∼345 ų for the ibogaine site. These results indicate that the size of the binding sites for ibogaine analogs, located between the serine and nonpolar rings and shared with TCP, is an important structural feature for binding and for inducing desensitization. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. An ensemble model of competitive multi-factor binding of the genome

    PubMed Central

    Wasson, Todd; Hartemink, Alexander J.

    2009-01-01

    Hundreds of different factors adorn the eukaryotic genome, binding to it in large number. These DNA binding factors (DBFs) include nucleosomes, transcription factors (TFs), and other proteins and protein complexes, such as the origin recognition complex (ORC). DBFs compete with one another for binding along the genome, yet many current models of genome binding do not consider different types of DBFs together simultaneously. Additionally, binding is a stochastic process that results in a continuum of binding probabilities at any position along the genome, but many current models tend to consider positions as being either binding sites or not. Here, we present a model that allows a multitude of DBFs, each at different concentrations, to compete with one another for binding sites along the genome. The result is an “occupancy profile,” a probabilistic description of the DNA occupancy of each factor at each position. We implement our model efficiently as the software package COMPETE. We demonstrate genome-wide and at specific loci how modeling nucleosome binding alters TF binding, and vice versa, and illustrate how factor concentration influences binding occupancy. Binding cooperativity between nearby TFs arises implicitly via mutual competition with nucleosomes. Our method applies not only to TFs, but also recapitulates known occupancy profiles of a well-studied replication origin with and without ORC binding. Importantly, the sequence preferences our model takes as input are derived from in vitro experiments. This ensures that the calculated occupancy profiles are the result of the forces of competition represented explicitly in our model and the inherent sequence affinities of the constituent DBFs. PMID:19720867

  14. Zinc binding in HDAC inhibitors: a DFT study.

    PubMed

    Wang, Difei; Helquist, Paul; Wiest, Olaf

    2007-07-06

    Histone deacetylases (HDACs) are attractive targets for the treatment of cancers and a variety of other diseases. Most currently studied HDAC inhibitors contain hydroxamic acids, which are potentially problematic in the development of practical drugs. DFT calculations of the binding modes and free energies of binding for a variety of other functionalities in a model active site of HDAC are described. The protonation state of hydroxamic acids in the active site and the origin of the high affinity are discussed. These results emphasize the importance of a carefully chosen pKa for zinc binding and provide guidance for the design of novel, non-hydroxamic acid HDAC inhibitors.

  15. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  16. A novel methodological approach for the analysis of host-ligand interactions.

    PubMed

    Strat, Daniela; Missailidis, Sotiris; Drake, Alex F

    2007-02-02

    Traditional analysis of drug-binding data relies upon the Scatchard formalism. These methods rely upon the fitting of a linear equation providing intercept and gradient data that relate to physical properties, such as the binding constant, cooperativity coefficients and number of binding sites. However, the existence of different binding modes with different binding constants makes the implementation of these models difficult. This article describes a novel approach to the binding model of host-ligand interactions by using a derived analytical function describing the observed signal. The benefit of this method is that physically significant parameters, that is, binding constants and number of binding sites, are automatically derived by the use of a minimisation routine. This methodology was utilised to analyse the interactions between a novel antitumour agent and DNA. An optical spectroscopy study confirms that the pentacyclic acridine derivative (DH208) binds to nucleic acids. Two binding modes can be identified: a stronger one that involves intercalation and a weaker one that involves oriented outer-sphere binding. In both cases the plane of the bound acridine ring is parallel to the nucleic acid bases, orthogonal to the phosphate backbone. Ultraviolet (UV) and circular dichroism (CD) data were fitted using the proposed model. The binding constants and the number of binding sites derived from the model remained consistent across the different techniques used. The different wavelengths at which the measurements were made maintained the coherence of the results.

  17. Substrate binding interferes with active site conformational dynamics in endoglucanase Cel5A from Thermobifida fusca.

    PubMed

    Jiang, Xukai; Wang, Yuying; Xu, Limei; Chen, Guanjun; Wang, Lushan

    2017-09-09

    The role of protein dynamics in enzyme catalysis is one of the most active areas in current enzymological research. Here, using endoglucanase Cel5A from Thermobifida fusca (TfCel5A) as a model, we applied molecular dynamics simulations to explore the dynamic behavior of the enzyme upon substrate binding. The collective motions of the active site revealed that the mechanism of TfCel5A substrate binding can likely be described by the conformational-selection model; however, we observed that the conformations of active site residues changed differently along with substrate binding. Although most active site residues retained their native conformational ensemble, some (Tyr163 and Glu355) generated newly induced conformations, whereas others (Phe162 and Tyr189) exhibited shifts in the equilibration of their conformational distributions. These results showed that TfCel5A substrate binding relied on a hybrid mechanism involving induced fit and conformational selection. Interestingly, we found that TfCel5A active site could only partly rebalance its conformational dynamics upon substrate dissociation within the same simulation time, which implies that the conformational rebalance upon substrate dissociation is likely more difficult than the conformational selection upon substrate binding at least in the view of the time required. Our findings offer new insight into enzyme catalysis and potential applications for future protein engineering. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Reduction of GABA/sub B/ receptor binding induced by climbing fiber degeneration in the rat cerebellum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kato, K.; Fukuda, H.

    1985-07-22

    When the rat cerebellar climbing fibers degenerated, as induced by lesioning the inferior olive with 3-acetylpyridine (3-AP), GABA/sub B/ receptor binding determined with /sup 3/H-(+/-)baclofen was reduced in the cerebellum but not in the cerebral cortex of rats. Computer analysis of saturation data revealed two components of the binding sites, and indicated that decrease of the binding in the cerebellum was due to reduction in receptor density, mainly of the high-affinity sites, the B/sub max/ of which was reduced to one-third that in the control animals. In vitro treatment with 3-AP, of the membranes prepared from either the cerebellum ormore » the cerebral cortex, induced no alteration in the binding sites, thereby indicating that the alteration of GABA/sub B/ sites induced by in vivo treatment with 3-AP is not due to a direct action of 3-AP on the receptor. GABA/sub A/ and benzodiazepine receptor binding labelled with /sup 3/H-muscimol and /sup 3/H-diazepam, respectively, in both of brain regions was not affected by destruction of the inferior olive. These results provide evidence that some of the GABA/sub B/ sites but neither GABA/sub A/ nor benzodiazepine receptors in the cerebellum are located at the climbing fiber terminals. 28 references, 4 figures, 2 tables.« less

  19. Fluorescence spectroscopic and molecular docking studies of the binding interaction between the new anaplastic lymphoma kinase inhibitor crizotinib and bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Abdelhameed, Ali S.; Alanazi, Amer M.; Bakheit, Ahmed H.; Darwish, Hany W.; Ghabbour, Hazem A.; Darwish, Ibrahim A.

    2017-01-01

    Binding of the recently introduced anti-cancer drug, crizotinib (CRB) with the bovine serum albumin (BSA) was comprehensively studied with the aid of fluorescence and UV-Vis spectroscopic as well as molecular docking techniques. The collective results of the study under the simulated physiological conditions proposed a static type of binding occurring between the CRB and BSA with binding constants of 104 L mol- 1. BSA conformational changes were investigated using three dimensional (3D) and synchronous fluorescence measurements. Moreover, the results of site marker competitive experiments and molecular docking, it could be deduced that CRB was inserted into the subdomain IIA (site I) of BSA yielding a more stabilized system. This was further confirmed with the molecular docking results which revealed that CRB is located in the active site residues Try149, Glu152, Ser191, Arg194, Arg198, Trp213, Arg217, Arg256, His287, Ala290, Glu291, Ser343, Asp450 within a radius of 6 Å. Combining the molecular docking studies and the computed thermodynamic parameters, it can be inferred that hydrophobic and electrostatic interactions are the major binding forces involved in formation of the CRB-BSA complex.

  20. Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

    PubMed

    Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

  1. Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

    PubMed Central

    Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

  2. Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site

    PubMed Central

    Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J.

    2016-01-01

    ABSTRACT Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. IMPORTANCE We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. PMID:26764003

  3. Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site.

    PubMed

    Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J; Hogle, James M

    2016-01-13

    Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  4. Characterization of little skate (Leucoraja erinacea) recombinant transthyretin: Zinc-dependent 3,3',5-triiodo-l-thyronine binding.

    PubMed

    Suzuki, Shunsuke; Kasai, Kentaro; Yamauchi, Kiyoshi

    2015-01-01

    Transthyretin (TTR) diverged from an ancestral 5-hydroxyisourate hydrolase (HIUHase) by gene duplication at some early stage of chordate evolution. To clarify how TTR had participated in the thyroid system as an extracellular thyroid hormone (TH) binding protein, TH binding properties of recombinant little skate Leucoraja erinacea TTR was investigated. At the amino acid level, skate TTR showed 37-46% identities with the other vertebrate TTRs. Because the skate TTR had a unique histidine-rich segment in the N-terminal region, it could be purified by Ni-affinity chromatography. The skate TTR was a 46-kDa homotetramer of 14.5kDa subunits, and had one order of magnitude higher affinity for 3,3',5-triiodo-l-thyronine (T3) and some halogenated phenols than for l-thyroxine. However, the skate TTR had no HIUHase activity. Ethylenediaminetetraacetic acid (EDTA) treatment inhibited [(125)I]T3 binding activity whereas the addition of Zn(2+) to the EDTA-treated TTR recovered [(125)I]T3 binding activity in a Zn(2+) concentration-dependent manner. Scatchard analysis revealed the presence of two classes of binding site for T3, with dissociation constants of 0.24 and 17nM. However, the high-affinity sites were completely abolished with 1mM EDTA, whereas the remaining low-affinity sites decreased binding capacity. The number of zinc per TTR was quantified to be 4.5-6.3. Our results suggest that skate TTR has tight Zn(2+)-binding sites, which are essential for T3 binding to at least the high-affinity sites. Zn(2+) binding to the N-terminal histidine-rich segment may play an important role in acquisition or reinforcement of TH binding ability during early evolution of TTR. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Insights on Na(+) binding and conformational dynamics in multidrug and toxic compound extrusion transporter NorM.

    PubMed

    Song, Jianing; Ji, Changge; Zhang, John Z H

    2014-02-01

    MATE (multidrug and toxic compound extrusion) transporter proteins mediate metabolite transport in plants and multidrug resistance in bacteria and mammals. MATE transporter NorM from Vibrio cholerae is an antiporter that is driven by Na+ gradient to extrude the substrates. To understand the molecular mechanism of Na+-substrate exchange, molecular dynamics simulation was performed to study conformational changes of both wild-type and mutant NorM with and without cation bindings. Our results show that NorM is able to bind two Na(+) ions simultaneously, one to each of the carboxylic groups of E255 and D371 in the binding pocket. Furthermore, this di-Na(+) binding state is likely more efficient for conformational changes of NorM_VC toward the inward-facing conformation than single-Na(+) binding state. The observation of two Na(+) binding sites of NorM_VC is consistent with the previous study that two sites for ion binding (denoted as Na1/Na2 sites) are found in the transporter LeuT and BetP, another two secondary transporters. Taken together, our findings shed light on the structure rearrangements of NorM on Na(+) binding and enrich our knowledge of the transport mechanism of secondary transporters. Copyright © 2013 Wiley Periodicals, Inc.

  6. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  7. Development of a sugar-binding residue prediction system from protein sequences using support vector machine.

    PubMed

    Banno, Masaki; Komiyama, Yusuke; Cao, Wei; Oku, Yuya; Ueki, Kokoro; Sumikoshi, Kazuya; Nakamura, Shugo; Terada, Tohru; Shimizu, Kentaro

    2017-02-01

    Several methods have been proposed for protein-sugar binding site prediction using machine learning algorithms. However, they are not effective to learn various properties of binding site residues caused by various interactions between proteins and sugars. In this study, we classified sugars into acidic and nonacidic sugars and showed that their binding sites have different amino acid occurrence frequencies. By using this result, we developed sugar-binding residue predictors dedicated to the two classes of sugars: an acid sugar binding predictor and a nonacidic sugar binding predictor. We also developed a combination predictor which combines the results of the two predictors. We showed that when a sugar is known to be an acidic sugar, the acidic sugar binding predictor achieves the best performance, and showed that when a sugar is known to be a nonacidic sugar or is not known to be either of the two classes, the combination predictor achieves the best performance. Our method uses only amino acid sequences for prediction. Support vector machine was used as a machine learning algorithm and the position-specific scoring matrix created by the position-specific iterative basic local alignment search tool was used as the feature vector. We evaluated the performance of the predictors using five-fold cross-validation. We have launched our system, as an open source freeware tool on the GitHub repository (https://doi.org/10.5281/zenodo.61513). Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Investigation of the Binding Profiles of AZD2184 and Thioflavin T with Amyloid-β(1-42) Fibril by Molecular Docking and Molecular Dynamics Methods.

    PubMed

    Kuang, Guanglin; Murugan, N Arul; Tu, Yaoquan; Nordberg, Agneta; Ågren, Hans

    2015-09-03

    Detecting deposits of amyloid β fibrils in the brain is of paramount importance for an early diagnosis of Alzheimer's disease. A number of PET tracers have been developed for amyloid imaging, but many suffer from poor specificity and large signal to background ratio. Design of tracers with specificity and improved binding affinity requires knowledge about various potential binding sites in the amyloid β fibril available for the tracers and the nature of the local microenvironment of these sites. In this study we investigate the local structure of fibrils using two important probes, namely, thioflavin T (a fluorescent probe) and AZD2184 (a PET tracer). The target structures for amyloid-β(1-42) fibril are based on reported NMR solution models. By explicitly considering the effect of fibril flexibility on the available binding sites for all these models, the binding affinity of these probes has been investigated. The binding profiles of AZD2184 and thioflavin T were studied by molecular docking and molecular dynamics simulation methods. The two compounds were found to bind at the same sites of the fibril: three of which are within the fibril, and one is on the two sides of the Met35 residue on the surface. The binding affinity of AZD2184 and thioflavin T is found to be higher at the core sites than on the surface due to more contact residues. The binding affinity of AZD2184 is much higher than that of thioflavin T at every site due to electrostatic interaction and spatial restriction, which is in good agreement with experimental observation. However, the structural change of thioflavin T is much more significant than that of AZD2184, which is the chemical basis for its usage as a fluorescent probe. The ramifications of these results for the design and optimization of PET radioligands and fluorescent probes are briefly discussed.

  9. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  10. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  11. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  12. Actin-induced dimerization of palladin promotes actin-bundling

    PubMed Central

    Vattepu, Ravi; Yadav, Rahul; Beck, Moriah R

    2015-01-01

    A subset of actin binding proteins is able to form crosslinks between two or more actin filaments, thus producing structures of parallel or networked bundles. These actin crosslinking proteins interact with actin through either bivalent binding or dimerization. We recently identified two binding sites within the actin binding domain of palladin, an actin crosslinking protein that plays an important role in normal cell adhesion and motility during wound healing and embryonic development. In this study, we show that actin induces dimerization of palladin. Furthermore, the extent of dimerization reflects earlier comparisons of actin binding and bundling between different domains of palladin. On the basis of these results we hypothesized that actin binding may promote a conformational change that results in dimerization of palladin, which in turn may drive the crosslinking of actin filaments. The proximal distance between two actin binding sites on crosslinking proteins determines the ultrastructural properties of the filament network, therefore we also explored interdomain interactions using a combination of chemical crosslinking experiments and actin cosedimentation assays. Limited proteolysis data reveals that palladin is less susceptible to enzyme digestion after actin binding. Our results suggest that domain movements in palladin are necessary for interactions with actin and are induced by interactions with actin filaments. Accordingly, we put forth a model linking the structural changes to functional dynamics. PMID:25307943

  13. Evidence for a single class of somatostatin receptors in ground squirrel cerebral cortex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krantic, S.; Petrovic, V.M.; Quirion, R.

    1989-01-01

    In the present study we characterized high-affinity somatostatin (SRIF) binding sites (Kd = 2.06 +/- 0.32 nM and Bmax = 295 +/- 28 fmol/mg protein) in cerebral cortex membrane preparations of European ground squirrel using /sup 125/I-(Tyr0-D-Trp8)-SRIF14 as a radioligand. The inhibition of radioligand specific binding by SRIF14, as well as by its agonists (SRIF28, Tyr0-D-Trp8-SRIF14, SMS 201 995) was complete and monophasic, thus revealing a single population of somatostatinergic binding sites. Radioautographic analysis of /sup 125/I-(Tyr0-D-Trp8)-SRIF14 labeled brain sections confirmed the results of our biochemical study. The homogeneity of SRIF binding sites in the ground squirrel neocortex was notmore » dependent on the animal's life-cycle phase.« less

  14. Biosorption of heavy metal ions on Rhodobacter sphaeroides and Alcaligenes eutrophus H16

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seki, Hideshi; Suzuki, Akira; Mitsueda, Shinichiro

    1998-01-15

    A fundamental study of the application of bacteria to the recovery of toxic heavy metals from aqueous environments was carried out. The biosorption characteristics of cadmium and lead ions were determined with purple nonsulfur bacteria, Rhodobacter sphaeroides and hydrogen bacteria, Alcaligenes eutrophus H16 that were inactivated by steam sterilization. A simplified version of the metal binding model proposed by Plette et al. was used for the description of meal binding data. The results showed that the biosorption of bivalent metal ions to whole cell bodies of the bacteria was due to monodentate binding to two different types of acidic sites:more » carboxilic and phosphatic-type sites. The number of metal binding sites of A. eutrophus was 2.4-fold larger than that of R. sphaeroides.« less

  15. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  16. Alterations in L-Glutamate Binding in Alzheimer's and Huntington's Diseases

    NASA Astrophysics Data System (ADS)

    Greenamyre, J. Timothy; Penney, John B.; Young, Anne B.; D'Amato, Constance J.; Hicks, Samuel P.; Shoulson, Ira

    1985-03-01

    Brain sections from patients who had died with senile dementia of the Alzheimer's type (SDAT), Huntington's disease (HD), or no neurologic disease were studied by autoradiography to measure sodium-independent L-[3H]glutamate binding. In brain sections from SDAT patients, glutamate binding was normal in the caudate, putamen, and claustrum but was lower than normal in the cortex. The decreased cortical binding represented a reduction in numbers of binding sites, not a change in binding affinity, and appeared to be the result of a specific decrease in numbers of the low-affinity quisqualate binding site. No significant changes in cortical binding of other ligands were observed. In brains from Huntington's disease patients, glutamate binding was lower in the caudate and putamen than in the same regions of brains from control and SDAT patients but was normal in the cortex. It is possible that development of positron-emitting probes for glutamate receptors may permit diagnosis of SDAT in vivo by means of positron emission tomographic scanning.

  17. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  18. Insights into the interaction of methotrexate and human serum albumin: A spectroscopic and molecular modeling approach.

    PubMed

    Cheng, Li-Yang; Fang, Min; Bai, Ai-Min; Ouyang, Yu; Hu, Yan-Jun

    2017-08-01

    In this study, fluorescence spectroscopy and molecular modeling approaches were employed to investigate the binding of methotrexate to human serum albumin (HSA) under physiological conditions. From the mechanism, it was demonstrated that fluorescence quenching of HSA by methotrexate results from the formation of a methotrexate/HSA complex. Binding parameters calculated using the Stern-Volmer method and the Scatchard method showed that methotrexate binds to HSA with binding affinities in the order 10 4  L·mol -1 . Thermodynamic parameter studies revealed that the binding reaction is spontaneous, and that hydrogen bonds and van der Waals interactions play a major role in the reaction. Site marker competitive displacement experiments and a molecular modeling approach demonstrated that methotrexate binds with appropriate affinity to site I (subdomain IIA) of HSA. Furthermore, we discuss some factors that influence methotrexate binding to HSA. Copyright © 2017 John Wiley & Sons, Ltd.

  19. Polymorphisms A387P in thrombospondin-4 and N700S in thrombospondin-1 perturb calcium binding sites.

    PubMed

    Stenina, Olga I; Ustinov, Valentin; Krukovets, Irene; Marinic, Tina; Topol, Eric J; Plow, Edward F

    2005-11-01

    Recent genetic studies have associated members of the thrombospondin (TSP) gene family with premature cardiovascular disease. The disease-associated polymorphisms lead to single amino acid changes in TSP-4 (A387P) and TSP-1 (N700S). These substitutions reside in adjacent domains of these highly homologous proteins. Secondary structural predictive programs and the homology of the domains harboring these amino acid substitutions to those in other proteins pointed to potential alterations of putative Ca2+ binding sites that reside in close proximity to the polymorphic amino acids. Since Ca2+ binding is critical for the structure and function of TSP family members, direct evidence for differences in Ca2+ binding by the polymorphic forms was sought. Using synthetic peptides and purified recombinant variant fragments bearing the amino acid substitutions, we measured differences in Tb3+ luminescence as an index of Ca2+ binding. The Tb3+ binding constants placed the TSP-1 region affected by N700S polymorphism among other high-affinity Ca2+ binding sites. The affinity of Ca2+ binding was lower for peptides (3.5-fold) and recombinant fragments (10-fold) containing the S700 vs. the N700 form. In TSP-4, the P387 form acquired an additional Ca2+ binding site absent in the A387 form. The results of our study suggest that both substitutions (A387P in TSP-4 and N700S in TSP-1) alter Ca2+ binding properties. Since these substitutions exert the opposite effects on Ca2+ binding, a decrease in TSP-1 and an increase in TSP-4, the two TSP variants are likely to influence cardiovascular functions in distinct but yet pathogenic ways.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hsu, Hao-Chi; Tong, Simon; Zhou, Yuchen

    Human FABP5 and FABP7 are intracellular endocannabinoid transporters. SBFI-26 is an α-truxillic acid 1-naphthyl monoester that competitively inhibits the activities of FABP5 and FABP7 and produces antinociceptive and anti-inflammatory effects in mice. The synthesis of SBFI-26 yields several stereoisomers, and it is not known how the inhibitor binds the transporters. Here we report co-crystal structures of SBFI-26 in complex with human FABP5 and FABP7 at 2.2 and 1.9 Å resolution, respectively. We found that only (S)-SBFI-26 was present in the crystal structures. The inhibitor largely mimics the fatty acid binding pattern, but it also has several unique interactions. Notably, themore » FABP7 complex corroborates key aspects of the ligand binding pose at the canonical site previously predicted by virtual screening. In FABP5, SBFI-26 was unexpectedly found to bind at the substrate entry portal region in addition to binding at the canonical ligand-binding pocket. Our structural and binding energy analyses indicate that both R and S forms appear to bind the transporter equally well. We suggest that the S enantiomer observed in the crystal structures may be a result of the crystallization process selectively incorporating the (S)-SBFI-26–FABP complexes into the growing lattice, or that the S enantiomer may bind to the portal site more rapidly than to the canonical site, leading to an increased local concentration of the S enantiomer for binding to the canonical site. Our work reveals two binding poses of SBFI-26 in its target transporters. This knowledge will guide the development of more potent FABP inhibitors based upon the SBFI-26 scaffold.« less

  1. Binding site size limit of the 2:1 pyrrole-imidazole polyamide-DNA motif.

    PubMed Central

    Kelly, J J; Baird, E E; Dervan, P B

    1996-01-01

    Polyamides containing N-methylimidazole (Im) and N-methylpyrrole (Py) amino acids can be combined in antiparallel side-by-side dimeric complexes for sequence-specific recognition in the minor groove of DNA. Six polyamides containing three to eight rings bind DNA sites 5-10 bp in length, respectively. Quantitative DNase I footprint titration experiments demonstrate that affinity maximizes and is similar at ring sizes of five, six, and seven. Sequence specificity decreases as the length of the polyamides increases beyond five rings. These results provide useful guidelines for the design of new polyamides that bind longer DNA sites with enhanced affinity and specificity. Images Fig. 4 PMID:8692930

  2. Receptor Binding Sites for Substance P, but not Substance K or Neuromedin K, are Expressed in High Concentrations by Arterioles, Venules, and Lymph Nodules in Surgical Specimens Obtained from Patients with Ulcerative Colitis and Crohn Disease

    NASA Astrophysics Data System (ADS)

    Mantyh, Christopher R.; Gates, Troy S.; Zimmerman, Robert P.; Welton, Mark L.; Passaro, Edward P.; Vigna, Steven R.; Maggio, John E.; Kruger, Lawrence; Mantyh, Patrick W.

    1988-05-01

    Several lines of evidence indicate that tachykinin neuropeptides [substance P (SP), substance K (SK), and neuromedin K (NK)] play a role in regulating the inflammatory and immune responses. To test this hypothesis in a human inflammatory disease, quantitative receptor autoradiography was used to examine possible abnormalities in tachykinin binding sites in surgical specimens from patients with inflammatory bowel disease. Surgical specimens of colon were obtained from patients with ulcerative colitis (n = 4) and Crohn disease (n = 4). Normal tissue was obtained from uninvolved areas of extensive resections for carcinoma (n = 6). In all cases, specimens were obtained <5 min after removal to minimize influences associated with degradation artifacts and were processed for quantitative receptor autoradiography by using 125I-labeled Bolton--Hunter conjugates of NK, SK, and SP. In the normal colon a low concentration of SP receptor binding sites is expressed by submucosal arterioles and venules and a moderate concentration is expressed by the external circular muscle, whereas SK receptor binding sites are expressed in low concentrations by the external circular and longitudinal muscle. In contrast, specific NK binding sites were not observed in any area of the human colon. In colon tissue obtained from ulcerative colitis and Crohn disease patients, however, very high concentrations of SP receptor binding sites are expressed by arterioles and venules located in the submucosa, muscularis mucosa, external circular muscle, external longitudinal muscle, and serosa. In addition, very high concentrations of SP receptor binding sites are expressed within the germinal center of lymph nodules, whereas the concentrations of SP and SK binding sites expressed by the external muscle layers are not altered significantly. These results demonstrate that receptor binding sites for SP, but not SK or NK, are ectopically expressed in high concentrations (1000-2000 times normal) by cells involved in mediating inflammatory and immune responses. These data suggest that SP may be involved in the pathophysiology of inflammatory bowel disease and might provide some insight into the interaction between the nervous system and the regulation of inflammation and the immune response in human inflammatory disease.

  3. Synthesis and stereospecificity of 4,5-disubstituted oxazolidinone ligands binding to T-box riboswitch RNA.

    PubMed

    Orac, Crina M; Zhou, Shu; Means, John A; Boehm, David; Bergmeier, Stephen C; Hines, Jennifer V

    2011-10-13

    The enantiomers and the cis isomers of two previously studied 4,5-disubstituted oxazolidinones have been synthesized, and their binding to the T-box riboswitch antiterminator model RNA has been investigated in detail. Characterization of ligand affinities and binding site localization indicates that there is little stereospecific discrimination for binding antiterminator RNA alone. This binding similarity between enantiomers is likely due to surface binding, which accommodates ligand conformations that result in comparable ligand-antiterminator contacts. These results have significant implications for T-box antiterminator-targeted drug discovery and, in general, for targeting other medicinally relevant RNA that do not present deep binding pockets.

  4. Synthesis and stereospecificity of 4,5-disubstituted oxazolidinone ligands binding to T-box riboswitch RNA

    PubMed Central

    Orac, Crina M.; Zhou, Shu; Means, John A.; Boehm, David; Bergmeier, Stephen C.; Hines, Jennifer V.

    2012-01-01

    The enantiomers and the cis isomers of two previously studied 4,5-disubstituted oxazolidinones have been synthesized and their binding to the T-box riboswitch antiterminator model RNA investigated in detail. Characterization of ligand affinities and binding site localization indicate that there is little stereospecific discrimination for binding antiterminator RNA alone. This binding similarity between enantiomers is likely due to surface binding, which accommodates ligand conformations that result in comparable ligand-antiterminator contacts. These results have significant implications for T-box antiterminator-targeted drug discovery and, in general, for targeting other medicinally relevant RNA that do not present deep binding pockets. PMID:21812425

  5. RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes

    PubMed Central

    Singh, Guramrit; Ricci, Emiliano P.; Moore, Melissa J.

    2013-01-01

    Development of high-throughput approaches to map the RNA interaction sites of individual RNA binding proteins (RBPs) transcriptome-wide is rapidly transforming our understanding of post-transcriptional gene regulatory mechanisms. Here we describe a ribonucleoprotein (RNP) footprinting approach we recently developed for identifying occupancy sites of both individual RBPs and multi-subunit RNP complexes. RNA:protein immunoprecipitation in tandem (RIPiT) yields highly specific RNA footprints of cellular RNPs isolated via two sequential purifications; the resulting RNA footprints can then be identified by high-throughput sequencing (Seq). RIPiT-Seq is broadly applicable to all RBPs regardless of their RNA binding mode and thus provides a means to map the RNA binding sites of RBPs with poor inherent ultraviolet (UV) crosslinkability. Further, among current high-throughput approaches, RIPiT has the unique capacity to differentiate binding sites of RNPs with overlapping protein composition. It is therefore particularly suited for studying dynamic RNP assemblages whose composition evolves as gene expression proceeds. PMID:24096052

  6. Structural basis for the interaction of antibiotics with peptidyl transferase center in eubacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlunzen, Frank; Zarivach, Raz; Harms, Jörg

    2009-10-07

    Ribosomes, the site of protein synthesis, are a major target for natural and synthetic antibiotics. Detailed knowledge of antibiotic binding sites is central to understanding the mechanisms of drug action. Conversely, drugs are excellent tools for studying the ribosome function. To elucidate the structural basis of ribosome-antibiotic interactions, we determined the high-resolution X-ray structures of the 50S ribosomal subunit of the eubacterium Deinococcus radiodurans, complexed with the clinically relevant antibiotics chloramphenicol, clindamycin and the three macrolides erythromycin, clarithromycin and roxithromycin. We found that antibiotic binding sites are composed exclusively of segments of 23S ribosomal RNA at the peptidyl transferase cavitymore » and do not involve any interaction of the drugs with ribosomal proteins. Here we report the details of antibiotic interactions with the components of their binding sites. Our results also show the importance of putative Mg{sup +2} ions for the binding of some drugs. This structural analysis should facilitate rational drug design.« less

  7. Dynamics of bleomycin interaction with a strongly bound hairpin DNA substrate, and implications for cleavage of the bound DNA.

    PubMed

    Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M

    2012-10-31

    Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.

  8. Regulatory interactions in the dimeric cytochrome bc(1) complex: the advantages of being a twin.

    PubMed

    Covian, Raul; Trumpower, Bernard L

    2008-09-01

    The dimeric cytochrome bc(1) complex catalyzes the oxidation-reduction of quinol and quinone at sites located in opposite sides of the membrane in which it resides. We review the kinetics of electron transfer and inhibitor binding that reveal functional interactions between the quinol oxidation site at center P and quinone reduction site at center N in opposite monomers in conjunction with electron equilibration between the cytochrome b subunits of the dimer. A model for the mechanism of the bc(1) complex has emerged from these studies in which binding of ligands that mimic semiquinone at center N regulates half-of-the-sites reactivity at center P and binding of ligands that mimic catalytically competent binding of ubiquinol at center P regulates half-of-the-sites reactivity at center N. An additional feature of this model is that inhibition of quinol oxidation at the quinone reduction site is avoided by allowing catalysis in only one monomer at a time, which maximizes the number of redox acceptor centers available in cytochrome b for electrons coming from quinol oxidation reactions at center P and minimizes the leakage of electrons that would result in the generation of damaging oxygen radicals.

  9. How Cations Can Assist DNase I in DNA Binding and Hydrolysis

    PubMed Central

    Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden, Marc

    2010-01-01

    DNase I requires Ca2+ and Mg2+ for hydrolyzing double-stranded DNA. However, the number and the location of DNase I ion-binding sites remain unclear, as well as the role of these counter-ions. Using molecular dynamics simulations, we show that bovine pancreatic (bp) DNase I contains four ion-binding pockets. Two of them strongly bind Ca2+ while the other two sites coordinate Mg2+. These theoretical results are strongly supported by revisiting crystallographic structures that contain bpDNase I. One Ca2+ stabilizes the functional DNase I structure. The presence of Mg2+ in close vicinity to the catalytic pocket of bpDNase I reinforces the idea of a cation-assisted hydrolytic mechanism. Importantly, Poisson-Boltzmann-type electrostatic potential calculations demonstrate that the divalent cations collectively control the electrostatic fit between bpDNase I and DNA. These results improve our understanding of the essential role of cations in the biological function of bpDNase I. The high degree of conservation of the amino acids involved in the identified cation-binding sites across DNase I and DNase I-like proteins from various species suggests that our findings generally apply to all DNase I-DNA interactions. PMID:21124947

  10. Pertussis toxin modifies the characteristics of both the inhibitory GTP binding proteins and the somatostatin receptor in anterior pituitary tumor cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mahy, N.; Woolkalis, M.; Thermos, K.

    1988-08-01

    The effects of pertussis toxin treatment on the characteristics of somatostatin receptors in the anterior pituitary tumor cell line AtT-20 were examined. Pertussis toxin selectively catalyzed the ADP ribosylation of the alpha subunits of the inhibitory GTP binding proteins in AtT-20 cells. Toxin treatment abolished somatostatin inhibition of forskolin-stimulated adenylyl cyclase activity and somatostatin stimulation of GTPase activity. To examine the effects of pertussis toxin treatment on the characteristics of the somatostatin receptor, the receptor was labeled by the somatostatin analog (125I)CGP 23996. (125I)CGP 23996 binding to AtT-20 cell membranes was saturable and within a limited concentration range was tomore » a single high affinity site. Pertussis toxin treatment reduced the apparent density of the high affinity (125I)CGP 23996 binding sites in AtT-20 cell membranes. Inhibition of (125I)CGP 23996 binding by a wide concentration range of CGP 23996 revealed the presence of two binding sites. GTP predominantly reduced the level of high affinity sites in control membranes. Pertussis toxin treatment also diminished the amount of high affinity sites. GTP did not affect (125I)CGP 23996 binding in the pertussis toxin-treated membranes. The high affinity somatostatin receptors were covalently labeled with (125I) CGP 23996 and the photoactivated crosslinking agent n-hydroxysuccinimidyl-4-azidobenzoate. No high affinity somatostatin receptors, covalently bound to (125I)CGP 23996, were detected in the pertussis toxin-treated membranes. These results are most consistent with pertussis toxin uncoupling the inhibitory G proteins from the somatostatin receptor thereby converting the receptor from a mixed population of high and low affinity sites to only low affinity receptors.« less

  11. Analogs of methyllycaconitine as novel noncompetitive inhibitors of nicotinic receptors: pharmacological characterization, computational modeling, and pharmacophore development.

    PubMed

    McKay, Dennis B; Chang, Cheng; González-Cestari, Tatiana F; McKay, Susan B; El-Hajj, Raed A; Bryant, Darrell L; Zhu, Michael X; Swaan, Peter W; Arason, Kristjan M; Pulipaka, Aravinda B; Orac, Crina M; Bergmeier, Stephen C

    2007-05-01

    As a novel approach to drug discovery involving neuronal nicotinic acetylcholine receptors (nAChRs), our laboratory targeted nonagonist binding sites (i.e., noncompetitive binding sites, negative allosteric binding sites) located on nAChRs. Cultured bovine adrenal cells were used as neuronal models to investigate interactions of 67 analogs of methyllycaconitine (MLA) on native alpha3beta4* nAChRs. The availability of large numbers of structurally related molecules presents a unique opportunity for the development of pharmacophore models for noncompetitive binding sites. Our MLA analogs inhibited nicotine-mediated functional activation of both native and recombinant alpha3beta4* nAChRs with a wide range of IC(50) values (0.9-115 microM). These analogs had little or no inhibitory effects on agonist binding to native or recombinant nAChRs, supporting noncompetitive inhibitory activity. Based on these data, two highly predictive 3D quantitative structure-activity relationship (comparative molecular field analysis and comparative molecular similarity index analysis) models were generated. These computational models were successfully validated and provided insights into the molecular interactions of MLA analogs with nAChRs. In addition, a pharmacophore model was constructed to analyze and visualize the binding requirements to the analog binding site. The pharmacophore model was subsequently applied to search structurally diverse molecular databases to prospectively identify novel inhibitors. The rapid identification of eight molecules from database mining and our successful demonstration of in vitro inhibitory activity support the utility of these computational models as novel tools for the efficient retrieval of inhibitors. These results demonstrate the effectiveness of computational modeling and pharmacophore development, which may lead to the identification of new therapeutic drugs that target novel sites on nAChRs.

  12. A membrane-embedded pathway delivers general anesthetics to two interacting binding sites in the Gloeobacter violaceus ion channel.

    PubMed

    Arcario, Mark J; Mayne, Christopher G; Tajkhorshid, Emad

    2017-06-09

    General anesthetics exert their effects on the central nervous system by acting on ion channels, most notably pentameric ligand-gated ion channels. Although numerous studies have focused on pentameric ligand-gated ion channels, the details of anesthetic binding and channel modulation are still debated. A better understanding of the anesthetic mechanism of action is necessary for the development of safer and more efficacious drugs. Herein, we present a computational study identifying two anesthetic binding sites in the transmembrane domain of the Gloeobacter violaceus ligand-gated ion channel (GLIC) channel, characterize the putative binding pathway, and observe structural changes associated with channel function. Molecular simulations of desflurane reveal a binding pathway to GLIC via a membrane-embedded tunnel using an intrasubunit protein lumen as the conduit, an observation that explains the Meyer-Overton hypothesis, or why the lipophilicity of an anesthetic and its potency are generally proportional. Moreover, employing high concentrations of ligand led to the identification of a second transmembrane site (TM2) that inhibits dissociation of anesthetic from the TM1 site and is consistent with the high concentrations of anesthetics required to achieve clinical effects. Finally, asymmetric binding patterns of anesthetic to the channel were found to promote an iris-like conformational change that constricts and dehydrates the ion pore, creating a 13.5 kcal/mol barrier to ion translocation. Together with previous studies, the simulations presented herein demonstrate a novel anesthetic binding site in GLIC that is accessed through a membrane-embedded tunnel and interacts with a previously known site, resulting in conformational changes that produce a non-conductive state of the channel. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Complexation of iron hexacyanides by cytochrome c. Evidence for electron exchange at the exposed heme edge.

    PubMed

    Stellwagen, E; Cass, R D

    1975-03-25

    Electrostatic binding of at least two anionic iron hexacyanides to cationic horse heart cytochrome c was demonstrated by equilibrium dialysis measurements. No binding was detected following trifluoroacetylation of all of the 19 lysine residues. Replacement of the natural heme iron ligand methionine 80 by the alternative intrinsic ligand lysine 79 but not the extrinsic ligand imidazole resulted in the loss of one hexacyanide binding site. It is proposed that this site is located at the exposed heme edge and is functional in electron exchange.

  14. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  15. pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families.

    PubMed

    Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas

    2014-07-01

    The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

    PubMed

    Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

    2015-01-01

    Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

  17. Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin.

    PubMed

    Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga; Renkawitz, Rainer; Georgiev, Pavel

    2015-01-01

    Insulators are multiprotein-DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. © 2015 Maksimenko et al.; Published by Cold Spring Harbor Laboratory Press.

  18. How does huperzine A enter and leave the binding gorge of acetylcholinesterase? Steered molecular dynamics simulations.

    PubMed

    Xu, Yechun; Shen, Jianhua; Luo, Xiaomin; Silman, Israel; Sussman, Joel L; Chen, Kaixian; Jiang, Hualiang

    2003-09-17

    The entering and leaving processes of Huperzine A (HupA) binding with the long active-site gorge of Torpedo californica acetylcholinesterase (TcAChE) have been investigated by using steered molecular dynamics simulations. The analysis of the force required along the pathway shows that it is easier for HupA to bind to the active site of AChE than to disassociate from it, which for the first time interprets at the atomic level the previous experimental result that unbinding process of HupA is much slower than its binding process to AChE. The direct hydrogen bonds, water bridges, and hydrophobic interactions were analyzed during two steered molecular dynamics (SMD) simulations. Break of the direct hydrogen bond needs a great pulling force. The steric hindrance of bottleneck might be the most important factor to produce the maximal rupture force for HupA to leave the binding site but it has a little effect on the binding process of HupA with AChE. Residue Asp72 forms a lot of water bridges with HupA leaving and entering the AChE binding gorge, acting as a clamp to take out HupA from or put HupA into the active site. The flip of the peptide bond between Gly117 and Gly118 has been detected during both the conventional MD and SMD simulations. The simulation results indicate that this flip phenomenon could be an intrinsic property of AChE and the Gly117-Gly118 peptide bond in both HupA bound and unbound AChE structures tends to adopt the native enzyme structure. At last, in a vacuum the rupture force is increased up to 1500 pN while in water solution the greatest rupture force is about 800 pN, which means water molecules in the binding gorge act as lubricant to facilitate HupA entering or leaving the binding gorge.

  19. Designing and Testing of Novel Taxanes to Probe the Highly Complex Mechanisms by Which Taxanes Bind to Microtubules and Cause Cytotoxicity to Cancer Cells

    PubMed Central

    St. George, Marc; Ayoub, Ahmed T.; Banerjee, Asok; Churchill, Cassandra D. M.; Winter, Philip; Klobukowski, Mariusz; Cass, Carol E.; Ludueña, Richard F.; Tuszynski, Jack A.; Damaraju, Sambasivarao

    2015-01-01

    Our previous work identified an intermediate binding site for taxanes in the microtubule nanopore. The goal of this study was to test derivatives of paclitaxel designed to bind to this intermediate site differentially depending on the isotype of β-tubulin. Since β-tubulin isotypes have tissue-dependent expression—specifically, the βIII isotype is very abundant in aggressive tumors and much less common in normal tissues—this is expected to lead to tubulin targeted drugs that are more efficacious and have less side effects. Seven derivatives of paclitaxel were designed and four of these were amenable for synthesis in sufficient purity and yield for further testing in breast cancer model cell lines. None of the derivatives studied were superior to currently used taxanes, however computer simulations provided insights into the activity of the derivatives. Our results suggest that neither binding to the intermediate binding site nor the final binding site is sufficient to explain the activities of the derivative taxanes studied. These findings highlight the need to iteratively improve on the design of taxanes based on their activity in model systems. Knowledge gained on the ability of the engineered drugs to bind to targets and bring about activity in a predictable manner is a step towards personalizing therapies. PMID:26052950

  20. BiP clustering facilitates protein folding in the endoplasmic reticulum.

    PubMed

    Griesemer, Marc; Young, Carissa; Robinson, Anne S; Petzold, Linda

    2014-07-01

    The chaperone BiP participates in several regulatory processes within the endoplasmic reticulum (ER): translocation, protein folding, and ER-associated degradation. To facilitate protein folding, a cooperative mechanism known as entropic pulling has been proposed to demonstrate the molecular-level understanding of how multiple BiP molecules bind to nascent and unfolded proteins. Recently, experimental evidence revealed the spatial heterogeneity of BiP within the nuclear and peripheral ER of S. cerevisiae (commonly referred to as 'clusters'). Here, we developed a model to evaluate the potential advantages of accounting for multiple BiP molecules binding to peptides, while proposing that BiP's spatial heterogeneity may enhance protein folding and maturation. Scenarios were simulated to gauge the effectiveness of binding multiple chaperone molecules to peptides. Using two metrics: folding efficiency and chaperone cost, we determined that the single binding site model achieves a higher efficiency than models characterized by multiple binding sites, in the absence of cooperativity. Due to entropic pulling, however, multiple chaperones perform in concert to facilitate the resolubilization and ultimate yield of folded proteins. As a result of cooperativity, multiple binding site models used fewer BiP molecules and maintained a higher folding efficiency than the single binding site model. These insilico investigations reveal that clusters of BiP molecules bound to unfolded proteins may enhance folding efficiency through cooperative action via entropic pulling.

  1. Rational design of a conformation-switchable Ca2+- and Tb3+-binding protein without the use of multiple coupled metal-binding sites.

    PubMed

    Li, Shunyi; Yang, Wei; Maniccia, Anna W; Barrow, Doyle; Tjong, Harianto; Zhou, Huan-Xiang; Yang, Jenny J

    2008-10-01

    Ca2+, as a messenger of signal transduction, regulates numerous target molecules via Ca2+-induced conformational changes. Investigation into the determinants for Ca2+-induced conformational change is often impeded by cooperativity between multiple metal-binding sites or protein oligomerization in naturally occurring proteins. To dissect the relative contributions of key determinants for Ca2+-dependent conformational changes, we report the design of a single-site Ca2+-binding protein (CD2.trigger) created by altering charged residues at an electrostatically sensitive location on the surface of the host protein rat Cluster of Differentiation 2 (CD2).CD2.trigger binds to Tb3+ and Ca2+ with dissociation constants of 0.3 +/- 0.1 and 90 +/- 25 microM, respectively. This protein is largely unfolded in the absence of metal ions at physiological pH, but Tb3+ or Ca2+ binding results in folding of the native-like conformation. Neutralization of the charged coordination residues, either by mutation or protonation, similarly induces folding of the protein. The control of a major conformational change by a single Ca2+ ion, achieved on a protein designed without reliance on sequence similarity to known Ca2+-dependent proteins and coupled metal-binding sites, represents an important step in the design of trigger proteins.

  2. The effect of Berberine on the secondary structure of human serum albumin

    NASA Astrophysics Data System (ADS)

    Li, Ying; He, WenYing; Tian, Jianniao; Tang, Jianghong; Hu, Zhide; Chen, Xingguo

    2005-05-01

    The presence of several high affinity binding sites on human serum albumin (HSA) makes it a possible target for many drugs. This study is designed to examine the effect of Berberine (an ancient Chinese drug used for antimicrobial, antiplasmodial, antidiarrheal and cardiovascular) on the solution structure of HSA using fluorescence, Fourier transform infrared (FT-IR), circular dichroism (CD) spectroscopic methods. The fluorescence spectroscopic results show that the fluorescence intensity of HSA was significantly decreased in the presence of Berberine. The Scatchard's plots indicated that the binding of Berberine to HSA at 296, 303, 318 K is characterized by one binding site with the binding constant is 4.071(±0.128)×10 4, 3.741(±0.089)×10 4, 3.454(±0.110)×10 4 M -1, respectively. The protein conformation is altered (FT-IR and CD data) with reductions of α-helices from 54 to 47% for free HSA to 45-32% and with increases of turn structure5% for free HSA to 18% in the presence of Berberine. The binding process was exothermic, enthalpy driven and spontaneous, as indicated by the thermodynamic analyses, Berberine bound to HSA was mainly based on hydrophobic interaction and electrostatic interaction cannot be excluded from the binding. Furthermore, the displace experiments indicate that Berberine can bind to the subdomain IIA, that is, high affinity site (site II).

  3. In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells

    PubMed Central

    Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon

    2016-01-01

    Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as opposed to YY1, suggesting that YY2 exerts unique contributions to gene regulation. YY2 binding was not generally associated with gene promoters. However, several YY2 binding sites are linked to long noncoding RNA (lncRNA) genes and we show that the expression levels of a few of those are Yy2-dependent. PMID:27191592

  4. Myosin binding protein C positioned to play a key role in regulation of muscle contraction: structure and interactions of domain C1.

    PubMed

    Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Le Masurier, Clare; Gautel, Mathias; Pfuhl, Mark

    2008-12-19

    Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1-S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (K(d) of approximately 10-20 microM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1-S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1-C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation.

  5. Myosin Binding Protein C Positioned to Play a Key Role in Regulation of Muscle Contraction: Structure and Interactions of Domain C1

    PubMed Central

    Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Masurier, Clare Le; Gautel, Mathias; Pfuhl, Mark

    2008-01-01

    Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1–S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (Kd of approximately 10–20 μM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1–S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1–C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation. PMID:18926831

  6. Selective binding of pyrene in subdomain IB of human serum albumin: Combining energy transfer spectroscopy and molecular modelling to understand protein binding flexibility

    NASA Astrophysics Data System (ADS)

    Ling, Irene; Taha, Mohamed; Al-Sharji, Nada A.; Abou-Zied, Osama K.

    2018-04-01

    The ability of human serum albumin (HSA) to bind medium-sized hydrophobic molecules is important for the distribution, metabolism, and efficacy of many drugs. Herein, the interaction between pyrene, a hydrophobic fluorescent probe, and HSA was thoroughly investigated using steady-state and time-resolved fluorescence techniques, ligand docking, and molecular dynamics (MD) simulations. A slight quenching of the fluorescence signal from Trp214 (the sole tryptophan residue in the protein) in the presence of pyrene was used to determine the ligand binding site in the protein, using Förster's resonance energy transfer (FRET) theory. The estimated FRET apparent distance between pyrene and Trp214 was 27 Å, which was closely reproduced by the docking analysis (29 Å) and MD simulation (32 Å). The highest affinity site for pyrene was found to be in subdomain IB from the docking results. The calculated equilibrium structure of the complex using MD simulation shows that the ligand is largely stabilized by hydrophobic interaction with Phe165, Phe127, and the nonpolar moieties of Tyr138 and Tyr161. The fluorescence vibronic peak ratio I1/I3 of bound pyrene inside HSA indicates the presence of polar effect in the local environment of pyrene which is less than that of free pyrene in buffer. This was clarified by the MD simulation results in which an average of 5.7 water molecules were found within 0.5 nm of pyrene in the binding site. Comparing the fluorescence signals and lifetimes of pyrene inside HSA to that free in buffer, the high tendency of pyrene to form dimer was almost completely suppressed inside HSA, indicating a high selectivity of the binding pocket toward pyrene monomer. The current results emphasize the ability of HSA, as a major carrier of several drugs and ligands in blood, to bind hydrophobic molecules in cavities other than subdomain IIA which is known to bind most hydrophobic drugs. This ability stems from the nature of the amino acids forming the binding sites of the protein that can easily adapt their shape to accommodate a variety of molecular structures.

  7. The hepta-beta-glucoside elicitor-binding proteins from legumes represent a putative receptor family.

    PubMed

    Mithöfer, A; Fliegmann, J; Neuhaus-Url, G; Schwarz, H; Ebel, J

    2000-08-01

    The ability of legumes to recognize and respond to beta-glucan elicitors by synthesizing phytoalexins is consistent with the existence of a membrane-bound beta-glucan-binding site. Related proteins of approximately 75 kDa and the corresponding mRNAs were detected in various species of legumes which respond to beta-glucans. The cDNAs for the beta-glucan-binding proteins of bean and soybean were cloned. The deduced 75-kDa proteins are predominantly hydrophilic and constitute a unique class of glucan-binding proteins with no currently recognizable functional domains. Heterologous expression of the soybean beta-glucan-binding protein in tomato cells resulted in the generation of a high-affinity binding site for the elicitor-active hepta-beta-glucoside conjugate (Kd = 4.5 nM). Ligand competition experiments with the recombinant binding sites demonstrated similar ligand specificities when compared with soybean. In both soybean and transgenic tomato, membrane-bound, active forms of the glucan-binding proteins coexist with immunologically detectable, soluble but inactive forms of the proteins. Reconstitution of a soluble protein fraction into lipid vesicles regained beta-glucoside-binding activity but with lower affinity (Kd = 130 nM). We conclude that the beta-glucan elicitor receptors of legumes are composed of the 75 kDa glucan-binding proteins as the critical components for ligand-recognition, and of an as yet unknown membrane anchor constituting the plasma membrane-associated receptor complex.

  8. Stabilization of Human Serum Albumin by the Binding of Phycocyanobilin, a Bioactive Chromophore of Blue-Green Alga Spirulina: Molecular Dynamics and Experimental Study

    PubMed Central

    Stanic-Vucinic, Dragana; Nikolic, Milan; Milcic, Milos; Cirkovic Velickovic, Tanja

    2016-01-01

    Phycocyanobilin (PCB) binds with high affinity (2.2 x 106 M-1 at 25°C) to human serum albumin (HSA) at sites located in IB and IIA subdomains. The aim of this study was to examine effects of PCB binding on protein conformation and stability. Using 300 ns molecular dynamics (MD) simulations, UV-VIS spectrophotometry, CD, FT-IR, spectrofluorimetry, thermal denaturation and susceptibility to trypsin digestion, we studied the effects of PCB binding on the stability and rigidity of HSA, as well as the conformational changes in PCB itself upon binding to the protein. MD simulation results demonstrated that HSA with PCB bound at any of the two sites showed greater rigidity and lower overall and individual domain flexibility compared to free HSA. Experimental data demonstrated an increase in the α-helical content of the protein and thermal and proteolytic stability upon ligand binding. PCB bound to HSA undergoes a conformational change to a more elongated conformation in the binding pockets of HSA. PCB binding to HSA stabilizes the structure of this flexible transport protein, making it more thermostable and resistant to proteolysis. The results from this work explain at molecular level, conformational changes and stabilization of HSA structure upon ligand binding. The resultant increased thermal and proteolytic stability of HSA may provide greater longevity to HSA in plasma. PMID:27959940

  9. In Vivo [11C]Dihydrotetrabenazine ([11C]DTBZ) Binding in Rat Striatum: Sensitivity to Dopamine Concentrations

    PubMed Central

    Kilbourn, Michael R.; Butch, Elizabeth R.; Desmond, Timothy; Sherman, Phillip; Harris, Paul E.; Frey, Kirk A.

    2009-01-01

    Introduction The sensitivity of the in vivo binding of [11C]dihydrotetrabenazine ([11C]DTBZ) and [11C]methylphenidate ([11C]MPH) to their respective targets, the vesicular monoamine transporter (VMAT2) and the neuronal membrane dopamine transporter (DAT), after alterations of endogenous levels of dopamine were examined in the rat brain. Methods In vivo binding of [11C]DTBZ and [11C]MPH were determined using a bolus+infusion protocol. In vitro numbers of VMAT2 binding sites were determined by autoradiography. Results Repeated dosing with α-methyl-p-tyrosine (AMPT) at doses that significantly (−75%) depleted brain tissue dopamine levels resulted in increased (+36%) in vivo [11C]DTBZ binding to VMAT2 in the striatum. The increase in binding could be completely reversed by treatment with L-DOPA/benserazide to restore dopamine levels. There were no changes in total numbers of VMAT2 binding sites as measured using in vitro autoradiography. No changes were observed for in vivo [11C]MPH binding to the DAT in the striatum following AMPT pretreatment. Conclusion These results indicate that large reductions of dopamine concentrations in the rat brain can produce modest but significant changes in binding of radioligands to the VMAT2, which can be reversed by repleneshment of dopamine using exogenous L-DOPA. PMID:20122661

  10. Crystallographic studies with xenon and nitrous oxide provide evidence for protein-dependent processes in the mechanisms of general anesthesia.

    PubMed

    Abraini, Jacques H; Marassio, Guillaume; David, Helene N; Vallone, Beatrice; Prangé, Thierry; Colloc'h, Nathalie

    2014-11-01

    The mechanisms by which general anesthetics, including xenon and nitrous oxide, act are only beginning to be discovered. However, structural approaches revealed weak but specific protein-gas interactions. To improve knowledge, we performed x-ray crystallography studies under xenon and nitrous oxide pressure in a series of 10 binding sites within four proteins. Whatever the pressure, we show (1) hydrophobicity of the gas binding sites has a screening effect on xenon and nitrous oxide binding, with a threshold value of 83% beyond which and below which xenon and nitrous oxide, respectively, binds to their sites preferentially compared to each other; (2) xenon and nitrous oxide occupancies are significantly correlated respectively to the product and the ratio of hydrophobicity by volume, indicating that hydrophobicity and volume are binding parameters that complement and oppose each other's effects; and (3) the ratio of occupancy of xenon to nitrous oxide is significantly correlated to hydrophobicity of their binding sites. These data demonstrate that xenon and nitrous oxide obey different binding mechanisms, a finding that argues against all unitary hypotheses of narcosis and anesthesia, and indicate that the Meyer-Overton rule of a high correlation between anesthetic potency and solubility in lipids of general anesthetics is often overinterpreted. This study provides evidence that the mechanisms of gas binding to proteins and therefore of general anesthesia should be considered as the result of a fully reversible interaction between a drug ligand and a receptor as this occurs in classical pharmacology.

  11. Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites

    PubMed Central

    Dupont, Daniel M.; Thuesen, Cathrine K.; Bøtkjær, Kenneth A.; Behrens, Manja A.; Dam, Karen; Sørensen, Hans P.; Pedersen, Jan S.; Ploug, Michael; Jensen, Jan K.; Andreasen, Peter A.

    2015-01-01

    Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126) with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site. PMID:25793507

  12. Electrostatic steering and ionic tethering in enzyme–ligand binding: Insights from simulations

    PubMed Central

    Wade, Rebecca C.; Gabdoulline, Razif R.; Lüdemann, Susanna K.; Lounnas, Valère

    1998-01-01

    To bind at an enzyme’s active site, a ligand must diffuse or be transported to the enzyme’s surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and β-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as “ionic tethering.” We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme’s surroundings even when the substrate is nonpolar. PMID:9600896

  13. Acteoside and Acyl-Migrated Acteoside, Compounds in Chinese Kudingcha Tea, Inhibit α-Amylase In Vitro.

    PubMed

    Lu, Yuqin; Zhou, Wenyu; Feng, Yue; Li, Yao; Liu, Ke; Liu, Lizhong; Lin, Dongxu; He, Zhendan; Wu, Xuli

    2017-06-01

    Acteoside, the predominant polyphenol of small-leaved kudingcha, the Chinese tea, has various biological activities. In this study, we examined the acyl migration of acteoside to isoacteoside with high-temperature treatment of acteoside. The inhibitory effects of acyl-migrated acteoside and acteoside on α-amylase were investigated, as were their binding interaction with α-amylase. The binding of acteoside and isoacteoside to α-amylase was investigated by using the fluorescence spectra assay, circular dichroism, and protein-ligand docking studies. Acteoside was more effective than preheated acteoside and isoacteoside in inhibiting α-amylase activity. Acteoside and isoacteoside binding to α-amylase may induce conformational changes to α-amylase, and the binding site of acteoside and isoacteoside being near the active site pocket of α-amylase may explain the decreased activity of α-amylase. The different affinities and binding sites of acteoside and isoacteoside for α-amylase resulted in different inhibition rates, which may be due to structural differences between acteoside and isoacteoside.

  14. Characterization of rodent liver and kidney AVP receptors: pharmacologic evidence for species differences.

    PubMed

    Tahara, A; Tsukada, J; Ishii, N; Tomura, Y; Wada, K; Kusayama, T; Yatsu, T; Uchida, W; Tanaka, A

    1999-10-22

    Radioligand binding studies with [3H]vasopressin (AVP) were used to determine the affinities of AVP receptor agonists and antagonists for mouse liver and kidney plasma membrane preparations. Both membrane preparations exhibited one class of high-affinity binding site. AVP ligand binding inhibition studies confirmed that mouse liver binding sites belong to the V1A subtype while kidney binding sites belong to the V2 receptor subtype. The affinity of each ligand for mouse V1A receptors was very similar to that for rat V1A receptors, showing differences in Ki values of less than 3-fold. In contrast, several peptide (d(CH2)5Tyr(Me)AVP) and nonpeptide (OPC-21268 and SR 49059) ligands had different affinities for mouse and rat kidney V2 receptors, with differences in Ki values ranging from 14- to 17-fold. These results indicate that mouse and rat kidney V2 receptors show significant pharmacologic differences.

  15. Mechanisms of Zn(II) binded to collagen and its effect on the capacity of eco-friendly Zn-Cr combination tanning system.

    PubMed

    Cao, Shan; Liu, Bing; Cheng, Baozhen; Lu, Fuping; Wang, Yanping; Li, Yu

    2017-01-05

    The eco-friendly combination tanning process has been developed to reduce chromium in existing researches, which is based on zinc tanning agents. This can be considered as a less-chrome substitute for current tanning process. To gain deeper understanding of the binding mechanisms of zinc-collagen interaction, which are affected by tanning pH, experiments have been carried out. Analysis in this paper reveals how chemical bonds from the collagen's main function groups combine with zinc. XPS and NIR data was analyzed for further understanding of where the zinc binding sites lie on collagen fibers at different pH. The results indicate that high pH is helpful to amino-binding sites while low pH promotes carboxyl-binding sites on collagen fibers. Furthermore, from the effect of Zinc-chrome combination tanning, we can see that the new method reduces the chromium dosage in tanning process compared to the conventional chrome tanning method. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Inactivation of phosphorylase b by potassium ferrate, a new reactive analogue of the phosphate group.

    PubMed

    Lee, Y M; Benisek, W F

    1976-03-25

    Rabbit muscle phosphorylase b reacts with the phosphate-like reagent potassium ferrate, K2FeO4, a potent oxidizing agent. The reaction results in inactivation of the enzyme and abolition of the ability of the enzyme to bind 5'-AMP. Activating and nonactivating nucleotides which bind at the 5'-AMP binding site such as 5'-AMP, 2'-AMP, 3'-AMP, and 5'-IMP substantially protect the enzyme from inactivation by ferrate. One to two residues of tyrosine and approximately 1 residue of cysteine are modified by ferrate under the conditions employed. Tyrosine is protected by 5-AMP, whereas cysteine is not. The tyrosine modification is suggested as the inactivating chemical reaction. The location of the inactivating reaction is suggested to be in or near the 5'-AMP binding site. The structural and chemical properties of ferrate ion are discussed and compared to those of phosphate. Ferrate ion may be a reagent useful for phosphate group binding site-directed modification of proteins.

  17. Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-08-01

    The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

  18. Binding site in eag voltage sensor accommodates a variety of ions and is accessible in closed channel.

    PubMed

    Silverman, William R; Bannister, John P A; Papazian, Diane M

    2004-11-01

    In ether-a-go-go K+ channels, voltage-dependent activation is modulated by ion binding to a site located in an extracellular-facing crevice between transmembrane segments S2 and S3 in the voltage sensor. We find that acidic residues D278 in S2 and D327 in S3 are able to coordinate a variety of divalent cations, including Mg2+, Mn2+, and Ni2+, which have qualitatively similar functional effects, but different half-maximal effective concentrations. Our data indicate that ions binding to individual voltage sensors in the tetrameric channel act without cooperativity to modulate activation gating. We have taken advantage of the unique phenotype of Ni2+ in the D274A channel, which contains a mutation of a nonbinding site residue, to demonstrate that ions can access the binding site from the extracellular solution when the voltage sensor is in the resting conformation. Our results are difficult to reconcile with the x-ray structure of the KvAP K+ channel, in which the binding site residues are widely separated, and with the hydrophobic paddle model for voltage-dependent activation, in which the voltage sensor domain, including the S3-S4 loop, is near the cytoplasmic side of the membrane in the closed channel.

  19. Polar bear hemoglobin and human Hb A0: same 2,3-diphosphoglycerate binding site but asymmetry of the binding?

    PubMed

    Pomponi, Massimo; Bertonati, Claudia; Patamia, Maria; Marta, Maurizio; Derocher, Andrew E; Lydersen, Christian; Kovacs, Kit M; Wiig, Oystein; Bårdgard, Astrid J

    2002-11-01

    Polar bear (Ursus maritimus) hemoglobin (Hb) shows a low response to 2,3-diphosphoglycerate (2,3-DPG), compared to human Hb A0, even though these proteins have the same 2,3-DPG-binding site. In addition, polar bear Hb shows a high response to chloride and an alkaline Bohr effect (deltalog P50/deltapH) that is significantly greater than that of human Hb A0. The difference in sequence Pro (Hb A0)-->Gly (polar bear Hb) at position A2 in the A helix seems to be critical for reduced binding of 2,3-DPG. Our results also show that the A2 position may influence not only the flexibility of the A helix, but that differences in flexibility of the first turn of the A helix may affect the unloading of oxygen for the intrinsic ligand affinities of the alpha and beta chains. However, preferential binding to either chain can only take place if there is appreciable asymmetric binding of the phosphoric effector. Regarding this point, 31P NMR data suggest a loss of symmetry of the 2,3-DPG-binding site in the deoxyHb-2,3-DPG complex.

  20. Evaluation of water displacement energetics in protein binding sites with grid cell theory.

    PubMed

    Gerogiokas, G; Southey, M W Y; Mazanetz, M P; Heifetz, A; Hefeitz, A; Bodkin, M; Law, R J; Michel, J

    2015-04-07

    Excess free energies, enthalpies and entropies of water in protein binding sites were computed via classical simulations and Grid Cell Theory (GCT) analyses for three pairs of congeneric ligands in complex with the proteins scytalone dehydratase, p38α MAP kinase and EGFR kinase respectively. Comparative analysis is of interest since the binding modes for each ligand pair differ in the displacement of one binding site water molecule, but significant variations in relative binding affinities are observed. Protocols that vary in their use of restraints on protein and ligand atoms were compared to determine the influence of protein-ligand flexibility on computed water structure and energetics, and to assess protocols for routine analyses of protein-ligand complexes. The GCT-derived binding affinities correctly reproduce experimental trends, but the magnitude of the predicted changes in binding affinities is exaggerated with respect to results from a previous Monte Carlo Free Energy Perturbation study. Breakdown of the GCT water free energies into enthalpic and entropic components indicates that enthalpy changes dominate the observed variations in energetics. In EGFR kinase GCT analyses revealed that replacement of a pyrimidine by a cyanopyridine perturbs water energetics up three hydration shells away from the ligand.

  1. Exploring the site-selective binding of jatrorrhizine to human serum albumin: spectroscopic and molecular modeling approaches.

    PubMed

    Mi, Ran; Hu, Yan-Jun; Fan, Xiao-Yang; Ouyang, Yu; Bai, Ai-Min

    2014-01-03

    This paper exploring the site-selective binding of jatrorrhizine to human serum albumin (HSA) under physiological conditions (pH=7.4). The investigation was carried out using fluorescence spectroscopy, UV-vis spectroscopy, and molecular modeling. The results of fluorescence quenching and UV-vis absorption spectra experiments indicated the formation of the complex of HSA-jatrorrhizine. Binding parameters calculating from Stern-Volmer method and Scatchard method were calculated at 298, 304 and 310 K, with the corresponding thermodynamic parameters ΔG, ΔH and ΔS as well. Binding parameters calculating from Stern-Volmer method and Scatchard method showed that jatrorrhizine bind to HSA with the binding affinities of the order 10(4) L mol(-1). The thermodynamic parameters studies revealed that the binding was characterized by negative enthalpy and positive entropy changes and the electrostatic interactions play a major role for jatrorrhizine-HSA association. Site marker competitive displacement experiments and molecular modeling calculation demonstrating that jatrorrhizine is mainly located within the hydrophobic pocket of the subdomain IIIA of HSA. Furthermore, the synchronous fluorescence spectra suggested that the association between jatrorrhizine and HSA changed molecular conformation of HSA. Copyright © 2013. Published by Elsevier B.V.

  2. Precursor-product discrimination by La protein during tRNA metabolism

    PubMed Central

    Bayfield, Mark A.; Maraia, Richard J.

    2009-01-01

    SUMMARY La proteins bind pre-tRNAs at their UUU-3'OH ends, facilitating their maturation. While the mechanism by which La binds pre-tRNA 3' trailers is known, the function of the RNA-binding β-sheet surface of RRM1 is unknown. How La dissociates from UUU-3'OH-containing trailers after 3' processing is also unknown. La preferentially binds pre-tRNAs over processed tRNAs or 3' trailer products through coupled use of two sites: one on the La motif and another on the RRM1 β surface that binds elsewhere on tRNA. Two sites provide stable pre-tRNA binding while processed tRNA and 3' trailer are released from their single sites relatively fast. RRM1 loop-3 mutations decrease affinity for pre-tRNA and tRNA but not UUU-3'OH trailer, and impair tRNA maturation in vivo. We propose that RRM1 functions in activities that are more complex than UUU-3'OH binding. Accordingly, the RRM1 mutations also impair a RNA chaperone activity of La. The results suggest how La distinguishes precursor from product RNAs, allowing it to recycle onto a new pre-tRNA. PMID:19287396

  3. Pyrene maleimide as a probe of microenvironmental and dynamics properties of protein binding sites

    NASA Astrophysics Data System (ADS)

    Benci, S.; Vaccari, S.; Schianchi, G.; Locatelli, Donata; Vaghi, P.; Bottiroli, Giovanni F.

    1995-01-01

    N-(1-Pyrene)maleimide is highly fluorescent upon covalent binding with sulfhydryl and amino groups of the proteins. Multiexponential fluorescence decays were observed for the dye bound to different proteins even when a single binding site is involved. The lack of information about the fluorescence decay of free dye does not allow to define the variations of fluorescence parameter following the conjugation and their correlation with the binding properties of the fluorophore. In this work, a study of the fluorescence of the probe, free in solution, bound to different antibodies and to the antigen-antibody complex both in solution and in cell, has been performed. The experimental results showed that chemico-physical properties of the medium influence the fluorescence decay of the probe in both the free and bound forms, although to a different extent. The variations of fluorescence decay and anisotropy of the bound probe are related to the electronic characteristics of microenvironment and show an increased stabilization of the probe binding site with the increasing complexity of the substrate. The sensitivity of the fluorescence properties of the probe to the binding site environment opens interesting perspectives concerning the application of Py- maleimide fluorochromization to assess the degree of specificity of immunocytochemical labelling.

  4. Binding of fluoresceinated epidermal growth factor to A431 cell sub-populations studied using a model-independent analysis of flow cytometric fluorescence data.

    PubMed Central

    Chatelier, R C; Ashcroft, R G; Lloyd, C J; Nice, E C; Whitehead, R H; Sawyer, W H; Burgess, A W

    1986-01-01

    A method is developed for determining ligand-cell association parameters from a model-free analysis of data obtained with a flow cytometer. The method requires measurement of the average fluorescence per cell as a function of ligand and cell concentration. The analysis is applied to data obtained for the binding of fluoresceinated epidermal growth factor to a human epidermoid carcinoma cell line, A431. The results indicate that the growth factor binds to two classes of sites on A431 cells: 4 X 10(4) sites with a dissociation constant (KD) of less than or equal to 20 pM, and 1.5 X 10(6) sites with a KD of 3.7 nM. A derived plot of the average fluorescence per cell versus the average number of bound ligands per cell is used to construct binding isotherms for four sub-populations of A431 cells fractionated on the basis of low-angle light scatter. The four sub-populations bind the ligand with equal affinity but differ substantially in terms of the number of binding sites per cell. We also use this new analysis to critically evaluate the use of 'Fluorotrol' as a calibration standard in flow cytometry. PMID:3015587

  5. Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Feng; Stanevich, Vitali; Wlodarchak, Nathan

    Proper activation of protein phosphatase 2A (PP2A) catalytic subunit is central for the complex PP2A regulation and is crucial for broad aspects of cellular function. The crystal structure of PP2A bound to PP2A phosphatase activator (PTPA) and ATPγS reveals that PTPA makes broad contacts with the structural elements surrounding the PP2A active site and the adenine moiety of ATP. PTPA-binding stabilizes the protein fold of apo-PP2A required for activation, and orients ATP phosphoryl groups to bind directly to the PP2A active site. This allows ATP to modulate the metal-binding preferences of the PP2A active site and utilize the PP2A activemore » site for ATP hydrolysis. In vitro, ATP selectively and drastically enhances binding of endogenous catalytic metal ions, which requires ATP hydrolysis and is crucial for acquisition of pSer/Thr-specific phosphatase activity. Furthermore, both PP2A- and ATP-binding are required for PTPA function in cell proliferation and survival. Our results suggest novel mechanisms of PTPA in PP2A activation with structural economy and a unique ATP-binding pocket that could potentially serve as a specific therapeutic target.« less

  6. Mediation of CTCF transcriptional insulation by DEAD-box RNA-binding protein p68 and steroid receptor RNA activator SRA

    PubMed Central

    Yao, Hongjie; Brick, Kevin; Evrard, Yvonne; Xiao, Tiaojiang; Camerini-Otero, R. Daniel; Felsenfeld, Gary

    2010-01-01

    CCCTC-binding factor (CTCF) is a DNA-binding protein that plays important roles in chromatin organization, although the mechanism by which CTCF carries out these functions is not fully understood. Recent studies show that CTCF recruits the cohesin complex to insulator sites and that cohesin is required for insulator activity. Here we showed that the DEAD-box RNA helicase p68 (DDX5) and its associated noncoding RNA, steroid receptor RNA activator (SRA), form a complex with CTCF that is essential for insulator function. p68 was detected at CTCF sites in the IGF2/H19 imprinted control region (ICR) as well as other genomic CTCF sites. In vivo depletion of SRA or p68 reduced CTCF-mediated insulator activity at the IGF2/H19 ICR, increased levels of IGF2 expression, and increased interactions between the endodermal enhancer and IGF2 promoter. p68/SRA also interacts with members of the cohesin complex. Depletion of either p68 or SRA does not affect CTCF binding to its genomic sites, but does reduce cohesin binding. The results suggest that p68/SRA stabilizes the interaction of cohesin with CTCF by binding to both, and is required for proper insulator function. PMID:20966046

  7. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  8. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  9. Rpn1 provides adjacent receptor sites for substrate binding and deubiquitination by the proteasome

    PubMed Central

    Shi, Yuan; Chen, Xiang; Elsasser, Suzanne; Stocks, Bradley B.; Tian, Geng; Lee, Byung-Hoon; Shi, Yanhong; Zhang, Naixia; de Poot, Stefanie A. H.; Tuebing, Fabian; Sun, Shuangwu; Vannoy, Jacob; Tarasov, Sergey G.; Engen, John R.; Finley, Daniel; Walters, Kylie J.

    2016-01-01

    Structured Abstract INTRODUCTION The ubiquitin-proteasome system comprises hundreds of distinct pathways of degradation, which converge at the step of ubiquitin recognition by the proteasome. Five proteasomal ubiquitin receptors have been identified, two that are intrinsic to the proteasome (Rpn10 and Rpn13) and three reversibly associated proteasomal ubiquitin receptors (Rad23, Dsk2, and Ddi1). RATIONALE We found that the five known proteasomal ubiquitin receptors of yeast are collectively nonessential for ubiquitin recognition by the proteasome. We therefore screened for additional ubiquitin receptors in the proteasome and identified subunit Rpn1 as a candidate. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the structure of the binding site within Rpn1, which we term the T1 site. Mutational analysis of this site showed its functional importance within the context of intact proteasomes. T1 binds both ubiquitin and ubiquitin-like (UBL) proteins, in particular the substrate-delivering shuttle factor Rad23. A second site within the Rpn1 toroid, T2, recognizes the UBL domain of deubiquitinating enzyme Ubp6, as determined by hydrogen-deuterium exchange mass spectrometry analysis and validated by amino acid substitution and functional assays. The Rpn1 toroid thus serves a critical scaffolding role within the proteasome, helping to assemble multiple proteasome cofactors as well as substrates. RESULTS Our results indicate that proteasome subunit Rpn1 can recognize both ubiquitin and UBL domains of substrate shuttling factors that themselves bind ubiquitin and function as reversibly-associated proteasomal ubiquitin receptors. Recognition is mediated by the T1 site within the Rpn1 toroid, which supports proteasome function in vivo. We found that the capacity of T1 to recognize both ubiquitin and UBL proteins was shared with Rpn10 and Rpn13. The surprising multiplicity of ubiquitin-recognition domains within the proteasome may promote enhanced, multipoint binding of ubiquitin chains. The structures of the T1 site in its free state and complexed with monoubiquitin or K48-linked diubiquitin were solved, revealing that three neighboring outer helices from the T1 toroid engage two ubiquitins. This binding mode leads to a preference for certain ubiquitin chain types, especially K6- and K48-linked chains, in a distinct configuration that can position substrates close to the entry port of the proteasome. The fate of proteasome-docked ubiquitin conjugates is determined by a competition between deubiquitination and substrate degradation. We find that proximal to the T1 site within the Rpn1 toroid is a second UBL-binding site, T2, that does not assist in ubiquitin chain recognition, but rather in chain disassembly, by binding to the UBL domain of deubiquitinating enzyme Ubp6. Importantly, the UBL interactors at T1 and T2 are distinct, assigning substrate localization to T1 and substrate deubiquitination to T2. CONCLUSION A ligand-binding hotspot was identified in the Rpn1 toroid, consisting of two adjacent receptor sites, T1 and T2. The Rpn1 toroid represents a novel class of binding domains for ubiquitin and UBL proteins. This study thus defines a novel two-site recognition domain intrinsic to the proteasome that uses homologous ubiquitin/UBL-class ligands to assemble substrates, substrate shuttling factors, and a deubiquitinating enzyme in close proximity. A ligand-binding hotspot in the proteasome for assembling substrates and cofactors Schematic (top) and model structure (bottom, left) mapping the UBL-binding Rpn1 T1 (indigo) and T2 (orange) sites. (Bottom, right) Enlarged region of the proteasome to illustrate the Rpn1 T1 and T2 sites bound to a ubiquitin chain (yellow) and deubiquitinating enzyme Ubp6 (green), respectively. PDB 4CR2 and 2B9R were used for this figure. Hundreds of pathways for degradation converge at ubiquitin recognition by proteasome. Here we found that the five known proteasomal ubiquitin receptors are collectively nonessential for ubiquitin recognition, and identified a sixth receptor, Rpn1. A site (T1) in the Rpn1 toroid recognized ubiquitin and ubiquitin-like (UBL) domains of substrate shuttling factors. T1 structures with monoubiquitin or K48 diubiquitin show three neighboring outer helices engaging two ubiquitins. T1 contributes a distinct substrate-binding pathway with preference for K48-linked chains. Proximal to T1 within the Rpn1 toroid is a second UBL-binding site (T2) that assists in ubiquitin chain disassembly, by binding the UBL of deubiquitinating enzyme Ubp6. Thus a two-site recognition domain intrinsic to the proteasome uses homologous ubiquitin/UBL-class ligands to assemble substrates, shuttling factors, and a deubiquitinating enzyme. PMID:26912900

  10. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  12. Dynamic Factors Affecting Gaseous Ligand Binding in an Artificial Oxygen Transport Protein‡

    PubMed Central

    Zhang, Lei; Andersen, Eskil M.E.; Khajo, Abdelahad; Magliozzo, Richard S.; Koder, Ronald L.

    2013-01-01

    We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7 this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime which may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when when exposed to oxygen. Compared to HP7, distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off-rate. EPR comparison of these ferric hemoproteins demonstrates that the mutation increases disorder at the heme binding site. NMR-detected deuterium exchange demonstrates that the mutation greatly increases water penetration into the protein core. The inability of the mutant protein to bind oxygen may be due to increased water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together these data underline the importance of the control of protein dynamics in the design of functional artificial proteins. PMID:23249163

  13. Dynamic factors affecting gaseous ligand binding in an artificial oxygen transport protein.

    PubMed

    Zhang, Lei; Andersen, Eskil M E; Khajo, Abdelahad; Magliozzo, Richard S; Koder, Ronald L

    2013-01-22

    We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7, this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities, and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime that may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when exposed to oxygen. Compared to that of HP7, the distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off rate. Electron paramagnetic resonance comparison of these ferric hemoproteins demonstrates that the mutation increases the level of disorder at the heme binding site. Nuclear magnetic resonance-detected deuterium exchange demonstrates that the mutation greatly increases the degree of penetration of water into the protein core. The inability of the mutant protein to bind oxygen may be due to an increased level of water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together, these data underline the importance of the control of protein dynamics in the design of functional artificial proteins.

  14. Specific binding of nicergoline on an alpha1-like adrenoreceptor in the rat retina.

    PubMed

    Lograno, M D; Tricarico, D; Masciopinto, V; Scuderl, A C

    2000-02-01

    Systemic treatment with nicergoline, an ergoline derivative showing alpha1-antagonist properties, causes vasodilatation in the eye without apparent untoward cardiovascular effects. In the present work we investigated the ability of nicergoline to inhibit the binding of radiolabelled prazosin in the rat retina and cortex. We found that nicergoline inhibited [3H]prazosin binding in both tissues, being more potent than unlabelled prazosin in the retinal tissue. The competition curves of the ergoline derivative were well fitted by a one-site model in the cortical tissue, with an IC50 (concentration of the drugs needed to inhibit the binding of labelled prazosin by 50%) of 2.54 x 10(-8) M, and by a two-site model in the retinal tissue, with IC50 values of 7.08 x 10(-12) M and 1.82 x 10(-5) M. 2-(2,6 dimetoxyphenoxyethyl) aminomethyl-1,4-benzodioxane hydrochloride (WB4101) and phentolamine, selective ligands for the high-affinity binding site for prazosin, in particular the alpha1A-site, fully inhibited prazosin binding in the cortex but only partially inhibited prazosin binding in the retina, being less potent in this tissue than either nicergoline or prazosin. Our results suggest that a binding component of alpha1-adrenoreceptors is expressed to a lesser extent in the retina than the cortex, leading to a reduced response of the retinal tissue to prazosin, and more particularly to WB4101 and phentolamine. The selective binding of the nicergoline on this retinal adrenoreceptor may explain the peculiar efficacy of the drug in ocular pathophysiology.

  15. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  16. Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

    PubMed Central

    Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

    2012-01-01

    Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

  17. Interaction of a novel peptoid enhancer--arginine oligomer with bovine submaxillary mucin.

    PubMed

    Liang, Wei; Davalian, Dariush; Torchilin, Vladimir P

    2004-12-01

    To determine the thermodynamics of binding reaction of arginine oligomer (R8) to bovine submaxillary mucin (BSM) in order to provide the foundation for understanding the influence of mucin on transport of macromolecules through mucosa mediated by arginine oligomer. Ultracentrifugation sedimentation was employed to investigate the interaction of BSM-R8. The mixtures of R8 with variable concentration and constant volume of BSM were placed on a shaker under oscillation at 25 degrees C to achieve equilibriums of binding reaction, and then centrifuged. The fluorescence intensity of the supernatant was measured by spectrofluorometer. The data were described by two types of binding sites model, the binding parameters of BSM-R8 were obtained by Scatchard plots. At the low pH values < or = 4.5 and ionic strength > or = 0.2 mol x L(-1), the BSM-R8 interaction was principally electrostatic interaction, the five primary binding sites (n1) predominantly were supplied by sulfate groups, the secondary binding sites apparently depended on pH, in that percent ionization of sialic acid residues (n2) in BSM. At the low ionic strength < or = 0.2 mol x L(-1) and pH 7.0, the BSM-R8 interaction was exceedingly complex, hydrogen bonds, hydrophobic interaction and electrostatic forces were involved in the interaction between R8 and BSM, the binding sites of BSM bound R8 were markedly increased. There existed evidence that R8 interacted with BSM. The pH and the ionic strength of the binding solution strongly affected the interaction of BSM with R8. The results suggested that the enhancing efficacy of the arginine oligomer for the transport of macromolecules through different site mucosa in body might be variable.

  18. Characterization of a neurokinin B receptor site in rat brain using a highly selective radioligand.

    PubMed

    Laufer, R; Gilon, C; Chorev, M; Selinger, Z

    1986-08-05

    We have recently characterized a tachykinin receptor subtype (SP-N) whose preferred ligand is the mammalian neuropeptide, neurokinin B (Laufer, R., Wormser, U., Friedman, Z. Y., Gilon, C., Chorev, M., and Selinger, Z. (1985) Proc. Natl. Acad. Sci. U.S.A. 82, 7444-7448). To investigate this novel tachykinin receptor, we have now prepared a radiolabeled peptide, N alpha-[( 125I]desamino-3-iodotyrosyl)-[Asp5,6, N-methyl-Phe8]substance P (5-11) heptapeptide (125I-BH-NH-Senktide), which selectively interacts with the SP-N receptor subtype. The binding of 125I-BH-NH-Senktide to rat cerebral cortex membranes was studied under conditions that minimized nonspecific binding. Unlike other tachykinin receptor probes, this radioligand is not degraded during the binding experiment. Binding of 125I-BH-NH-Senktide is reversible, saturable, and of high affinity (KD = 0.9 nM). The radioligand labels a single class of binding site (122 fmol binding sites/mg of protein), as indicated by a linear Scatchard plot and a Hill coefficient close to unity (nH = 1.05). The pharmacological specificity of this binding site corresponds to that of the neuronal SP-N receptor in guinea pig ileum myenteric plexus, which was determined by a functional bioassay. Among various rat brain regions, the highest binding was observed in the cerebral cortex, olfactory bulb, hypothalamus, and hippocampus. These results suggest the existence and specific distribution of a neurokinin B receptor site of the SP-N type in rat brain. 125I-BH-NH-Senktide is the first selective and potent probe for this receptor and is thus an important tool for further studies of its distribution, regulation, and functional role.

  19. Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

    PubMed

    Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

    2017-01-01

    Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  20. Modeling the Binding of Neurotransmitter Transporter Inhibitors with Molecular Dynamics and Free Energy Calculations

    NASA Astrophysics Data System (ADS)

    Jean, Bernandie

    The monoamine transporter (MAT) proteins responsible for the reuptake of the neurotransmitter substrates, dopamine, serotonin, and norepinephrine, are drug targets for the treatment of psychiatric disorders including depression, anxiety, and attention deficit hyperactivity disorder. Small molecules that inhibit these proteins can serve as useful therapeutic agents. However, some dopamine transporter (DAT) inhibitors, such as cocaine and methamphetamine, are highly addictive and abusable. Efforts have been made to develop small molecules that will inhibit the transporters and elucidate specific binding site interactions. This work provides knowledge of molecular interactions associated with MAT inhibitors by offering an atomistic perspective that can guide designs of new pharmacotherapeutics with enhanced activity. The work described herein evaluates intermolecular interactions using computational methods to reveal the mechanistic detail of inhibitors binding in the DAT. Because cocaine recognizes the extracellular-facing or outward-facing (OF) DAT conformation and benztropine recognizes the intracellular-facing or inward-facing (IF) conformation, it was postulated that behaviorally "typical" (abusable, locomotor psychostimulant) inhibitors stabilize the OF DAT and "atypical" (little or no abuse potential) inhibitors favor IF DAT. Indeed, behaviorally-atypical cocaine analogs have now been shown to prefer the OF DAT conformation. Specifically, the binding interactions of two cocaine analogs, LX10 and LX11, were studied in the OF DAT using molecular dynamics simulations. LX11 was able to interact with residues of transmembrane helix 8 and bind in a fashion that allowed for hydration of the primary binding site (S1) from the intracellular space, thus impacting the intracellular interaction network capable of regulating conformational transitions in DAT. Additionally, a novel serotonin transporter (SERT) inhibitor previously discovered through virtual screening at the SERT secondary binding site (S2) was studied. Intermolecular interactions between SM11 and SERT have been assessed using binding free energy calculations to predict the ligand-binding site and optimize ligand-binding interactions. Results indicate the addition of atoms to the 4-chlorobenzyl moiety were most energetically favorable. The simulations carried out in DAT and SERT were supported by experimental results. Furthermore, the co-crystal structures of DAT and SERT share similar ligand-binding interactions with the homology models used in this study.

  1. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  2. MDB: the Metalloprotein Database and Browser at The Scripps Research Institute

    PubMed Central

    Castagnetto, Jesus M.; Hennessy, Sean W.; Roberts, Victoria A.; Getzoff, Elizabeth D.; Tainer, John A.; Pique, Michael E.

    2002-01-01

    The Metalloprotein Database and Browser (MDB; http://metallo.scripps.edu) at The Scripps Research Institute is a web-accessible resource for metalloprotein research. It offers the scientific community quantitative information on geometrical parameters of metal-binding sites in protein structures available from the Protein Data Bank (PDB). The MDB also offers analytical tools for the examination of trends or patterns in the indexed metal-binding sites. A user can perform interactive searches, metal-site structure visualization (via a Java applet), and analysis of the quantitative data by accessing the MDB through a web browser without requiring an external application or platform-dependent plugin. The MDB also has a non-interactive interface with which other web sites and network-aware applications can seamlessly incorporate data or statistical analysis results from metal-binding sites. The information contained in the MDB is periodically updated with automated algorithms that find and index metal sites from new protein structures released by the PDB. PMID:11752342

  3. Trench-shaped binding sites promote multiple classes of interactions between collagen and the adherence receptors, alpha(1)beta(1) integrin and Staphylococcus aureus cna MSCRAMM.

    PubMed

    Rich, R L; Deivanayagam, C C; Owens, R T; Carson, M; Höök, A; Moore, D; Symersky, J; Yang, V W; Narayana, S V; Höök, M

    1999-08-27

    Most mammalian cells and some pathogenic bacteria are capable of adhering to collagenous substrates in processes mediated by specific cell surface adherence molecules. Crystal structures of collagen-binding regions of the human integrin alpha(2)beta(1) and a Staphylococcus aureus adhesin reveal a "trench" on the surface of both of these proteins. This trench can accommodate a collagen triple-helical structure and presumably represents the ligand-binding site (Emsley, J., King, S. L., Bergelson, J. M., and Liddington, R. C. (1997) J. Biol. Chem. 272, 28512-28517; Symersky, J., Patti, J. M., Carson, M., House-Pompeo, K., Teale, M., Moore, D., Jin, L., Schneider, A., DeLucas, L. J., Höök, M., and Narayana, S. V. L. (1997) Nat. Struct. Biol. 4, 833-838). We report here the crystal structure of the alpha subunit I domain from the alpha(1)beta(1) integrin. This collagen-binding protein also contains a trench on one face in which the collagen triple helix may be docked. Furthermore, we compare the collagen-binding mechanisms of the human alpha(1) integrin I domain and the A domain from the S. aureus collagen adhesin, Cna. Although the S. aureus and human proteins have unrelated amino acid sequences, secondary structure composition, and cation requirements for effective ligand binding, both proteins bind at multiple sites within one collagen molecule, with the sites in collagen varying in their affinity for the adherence molecule. We propose that (i) these evolutionarily dissimilar adherence proteins recognize collagen via similar mechanisms, (ii) the multisite, multiclass protein/ligand interactions observed in these two systems result from a binding-site trench, and (iii) this unusual binding mechanism may be thematic for proteins binding extended, rigid ligands that contain repeating structural motifs.

  4. Receptor type I and type II binding regions and the peptidyl-prolyl isomerase site of cyclophilin B are required for enhancement of T-lymphocyte adhesion to fibronectin.

    PubMed

    Carpentier, Mathieu; Allain, Fabrice; Slomianny, Marie-Christine; Durieux, Sandrine; Vanpouille, Christophe; Haendler, Bernard; Spik, Geneviève

    2002-04-23

    Cyclophilin B (CyPB), a cyclosporin A (CsA) binding protein, interacts with two types of binding sites at the surface of T-lymphocytes. The type I sites correspond to functional receptors involved in endocytosis and the type II sites to sulfated glycosaminoglycans (GAGs). Mutational analysis of CyPB has revealed that W128, which is part of the CsA-binding pocket, is implicated in the binding to the functional type I receptors and that two amino acid clusters located in the N-terminus ensure the binding to GAGs. The peptidyl-prolyl isomerase activity of CyPB is not required for receptor binding. We have recently demonstrated that CyPB enhances adhesion of peripheral blood T-lymphocytes to fibronectin, a component of the extracellular matrix. We intended to identify additional amino acids involved in the binding of CyPB to its functional type I receptor and to determine regions responsible for the stimulation of peripheral blood T-lymphocyte adhesion. We determined that residues R76, G77, K132, D155, and D158 of the calcineurin (CN) interacting region were implicated in the recognition of type I receptor but not of GAGs. We also found that two different changes in the N-terminal extension that abated binding to GAGs prevented adhesion of peripheral blood T-lymphocytes to coated CyPB, whereas abbrogation of the PPIase activity had no effect. On the other hand, the adhesion of peripheral blood T-lymphocytes to coated fibronectin was not stimulated by CyPB mutants devoid of either type I receptor or GAGs binding activity or by mutants of the PPIase site. Altogether, the results demonstrate that different regions of CyPB are involved in peripheral blood T-lymphocyte activation and imply a novel important physiological function for peptidyl-prolyl isomerase activity.

  5. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  7. Bone morphogenetic protein 2 activates Smad6 gene transcription through bone-specific transcription factor Runx2.

    PubMed

    Wang, Qing; Wei, Xiaochao; Zhu, Tianhui; Zhang, Ming; Shen, Run; Xing, Lianping; O'Keefe, Regis J; Chen, Di

    2007-04-06

    BMP-2 plays an essential role in osteoblast and chondrocyte differentiation, but its signaling mechanism has not been fully defined. In the present studies, we investigated the mechanism through which BMP-2 activates the Smad6 gene. A -2006/+45 Smad6 promoter-luciferase construct was generated along with deletions and Runx2 binding site mutations to examine the role of Smad1 and Runx2 signaling following BMP-2 stimulation in osteoblasts. Transfection of Runx2 or treatment with BMP-2-stimulated promoter activity of the -2006/+45 and -1191/+45 reporters but not the -829/+45 and -374/+45 reporters. No Smad1/5 binding site is present in the -1191/-829 region of the Smad6 promoter. Mutation of the OSE2-a site (-1036/-1031) completely abolished the stimulatory effect of Runx2 as well as BMP-2 on the -2006/+45 and -1191/+45 Smad6 reporters. Gel shift and chromatin immunoprecipitation (ChIP) assays showed that Runx2 binds the OSE2-a element. ChIP assays demonstrated that Smad1 also interacts with the OSE2-a site at the Smad6 promoter through Runx2. The protein degradation of Runx2 is mediated by the E3 ubiquitin ligase Smurf1. In the present studies, we found that Smurf1 binds the OSE2-a site through Runx2 and inhibits Smad6 gene transcription. Treatment with BMP-2 and transfection of Smad1 abolished Smurf1 binding to the OSE2 site. These results show that Smad1 binding excludes Smurf1 interaction with the OSE2 site and promotes Smad6 gene transcription.

  8. Mefloquine inhibits voltage dependent Nav1.4 channel by overlapping the local anaesthetic binding site.

    PubMed

    Paiz-Candia, Bertin; Islas, Angel A; Sánchez-Solano, Alfredo; Mancilla-Simbro, Claudia; Scior, Thomas; Millan-PerezPeña, Lourdes; Salinas-Stefanon, Eduardo M

    2017-02-05

    Mefloquine constitutes a multitarget antimalaric that inhibits cation currents. However, the effect and the binding site of this compound on Na + channels is unknown. To address the mechanism of action of mefloquine, we employed two-electrode voltage clamp recordings on Xenopus laevis oocytes, site-directed mutagenesis of the rat Na + channel, and a combined in silico approach using Molecular Dynamics and docking protocols. We found that mefloquine: i) inhibited Na v 1.4 currents (IC 50 =60μM), ii) significantly delayed fast inactivation but did not affect recovery from inactivation, iii) markedly the shifted steady-state inactivation curve to more hyperpolarized potentials. The presence of the β1 subunit significantly reduced mefloquine potency, but the drug induced a significant frequency-independent rundown upon repetitive depolarisations. Computational and experimental results indicate that mefloquine overlaps the local anaesthetic binding site by docking at a hydrophobic cavity between domains DIII and DIV that communicates the local anaesthetic binding site with the selectivity filter. This is supported by the fact that mefloquine potency significantly decreased on mutant Na v 1.4 channel F1579A and significantly increased on K1237S channels. In silico this compound docked above F1579 forming stable π-π interactions with this residue. We provide structure-activity insights into how cationic amphiphilic compounds may exert inhibitory effects by docking between the local anaesthetic binding site and the selectivity filter of a mammalian Na + channel. Our proposed synergistic cycle of experimental and computational studies may be useful for elucidating binding sites of other drugs, thereby saving in vitro and in silico resources. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Two-phase positive inotropic effects of ouabain and the presence of multiple classes of ouabain binding sites in the ferret heart

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ng, Y.C.; Akera, T.

    1986-03-05

    Characteristics of more than one class of ouabain receptors which appear to exist in ferret heart were examined. In isolated papillary muscle, 1 to 30 nM ouabain produced a positive inotropic effect in the presence of 5 ..mu..M propranolol and 2 ..mu..M phentolamine. Higher concentrations of ouabain (0.1 to 10 ..mu..M) produced an additional and prominent inotropic effect. In partially purified Na, K-ATPase, ouabain caused a monophasic inhibition; however, the concentration-inhibition curve spanned over 5 log units, indicating that ouabain is interacting with more than a single class of the enzyme. Scatchard analysis of specific /sup 3/H-ouabain binding revealed approximatelymore » equal abundance of high and low affinity binding sites. The K/sub D/ value for high affinity sites was approximately 20 nM whereas that for low affinity sites was about 45 times higher. When phosphoenzyme was formed in the presence of (..gamma..-/sup 32/P)-ATP, Mg/sup 2 +/ and Na/sup +/ and subjected to SDS gel electrophoresis, two distinct K/sup +/-sensitive bands with about 100,000 dalton molecular weight were detected. Molecular weight difference between these two bands was approximately 2500 dalton. Phosphorylation of either band was abolished by 1 ..mu..M ouabain suggesting that both bands may correspond to the high-affinity binding sites. These results indicate that high and low affinity ouabain binding sites exists in approximately equal abundance in the ferret heart, and that binding of ouabain to these sites cases Na,K-ATPase inhibition and the positive inotropic effect.« less

  10. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  11. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. The heat shock protein 90 antagonist novobiocin interacts with a previously unrecognized ATP-binding domain in the carboxyl terminus of the chaperone.

    PubMed

    Marcu, M G; Chadli, A; Bouhouche, I; Catelli, M; Neckers, L M

    2000-11-24

    Heat shock protein 90 (Hsp90), one of the most abundant chaperones in eukaryotes, participates in folding and stabilization of signal-transducing molecules including steroid hormone receptors and protein kinases. The amino terminus of Hsp90 contains a non-conventional nucleotide-binding site, related to the ATP-binding motif of bacterial DNA gyrase. The anti-tumor agents geldanamycin and radicicol bind specifically at this site and induce destabilization of Hsp90-dependent client proteins. We recently demonstrated that the gyrase inhibitor novobiocin also interacts with Hsp90, altering the affinity of the chaperone for geldanamycin and radicicol and causing in vitro and in vivo depletion of key regulatory Hsp90-dependent kinases including v-Src, Raf-1, and p185(ErbB2). In the present study we used deletion/mutation analysis to identify the site of interaction of novobiocin with Hsp90, and we demonstrate that the novobiocin-binding site resides in the carboxyl terminus of the chaperone. Surprisingly, this motif also recognizes ATP, and ATP and novobiocin efficiently compete with each other for binding to this region of Hsp90. Novobiocin interferes with association of the co-chaperones Hsc70 and p23 with Hsp90. These results identify a second site on Hsp90 where the binding of small molecule inhibitors can significantly impact the function of this chaperone, and they support the hypothesis that both amino- and carboxyl-terminal domains of Hsp90 interact to modulate chaperone activity.

  13. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  14. Botulinum neurotoxin serotype D attacks neurons via two carbohydrate-binding sites in a ganglioside-dependent manner.

    PubMed

    Strotmeier, Jasmin; Lee, Kwangkook; Völker, Anne K; Mahrhold, Stefan; Zong, Yinong; Zeiser, Johannes; Zhou, Jie; Pich, Andreas; Bigalke, Hans; Binz, Thomas; Rummel, Andreas; Jin, Rongsheng

    2010-10-15

    The extraordinarily high toxicity of botulinum neurotoxins primarily results from their specific binding and uptake into neurons. At motor neurons, the seven BoNT (botulinum neurotoxin) serotypes A-G inhibit acetylcholine release leading to flaccid paralysis. Uptake of BoNT/A, B, E, F and G requires a dual interaction with gangliosides and the synaptic vesicle proteins synaptotagmin or SV2 (synaptic vesicle glycoprotein 2), whereas little is known about the cell entry mechanisms of the serotypes C and D, which display the lowest amino acid sequence identity compared with the other five serotypes. In the present study we demonstrate that the neurotoxicity of BoNT/D depends on the presence of gangliosides by employing phrenic nerve hemidiaphragm preparations derived from mice expressing the gangliosides GM3, GM2, GM1 and GD1a, or only GM3 [a description of our use of ganglioside nomenclature is given in Svennerholm (1994) Prog. Brain Res. 101, XI-XIV]. High-resolution crystal structures of the 50 kDa cell-binding domain of BoNT/D alone and in complex with sialic acid, as well as biological analyses of single-site BoNT/D mutants identified two carbohydrate-binding sites. One site is located at a position previously identified in BoNT/A, B, E, F and G, but is lacking the conserved SXWY motif. The other site, co-ordinating one molecule of sialic acid, resembles the second ganglioside-binding pocket (the sialic-acid-binding site) of TeNT (tetanus neurotoxin).

  15. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  16. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  17. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  18. Sugar-binding sites on the surface of the carbohydrate-binding module of CBH I from Trichoderma reesei.

    PubMed

    Tavagnacco, Letizia; Mason, Philip E; Schnupf, Udo; Pitici, Felicia; Zhong, Linghao; Himmel, Michael E; Crowley, Michael; Cesàro, Attilio; Brady, John W

    2011-05-01

    Molecular dynamics simulations were carried out for a system consisting of the carbohydrate-binding module (CBM) of the cellulase CBH I from Trichoderma reesei (Hypocrea jecorina) in a concentrated solution of β-D-glucopyranose, to determine whether there is any tendency for the sugar molecules to bind to the CBM. In spite of the general tendency of glucose to behave as an osmolyte, a marked tendency for the sugar molecules to bind to the protein was observed. However, the glucose molecules tended to bind only to specific sites on the protein. As expected, the hydrophobic face of the sugar molecules, comprising the axial H1, H3, and H5 aliphatic protons, tended to adhere to the flat faces of the three tyrosine side chains on the planar binding surface of the CBM. However, a significant tendency to bind to a groove-like feature on the upper surface of the CBM was also observed. These results would not be inconsistent with a model of the mechanism for this globular domain in which the cellodextrin chain being removed from the surface of crystalline cellulose passes over the upper surface of the CBM, presumably then available for hydrolysis in the active site tunnel of this processive cellulase. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. The Src SH2 domain interacts dynamically with the focal adhesion kinase binding site as demonstrated by paramagnetic NMR spectroscopy.

    PubMed

    Lindfors, Hanna E; Drijfhout, Jan Wouter; Ubbink, Marcellus

    2012-06-01

    The interaction between the tyrosine kinases Src and focal adhesion kinase (FAK) is a key step in signaling processes from focal adhesions. The phosphorylated tyrosine residue 397 in FAK is able to bind the Src SH2 domain. To establish the extent of the FAK binding motif, the binding affinity of the SH2 domain for phosphorylated and unphosphorylated FAK-derived peptides of increasing length was determined and compared with that of the internal Src SH2 binding site. It is shown that the FAK peptides have higher affinity than the internal binding site and that seven negative residues adjacent to the core SH2 binding motif increase the binding constant 30-fold. A rigid spin-label incorporated in the FAK peptides was used to establish on the basis of paramagnetic relaxation enhancement whether the peptide-protein complex is well defined. A large spread of the paramagnetic effects on the surface of the SH2 domain suggests that the peptide-protein complex exhibits dynamics, despite the high affinity of the peptide. The strong electrostatic interaction between the positive side of the SH2 domain and the negative peptide results in a high affinity but may also favor a dynamic interaction. Copyright © 2012 Wiley Periodicals, Inc.

  20. Characterization of strychnine-sensitive glycine receptor in the intact frog retina: modulation by protein kinases.

    PubMed

    Salceda, Rocío; Aguirre-Ramirez, Marisela

    2005-03-01

    We studied 3H-glycine and 3H-strychnine specific binding to glycine receptor (GlyR) in intact isolated frog retinas. To avoid glycine binding to glycine uptake sites, experiments were performed at low ligand concentrations in a sodium-free medium. The binding of both radiolabeled ligands was saturated. Scatchard analysis of bound glycine and strychnine revealed a KD of 2.5 and 2.0 microM, respectively. Specific binding of glycine was displaced by beta-alanine, sarcosine, and strychnine. Strychnine binding was displaced 50% by glycine, and sarcosine. Properties of the strychnine-binding site in the GlyR were modified by sarcosine. Binding of both radioligands was considerably reduced by compounds that inhibit or activate adenylate cyclase and increased cAMP levels. A phorbol ester activator of PKC remarkably decreased glycine and strychnine binding. These results suggest modulation of GlyR in response to endogenous activation of protein kinases A and C, as well as protein phosphorylation modulating GlyR function in retina.

  1. Biological role and structural mechanism of twinfilin–capping protein interaction

    PubMed Central

    Falck, Sandra; Paavilainen, Ville O; Wear, Martin A; Grossmann, J Günter; Cooper, John A; Lappalainen, Pekka

    2004-01-01

    Twinfilin and capping protein (CP) are highly conserved actin-binding proteins that regulate cytoskeletal dynamics in organisms from yeast to mammals. Twinfilin binds actin monomer, while CP binds the barbed end of the actin filament. Remarkably, twinfilin and CP also bind directly to each other, but the mechanism and role of this interaction in actin dynamics are not defined. Here, we found that the binding of twinfilin to CP does not affect the binding of either protein to actin. Furthermore, site-directed mutagenesis studies revealed that the CP-binding site resides in the conserved C-terminal tail region of twinfilin. The solution structure of the twinfilin–CP complex supports these conclusions. In vivo, twinfilin's binding to both CP and actin monomer was found to be necessary for twinfilin's role in actin assembly dynamics, based on genetic studies with mutants that have defined biochemical functions. Our results support a novel model for how sequential interactions between actin monomers, twinfilin, CP, and actin filaments promote cytoskeletal dynamics. PMID:15282541

  2. Differential regulation of transcription through distinct Suppressor of Hairless DNA binding site architectures during Notch signaling in proneural clusters.

    PubMed

    Cave, John W; Xia, Li; Caudy, Michael

    2011-01-01

    In Drosophila melanogaster, achaete (ac) and m8 are model basic helix-loop-helix activator (bHLH A) and repressor genes, respectively, that have the opposite cell expression pattern in proneural clusters during Notch signaling. Previous studies have shown that activation of m8 transcription in specific cells within proneural clusters by Notch signaling is programmed by a "combinatorial" and "architectural" DNA transcription code containing binding sites for the Su(H) and proneural bHLH A proteins. Here we show the novel result that the ac promoter contains a similar combinatorial code of Su(H) and bHLH A binding sites but contains a different Su(H) site architectural code that does not mediate activation during Notch signaling, thus programming a cell expression pattern opposite that of m8 in proneural clusters.

  3. Multiheteromacrocycles that Complex Metal Ions. Ninth Progress Report (includes results of last three years), 1 May 1980 -- 30 April 1983

    DOE R&D Accomplishments Database

    Cram, D. J.

    1982-09-15

    The overall objective of this research is to design, synthesize, and evaluate cyclic and polycyclic host organic compounds for the abilities to complex and lipophilize guest metal ions, their complexes, and their clusters. Host organic compounds consist of strategically placed solvating, coordinating, and ion-pairing sites tied together by covalent bonds through hydrocarbon units around cavities shaped to be occupied by guest metal ions, or by metal ions plus their ligands. Specificity in complexation is sought by matching the following properties of host and guest: cavity and metal ion sizes; geometric arrangements of binding sites; numbers of binding sites; characters of binding sites; and valences. The hope is to synthesize new classes of compounds useful in the separation of metal ions, their complexes, and their clusters.

  4. Theoretical Insights into Methane C–H Bond Activation on Alkaline Metal Oxides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aljama, Hassan; Nørskov, Jens K.; Abild-Pedersen, Frank

    Here, we investigate the role of alkaline metal oxides (AMO) (MgO, CaO, and SrO) in activating the C–H bond in methane. We also use Density Functional Theory (DFT) and microkinetic modeling to study the catalytic elementary steps in breaking the C–H bond in methane and creating the methyl radical, a precursor prior to creating C2 products. We also study the effects of surface geometry on the catalytic activity of AMO by examining terrace and step sites. We observe that the process of activating methane depends strongly on the structure of the AMO. When the AMO surface is doped with anmore » alkali metal, the transition state (TS) structure has a methyl radical-like behavior, where the methyl radical interacts weakly with the AMO surface. In this case, the TS energy scales with the hydrogen binding energy. On pure AMO, the TS interacts with AMO surface oxygen as well as the metal atom on the surface, and consequently the TS energy scales with the binding energy of hydrogen and methyl. We study the activity of AMO using a mean-field microkinetic model. The results indicate that terrace sites have similar catalytic activity, with the exception of MgO(100). Step sites bind hydrogen more strongly, making them more active, and this confirms previously reported experimental results. We map the catalytic activity of AMO using a volcano plot with two descriptors: the methyl and the hydrogen binding energies, with the latter being a more significant descriptor. The microkinetic model results suggest that C–H bond dissociation is not always the rate-limiting step. At weak hydrogen binding, the reaction is limited by C–H bond activation. At strong hydrogen binding, the reaction is limited due to poisoning of the active site. We found an increase in activity of AMO as the basicity increased. Finally, the developed microkinetic model allows screening for improved catalysts using simple calculations of the hydrogen binding energy.« less

  5. Theoretical Insights into Methane C–H Bond Activation on Alkaline Metal Oxides

    DOE PAGES

    Aljama, Hassan; Nørskov, Jens K.; Abild-Pedersen, Frank

    2017-07-17

    Here, we investigate the role of alkaline metal oxides (AMO) (MgO, CaO, and SrO) in activating the C–H bond in methane. We also use Density Functional Theory (DFT) and microkinetic modeling to study the catalytic elementary steps in breaking the C–H bond in methane and creating the methyl radical, a precursor prior to creating C2 products. We also study the effects of surface geometry on the catalytic activity of AMO by examining terrace and step sites. We observe that the process of activating methane depends strongly on the structure of the AMO. When the AMO surface is doped with anmore » alkali metal, the transition state (TS) structure has a methyl radical-like behavior, where the methyl radical interacts weakly with the AMO surface. In this case, the TS energy scales with the hydrogen binding energy. On pure AMO, the TS interacts with AMO surface oxygen as well as the metal atom on the surface, and consequently the TS energy scales with the binding energy of hydrogen and methyl. We study the activity of AMO using a mean-field microkinetic model. The results indicate that terrace sites have similar catalytic activity, with the exception of MgO(100). Step sites bind hydrogen more strongly, making them more active, and this confirms previously reported experimental results. We map the catalytic activity of AMO using a volcano plot with two descriptors: the methyl and the hydrogen binding energies, with the latter being a more significant descriptor. The microkinetic model results suggest that C–H bond dissociation is not always the rate-limiting step. At weak hydrogen binding, the reaction is limited by C–H bond activation. At strong hydrogen binding, the reaction is limited due to poisoning of the active site. We found an increase in activity of AMO as the basicity increased. Finally, the developed microkinetic model allows screening for improved catalysts using simple calculations of the hydrogen binding energy.« less

  6. The kinetics of effector binding to phosphofructokinase. The allosteric conformational transition induced by 1,N6-ethenoadenosine triphosphate.

    PubMed Central

    Roberts, D; Kellett, G L

    1979-01-01

    1. The fluorescent ATP analogue 1,N6-etheno-ATP is a good substrate and an efficient allosteric inhibitor of rabbit skeletal-muscle phosphofructokinase. 2. Fluorescence energy transfer occurs between bound 1,N6-etheno-ATP and phosphofructokinase. 1,N6-Etheno-ATP fluorescence is enhanced, intrinsic protein fluorescence is quenched, and the excitation spectrum of 1,N6-etheno-ATP fluorescence is characteristic of protein absorption. 3. The binding reaction of 1,N6-etheno-ATP observed by stopped-flow fluorimetry is biphasic. The fast phase results from binding to the catalytic site alone. The slow phase results from the allosteric transition of the R conformation into the T conformation induced by the binding of 1,N6-etheno-ATP to the regulatory site. 4. The fluorescence signal that allows the transition of the R conformation into the T conformation to be observed does not arise from 1,N6-etheno-ATP bound to the regulatory site. It arises instead from 1,N6-etheno-ATP bound to the catalytic site as a consequence of changes at the catalytic site caused by the transition of the R conformation into the T conformation. 5. In the presence of excess of Mg2+, the affinity of 1,N6-etheno-ATP for the regulatory site is very much greater in the T state than in the R state. Images Fig. 5. Fig. 8. PMID:160791

  7. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    PubMed Central

    2010-01-01

    Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

  8. Zinc Finger Independent Genome-Wide Binding of Sp2 Potentiates Recruitment of Histone-Fold Protein Nf-y Distinguishing It from Sp1 and Sp3

    PubMed Central

    Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram

    2015-01-01

    Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500

  9. Monomolecular Siloxane Film as a Model of Single Site Catalysts

    DOE PAGES

    Martynowycz, Michael W.; Hu, Bo; Kuzmenko, Ivan; ...

    2016-09-06

    Achieving structurally well-defined catalytic species requires a fundamental understanding of surface chemistry. Detailed structural characterization of the catalyst binding sites in situ, such as single site catalysts on silica supports, is technically challenging or even unattainable. Octadecyltrioxysilane (OTOS) monolayers formed from octadecyltrimethoxysilane (OTMS) at the air-liquid interface after hydrolysis and condensation at low pH were chosen as a model system of surface binding sites in silica-supported Zn 2+ catalysts. We characterize the system by grazing incidence X-ray diffraction, X-ray reflectivity (XR), and X-ray fluorescence spectroscopy (XFS). Previous X-ray and infrared surface studies of OTMS/OTOS films at the airliquid interface proposedmore » the formation of polymer OTOS structures. According to our analysis, polymer formation is inconsistent with the X-ray observations and structural properties of siloxanes; it is energetically unfavorable and thus highly unlikely. We suggest an alternative mechanism of hydrolysis/condensation in OTMS leading to the formation of structurally allowed cyclic trimers with the six-membered siloxane rings, which explain well both the X-ray and infrared results. XR and XFS consistently demonstrate that tetrahedral [Zn(NH 3) 4] 2+ ions bind to hydroxyl groups of the film at a stoichiometric ratio of OTOS:Zn ~ 2:1. The high binding affinity of zinc ions to OTOS trimers suggests that the six-membered siloxane rings are binding locations for single site Zn/SiO 2 catalysts. Finally, our results show that OTOS monolayers may serve as a platform for studying silica surface chemistry or hydroxyl-mediated reactions.« less

  10. A gain-of-function mutation in the M-domain of cardiac myosin-binding protein-C increases binding to actin.

    PubMed

    Bezold, Kristina L; Shaffer, Justin F; Khosa, Jaskiran K; Hoye, Elaine R; Harris, Samantha P

    2013-07-26

    The M-domain is the major regulatory subunit of cardiac myosin-binding protein-C (cMyBP-C) that modulates actin and myosin interactions to influence muscle contraction. However, the precise mechanism(s) and the specific residues involved in mediating the functional effects of the M-domain are not fully understood. Positively charged residues adjacent to phosphorylation sites in the M-domain are thought to be critical for effects of cMyBP-C on cross-bridge interactions by mediating electrostatic binding with myosin S2 and/or actin. However, recent structural studies revealed that highly conserved sequences downstream of the phosphorylation sites form a compact tri-helix bundle. Here we used site-directed mutagenesis to probe the functional significance of charged residues adjacent to the phosphorylation sites and conserved residues within the tri-helix bundle. Results confirm that charged residues adjacent to phosphorylation sites and residues within the tri-helix bundle are important for mediating effects of the M-domain on contraction. In addition, four missense variants within the tri-helix bundle that are associated with human hypertrophic cardiomyopathy caused either loss-of-function or gain-of-function effects on force. Importantly, the effects of the gain-of-function variant, L348P, increased the affinity of the M-domain for actin. Together, results demonstrate that functional effects of the M-domain are not due solely to interactions with charged residues near phosphorylatable serines and provide the first demonstration that the tri-helix bundle contributes to the functional effects of the M-domain, most likely by binding to actin.

  11. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  12. Mapping of the acetylcholine binding site of the nicotinic acetylcholine receptor: ( sup 3 H)nicotine as an agonist photoaffinity label

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Middleton, R.E.; Cohen, J.B.

    1991-07-16

    The agonist ({sup 3}H)nicotine was used as a photoaffinity label for the acetylcholine binding sties on the Torpedo nicotinic acetylcholine receptor (AChR). ({sup 3}H)Nicotine binds at equilibrium with K{sub eq} = 0.6 {mu}M to the agonist binding sites. Irradiation with 254-nm light of AChR-rich membranes equilibrated with ({sup 3}H)nicotine resulted in covalent incorporation into the {alpha}- and {gamma}-subunits, which was inhibited by agonists and competitive antagonists but not by noncompetitive antagonists. Inhibition of labeling by d-tubocurarine demonstrated that the {alpha}-subunit was labeled via both agonist sites but the {gamma}-subunit was labeled only via the site that binds d-tubocurarine with highmore » affinity. Chymotryptic digestion of the {alpha}-subunit confirmed that Try-198 was the principal amino acid labeled by ({sup 3}H)nicotine. This confirmation required a novel radiosequencing strategy employing o-phthalaldehyde ({sup 3}H)Nicotine, which is the first photoaffinity agonist used, labels primarily Tyr-198 in contrast to competitive antagonist affinity labels, which label primarily Tyr-190 and Cys-192/Cys-193.« less

  13. A spin transition mechanism for cooperative adsorption in metal-organic frameworks

    NASA Astrophysics Data System (ADS)

    Reed, Douglas A.; Keitz, Benjamin K.; Oktawiec, Julia; Mason, Jarad A.; Runčevski, Tomče; Xiao, Dianne J.; Darago, Lucy E.; Crocellà, Valentina; Bordiga, Silvia; Long, Jeffrey R.

    2017-10-01

    Cooperative binding, whereby an initial binding event facilitates the uptake of additional substrate molecules, is common in biological systems such as haemoglobin. It was recently shown that porous solids that exhibit cooperative binding have substantial energetic benefits over traditional adsorbents, but few guidelines currently exist for the design of such materials. In principle, metal-organic frameworks that contain coordinatively unsaturated metal centres could act as both selective and cooperative adsorbents if guest binding at one site were to trigger an electronic transformation that subsequently altered the binding properties at neighbouring metal sites. Here we illustrate this concept through the selective adsorption of carbon monoxide (CO) in a series of metal-organic frameworks featuring coordinatively unsaturated iron(II) sites. Functioning via a mechanism by which neighbouring iron(II) sites undergo a spin-state transition above a threshold CO pressure, these materials exhibit large CO separation capacities with only small changes in temperature. The very low regeneration energies that result may enable more efficient Fischer-Tropsch conversions and extraction of CO from industrial waste feeds, which currently underutilize this versatile carbon synthon. The electronic basis for the cooperative adsorption demonstrated here could provide a general strategy for designing efficient and selective adsorbents suitable for various separations.

  14. Identification of metal ion binding sites based on amino acid sequences

    PubMed Central

    Cao, Xiaoyong; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

    2017-01-01

    The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html. PMID:28854211

  15. Identification of metal ion binding sites based on amino acid sequences.

    PubMed

    Cao, Xiaoyong; Hu, Xiuzhen; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

    2017-01-01

    The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html.

  16. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  17. Degradation of Perfluorinated Ether Lubricants on Pure Aluminum Surfaces: Semiempirical Quantum Chemical Modeling

    NASA Technical Reports Server (NTRS)

    Slaby, Scott M.; Ewing, David W.; Zehe, Michael J.

    1997-01-01

    The AM1 semiempirical quantum chemical method was used to model the interaction of perfluoroethers with aluminum surfaces. Perfluorodimethoxymethane and perfluorodimethyl ether were studied interacting with aluminum surfaces, which were modeled by a five-atom cluster and a nine-atom cluster. Interactions were studied for edge (high index) sites and top (low index) sites of the clusters. Both dissociative binding and nondissociative binding were found, with dissociative binding being stronger. The two different ethers bound and dissociated on the clusters in different ways: perfluorodimethoxymethane through its oxygen atoms, but perfluorodimethyl ether through its fluorine atoms. The acetal linkage of perfluorodimeth-oxymethane was the key structural feature of this molecule in its binding and dissociation on the aluminum surface models. The high-index sites of the clusters caused the dissociation of both ethers. These results are consistent with the experimental observation that perfluorinated ethers decompose in contact with sputtered aluminum surfaces.

  18. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

    PubMed

    Kageyama, R; Merlino, G T; Pastan, I

    1989-09-15

    Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

  19. PRODORIC2: the bacterial gene regulation database in 2018

    PubMed Central

    Dudek, Christian-Alexander; Hartlich, Juliane; Brötje, David; Jahn, Dieter

    2018-01-01

    Abstract Bacteria adapt to changes in their environment via differential gene expression mediated by DNA binding transcriptional regulators. The PRODORIC2 database hosts one of the largest collections of DNA binding sites for prokaryotic transcription factors. It is the result of the thoroughly redesigned PRODORIC database. PRODORIC2 is more intuitive and user-friendly. Besides significant technical improvements, the new update offers more than 1000 new transcription factor binding sites and 110 new position weight matrices for genome-wide pattern searches with the Virtual Footprint tool. Moreover, binding sites deduced from high-throughput experiments were included. Data for 6 new bacterial species including bacteria of the Rhodobacteraceae family were added. Finally, a comprehensive collection of sigma- and transcription factor data for the nosocomial pathogen Clostridium difficile is now part of the database. PRODORIC2 is publicly available at http://www.prodoric2.de. PMID:29136200

  20. The effects of methylglyoxal-bis(guanylhydrazone) on spermine binding and transport in liver mitochondria.

    PubMed

    Toninello, A; Via, L D; Di Noto, V; Mancon, M

    1999-12-15

    This study evaluated the effect of the anticancer drug methylglyoxal-bis(guanylhydrazone) (MGBG) on the binding of the polyamine spermine to the mitochondrial membrane and its transport into the inner compartment of this organelle. Spermine binding was studied by applying a new thermodynamic treatment of ligand-receptor interactions (Di Noto et al., Macromol Theory Simul 5: 165-181, 1996). Results showed that MGBG inhibited the binding of spermine to the site competent for the first step in polyamine transport; the interaction of spermine with this site, termed S1, also mediates the inhibitory effect of the polyamine on the mitochondrial permeability transition (Dalla Via et al., Biochim Biophys Acta 1284: 247-252, 1996). In the presence of 1 mM MGBG, the binding capacity and affinity of this site were reduced by about 2.6-fold; on the contrary, the binding capacity of the S2 site, which is most likely responsible for the internalization of cytoplasmic proteins (see Dalla Via et al., reference cited above), increased by about 1.3-fold, and its binding affinity remained unaffected. MGBG also inhibited the initial rate of spermine transport in a dose-dependent manner by establishing apparently sigmoidal kinetics. Consequently, the total extent of spermine accumulation inside mitochondria was inhibited. This inhibition in transport seems to reflect a conformational change at the level of the channel protein constituting the polyamine transport system, rather than competitive inhibition at the inner active site of the channel, thereby excluding the possibility that the polyamine and drug use the same transport pathway. Furthermore, it is suggested that, in the presence of MGBG, the S2 site is able to participate in residual spermine transport. MGBG also strongly inhibits deltapH-dependent spermine efflux, resulting in a complete block in the bidirectional flux of the polyamine and its sequestration inside the matrix space. The effects of MGBG on spermine accumulation are consistent with in vivo disruption of the regulator of energy metabolism and replication of the mitochondrial genome.

  1. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  2. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  3. Jack bean urease: the effect of active-site binding inhibitors on the reactivity of enzyme thiol groups.

    PubMed

    Krajewska, Barbara; Zaborska, Wiesława

    2007-10-01

    In view of the complexity of the role of the active site flap cysteine in the urease catalysis, in this work we studied how the presence of typical active-site binding inhibitors of urease, phenylphosphorodiamidate (PPD), acetohydroxamic acid (AHA), boric acid and fluoride, affects the reactivity of enzyme thiol groups, the active site flap thiol in particular. For that the inhibitor-urease complexes were prepared with excess inhibitors and had their thiol groups titrated with DTNB. The effects observed were analyzed in terms of the structures of the inhibitor-urease complexes reported in the literature. We found that the effectiveness in preventing the active site cysteine from the modification by disulfides, varied among the inhibitors studied, even though they all bind to the active site. The variations were accounted for by different extents of geometrical distortion in the active site that the inhibitors introduced upon binding, leaving the flap either open in AHA-, boric acid- and fluoride-inhibited urease, like in the native enzyme or closed in PPD-inhibited urease. Among the inhibitors, only PPD was found to be able to thoroughly protect the flap cysteines from the further reaction with disulfides, this apparently resulting from the closed conformation of the flap. Accordingly, in practical terms PPD may be regarded as the most suitable inhibitor for active-site protection experiments in inhibition studies of urease.

  4. Probing the binding sites and the effect of berbamine on the structure of bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Cheng, Xiao-Xia; Lui, Yi; Zhou, Bo; Xiao, Xiao-He; Liu, Yi

    2009-06-01

    Berbamine, a naturally occurring isoquinoline alkaloid extracted from Berberis sp., is the active constituent of some Chinese herbal medicines and exhibits a variety of pharmacological activities. The effects of berbamine on the structure of bovine serum albumin (BSA) were investigated by circular dichroism, fluorescence and absorption spectroscopy under physiological conditions. Berbamine caused a static quenching of the intrinsic fluorescence of BSA, and the quenching data were analyzed by application of the Stern-Volmer equation. There was a single primary berbamine-binding site on BSA with a binding constant of 2.577 × 10 4 L mol -1 at 298 K. The thermodynamic parameters, enthalpy change (Δ H0) and entropy change (Δ S0) for the reaction were -76.5 kJ mol -1 and -173.4 J mol -1 K -1 according to the van't Hoff equation. The results showed that the hydrogen bond and van der Waals interaction were the predominant forces in the binding process. Competitive experiments revealed a displacement of warfarin by berbamine, indicating that the binding site was located at Drug sites I. The distance r between the donor (BSA) and the acceptor (berbamine) was obtained according to the Förster non-radiation energy transfer theory. The results of three-dimensional fluorescence spectra, UV-vis absorption difference spectra and circular dichroism of BSA in the presence of berbamine showed that the conformation of BSA was changed. The results provide a quantitative understanding of the effect of berbamine on the structure of bovine serum albumin, providing a useful guideline for further drug design.

  5. Probing the binding sites and the effect of berbamine on the structure of bovine serum albumin.

    PubMed

    Cheng, Xiao-Xia; Lui, Yi; Zhou, Bo; Xiao, Xiao-He; Liu, Yi

    2009-06-01

    Berbamine, a naturally occurring isoquinoline alkaloid extracted from Berberis sp., is the active constituent of some Chinese herbal medicines and exhibits a variety of pharmacological activities. The effects of berbamine on the structure of bovine serum albumin (BSA) were investigated by circular dichroism, fluorescence and absorption spectroscopy under physiological conditions. Berbamine caused a static quenching of the intrinsic fluorescence of BSA, and the quenching data were analyzed by application of the Stern-Volmer equation. There was a single primary berbamine-binding site on BSA with a binding constant of 2.577x10(4)Lmol(-1) at 298K. The thermodynamic parameters, enthalpy change (DeltaH(0)) and entropy change (DeltaS(0)) for the reaction were -76.5kJmol(-1) and -173.4Jmol(-1)K(-1) according to the van't Hoff equation. The results showed that the hydrogen bond and van der Waals interaction were the predominant forces in the binding process. Competitive experiments revealed a displacement of warfarin by berbamine, indicating that the binding site was located at Drug sites I. The distance r between the donor (BSA) and the acceptor (berbamine) was obtained according to the Förster non-radiation energy transfer theory. The results of three-dimensional fluorescence spectra, UV-vis absorption difference spectra and circular dichroism of BSA in the presence of berbamine showed that the conformation of BSA was changed. The results provide a quantitative understanding of the effect of berbamine on the structure of bovine serum albumin, providing a useful guideline for further drug design.

  6. Antagonism of ligand-gated ion channel receptors: two domains of the glycine receptor alpha subunit form the strychnine-binding site.

    PubMed Central

    Vandenberg, R J; French, C R; Barry, P H; Shine, J; Schofield, P R

    1992-01-01

    The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. Glycine activation of the receptor is antagonized by the convulsant alkaloid strychnine. Using in vitro mutagenesis and functional analysis of the cDNA encoding the alpha 1 subunit of the human GlyR, we have identified several amino acid residues that form the strychnine-binding site. These residues were identified by transient expression of mutated cDNAs in mammalian (293) cells and examination of resultant [3H]strychnine binding, glycine displacement of [3H]strychnine, and electrophysiological responses to the application of glycine and strychnine. This mutational analysis revealed that residues from two separate domains within the alpha 1 subunit form the binding site for the antagonist strychnine. The first domain includes the amino acid residues Gly-160 and Tyr-161, and the second domain includes the residues Lys-200 and Tyr-202. These results, combined with analyses of other ligand-gated ion channel receptors, suggest a conserved tertiary structure and a common mechanism for antagonism in this receptor superfamily. PMID:1311851

  7. Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

    PubMed

    Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

    2010-04-01

    The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

  8. Molecular interaction of 2,4-diacetylphloroglucinol (DAPG) with human serum albumin (HSA): The spectroscopic, calorimetric and computational investigation

    NASA Astrophysics Data System (ADS)

    Pragna Lakshmi, T.; Mondal, Moumita; Ramadas, Krishna; Natarajan, Sakthivel

    2017-08-01

    Drug molecule interaction with human serum albumin (HSA) affects the distribution and elimination of the drug. The compound, 2,4-diacetylphloroglucinol (DAPG) has been known for its antimicrobial, antiviral, antihelminthic and anticancer properties. However, its interaction with HSA is not yet reported. In this study, the interaction between HSA and DAPG was investigated through steady-state fluorescence, time-resolved fluorescence (TRF), circular dichroism (CD), Fourier transform infrared (FT-IR) spectroscopy, isothermal titration calorimetry (ITC), molecular docking and molecular dynamics simulation (MDS). Fluorescence spectroscopy results showed the strong quenching of intrinsic fluorescence of HSA due to interaction with DAPG, through dynamic quenching mechanism. The compound bound to HSA with reversible and moderate affinity which explained its easy diffusion from circulatory system to target tissue. The thermodynamic parameters from fluorescence spectroscopic data clearly revealed the contribution of hydrophobic forces but, the role of hydrogen bonds was not negligible according to the ITC studies. The interaction was exothermic and spontaneous in nature. Binding with DAPG reduced the helical content of protein suggesting the unfolding of HSA. Site marker fluorescence experiments revealed the change in binding constant of DAPG in the presence of site I (warfarin) but not site II marker (ibuprofen) which confirmed that the DAPG bound to site I. ITC experiments also supported this as site I marker could not bind to HSA-DAPG complex while site II marker was accommodated in the complex. In silico studies further showed the lowest binding affinity and more stability of DAPG in site I than in site II. Thus the data presented in this study confirms the binding of DAPG to the site I of HSA which may help in further understanding of pharmacokinetic properties of DAPG.

  9. Prefusion F-specific antibodies determine the magnitude of RSV neutralizing activity in human sera.

    PubMed

    Ngwuta, Joan O; Chen, Man; Modjarrad, Kayvon; Joyce, M Gordon; Kanekiyo, Masaru; Kumar, Azad; Yassine, Hadi M; Moin, Syed M; Killikelly, April M; Chuang, Gwo-Yu; Druz, Aliaksandr; Georgiev, Ivelin S; Rundlet, Emily J; Sastry, Mallika; Stewart-Jones, Guillaume B E; Yang, Yongping; Zhang, Baoshan; Nason, Martha C; Capella, Cristina; Peeples, Mark E; Ledgerwood, Julie E; McLellan, Jason S; Kwong, Peter D; Graham, Barney S

    2015-10-14

    Respiratory syncytial virus (RSV) is estimated to claim more lives among infants <1 year old than any other single pathogen, except malaria, and poses a substantial global health burden. Viral entry is mediated by a type I fusion glycoprotein (F) that transitions from a metastable prefusion (pre-F) to a stable postfusion (post-F) trimer. A highly neutralization-sensitive epitope, antigenic site Ø, is found only on pre-F. We determined what fraction of neutralizing (NT) activity in human sera is dependent on antibodies specific for antigenic site Ø or other antigenic sites on F in healthy subjects from ages 7 to 93 years. Adsorption of individual sera with stabilized pre-F protein removed >90% of NT activity and depleted binding antibodies to both F conformations. In contrast, adsorption with post-F removed ~30% of NT activity, and binding antibodies to pre-F were retained. These findings were consistent across all age groups. Protein competition neutralization assays with pre-F mutants in which sites Ø or II were altered to knock out binding of antibodies to the corresponding sites showed that these sites accounted for ~35 and <10% of NT activity, respectively. Binding competition assays with monoclonal antibodies (mAbs) indicated that the amount of site Ø-specific antibodies correlated with NT activity, whereas the magnitude of binding competed by site II mAbs did not correlate with neutralization. Our results indicate that RSV NT activity in human sera is primarily derived from pre-F-specific antibodies, and therefore, inducing or boosting NT activity by vaccination will be facilitated by using pre-F antigens that preserve site Ø. Copyright © 2015, American Association for the Advancement of Science.

  10. Determination of an organic-acid analog of DOC for use in copper toxicity studies on salmonids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MacRae, R.K.; Meyer, J.S.; Hansen, J.A.

    1995-12-31

    Concentrations of dissolved copper in streams draining mine sites often exceed concentrations shown to cause acute and chronic mortality in salmonids. However, toxicity and impaired behaviors may be modified by dissolved organic carbon (DOC) and other inorganic components present in the site water. The effects of DOC on copper speciation, and thus bioavailability and toxicity, were determined by titrating stream waters with copper, using a cupric ion-specific electrode to detect free copper concentrations. Effects of various competing cations (e.g., Ca{sup +2}, Co{sup +2}) on copper-DOC binding were also evaluated. Titration results were evaluated using Scatchard and non-linear regression analyses tomore » quantify the strength and capacity of copper-DOC binding. Inorganic speciation was determined using the geochemical model MINEQL{sup +}. Results of these titrations indicated the presence of two or three distinct copper binding components in site water DOC. Three commercially available organic acids where then chosen to mimic the binding characteristics of natural DOC. This DOC-analog was used successfully in fish toxicity studies to evaluate the influence of DOC on copper bioavailability. Geochemical models were developed to predict copper speciation in both laboratory test waters and site waters, for any typical combination of water chemistry parameters (pH, alkalinity, [DOC], etc.). A combined interpretation of fish toxicity and modeling results indicate that some DOC-bound copper was bioavailable.« less

  11. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  12. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  13. Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

    PubMed

    Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

    2016-01-01

    Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

  14. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  15. Sliding of proteins non-specifically bound to DNA: Brownian dynamics studies with coarse-grained protein and DNA models.

    PubMed

    Ando, Tadashi; Skolnick, Jeffrey

    2014-12-01

    DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.

  16. Separating the Role of Protein Restraints and Local Metal-Site Interaction Chemistry in the Thermodynamics of a Zinc Finger Protein

    PubMed Central

    Dixit, Purushottam D.; Asthagiri, D.

    2011-01-01

    We express the effective Hamiltonian of an ion-binding site in a protein as a combination of the Hamiltonian of the ion-bound site in vacuum and the restraints of the protein on the site. The protein restraints are described by the quadratic elastic network model. The Hamiltonian of the ion-bound site in vacuum is approximated as a generalized Hessian around the minimum energy configuration. The resultant of the two quadratic Hamiltonians is cast into a pure quadratic form. In the canonical ensemble, the quadratic nature of the resultant Hamiltonian allows us to express analytically the excess free energy, enthalpy, and entropy of ion binding to the protein. The analytical expressions allow us to separate the roles of the dynamic restraints imposed by the protein on the binding site and the temperature-independent chemical effects in metal-ligand coordination. For the consensus zinc-finger peptide, relative to the aqueous phase, the calculated free energy of exchanging Zn2+ with Fe2+, Co2+, Ni2+, and Cd2+ are in agreement with experiments. The predicted excess enthalpy of ion exchange between Zn2+ and Co2+ also agrees with the available experimental estimate. The free energy of applying the protein restraints reveals that relative to Zn2+, the Co2+, and Cd2+-site clusters are more destabilized by the protein restraints. This leads to an experimentally testable hypothesis that a tetrahedral metal binding site with minimal protein restraints will be less selective for Zn2+ over Co2+ and Cd2+ compared to a zinc finger peptide. No appreciable change is expected for Fe2+ and Ni2+. The framework presented here may prove useful in protein engineering to tune metal selectivity. PMID:21943427

  17. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  18. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  19. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  20. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  1. The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

    PubMed Central

    Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

    2006-01-01

    As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

  2. Agonist trapped in ATP-binding sites of the P2X2 receptor.

    PubMed

    Jiang, Ruotian; Lemoine, Damien; Martz, Adeline; Taly, Antoine; Gonin, Sophie; Prado de Carvalho, Lia; Specht, Alexandre; Grutter, Thomas

    2011-05-31

    ATP-gated P2X receptors are trimeric ion channels, as recently confirmed by X-ray crystallography. However, the structure was solved without ATP and even though extracellular intersubunit cavities surrounded by conserved amino acid residues previously shown to be important for ATP function were proposed to house ATP, the localization of the ATP sites remains elusive. Here we localize the ATP-binding sites by creating, through a proximity-dependent "tethering" reaction, covalent bonds between a synthesized ATP-derived thiol-reactive P2X2 agonist (NCS-ATP) and single cysteine mutants engineered in the putative binding cavities of the P2X2 receptor. By combining whole-cell and single-channel recordings, we report that NCS-ATP covalently and specifically labels two previously unidentified positions N140 and L186 from two adjacent subunits separated by about 18 Å in a P2X2 closed state homology model, suggesting the existence of at least two binding modes. Tethering reaction at both positions primes subsequent agonist binding, yet with distinct functional consequences. Labeling of one position impedes subsequent ATP function, which results in inefficient gating, whereas tethering of the other position, although failing to produce gating by itself, enhances subsequent ATP function. Our results thus define a large and dynamic intersubunit ATP-binding pocket and suggest that receptors trapped in covalently agonist-bound states differ in their ability to gate the ion channel.

  3. Mechanistic and conformational studies on the interaction of food dye amaranth with human serum albumin by multispectroscopic methods.

    PubMed

    Zhang, Guowen; Ma, Yadi

    2013-01-15

    The mechanism of interaction between food dye amaranth and human serum albumin (HSA) in physiological buffer (pH 7.4) was investigated by fluorescence, UV-vis absorption, circular dichroism (CD), and Fourier transform infrared (FT-IR) spectroscopy. Results obtained from analysis of fluorescence spectra indicated that amaranth had a strong ability to quench the intrinsic fluorescence of HSA through a static quenching procedure. The negative value of enthalpy change and positive value of entropy change elucidated that the binding of amaranth to HSA was driven mainly by hydrophobic and hydrogen bonding interactions. The surface hydrophobicity of HSA increased after binding with amaranth. The binding distance between HSA and amaranth was estimated to be 3.03 nm and subdomain IIA (Sudlow site I) was the primary binding site for amaranth on HSA. The results of CD and FT-IR spectra showed that binding of amaranth to HSA induced conformational changes of HSA. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. The effects of pH and temperature on the in vitro bindings of delta-9-tetrahydrocannabinol and other cannabinoids to bovine serum albumin.

    PubMed

    Papa, V M; Shen, M L; Ou, D W

    1990-01-01

    Albumin is a major carrier of drugs and fatty acids in biological fluids. These protein-drug complexes serve to solubilize, transport these compounds to sites of action, and have been associated with increased half-life for these compounds. The authors are interested in the pH and temperature effects of the binding of delta-9-tetrahydrocannabinol to albumin. Ultrafiltration techniques were used in the separation of free to bound compounds. Cannabinoids bind to bovine serum albumin rapidly. The cannabinoid binding sites are more sensitive to temperature changes (37-47 degrees C) than changes in pH with 37 degrees C and pH 7.4 resulting in optimal binding. These conditions would result in the greatest viability in the cells, while allowing for the use of a variety of compounds in in vitro studies for the administration of compounds to isolated cells and cell lines.

  5. Study on the interaction of the epilepsy drug, zonisamide with human serum albumin (HSA) by spectroscopic and molecular docking techniques

    NASA Astrophysics Data System (ADS)

    Shahabadi, Nahid; Khorshidi, Aref; Moghadam, Neda Hossinpour

    2013-10-01

    In the present investigation, an attempt has been made to study the interaction of zonisamide (ZNS) with the transport protein, human serum albumin (HSA) employing UV-Vis, fluorometric, circular dichroism (CD) and molecular docking techniques. The results indicated that binding of ZNS to HSA caused strong fluorescence quenching of HSA through static quenching mechanism, hydrogen bonds and van der Waals contacts are the major forces in the stability of protein ZNS complex and the process of the binding of ZNS with HSA was driven by enthalpy (ΔH = -193.442 kJ mol-1). The results of CD and UV-Vis spectroscopy showed that the binding of this drug to HSA induced conformational changes in HSA. Furthermore, the study of molecular docking also indicated that zonisamide could strongly bind to the site I (subdomain IIA) of HSA mainly by hydrophobic interaction and there were hydrogen bond interactions between this drug and HSA, also known as the warfarin binding site.

  6. Characterization of interaction between doxycycline and human serum albumin by capillary electrophoresis-frontal analysis.

    PubMed

    Sun, Hanwen; He, Pan

    2009-06-01

    The binding of doxycycline to HSA under simulated physiological conditions (pH 7.4, 67 mM phosphate, I=0.17, drug concentration 100 microM, HSA concentration up to 475 microM, 36.5 degrees C) was studied by CE-frontal analysis. The number of primary binding sites, binding constant and physiological protein-binding percentage were 1.9, 1.51 x 10(3) M(-1) and 59.80%, respectively. In addition, the thermodynamic parameters including enthalpy change (DeltaH), entropy change (DeltaS) and free energy change (DeltaG) of the reaction were obtained in order to characterize the acting forces between doxycycline and HSA. Furthermore, to better understand the nature of doxycycline-HSA binding and to get information about potential interaction with other drugs, displacement experiments were performed. The results showed that doxycycline binds at site II of HSA.

  7. Pressure reversal of the action of octanol on postsynaptic membranes from Torpedo.

    PubMed Central

    Braswell, L. M.; Miller, K. W.; Sauter, J. F.

    1984-01-01

    Octanol increases the binding of [3H]-acetylcholine to the desensitized state of the nicotinic receptor in postsynaptic membranes prepared from Torpedo californica. This increase in binding results from an increase in the affinity of [3H]-acetylcholine for its receptor without any change in the number of sites or the shape of the acetylcholine binding curve. High pressures of helium (300 atm) decrease [3H]-acetylcholine binding by a mechanism that changes only the affinity of acetylcholine binding. Helium pressure reverses the effect of octanol on the affinity of [3H]-acetylcholine for its receptor. This pressure reversal of the action of octanol at a postsynaptic membrane is consistent either with pressure counteracting an octanol-induced membrane expansion or with independent mechanisms for the actions of octanol and pressure. The data do not conform with a mechanism in which pressure displaces octanol from a binding site on the receptor protein. PMID:6487895

  8. Calorimetric study of mutant human lysozymes with partially introduced Ca2+ binding sites and its efficient refolding system from inclusion bodies.

    PubMed

    Koshiba, T; Tsumoto, K; Masaki, K; Kawano, K; Nitta, K; Kumagai, I

    1998-08-01

    During the process of evolution, ancestral lysozymes evolved into calcium-binding lysozymes by acquiring three critical aspartate residues at positions 86, 91 and 92. To investigate the process of the acquisition of calcium-binding ability, two of the aspartates were partially introduced into human lysozyme at positions 86, 91 and 92. These mutants (HLQ86D, HLA92D and HLQ86D/D91Q/A92D), having two critical aspartates in calcium-binding sites, were expressed in Escherichia coli as non-active inclusion bodies. For the preparation of lysozyme samples, a refolding system using thioredoxin was established. This system allowed for effective refolding of wild-type and mutant lysozymes, and 100% of activity was recovered within 4 days. The calcium ion dependence of the melting temperature (Tm) of wild-type and mutant lysozymes was investigated by differential scanning calorimetry at pH 4.5. The Tm values of wild-type, HLQ86D and HLA92D mutants were not dependent on calcium ion concentration. However, the Tm of HLQ86D/D91Q/A92D was 4 degrees higher in the presence of 50 mM CaCl2 than in its absence, and the calcium-binding constant of this mutant was estimated to be 2.25(+/-0.25)x10(2) M(-1) at pH 4.5. Moreover, the calcium-binding ability of this mutant was confirmed by the result using Sephadex G-25 gel chromatography. These results indicate that it is indispensable to have at least two aspartates at positions 86 and 92 for acquisition of calcium-binding ability. The process of the acquisition of calcium-binding site during evolution of calcium-binding lysozyme is discussed.

  9. Channel architecture in maltoporin: dominance studies with lamB mutations influencing maltodextrin binding provide evidence for independent selectivity filters in each subunit.

    PubMed Central

    Ferenci, T; Lee, K S

    1989-01-01

    Maltoporin trimers constitute maltodextrin-selective channels in the outer membrane of Escherichia coli. To study the organization of the maltodextrin-binding site within trimers, dominance studies were undertaken with maltoporin variants of altered binding affinity. It has been established that amino acid substitutions at three dispersed regions of the maltoporin sequence (at residues 8, 82, and 360) resulted specifically in maltodextrin-binding defects and loss of maltodextrin channel selectivity; a substitution at residue 118 increased both binding affinity and maltodextrin transport. Strains heterodiploid for lamB were constructed in which these substitutions were encoded by chromosomal and plasmid-borne genes, and the relative level of maltoporin expression from these genes was estimated. Binding assays with bacteria forming maltoporin heterotrimers were performed in order to test for complementation between binding-negative alleles, negative dominance of negative over wild-type alleles, and possible dominance of negatives over the high-affinity allele. Double mutants with mutations affecting residues 8 and 118, 82 and 118, and 118 and 360 were constructed in vitro, and the dominance properties of the mutations in cis were also tested. There was no complementation between negatives and no negative dominance in heterotrimers. The high-affinity mutation was dominant over negatives in trans but not in cis. The affinity of binding sites in heterotrimer populations was characteristic of the high-affinity allele present and uninfluenced by the negative allele. These results are consistent with the presence of three discrete binding sites in a maltoporin trimer and suggest that the selectivity filter for maltodextrins is not at the interface between the three subunits. PMID:2521623

  10. Genetic variations in the DNA replication origins of human papillomavirus family correlate with their oncogenic potential.

    PubMed

    Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2018-04-01

    Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.

  11. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  12. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  13. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  14. Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†

    PubMed Central

    Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald

    2009-01-01

    A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129

  15. Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

    PubMed

    Odell, M; Shuman, S

    1999-05-14

    The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

  16. The RCAN carboxyl end mediates calcineurin docking-dependent inhibition via a site that dictates binding to substrates and regulators

    PubMed Central

    Martínez-Martínez, Sara; Genescà, Lali; Rodríguez, Antonio; Raya, Alicia; Salichs, Eulàlia; Were, Felipe; López-Maderuelo, María Dolores; Redondo, Juan Miguel; de la Luna, Susana

    2009-01-01

    Specificity of signaling kinases and phosphatases toward their targets is usually mediated by docking interactions with substrates and regulatory proteins. Here, we characterize the motifs involved in the physical and functional interaction of the phosphatase calcineurin with a group of modulators, the RCAN protein family. Mutation of key residues within the hydrophobic docking-cleft of the calcineurin catalytic domain impairs binding to all human RCAN proteins and to the calcineurin interacting proteins Cabin1 and AKAP79. A valine-rich region within the RCAN carboxyl region is essential for binding to the docking site in calcineurin. Although a peptide containing this sequence compromises NFAT signaling in living cells, it does not inhibit calcineurin catalytic activity directly. Instead, calcineurin catalytic activity is inhibited by a motif at the extreme C-terminal region of RCAN, which acts in cis with the docking motif. Our results therefore indicate that the inhibitory action of RCAN on calcineurin-NFAT signaling results not only from the inhibition of phosphatase activity but also from competition between NFAT and RCAN for binding to the same docking site in calcineurin. Thus, competition by substrates and modulators for a common docking site appears to be an essential mechanism in the regulation of Ca2+-calcineurin signaling. PMID:19332797

  17. The adenovirus L4-22K protein regulates transcription and RNA splicing via a sequence-specific single-stranded RNA binding.

    PubMed

    Lan, Susan; Kamel, Wael; Punga, Tanel; Akusjärvi, Göran

    2017-02-28

    The adenovirus L4-22K protein both activates and suppresses transcription from the adenovirus major late promoter (MLP) by binding to DNA elements located downstream of the MLP transcriptional start site: the so-called DE element (positive) and the R1 region (negative). Here we show that L4-22K preferentially binds to the RNA form of the R1 region, both to the double-stranded RNA and the single-stranded RNA of the same polarity as the nascent MLP transcript. Further, L4-22K binds to a 5΄-CAAA-3΄ motif in the single-stranded RNA, which is identical to the sequence motif characterized for L4-22K DNA binding. L4-22K binding to single-stranded RNA results in an enhancement of U1 snRNA recruitment to the major late first leader 5΄ splice site. This increase in U1 snRNA binding results in a suppression of MLP transcription and a concurrent stimulation of major late first intron splicing. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. A novel site contributing to growth-arrest-specific gene 6 binding to its receptors as revealed by a human monoclonal antibody

    PubMed Central

    2004-01-01

    Gas6 (growth-arrest-specific gene 6) is a vitamin K-dependent protein known to activate the Axl family of receptor tyrosine kinases. It is an important regulator of thrombosis and many other biological functions. The C-terminus of Gas6 binds to receptors and consists of two laminin-like globular domains LG1 and LG2. It has been reported that a Ca2+-binding site at the junction of LG1 and LG2 domains and a hydrophobic patch at the LG2 domain are important for receptor binding [Sasaki, Knyazev, Cheburkin, Gohring, Tisi, Ullrich, Timpl and Hohenester (2002) J. Biol. Chem. 277, 44164–44170]. In the present study, we developed a neutralizing human monoclonal antibody, named CNTO300, for Gas6. The antibody was generated by immunization of human IgG-expressing transgenic mice with recombinant human Gas6 protein and the anti-Gas6 IgG sequences were rescued from an unstable hybridoma clone. Binding of Gas6 to its receptors was partially inhibited by the CNTO300 antibody in a dose-dependent manner. To characterize further the interaction between Gas6 and this antibody, the binding kinetics of CNTO300 for recombinant Gas6 were compared with independently expressed LG1 and LG2. The CNTO300 antibody showed comparable binding affinity, yet different dependence on Ca2+, to Gas6 and LG1. No binding to LG2 was detected. In the presence of EDTA, binding of the antibody to Gas6 was disrupted, but no significant effect of EDTA on LG1 binding was evident. Further epitope mapping identified a Gas6 peptide sequence recognized by the CNTO300 antibody. This peptide sequence was found to be located at the LG1 domain distant from the Ca2+-binding site and the hydrophobic patch. Co-interaction of Gas6 with its receptor and CNTO300 antibody was detected by BIAcore analysis, suggesting a second receptor-binding site on the LG1 domain. This hypothesis was further supported by direct binding of Gas6 receptors to an independently expressed LG1 domain. Our results revealed, for the first time, a second binding site for Gas6–receptor interaction. PMID:15579134

  19. Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

    PubMed

    Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

    2012-06-01

    DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Structural insights into the specific binding of huntingtin proline-rich region with the SH3 and WW domains.

    PubMed

    Gao, Yong-Guang; Yan, Xian-Zhong; Song, Ai-Xin; Chang, Yong-Gang; Gao, Xue-Chao; Jiang, Nan; Zhang, Qi; Hu, Hong-Yu

    2006-12-01

    The interactions of huntingtin (Htt) with the SH3 domain- or WW domain-containing proteins have been implicated in the pathogenesis of Huntington's disease (HD). We report the specific interactions of Htt proline-rich region (PRR) with the SH3GL3-SH3 domain and HYPA-WW1-2 domain pair by NMR. The results show that Htt PRR binds with the SH3 domain through nearly its entire chain, and that the binding region on the domain includes the canonical PxxP-binding site and the specificity pocket. The C terminus of PRR orients to the specificity pocket, whereas the N terminus orients to the PxxP-binding site. Htt PRR can also specifically bind to WW1-2; the N-terminal portion preferentially binds to WW1, while the C-terminal portion binds to WW2. This study provides structural insights into the specific interactions between Htt PRR and its binding partners as well as the alteration of these interactions that involve PRR, which may have implications for the understanding of HD.

Top