Elucidating the druggable interface of protein-protein interactions using fragment docking and coevolutionary analysis.

PubMed

Bai, Fang; Morcos, Faruck; Cheng, Ryan R; Jiang, Hualiang; Onuchic, José N

2016-12-13

Protein-protein interactions play a central role in cellular function. Improving the understanding of complex formation has many practical applications, including the rational design of new therapeutic agents and the mechanisms governing signal transduction networks. The generally large, flat, and relatively featureless binding sites of protein complexes pose many challenges for drug design. Fragment docking and direct coupling analysis are used in an integrated computational method to estimate druggable protein-protein interfaces. (i) This method explores the binding of fragment-sized molecular probes on the protein surface using a molecular docking-based screen. (ii) The energetically favorable binding sites of the probes, called hot spots, are spatially clustered to map out candidate binding sites on the protein surface. (iii) A coevolution-based interface interaction score is used to discriminate between different candidate binding sites, yielding potential interfacial targets for therapeutic drug design. This approach is validated for important, well-studied disease-related proteins with known pharmaceutical targets, and also identifies targets that have yet to be studied. Moreover, therapeutic agents are proposed by chemically connecting the fragments that are strongly bound to the hot spots.

Multiheteromacrocycles that Complex Metal Ions. Ninth Progress Report (includes results of last three years), 1 May 1980 -- 30 April 1983

DOE R&D Accomplishments Database

Cram, D. J.

1982-09-15

The overall objective of this research is to design, synthesize, and evaluate cyclic and polycyclic host organic compounds for the abilities to complex and lipophilize guest metal ions, their complexes, and their clusters. Host organic compounds consist of strategically placed solvating, coordinating, and ion-pairing sites tied together by covalent bonds through hydrocarbon units around cavities shaped to be occupied by guest metal ions, or by metal ions plus their ligands. Specificity in complexation is sought by matching the following properties of host and guest: cavity and metal ion sizes; geometric arrangements of binding sites; numbers of binding sites; characters of binding sites; and valences. The hope is to synthesize new classes of compounds useful in the separation of metal ions, their complexes, and their clusters.

Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library*

PubMed Central

Kiefer, Jonathan D.; Srinivas, Raja R.; Lobner, Elisabeth; Tisdale, Alison W.; Mehta, Naveen K.; Yang, Nicole J.; Tidor, Bruce; Wittrup, K. Dane

2016-01-01

The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (Tm of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. PMID:27582495

Oriented Immobilization of Fab Fragments by Site-Specific Biotinylation at the Conserved Nucleotide Binding Site for Enhanced Antigen Detection.

PubMed

Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

2015-09-08

Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.

Contributions of molecular size, charge distribution, and specific amino acids to the iron-binding capacity of sea cucumber (Stichopus japonicus) ovum hydrolysates.

PubMed

Sun, Na; Cui, Pengbo; Jin, Ziqi; Wu, Haitao; Wang, Yixing; Lin, Songyi

2017-09-01

This study investigated the contributions of molecular size, charge distribution and specific amino acids to the iron-binding capacity of sea cucumber (Stichopus japonicus) ovum hydrolysates (SCOHs), and further explored their iron-binding sites. It was demonstrated that enzyme type and degree of hydrolysis (DH) significantly influenced the iron-binding capacity of the SCOHs. The SCOHs produced by alcalase at a DH of 25.9% possessed the highest iron-binding capacity at 92.1%. As the hydrolysis time increased, the molecular size of the SCOHs decreased, the negative charges increased, and the hydrophilic amino acids were exposed to the surface, facilitating iron binding. Furthermore, the Fourier transform infrared spectra, combined with amino acid composition analysis, revealed that iron bound to the SCOHs primarily through interactions with carboxyl oxygen of Asp, guanidine nitrogen of Arg or nitrogen atoms in imidazole group of His. The formed SCOHs-iron complexes exhibited a fold and crystal structure with spherical particles. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

PubMed

Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

2015-05-19

Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

PubMed Central

Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

2011-01-01

Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

Protein pharmacophore selection using hydration-site analysis

PubMed Central

Hu, Bingjie; Lill, Markus A.

2012-01-01

Virtual screening using pharmacophore models is an efficient method to identify potential lead compounds for target proteins. Pharmacophore models based on protein structures are advantageous because a priori knowledge of active ligands is not required and the models are not biased by the chemical space of previously identified actives. However, in order to capture most potential interactions between all potentially binding ligands and the protein, the size of the pharmacophore model, i.e. number of pharmacophore elements, is typically quite large and therefore reduces the efficiency of pharmacophore based screening. We have developed a new method to select important pharmacophore elements using hydration-site information. The basic premise is that ligand functional groups that replace water molecules in the apo protein contribute strongly to the overall binding affinity of the ligand, due to the additional free energy gained from releasing the water molecule into the bulk solvent. We computed the free energy of water released from the binding site for each hydration site using thermodynamic analysis of molecular dynamics (MD) simulations. Pharmacophores which are co-localized with hydration sites with estimated favorable contributions to the free energy of binding are selected to generate a reduced pharmacophore model. We constructed reduced pharmacophore models for three protein systems and demonstrated good enrichment quality combined with high efficiency. The reduction in pharmacophore model size reduces the required screening time by a factor of 200–500 compared to using all protein pharmacophore elements. We also describe a training process using a small set of known actives to reliably select the optimal set of criteria for pharmacophore selection for each protein system. PMID:22397751

Multiheteromacrocycles that Complex Metal Ions. Sixth Progress Report, 1 May 1979-30 April 1980

DOE R&D Accomplishments Database

Cram, D. J.

1980-01-15

Objective is to design synthesize, and evaluate cyclic and polycyclic host organic compounds for their abilities to complex and lipophilize guest metal ions, their complexes, and their clusters. Host organic compounds consist of strategically placed solvating, coordinating, and ion-pairing sites tied together by covalent bonds through hydrocarbon units around cavities shaped to be occupied by guest metal ions or by metal ions plus their ligands. Specificity in complexation is sought by matching the following properties of host and guest: cavity and metal ion sizes; geometric arrangements of binding sites; number of binding sites; character of binding sites; and valences. During this period, hemispherands based on an aryloxy or cyclic urea unit, spherands based on aryloxyl units only, and their complexes with alkali metals and alkaline earths were investigated. An attempt to separate {sup 6}Li and {sup 7}Li by gel permeation chromatography of lithiospherium chloride failed. (DLC)

Calculating an optimal box size for ligand docking and virtual screening against experimental and predicted binding pockets.

PubMed

Feinstein, Wei P; Brylinski, Michal

2015-01-01

Computational approaches have emerged as an instrumental methodology in modern research. For example, virtual screening by molecular docking is routinely used in computer-aided drug discovery. One of the critical parameters for ligand docking is the size of a search space used to identify low-energy binding poses of drug candidates. Currently available docking packages often come with a default protocol for calculating the box size, however, many of these procedures have not been systematically evaluated. In this study, we investigate how the docking accuracy of AutoDock Vina is affected by the selection of a search space. We propose a new procedure for calculating the optimal docking box size that maximizes the accuracy of binding pose prediction against a non-redundant and representative dataset of 3,659 protein-ligand complexes selected from the Protein Data Bank. Subsequently, we use the Directory of Useful Decoys, Enhanced to demonstrate that the optimized docking box size also yields an improved ranking in virtual screening. Binding pockets in both datasets are derived from the experimental complex structures and, additionally, predicted by eFindSite. A systematic analysis of ligand binding poses generated by AutoDock Vina shows that the highest accuracy is achieved when the dimensions of the search space are 2.9 times larger than the radius of gyration of a docking compound. Subsequent virtual screening benchmarks demonstrate that this optimized docking box size also improves compound ranking. For instance, using predicted ligand binding sites, the average enrichment factor calculated for the top 1 % (10 %) of the screening library is 8.20 (3.28) for the optimized protocol, compared to 7.67 (3.19) for the default procedure. Depending on the evaluation metric, the optimal docking box size gives better ranking in virtual screening for about two-thirds of target proteins. This fully automated procedure can be used to optimize docking protocols in order to improve the ranking accuracy in production virtual screening simulations. Importantly, the optimized search space systematically yields better results than the default method not only for experimental pockets, but also for those predicted from protein structures. A script for calculating the optimal docking box size is freely available at www.brylinski.org/content/docking-box-size. Graphical AbstractWe developed a procedure to optimize the box size in molecular docking calculations. Left panel shows the predicted binding pose of NADP (green sticks) compared to the experimental complex structure of human aldose reductase (blue sticks) using a default protocol. Right panel shows the docking accuracy using an optimized box size.

A global optimization algorithm for protein surface alignment

PubMed Central

2010-01-01

Background A relevant problem in drug design is the comparison and recognition of protein binding sites. Binding sites recognition is generally based on geometry often combined with physico-chemical properties of the site since the conformation, size and chemical composition of the protein surface are all relevant for the interaction with a specific ligand. Several matching strategies have been designed for the recognition of protein-ligand binding sites and of protein-protein interfaces but the problem cannot be considered solved. Results In this paper we propose a new method for local structural alignment of protein surfaces based on continuous global optimization techniques. Given the three-dimensional structures of two proteins, the method finds the isometric transformation (rotation plus translation) that best superimposes active regions of two structures. We draw our inspiration from the well-known Iterative Closest Point (ICP) method for three-dimensional (3D) shapes registration. Our main contribution is in the adoption of a controlled random search as a more efficient global optimization approach along with a new dissimilarity measure. The reported computational experience and comparison show viability of the proposed approach. Conclusions Our method performs well to detect similarity in binding sites when this in fact exists. In the future we plan to do a more comprehensive evaluation of the method by considering large datasets of non-redundant proteins and applying a clustering technique to the results of all comparisons to classify binding sites. PMID:20920230

Ligand deconstruction: Why some fragment binding positions are conserved and others are not

PubMed Central

Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

2015-01-01

Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

A stochastic context free grammar based framework for analysis of protein sequences

PubMed Central

Dyrka, Witold; Nebel, Jean-Christophe

2009-01-01

Background In the last decade, there have been many applications of formal language theory in bioinformatics such as RNA structure prediction and detection of patterns in DNA. However, in the field of proteomics, the size of the protein alphabet and the complexity of relationship between amino acids have mainly limited the application of formal language theory to the production of grammars whose expressive power is not higher than stochastic regular grammars. However, these grammars, like other state of the art methods, cannot cover any higher-order dependencies such as nested and crossing relationships that are common in proteins. In order to overcome some of these limitations, we propose a Stochastic Context Free Grammar based framework for the analysis of protein sequences where grammars are induced using a genetic algorithm. Results This framework was implemented in a system aiming at the production of binding site descriptors. These descriptors not only allow detection of protein regions that are involved in these sites, but also provide insight in their structure. Grammars were induced using quantitative properties of amino acids to deal with the size of the protein alphabet. Moreover, we imposed some structural constraints on grammars to reduce the extent of the rule search space. Finally, grammars based on different properties were combined to convey as much information as possible. Evaluation was performed on sites of various sizes and complexity described either by PROSITE patterns, domain profiles or a set of patterns. Results show the produced binding site descriptors are human-readable and, hence, highlight biologically meaningful features. Moreover, they achieve good accuracy in both annotation and detection. In addition, findings suggest that, unlike current state-of-the-art methods, our system may be particularly suited to deal with patterns shared by non-homologous proteins. Conclusion A new Stochastic Context Free Grammar based framework has been introduced allowing the production of binding site descriptors for analysis of protein sequences. Experiments have shown that not only is this new approach valid, but produces human-readable descriptors for binding sites which have been beyond the capability of current machine learning techniques. PMID:19814800

Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites

PubMed Central

Dupont, Daniel M.; Thuesen, Cathrine K.; Bøtkjær, Kenneth A.; Behrens, Manja A.; Dam, Karen; Sørensen, Hans P.; Pedersen, Jan S.; Ploug, Michael; Jensen, Jan K.; Andreasen, Peter A.

2015-01-01

Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126) with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site. PMID:25793507

Stable nanoconjugates of transferrin with alloyed quaternary nanocrystals Ag-In-Zn-S as a biological entity for tumor recognition.

PubMed

Matysiak-Brynda, Edyta; Bujak, Piotr; Augustin, Ewa; Kowalczyk, Agata; Mazerska, Zofia; Pron, Adam; Nowicka, Anna M

2018-01-18

One way to limit the negative effects of anti-tumor drugs on healthy cells is targeted therapy employing functionalized drug carriers. Here we present a biocompatible and stable nanoconjugate of transferrin anchored to Ag-In-Zn-S quantum dots modified with 11-mercaptoundecanoic acid (Tf-QD) as a drug carrier versus typical anticancer drug, doxorubicin. Detailed investigations of Tf-QD nanoconjugates without and with doxorubicin by fluorescence studies and cytotoxic measurements showed that the biological activity of both the transferrin and doxorubicin was fully retained in the nanoconjugate. In particular, the intercalation capabilities of free doxorubicin versus ctDNA remained essentially intact upon its binding to the nanoconjugate. In order to evaluate these capabilities, we studied the binding constant of doxorubicin attached to Tf-QDs with ctDNA as well as the binding site size on the ctDNA molecule. The binding constant slightly decreased compared to that of free doxorubicin while the binding site size, describing the number of consecutive DNA lattice residues involved in the binding, increased. It was also demonstrated that the QDs alone and in the form of a nanoconjugate with Tf were not cytotoxic towards human non-small cell lung carcinoma (H460 cell line) and the tumor cell sensitivity of the DOX-Tf-QD nanoconjugate was comparable to that of doxorubicin alone.

A model of high-affinity antibody binding to type III group B Streptococcus capsular polysaccharide.

PubMed

Wessels, M R; Muñoz, A; Kasper, D L

1987-12-01

We recently reported that the single repeating-unit pentasaccharide of type III group B Streptococcus (GBS) capsular polysaccharide is only weakly reactive with type III GBS antiserum. To further elucidate the relationship between antigen-chain length and antigenicity, tritiated oligosaccharides derived from type III capsular polysaccharide were used to generate detailed saturation binding curves with a fixed concentration of rabbit antiserum in a radioactive antigen-binding assay. A graded increase in affinity of antigen-antibody binding was seen as oligosaccharide size increased from 2.6 repeating units to 92 repeating units. These differences in affinity of antibody binding to oligosaccharides of different molecular size were confirmed by immunoprecipitation and competitive ELISA, two independent assays of antigen-antibody binding. Analysis of the saturation binding experiment indicated a difference of 300-fold in antibody-binding affinity for the largest versus the smallest tested oligosaccharides. Unexpectedly, the saturation binding values approached by the individual curves were inversely related to oligosaccharide chain length on a molar basis but equivalent on a weight basis. This observation is compatible with a model in which binding of an immunoglobulin molecule to an antigenic site on the polysaccharide facilitates subsequent binding of antibody to that antigen.

Recognizing metal and acid radical ion-binding sites by integrating ab initio modeling with template-based transferals.

PubMed

Hu, Xiuzhen; Dong, Qiwen; Yang, Jianyi; Zhang, Yang

2016-11-01

More than half of proteins require binding of metal and acid radical ions for their structure and function. Identification of the ion-binding locations is important for understanding the biological functions of proteins. Due to the small size and high versatility of the metal and acid radical ions, however, computational prediction of their binding sites remains difficult. We proposed a new ligand-specific approach devoted to the binding site prediction of 13 metal ions (Zn 2+ , Cu 2+ , Fe 2+ , Fe 3+ , Ca 2+ , Mg 2+ , Mn 2+ , Na + , K + ) and acid radical ion ligands (CO3 2- , NO2 - , SO4 2- , PO4 3- ) that are most frequently seen in protein databases. A sequence-based ab initio model is first trained on sequence profiles, where a modified AdaBoost algorithm is extended to balance binding and non-binding residue samples. A composite method IonCom is then developed to combine the ab initio model with multiple threading alignments for further improving the robustness of the binding site predictions. The pipeline was tested using 5-fold cross validations on a comprehensive set of 2,100 non-redundant proteins bound with 3,075 small ion ligands. Significant advantage was demonstrated compared with the state of the art ligand-binding methods including COACH and TargetS for high-accuracy ion-binding site identification. Detailed data analyses show that the major advantage of IonCom lies at the integration of complementary ab initio and template-based components. Ion-specific feature design and binding library selection also contribute to the improvement of small ion ligand binding predictions. http://zhanglab.ccmb.med.umich.edu/IonCom CONTACT: hxz@imut.edu.cn or zhng@umich.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library.

PubMed

Traxlmayr, Michael W; Kiefer, Jonathan D; Srinivas, Raja R; Lobner, Elisabeth; Tisdale, Alison W; Mehta, Naveen K; Yang, Nicole J; Tidor, Bruce; Wittrup, K Dane

2016-10-21

The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (T m of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Pretargeted Molecular Imaging and Radioimmunotherapy

PubMed Central

Goldenberg, David M.; Chang, Chien-Hsing; Rossi, Edmund A.; J, William; McBride; Sharkey, Robert M.

2012-01-01

Pretargeting is a multi-step process that first has an unlabeled bispecific antibody (bsMAb) localize within a tumor by virtue of its anti-tumor binding site(s) before administering a small, fast-clearing radiolabeled compound that then attaches to the other portion of the bsMAb. The compound's rapid clearance significantly reduces radiation exposure outside of the tumor and its small size permits speedy delivery to the tumor, creating excellent tumor/nontumor ratios in less than 1 hour. Haptens that bind to an anti-hapten antibody, biotin that binds to streptavidin, or an oligonucleotide binding to a complementary oligonucleotide sequence have all been radiolabeled for use by pretargeting. This review will focus on a highly flexible anti-hapten bsMAb platform that has been used to target a variety of radionuclides to image (SPECT and PET) as well as treat tumors. PMID:22737190

Endogenously Generated Plasmin at the Vascular Wall Injury Site Amplifies Lysine Binding Site-Dependent Plasminogen Accumulation in Microthrombi

PubMed Central

Brzoska, Tomasz; Tanaka-Murakami, Aki; Suzuki, Yuko; Sano, Hideto; Kanayama, Naohiro; Urano, Tetsumei

2015-01-01

The fibrinolytic system plays a pivotal role in the regulation of hemostasis; however, it remains unclear how and when the system is triggered to induce thrombolysis. Using intra-vital confocal fluorescence microscopy, we investigated the process of plasminogen binding to laser-induced platelet-rich microthrombi generated in the mesenteric vein of transgenic mice expressing green fluorescent protein (GFP). The accumulation of GFP-expressing platelets as well as exogenously infused Alexa Fluor 568-labeled Glu-plasminogen (Glu-plg) on the injured vessel wall was assessed by measuring the increase in the corresponding fluorescence intensities. Glu-plg accumulated in a time-dependent manner in the center of the microthrombus, where phosphatidylserine is exposed on platelet surfaces and fibrin formation takes place. The rates of binding of Glu-plg in the presence of ε-aminocaproic acid and carboxypeptidase B, as well as the rates of binding of mini-plasminogen lacking kringle domains 1-4 and lysine binding sites, were significantly lower than that of Glu-plg alone, suggesting that the binding was dependent on lysine binding sites. Furthermore, aprotinin significantly suppressed the accumulation of Glu-plg, suggesting that endogenously generated plasmin activity is a prerequisite for the accumulation. In spite of the endogenous generation of plasmin and accumulation of Glu-plg in the center of microthrombi, the microthrombi did not change in size during the 2-hour observation period. When human tissue plasminogen activator was administered intravenously, Glu-plg further accumulated and the microthrombi were lysed. Glu-plg appeared to accumulate in the center of microthrombi in the early phase of microthrombus formation, and plasmin activity and lysine binding sites were required for this accumulation. PMID:25806939

Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

PubMed Central

Glinsky, Gennadi V.

2015-01-01

Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

Ontogeny of growth hormone (GH) binding in the domestic turkey: evidence of sexual dimorphism and developmental changes in relationship to plasma GH.

PubMed

Vasilatos-Younken, R; Gray, K S; Bacon, W L; Nestor, K E; Long, D W; Rosenberger, J L

1990-07-01

The post-hatch ontogeny of hepatic GH binding and its relationship to GH plasma profile characteristics in male and female turkeys of slow- (RBC-2) and fast-growing (F; selected from RBC-2) genetic lines were determined. Specific binding of 125I-labelled recombinant chicken GH to crude hepatic membrane preparations (100,000 g pellet) was determined at 2, 4, 8, 14 and 24 weeks of age for both total (occupied plus free; 4 mol MgCl2/l pretreatment) and free (without MgCl2 pretreatment) binding sites. Characteristics of the plasma GH profile were measured at each age by serial blood sampling through indwelling jugular vein catheters. When specific binding to either free or total sites was expressed on a whole organ basis (i.e. hepatic GH-binding capacity/bird), binding increased dramatically (P less than 0.0001) with increasing age over both lines and sexes. Total binding capacity (free plus occupied sites) per bird was greater for females than for males at 24 weeks of age (P less than 0.04), as birds reached sexual maturity, but did not differ between fast- and slow-growing lines at any age. Available binding capacity (free sites) per bird was greater for the faster growing F than RBC-2 line at the older ages when body size was most divergent (14 and 24 weeks of age; P less than 0.01, P less than 0.06 respectively), but did not differ between sexes. Correlation analysis at individual ages revealed a progressive change in the nature of the relationship between hepatic GH binding, plasma GH and somatic growth.(ABSTRACT TRUNCATED AT 250 WORDS)

Neurotransmitter and psychostimulant recognition by the dopamine transporter

PubMed Central

Wang, Kevin H.; Penmatsa, Aravind; Gouaux, Eric

2015-01-01

Na+/Cl−-coupled biogenic amine transporters are the primary targets of therapeutic and abused drugs, ranging from antidepressants to the psychostimulants cocaine and amphetamines, and to their cognate substrates. Here we determine x-ray crystal structures of the Drosophila melanogaster dopamine transporter (dDAT) bound to its substrate dopamine (DA), a substrate analogue 3,4-dichlorophenethylamine, the psychostimulants D-amphetamine, methamphetamine, or to cocaine and cocaine analogues. All ligands bind to the central binding site, located approximately halfway across the membrane bilayer, in close proximity to bound sodium and chloride ions. The central binding site recognizes three chemically distinct classes of ligands via conformational changes that accommodate varying sizes and shapes, thus illustrating molecular principles that distinguish substrates from inhibitors in biogenic amine transporters. PMID:25970245

Selective binding of choline by a phosphate-coordination-based triple helicate featuring an aromatic box.

PubMed

Jia, Chuandong; Zuo, Wei; Yang, Dong; Chen, Yanming; Cao, Liping; Custelcean, Radu; Hostaš, Jiří; Hobza, Pavel; Glaser, Robert; Wang, Yao-Yu; Yang, Xiao-Juan; Wu, Biao

2017-10-16

In nature, proteins have evolved sophisticated cavities tailored for capturing target guests selectively among competitors of similar size, shape, and charge. The fundamental principles guiding the molecular recognition, such as self-assembly and complementarity, have inspired the development of biomimetic receptors. In the current work, we report a self-assembled triple anion helicate (host 2) featuring a cavity resembling that of the choline-binding protein ChoX, as revealed by crystal and density functional theory (DFT)-optimized structures, which binds choline in a unique dual-site-binding mode. This similarity in structure leads to a similarly high selectivity of host 2 for choline over its derivatives, as demonstrated by the NMR and fluorescence competition experiments. Furthermore, host 2 is able to act as a fluorescence displacement sensor for discriminating choline, acetylcholine, L-carnitine, and glycine betaine effectively.The choline-binding protein ChoX exhibits a synergistic dual-site binding mode that allows it to discriminate choline over structural analogues. Here, the authors design a biomimetic triple anion helicate receptor whose selectivity for choline arises from a similar binding mechanism.

Computational Optimization and Characterization of Molecularly Imprinted Polymers

NASA Astrophysics Data System (ADS)

Terracina, Jacob J.

Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

Avidin as a Model for Charge Driven Transport into Cartilage and Drug Delivery for treating Early Stage Post-traumatic Osteoarthritis

PubMed Central

Bajpayee, Ambika G.; Wong, Cliff R.; Bawendi, Moungi G.; Frank, Eliot H.; Grodzinsky, Alan J.

2013-01-01

Local drug delivery into cartilage remains a challenge due to its dense extracellular matrix of negatively charged proteoglycans enmeshed within a collagen fibril network. The high negative fixed charge density of cartilage offers the unique opportunity to utilize electrostatic interactions to augment transport, binding and retention of drug carriers. With the goal of developing particle-based drug delivery mechanisms for treating post-traumatic osteoarthritis, our objectives were, first, to determine the size range of a variety of solutes that could penetrate and diffuse through normal cartilage and enzymatically treated cartilage to mimic early stages of OA, and second, to investigate the effects of electrostatic interactions on particle partitioning, uptake and binding within cartilage using the highly positively charged protein, Avidin, as a model. Results showed that solutes having a hydrodynamic diameter ≤ 10 nm can penetrate into the full thickness of cartilage explants while larger sized solutes were trapped in the tissue’s superficial zone. Avidin had a 400-fold higher uptake than its neutral same-sized counterpart, NeutrAvidin, and >90% of the absorbed Avidin remained within cartilage explants for at least 15 days. We report reversible, weak binding (KD ~150 μM) of Avidin to intratissue sites in cartilage. The large effective binding site density (NT ~ 2920 μM) within cartilage matrix facilitates Avidin’s retention, making its structure suitable for particle based drug delivery into cartilage. PMID:24120044

The conserved potassium channel filter can have distinct ion binding profiles: Structural analysis of rubidium, cesium, and barium binding in NaK2K

PubMed Central

Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant

2014-01-01

Potassium channels are highly selective for K+ over the smaller Na+. Intriguingly, they are permeable to larger monovalent cations such as Rb+ and Cs+ but are specifically blocked by the similarly sized Ba2+. In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K+ channels KcsA and MthK. Rb+ bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs+, however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba2+ binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba2+ block. In the presence of K+, Ba2+ bound to the NaK2K channel at site 3 in conjunction with a K+ at site 1; this led to a prolonged block of the channel (the external K+-dependent Ba2+ lock-in state). In the absence of K+, however, Ba2+ acts as a permeating blocker. We found that, under these conditions, Ba2+ bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba2+ binding profile in the presence and absence of K+ thus provides a structural explanation for the short and prolonged Ba2+ block observed in NaK2K. PMID:25024267

The conserved potassium channel filter can have distinct ion binding profiles: structural analysis of rubidium, cesium, and barium binding in NaK2K.

PubMed

Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant; Jiang, Youxing

2014-08-01

Potassium channels are highly selective for K(+) over the smaller Na(+). Intriguingly, they are permeable to larger monovalent cations such as Rb(+) and Cs(+) but are specifically blocked by the similarly sized Ba(2+). In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K(+) channels KcsA and MthK. Rb(+) bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs(+), however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba(2+) binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba(2+) block. In the presence of K(+), Ba(2+) bound to the NaK2K channel at site 3 in conjunction with a K(+) at site 1; this led to a prolonged block of the channel (the external K(+)-dependent Ba(2+) lock-in state). In the absence of K(+), however, Ba(2+) acts as a permeating blocker. We found that, under these conditions, Ba(2+) bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba(2+) binding profile in the presence and absence of K(+) thus provides a structural explanation for the short and prolonged Ba(2+) block observed in NaK2K. © 2014 Lam et al.

Response of SCP-2L domain of human MFE-2 to ligand removal: binding site closure and burial of peroxisomal targeting signal.

PubMed

Lensink, M F; Haapalainen, A M; Hiltunen, J K; Glumoff, T; Juffer, A H

2002-10-11

In the study of the structure and function relationship of human MFE-2, we have investigated the dynamics of human MFE-2SCP-2L (hSCP-2L) and its response to ligand removal. A comparison was made with homologous rabbit SCP-2. Breathing and a closing motion are found, identifiable with an adjustment in size and a closing off of the binding pocket. Crucial residues for structural integrity have been identified. Particularly mobile areas of the protein are loop 1 that is connecting helices A and C in space, and helix D, next to the entrance of the pocket. In hSCP-2L, the binding pocket gets occupied by Phe93, which is making a tight hydrophobic contact with Trp36. In addition, it is found that the C-terminal peroxisomal targeting signal (PTS1) that is solvent exposed in the complexed structure becomes buried when no ligand is present. Moreover, an anti-correlation exists between burial of PTS1 and the size of the binding pocket. The results are in accordance with plant nsLTPs, where a similar accommodation of binding pocket size was found after ligand binding/removal. Furthermore, the calculations support the suggestion of a ligand-assisted targeting mechanism.

Species Differences in the Binding of Sodium 4-Phenylbutyrate to Serum Albumin.

PubMed

Yamasaki, Keishi; Enokida, Taisuke; Taguchi, Kazuaki; Miyamura, Shigeyuki; Kawai, Akito; Miyamoto, Shuichi; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

2017-09-01

Sodium 4-phenylbutyrate (PB) is clinically used as a drug for treating urea cycle disorders. Recent research has shown that PB also has other pharmacologic activities, suggesting that it has the potential for use as a drug for treating other disorders. In the process of drug development, preclinical testing using experimental animals is necessary to verify the efficacy and safety of PB. Although the binding of PB to human albumin has been studied, our knowledge of its binding to albumin from the other animal species is extremely limited. To address this issue, we characterized the binding of PB to albumin from several species (human, bovine, rabbit, and rat). The results indicated that PB interacts with 1 high-affinity site of albumin from these species, which corresponds to site II of human albumin. The affinities of PB to human and bovine albumins were higher than those to rabbit and rat albumin, and that to rabbit albumin was the lowest. Binding and molecular docking studies using structurally related compounds of PB suggested that species differences in the affinity are attributed to differences in the structural feature of the PB-binding sites on albumins (e.g., charge distribution, hydrophobicity, shape, or size). Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

PubMed

Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

1989-01-01

A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

SPACER: server for predicting allosteric communication and effects of regulation

PubMed Central

Goncearenco, Alexander; Mitternacht, Simon; Yong, Taipang; Eisenhaber, Birgit; Eisenhaber, Frank; Berezovsky, Igor N.

2013-01-01

The SPACER server provides an interactive framework for exploring allosteric communication in proteins with different sizes, degrees of oligomerization and function. SPACER uses recently developed theoretical concepts based on the thermodynamic view of allostery. It proposes easily tractable and meaningful measures that allow users to analyze the effect of ligand binding on the intrinsic protein dynamics. The server shows potential allosteric sites and allows users to explore communication between the regulatory and functional sites. It is possible to explore, for instance, potential effector binding sites in a given structure as targets for allosteric drugs. As input, the server only requires a single structure. The server is freely available at http://allostery.bii.a-star.edu.sg/. PMID:23737445

Doubling the Size of the Glucocorticoid Receptor Ligand Binding Pocket by Deacylcortivazol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suino-Powell, Kelly; Xu, Yong; Zhang, Chenghai

A common feature of nuclear receptor ligand binding domains (LBD) is a helical sandwich fold that nests a ligand binding pocket within the bottom half of the domain. Here we report that the ligand pocket of glucocorticoid receptor (GR) can be continuously extended into the top half of the LBD by binding to deacylcortivazol (DAC), an extremely potent glucocorticoid. It has been puzzling for decades why DAC, which contains a phenylpyrazole replacement at the conserved 3-ketone of steroid hormones that are normally required for activation of their cognate receptors, is a potent GR activator. The crystal structure of the GRmore » LBD bound to DAC and the fourth LXXLL motif of steroid receptor coactivator 1 reveals that the GR ligand binding pocket is expanded to a size of 1,070 {angstrom}{sup 3}, effectively doubling the size of the GR dexamethasone-binding pocket of 540 {angstrom}{sup 3} and yet leaving the structure of the coactivator binding site intact. DAC occupies only {approx}50% of the space of the pocket but makes intricate interactions with the receptor around the phenylpyrazole group that accounts for the high-affinity binding of DAC. The dramatic expansion of the DAC-binding pocket thus highlights the conformational adaptability of GR to ligand binding. The new structure also allows docking of various nonsteroidal ligands that cannot be fitted into the previous structures, thus providing a new rational template for drug discovery of steroidal and nonsteroidal glucocorticoids that can be specifically designed to reach the unoccupied space of the expanded pocket.« less

Tumor suppressor genes are larger than apoptosis-effector genes and have more regions of active chromatin: Connection to a stochastic paradigm for sequential gene expression programs.

PubMed

Garcia, Marlene; Mauro, James A; Ramsamooj, Michael; Blanck, George

2015-08-03

Apoptosis- and proliferation-effector genes are substantially regulated by the same transactivators, with E2F-1 and Oct-1 being notable examples. The larger proliferation-effector genes have more binding sites for the transactivators that regulate both sets of genes, and proliferation-effector genes have more regions of active chromatin, i.e, DNase I hypersensitive and histone 3, lysine-4 trimethylation sites. Thus, the size differences between the 2 classes of genes suggest a transcriptional regulation paradigm whereby the accumulation of transcription factors that regulate both sets of genes, merely as an aspect of stochastic behavior, accumulate first on the larger proliferation-effector gene "traps," and then accumulate on the apoptosis effector genes, thereby effecting sequential activation of the 2 different gene sets. As IRF-1 and p53 levels increase, tumor suppressor proteins are first activated, followed by the activation of apoptosis-effector genes, for example during S-phase pausing for DNA repair. Tumor suppressor genes are larger than apoptosis-effector genes and have more IRF-1 and p53 binding sites, thereby likewise suggesting a paradigm for transcription sequencing based on stochastic interactions of transcription factors with different gene classes. In this report, using the ENCODE database, we determined that tumor suppressor genes have a greater number of open chromatin regions and histone 3 lysine-4 trimethylation sites, consistent with the idea that a larger gene size can facilitate earlier transcriptional activation via the inclusion of more transactivator binding sites.

Steady-state EB cap size fluctuations are determined by stochastic microtubule growth and maturation

PubMed Central

Rickman, Jamie; Duellberg, Christian; Cade, Nicholas I.; Griffin, Lewis D.; Surrey, Thomas

2017-01-01

Growing microtubules are protected from depolymerization by the presence of a GTP or GDP/Pi cap. End-binding proteins of the EB1 family bind to the stabilizing cap, allowing monitoring of its size in real time. The cap size has been shown to correlate with instantaneous microtubule stability. Here we have quantitatively characterized the properties of cap size fluctuations during steady-state growth and have developed a theory predicting their timescale and amplitude from the kinetics of microtubule growth and cap maturation. In contrast to growth speed fluctuations, cap size fluctuations show a characteristic timescale, which is defined by the lifetime of the cap sites. Growth fluctuations affect the amplitude of cap size fluctuations; however, cap size does not affect growth speed, indicating that microtubules are far from instability during most of their time of growth. Our theory provides the basis for a quantitative understanding of microtubule stability fluctuations during steady-state growth. PMID:28280102

A new design for a green calcium indicator with a smaller size and a reduced number of calcium-binding sites

PubMed Central

Barykina, Natalia V.; Subach, Oksana M.; Doronin, Danila A.; Sotskov, Vladimir P.; Roshchina, Marina A.; Kunitsyna, Tatiana A.; Malyshev, Aleksey Y.; Smirnov, Ivan V.; Azieva, Asya M.; Sokolov, Ilya S.; Piatkevich, Kiryl D.; Burtsev, Mikhail S.; Varizhuk, Anna M.; Pozmogova, Galina E.; Anokhin, Konstantin V.; Subach, Fedor V.; Enikolopov, Grigori N.

2016-01-01

Genetically encoded calcium indicators (GECIs) are mainly represented by two- or one-fluorophore-based sensors. One type of two-fluorophore-based sensor, carrying Opsanus troponin C (TnC) as the Ca2+-binding moiety, has two binding sites for calcium ions, providing a linear response to calcium ions. One-fluorophore-based sensors have four Ca2+-binding sites but are better suited for in vivo experiments. Herein, we describe a novel design for a one-fluorophore-based GECI with two Ca2+-binding sites. The engineered sensor, called NTnC, uses TnC as the Ca2+-binding moiety, inserted in the mNeonGreen fluorescent protein. Monomeric NTnC has higher brightness and pH-stability in vitro compared with the standard GECI GCaMP6s. In addition, NTnC shows an inverted fluorescence response to Ca2+. Using NTnC, we have visualized Ca2+ dynamics during spontaneous activity of neuronal cultures as confirmed by control NTnC and its mutant, in which the affinity to Ca2+ is eliminated. Using whole-cell patch clamp, we have demonstrated that NTnC dynamics in neurons are similar to those of GCaMP6s and allow robust detection of single action potentials. Finally, we have used NTnC to visualize Ca2+ neuronal activity in vivo in the V1 cortical area in awake and freely moving mice using two-photon microscopy or an nVista miniaturized microscope. PMID:27677952

Concentrations of selected constituents in surface-water and streambed-sediment samples collected from streams in and near an area of oil and natural-gas development, south-central Texas, 2011-13

USGS Publications Warehouse

Opsahl, Stephen P.; Crow, Cassi L.

2014-01-01

During collection of streambed-sediment samples, additional samples from a subset of three sites (the SAR Elmendorf, SAR 72, and SAR McFaddin sites) were processed by using a 63-µm sieve on one aliquot and a 2-mm sieve on a second aliquot for PAH and n-alkane analyses. The purpose of analyzing PAHs and n-alkanes on a sample containing sand, silt, and clay versus a sample containing only silt and clay was to provide data that could be used to determine if these organic constituents had a greater affinity for silt- and clay-sized particles relative to sand-sized particles. The greater concentrations of PAHs in the <63-μm size-fraction samples at all three of these sites are consistent with a greater percentage of binding sites associated with fine-grained (<63 μm) sediment versus coarse-grained (<2 mm) sediment. The larger difference in total PAHs between the <2-mm and <63-μm size-fraction samples at the SAR Elmendorf site might be related to the large percentage of sand in the <2-mm size-fraction sample which was absent in the <63-μm size-fraction sample. In contrast, the <2-mm size-fraction sample collected from the SAR McFaddin site contained very little sand and was similar in particle-size composition to the <63-μm size-fraction sample.

Role of hydrogen bonding in ligand interaction with the N-methyl-D-aspartate receptor ion channel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leeson, P.D.; Carling, R.W.; James, K.

1990-05-01

Displacement of (3H)MK-801 (dizocilpine, 1) binding to rat brain membranes has been used to evaluate the affinities of novel dibenzocycloalkenimines related to 1 for the ion channel binding site (also known as the phencyclidine or PCP receptor) on the N-methyl-D-aspartate (NMDA) subtype of excitory amino acid receptor. In common with many other agents having actions in the central nervous system, these compounds contain a hydrophobic aromatic moiety and a basic nitrogen atom. The conformational rigidity of these ligands provides a unique opportunity to evaluate the importance of specific geometrical properties that influence active-site recognition, in particular the role of themore » nitrogen atom in hydrogen-bonding interactions. The relative affinities (IC50s) of hydrocarbon-substituted analogues of 1 and ring homologated cyclooctenimines illustrate the importance of size-limited hydrophobic binding of both aryl rings and of the quaternary C-5 methyl group. Analysis of the binding of a series of the 10 available structurally rigid dibenzoazabicyclo(x.y.z)alkanes, by using molecular modeling techniques, uncovered a highly significant correlation between affinity and a proposed ligand-active site hydrogen bonding vector (r = 0.950, p less than 0.001). These results are used to generate a pharmacophore of the MK-801 recognition site/PCP receptor, which accounts for the binding of all of the known ligands.« less

Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

PubMed

Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

2018-04-10

Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Probes of the catalytic site of cysteine dioxygenase.

PubMed

Chai, Sergio C; Bruyere, John R; Maroney, Michael J

2006-06-09

The first major step of cysteine catabolism, the oxidation of cysteine to cysteine sulfinic acid, is catalyzed by cysteine dioxygenase (CDO). In the present work, we utilize recombinant rat liver CDO and cysteine derivatives to elucidate structural parameters involved in substrate recognition and x-ray absorption spectroscopy to probe the interaction of the active site iron center with cysteine. Kinetic studies using cysteine structural analogs show that most are inhibitors and that a terminal functional group bearing a negative charge (e.g. a carboxylate) is required for binding. The substrate-binding site has no stringent restrictions with respect to the size of the amino acid. Lack of the amino or carboxyl groups at the alpha-carbon does not prevent the molecules from interacting with the active site. In fact, cysteamine is shown to be a potent activator of the enzyme without being a substrate. CDO was also rendered inactive upon complexation with the metal-binding inhibitors azide and cyanide. Unlike many non-heme iron dioxygenases that employ alpha-keto acids as cofactors, CDO was shown to be the only dioxygenase known to be inhibited by alpha-ketoglutarate.

Probing site-exclusive binding of aqueous QDs and their organelle-dependent dynamics in live cells by single molecule spectroscopy.

PubMed

Dong, Chaoqing; Chowdhury, Basudev; Irudayaraj, Joseph

2013-05-21

Understanding the biophysical and chemical interactions of nanoprobes and their fate upon entering live cells is critical for developing fundamental insights related to intracellular diagnostics, drug delivery and targeting. In this article we report herein a single molecule analysis procedure to quantitate site-specific exclusive membrane binding of N-acetyl-L-cysteine (NAC)-capped cadmium telluride (CdTe) quantum dots (QDs) in A-427 lung carcinoma cells (k(eq) = 0.075 ± 0.011 nM(-1)), its relative intracellular distribution and dynamics using fluorescence correlation spectroscopy (FCS) combined with scanning confocal fluorescence lifetime imaging (FLIM). In particular, we demonstrate that the binding efficacy of QDs to the cell membrane is directly related to their size and the targeting of QDs to specific membrane sites is exclusive. We also show that QDs are efficiently internalized by endocytosis and enclosed within the endosome and organelle-dependent diffusion dynamics can be monitored in live cells.

Atrial natriuretic peptide receptor heterogeneity and effects on cyclic GMP accumulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leitman, D.C.

1988-01-01

The effects of atrial natriuretic peptide (ANP), oxytocin (OT) and vasopressin (AVP) on guanylate cyclase activity and cyclic GMP accumulation were examined, since these hormones appear to be intimately associated with blood pressure and intravascular volume homeostasis. ANP was found to increase cyclic GMP accumulation in ten cell culture systems, which were derived from blood vessels, adrenal cortex, kidney, lung, testes and mammary gland. ANP receptors were characterized in intact cultured cells using {sup 125}I-ANP{sub 8-33}. Specific {sup 125}I-ANP binding was saturable and of high affinity. Scratchard analysis of the binding data for all cell types exhibited a straight line,more » indicating that these cells possessed a single class of binding sites. Despite the presence of linear Scatchard plots, these studies demonstrated that cultured cells possess two functionally and physically distinct ANP-binding sites. Most of the ANP-binding sites in cultured cells have a molecular size of 66,000 daltons under reducing conditions. The identification of cultured cell types in which hormones (ANP and oxytocin) regulate guanylate cyclase activity and increase cyclic GMP synthesis will provide valuable systems to determine the mechanisms of hormone-receptor coupling to guanylate cyclase and the cellular processes regulated by cyclic GMP.« less

An integrated catch-and-hold mechanism activates nicotinic acetylcholine receptors.

PubMed

Jadey, Snehal; Auerbach, Anthony

2012-07-01

In neuromuscular acetylcholine (ACh) receptor channels (AChRs), agonist molecules bind with a low affinity (LA) to two sites that can switch to high affinity (HA) and increase the probability of channel opening. We measured (by using single-channel kinetic analysis) the rate and equilibrium constants for LA binding and channel gating for several different agonists of adult-type mouse AChRs. Almost all of the variation in the equilibrium constants for LA binding was from differences in the association rate constants. These were consistently below the limit set by diffusion and were substantially different even though the agonists had similar sizes and the same charge. This suggests that binding to resting receptors is not by diffusion alone and, hence, that each binding site can undergo two conformational changes ("catch" and "hold") that connect three different structures (apo-, LA-bound, and HA-bound). Analyses of ACh-binding protein structures suggest that this binding site, too, may adopt three discrete structures having different degrees of loop C displacement ("capping"). For the agonists we tested, the logarithms of the equilibrium constants for LA binding and LA↔HA gating were correlated. Although agonist binding and channel gating have long been considered to be separate processes in the activation of ligand-gated ion channels, this correlation implies that the catch-and-hold conformational changes are energetically linked and together comprise an integrated process having a common structural basis. We propose that loop C capping mainly reflects agonist binding, with its two stages corresponding to the formation of the LA and HA complexes. The catch-and-hold reaction coordinate is discussed in terms of preopening states and thermodynamic cycles of activation.

An integrated catch-and-hold mechanism activates nicotinic acetylcholine receptors

PubMed Central

Jadey, Snehal

2012-01-01

In neuromuscular acetylcholine (ACh) receptor channels (AChRs), agonist molecules bind with a low affinity (LA) to two sites that can switch to high affinity (HA) and increase the probability of channel opening. We measured (by using single-channel kinetic analysis) the rate and equilibrium constants for LA binding and channel gating for several different agonists of adult-type mouse AChRs. Almost all of the variation in the equilibrium constants for LA binding was from differences in the association rate constants. These were consistently below the limit set by diffusion and were substantially different even though the agonists had similar sizes and the same charge. This suggests that binding to resting receptors is not by diffusion alone and, hence, that each binding site can undergo two conformational changes (“catch” and “hold”) that connect three different structures (apo-, LA-bound, and HA-bound). Analyses of ACh-binding protein structures suggest that this binding site, too, may adopt three discrete structures having different degrees of loop C displacement (“capping”). For the agonists we tested, the logarithms of the equilibrium constants for LA binding and LA↔HA gating were correlated. Although agonist binding and channel gating have long been considered to be separate processes in the activation of ligand-gated ion channels, this correlation implies that the catch-and-hold conformational changes are energetically linked and together comprise an integrated process having a common structural basis. We propose that loop C capping mainly reflects agonist binding, with its two stages corresponding to the formation of the LA and HA complexes. The catch-and-hold reaction coordinate is discussed in terms of preopening states and thermodynamic cycles of activation. PMID:22732309

Analysis of Immune Complex Structure by Statistical Mechanics and Light Scattering Techniques.

NASA Astrophysics Data System (ADS)

Busch, Nathan Adams

1995-01-01

The size and structure of immune complexes determine their behavior in the immune system. The chemical physics of the complex formation is not well understood; this is due in part to inadequate characterization of the proteins involved, and in part by lack of sufficiently well developed theoretical techniques. Understanding the complex formation will permit rational design of strategies for inhibiting tissue deposition of the complexes. A statistical mechanical model of the proteins based upon the theory of associating fluids was developed. The multipole electrostatic potential for each protein used in this study was characterized for net protein charge, dipole moment magnitude, and dipole moment direction. The binding sites, between the model antigen and antibodies, were characterized for their net surface area, energy, and position relative to the dipole moment of the protein. The equilibrium binding graphs generated with the protein statistical mechanical model compares favorably with experimental data obtained from radioimmunoassay results. The isothermal compressibility predicted by the model agrees with results obtained from dynamic light scattering. The statistical mechanics model was used to investigate association between the model antigen and selected pairs of antibodies. It was found that, in accordance to expectations from thermodynamic arguments, the highest total binding energy yielded complex distributions which were skewed to higher complex size. From examination of the simulated formation of ring structures from linear chain complexes, and from the joint shape probability surfaces, it was found that ring configurations were formed by the "folding" of linear chains until the ends are within binding distance. By comparing the single antigen/two antibody system which differ only in their respective binding site locations, it was found that binding site location influences complex size and shape distributions only when ring formation occurs. The internal potential energy of a ring complex is considerably less than that of the non-associating system; therefore the ring complexes are quite stable and show no evidence of breaking, and collapsing into smaller complexes. The ring formation will occur only in systems where the total free energy of each complex may be minimized. Thus, ring formation will occur even though entropically unfavorable conformations result if the total free energy can be minimized by doing so.

Structural and functional characterization of cargo-binding sites on the μ4-subunit of adaptor protein complex 4.

PubMed

Ross, Breyan H; Lin, Yimo; Corales, Esteban A; Burgos, Patricia V; Mardones, Gonzalo A

2014-01-01

Adaptor protein (AP) complexes facilitate protein trafficking by playing key roles in the selection of cargo molecules to be sorted in post-Golgi compartments. Four AP complexes (AP-1 to AP-4) contain a medium-sized subunit (μ1-μ4) that recognizes YXXØ-sequences (Ø is a bulky hydrophobic residue), which are sorting signals in transmembrane proteins. A conserved, canonical region in μ subunits mediates recognition of YXXØ-signals by means of a critical aspartic acid. Recently we found that a non-canonical YXXØ-signal on the cytosolic tail of the Alzheimer's disease amyloid precursor protein (APP) binds to a distinct region of the μ4 subunit of the AP-4 complex. In this study we aimed to determine the functionality of both binding sites of μ4 on the recognition of the non-canonical YXXØ-signal of APP. We found that substitutions in either binding site abrogated the interaction with the APP-tail in yeast-two hybrid experiments. Further characterization by isothermal titration calorimetry showed instead loss of binding to the APP signal with only the substitution R283D at the non-canonical site, in contrast to a decrease in binding affinity with the substitution D190A at the canonical site. We solved the crystal structure of the C-terminal domain of the D190A mutant bound to this non-canonical YXXØ-signal. This structure showed no significant difference compared to that of wild-type μ4. Both differential scanning fluorimetry and limited proteolysis analyses demonstrated that the D190A substitution rendered μ4 less stable, suggesting an explanation for its lower binding affinity to the APP signal. Finally, in contrast to overexpression of the D190A mutant, and acting in a dominant-negative manner, overexpression of μ4 with either a F255A or a R283D substitution at the non-canonical site halted APP transport at the Golgi apparatus. Together, our analyses support that the functional recognition of the non-canonical YXXØ-signal of APP is limited to the non-canonical site of μ4.

Structural and Functional Characterization of Cargo-Binding Sites on the μ4-Subunit of Adaptor Protein Complex 4

PubMed Central

Ross, Breyan H.; Lin, Yimo; Corales, Esteban A.; Burgos, Patricia V.; Mardones, Gonzalo A.

2014-01-01

Adaptor protein (AP) complexes facilitate protein trafficking by playing key roles in the selection of cargo molecules to be sorted in post-Golgi compartments. Four AP complexes (AP-1 to AP-4) contain a medium-sized subunit (μ1-μ4) that recognizes YXXØ-sequences (Ø is a bulky hydrophobic residue), which are sorting signals in transmembrane proteins. A conserved, canonical region in μ subunits mediates recognition of YXXØ-signals by means of a critical aspartic acid. Recently we found that a non-canonical YXXØ-signal on the cytosolic tail of the Alzheimer's disease amyloid precursor protein (APP) binds to a distinct region of the μ4 subunit of the AP-4 complex. In this study we aimed to determine the functionality of both binding sites of μ4 on the recognition of the non-canonical YXXØ-signal of APP. We found that substitutions in either binding site abrogated the interaction with the APP-tail in yeast-two hybrid experiments. Further characterization by isothermal titration calorimetry showed instead loss of binding to the APP signal with only the substitution R283D at the non-canonical site, in contrast to a decrease in binding affinity with the substitution D190A at the canonical site. We solved the crystal structure of the C-terminal domain of the D190A mutant bound to this non-canonical YXXØ-signal. This structure showed no significant difference compared to that of wild-type μ4. Both differential scanning fluorimetry and limited proteolysis analyses demonstrated that the D190A substitution rendered μ4 less stable, suggesting an explanation for its lower binding affinity to the APP signal. Finally, in contrast to overexpression of the D190A mutant, and acting in a dominant-negative manner, overexpression of μ4 with either a F255A or a R283D substitution at the non-canonical site halted APP transport at the Golgi apparatus. Together, our analyses support that the functional recognition of the non-canonical YXXØ-signal of APP is limited to the non-canonical site of μ4. PMID:24498434

Site-specific protein backbone and side-chain NMR chemical shift and relaxation analysis of human vinexin SH3 domain using a genetically encoded {sup 15}N/{sup 19}F-labeled unnatural amino acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Pan; School of Life Science, University of Science and Technology of China, Hefei, Anhui 230026; Xi, Zhaoyong

Research highlights: {yields} Chemical synthesis of {sup 15}N/{sup 19}F-trifluomethyl phenylalanine. {yields} Site-specific incorporation of {sup 15}N/{sup 19}F-trifluomethyl phenylalanine to SH3. {yields} Site-specific backbone and side chain chemical shift and relaxation analysis. {yields} Different internal motions at different sites of SH3 domain upon ligand binding. -- Abstract: SH3 is a ubiquitous domain mediating protein-protein interactions. Recent solution NMR structural studies have shown that a proline-rich peptide is capable of binding to the human vinexin SH3 domain. Here, an orthogonal amber tRNA/tRNA synthetase pair for {sup 15}N/{sup 19}F-trifluoromethyl-phenylalanine ({sup 15}N/{sup 19}F-tfmF) has been applied to achieve site-specific labeling of SH3 at threemore » different sites. One-dimensional solution NMR spectra of backbone amide ({sup 15}N){sup 1}H and side-chain {sup 19}F were obtained for SH3 with three different site-specific labels. Site-specific backbone amide ({sup 15}N){sup 1}H and side-chain {sup 19}F chemical shift and relaxation analysis of SH3 in the absence or presence of a peptide ligand demonstrated different internal motions upon ligand binding at the three different sites. This site-specific NMR analysis might be very useful for studying large-sized proteins or protein complexes.« less

Relationship between Hot Spot Residues and Ligand Binding Hot Spots in Protein-Protein Interfaces

PubMed Central

Zerbe, Brandon S.; Hall, David R.

2013-01-01

In the context of protein-protein interactions, the term “hot spot” refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening. PMID:22770357

Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces.

PubMed

Zerbe, Brandon S; Hall, David R; Vajda, Sandor; Whitty, Adrian; Kozakov, Dima

2012-08-27

In the context of protein-protein interactions, the term "hot spot" refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research, a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening.

Spectroscopic study of binding of chlorogenic acid with the surface of ZnO nanoparticles

NASA Astrophysics Data System (ADS)

Belay, Abebe; Kim, Hyung Kook; Hwang, Yoon-Hwae

2017-09-01

Understanding the interaction properties of biological materials with ZnO NPs is fundamental interest in the field of biotechnological applications as well as in the formation of optoelectronic devices. In this research, the binding of ZnO NPs and chlorogenic acid (CGA) were investigated using fluorescence quenching, UV-Vis absorption spectroscopy, Fourier transform infrared (FTIR), Raman spectroscopy, scanning electron microscopy (TEM), and dynamic light scattering (DLS) techniques. The study results indicated the fluorescence quenching between ZnO NPs and CGA rationalized in terms of static quenching mechanism or the formation of nonfluorescent CGA-ZnO. From fluorescence quenching spectral analysis the binding constant ( K a ), number of binding sites ( n), and thermodynamic properties, were determined. The quenching constants ( K sv) and binding constant ( K a ), decrease with increasing the temperature and their binding sites n are 2. The thermodynamic parameters determined using Van't Hoff equation indicated binding occurs spontaneously involving the hydrogen bond and van der Walls forces played the major role in the reaction of ZnO NPs with CGA. The Raman, SEM, DLS, and Zeta potential measurements were also indicated the differences in the structure, morphology and sizes of CGA, ZnO NPs, and their corresponding CGA-ZnO due to adsorption of CGA on the surface of ZnO NPs

Dynein's Network of Chemomechanical Motor Cycles

NASA Astrophysics Data System (ADS)

Shen, Weibo; Wang, Ziqing; Wang, Guodong

2012-07-01

An eight-state network model of dynein's chemomechanical motor cycles is developed, in which the states of an effective single dynein head are represented by the number of ATP binding at the primary site and the number of ATP binding at other three secondary sites. The binding and unbinding of ATP, as well as the hydrolysis of ATP and the reverse process, are characterized by transition rates between certain states. Our results show that the stall force of dynein increases fast with ATP up to 1 mM ATP, beyond which it increases slowly to a saturated value, and that load and ATP concentration can adjust the step size of dynein, i.e., dynein can shift gears according to conditions. These results are in agreement with experiments [R. Mallik, B. C. Carter, S. A. Lex, S. J. King and S. P. Gross, Nature 427, 649 (2004)].

Dynamic Conformational Changes in MUNC18 Prevent Syntaxin Binding

PubMed Central

Bar-On, Dana; Nachliel, Esther; Gutman, Menachem; Ashery, Uri

2011-01-01

The Sec1/munc18 protein family is essential for vesicle fusion in eukaryotic cells via binding to SNARE proteins. Protein kinase C modulates these interactions by phosphorylating munc18a thereby reducing its affinity to one of the central SNARE members, syntaxin-1a. The established hypothesis is that the reduced affinity of the phosphorylated munc18a to syntaxin-1a is a result of local electrostatic repulsion between the two proteins, which interferes with their compatibility. The current study challenges this paradigm and offers a novel mechanistic explanation by revealing a syntaxin-non-binding conformation of munc18a that is induced by the phosphomimetic mutations. In the present study, using molecular dynamics simulations, we explored the dynamics of the wild-type munc18a versus phosphomimetic mutant munc18a. We focused on the structural changes that occur in the cavity between domains 3a and 1, which serves as the main syntaxin-binding site. The results of the simulations suggest that the free wild-type munc18a exhibits a dynamic equilibrium between several conformations differing in the size of its cavity (the main syntaxin-binding site). The flexibility of the cavity's size might facilitate the binding or unbinding of syntaxin. In silico insertion of phosphomimetic mutations into the munc18a structure induces the formation of a conformation where the syntaxin-binding area is rigid and blocked as a result of interactions between residues located on both sides of the cavity. Therefore, we suggest that the reduced affinity of the phosphomimetic mutant/phosphorylated munc18a is a result of the closed-cavity conformation, which makes syntaxin binding energetically and sterically unfavorable. The current study demonstrates the potential of phosphoryalation, an essential biological process, to serve as a driving force for dramatic conformational changes of proteins modulating their affinity to target proteins. PMID:21390273

Binding thermodynamics discriminates fragments from druglike compounds: a thermodynamic description of fragment-based drug discovery.

PubMed

Williams, Glyn; Ferenczy, György G; Ulander, Johan; Keserű, György M

2017-04-01

Small is beautiful - reducing the size and complexity of chemical starting points for drug design allows better sampling of chemical space, reveals the most energetically important interactions within protein-binding sites and can lead to improvements in the physicochemical properties of the final drug. The impact of fragment-based drug discovery (FBDD) on recent drug discovery projects and our improved knowledge of the structural and thermodynamic details of ligand binding has prompted us to explore the relationships between ligand-binding thermodynamics and FBDD. Information on binding thermodynamics can give insights into the contributions to protein-ligand interactions and could therefore be used to prioritise compounds with a high degree of specificity in forming key interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Isolation and characterization of fatty acid binding protein in the liver of the nurse shark, Ginglymostoma cirratum.

PubMed

Bass, N M; Manning, J A; Luer, C A

1991-01-01

1. A 14.5 kDa fatty acid binding protein was isolated from the liver of the nurse shark, Ginglymostoma cirratum. 2. Purified shark liver FABP (pI = 5.4) bound oleic acid at a single site with an affinity similar to that of mammalian FABP. 3. The apparent size, pI and amino acid composition of shark liver FABP indicate a close structural relationship between this protein and mammalian heart FABP.

CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

PubMed Central

Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

1995-01-01

Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

PubMed

Odell, M; Shuman, S

1999-05-14

The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

Phenanthrene binding by humic acid-protein complexes as studied by passive dosing technique.

PubMed

Zhao, Jian; Wang, Zhenyu; Ghosh, Saikat; Xing, Baoshan

2014-01-01

This work investigated the binding behavior of phenanthrene by humic acids (HA-2 and HA-5), proteins (bovine serum albumin (BSA)), lysozyme and pepsin), and their complexes using a passive dosing technique. All sorption isotherms were fitted well with Freundlich model and the binding capability followed an order of HA-5 > HA-2 > BSA > pepsin > lysozyme. In NaCl solution, phenanthrene binding to HA-BSA complexes was much higher than the sum of binding to individual HA and BSA, while there was no enhancement for HA-pepsin. Positively charged lysozyme slightly lowered phenanthrene binding on both HAs due to strong aggregation of HA-lysozyme complexes, leading to reduction in the number of binding sites. The binding enhancement by HA-BSA was observed under all tested ion species and ionic strengths. This enhancement can be explained by unfolding of protein, reduction of aggregate size and formation of HA-BSA complexes with favorable conformations for binding phenanthrene. Copyright © 2013 Elsevier Ltd. All rights reserved.

Elucidating the Influence of Gold Nanoparticles on the Binding of Salvianolic Acid B and Rosmarinic Acid to Bovine Serum Albumin

PubMed Central

Peng, Xin; Qi, Wei; Huang, Renliang; Su, Rongxin; He, Zhimin

2015-01-01

Salvianolic acid B and rosmarinic acid are two main water-soluble active ingredients from Salvia miltiorrhiza with important pharmacological activities and clinical applications. The interactions between salvianolic acid B (or rosmarinic acid) and bovine serum albumin (BSA) in the presence and absence of gold nanoparticles (Au NPs) with three different sizes were investigated by using biophysical methods for the first time. Experimental results proved that two components quenched the fluorescence of BSA mainly through a static mechanism irrespective of the absence or presence of Au NPs. The presence of Au NPs decreased the binding constants of salvianolic acid B with BSA from 27.82% to 10.08%, while Au NPs increased the affinities of rosmarinic acid for BSA from 0.4% to 14.32%. The conformational change of BSA in the presence of Au NPs (caused by a noncompetitive binding between Au NPs and drugs at different albumin sites) induced changeable affinity and binding distance between drugs and BSA compared with no Au NPs. The competitive experiments revealed that the site I (subdomain IIA) of BSA was the primary binding site for salvianolic acid B and rosmarinic acid. Additionally, two compounds may induce conformational and micro-environmental changes of BSA. The results would provide valuable binding information between salvianolic acid B (or rosmarinic acid) and BSA, and also indicated that the Au NPs could alter the interaction mechanism and binding capability of drugs to BSA, which might be beneficial to understanding the pharmacokinetics and biological activities of the two drugs. PMID:25861047

Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy.

PubMed

Poiroux, Guillaume; Barre, Annick; van Damme, Els J M; Benoist, Hervé; Rougé, Pierre

2017-06-09

Aberrant O -glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O -glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola , and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O -glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors.

Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy

PubMed Central

Poiroux, Guillaume; Barre, Annick; van Damme, Els J. M.; Benoist, Hervé; Rougé, Pierre

2017-01-01

Aberrant O-glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O-glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola, and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O-glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors. PMID:28598369

NMR and molecular modeling of wine tannins binding to saliva proteins: revisiting astringency from molecular and colloidal prospects.

PubMed

Cala, Olivier; Pinaud, Noël; Simon, Cécile; Fouquet, Eric; Laguerre, Michel; Dufourc, Erick J; Pianet, Isabelle

2010-11-01

In organoleptic science, the association of tannins to saliva proteins leads to the poorly understood phenomenon of astringency. To decipher this interaction at molecular and colloidal levels, the binding of 4 procyanidin dimers (B1-4) and 1 trimer (C2) to a human saliva proline-rich peptide, IB7(14), was studied. Interactions have been characterized by measuring dissociation constants, sizes of complexes, number, and nature of binding sites using NMR (chemical shift variations, diffusion-ordered spectroscopy, and saturation transfer diffusion). The binding sites were identified using molecular mechanics, and the hydrophilic/hydrophobic nature of the interactions was resolved by calculating the molecular lipophilicity potential within the complexes. The following comprehensive scheme can be proposed: 1) below the tannin critical micelle concentration (CMC), interaction is specific, and the procyanidin anchorage always occurs on the same three IB7(14) sites. The tannin 3-dimensional structure plays a key role in the binding force and in the tannin's ability to act as a bidentate ligand: tannins adopting an extended conformation exhibit higher affinity toward protein and initiate the formation of a network. 2) Above the CMC, after the first specific hydrophilic interaction has taken place, a random hydrophobic stacking occurs between tannins and proteins. The whole process is discussed in the general frame of wine tannins eliciting astringency.

The FTMap family of web servers for determining and characterizing ligand binding hot spots of proteins

PubMed Central

Kozakov, Dima; Grove, Laurie E.; Hall, David R.; Bohnuud, Tanggis; Mottarella, Scott; Luo, Lingqi; Xia, Bing; Beglov, Dmitri; Vajda, Sandor

2016-01-01

FTMap is a computational mapping server that identifies binding hot spots of macromolecules, i.e., regions of the surface with major contributions to the ligand binding free energy. To use FTMap, users submit a protein, DNA, or RNA structure in PDB format. FTMap samples billions of positions of small organic molecules used as probes and scores the probe poses using a detailed energy expression. Regions that bind clusters of multiple probe types identify the binding hot spots, in good agreement with experimental data. FTMap serves as basis for other servers, namely FTSite to predict ligand binding sites, FTFlex to account for side chain flexibility, FTMap/param to parameterize additional probes, and FTDyn to map ensembles of protein structures. Applications include determining druggability of proteins, identifying ligand moieties that are most important for binding, finding the most bound-like conformation in ensembles of unliganded protein structures, and providing input for fragment based drug design. FTMap is more accurate than classical mapping methods such as GRID and MCSS, and is much faster than the more recent approaches to protein mapping based on mixed molecular dynamics. Using 16 probe molecules, the FTMap server finds the hot spots of an average size protein in less than an hour. Since FTFlex performs mapping for all low energy conformers of side chains in the binding site, its completion time is proportionately longer. PMID:25855957

The Effect of 3-Thiopheneacetic Acid in the Polymerization of a Conductive Electrotextile for Use in Biosensor Development

PubMed Central

McGraw, Shannon K.; Alocilja, Evangelyn; Senecal, Andre; Senecal, Kris

2013-01-01

Investigations were conducted to develop an electrotextile using a nonwoven polypropylene fiber platform conformally coated in a conductive, functionalized copolymer of polypyrrole and 3-thiopheneacetic acid (3TAA). The objectives of this study were to determine: (1) if the inclusion of 3TAA in the polymerization process would have an effect on the availability of binding sites in the high-surface area electrotextile for biorecognition elements and (2) how the increase in the concentration of 3TAA would affect the physical characteristics of the coating, resistivity of the sample and availability of binding sites. It was found that the addition of 3TAA to the polymerization process resulted in an increase in the size of the polypyrrole coating, as well as the material resistivity and available binding sites for biorecognition elements. These factors were used to determine which of the tested concentrations was best for biosensor development. A polymer coated membrane sample containing a concentration within the range of 10–50 mg/mL of 3TAA was selected as the best for future biosensor work. PMID:25586259

Mutation of mapped TIA-1/TIAR binding sites in the 3' terminal stem-loop of West Nile virus minus-strand RNA in an infectious clone negatively affects genomic RNA amplification.

PubMed

Emara, Mohamed M; Liu, Hsuan; Davis, William G; Brinton, Margo A

2008-11-01

Previous data showed that the cellular proteins TIA-1 and TIAR bound specifically to the West Nile virus 3' minus-strand stem-loop [WNV3'(-)SL] RNA (37) and colocalized with flavivirus replication complexes in WNV- and dengue virus-infected cells (21). In the present study, the sites on the WNV3'(-)SL RNA required for efficient in vitro T-cell intracellular antigen-related (TIAR) and T-cell intracellular antigen-1 (TIA-1) protein binding were mapped to short AU sequences (UAAUU) located in two internal loops of the WNV3'(-)SL RNA structure. Infectious clone RNAs with all or most of the binding site nucleotides in one of the 3' (-)SL loops deleted or substituted did not produce detectable virus after transfection or subsequent passage. With one exception, deletion/mutation of a single terminal nucleotide in one of the binding sequences had little effect on the efficiency of protein binding or virus production, but mutation of a nucleotide in the middle of a binding sequence reduced both the in vitro protein binding efficiency and virus production. Plaque size, intracellular genomic RNA levels, and virus production progressively decreased with decreasing in vitro TIAR/TIA-1 binding activity, but the translation efficiency of the various mutant RNAs was similar to that of the parental RNA. Several of the mutant RNAs that inefficiently interacted with TIAR/TIA-1 in vitro rapidly reverted in vivo, indicating that they could replicate at a low level and suggesting that an interaction between TIAR/TIA-1 and the viral 3'(-)SL RNA is not required for initial low-level symmetric RNA replication but instead facilitates the subsequent asymmetric amplification of genome RNA from the minus-strand template.

Structure-activity relationship of ibogaine analogs interacting with nicotinic acetylcholine receptors in different conformational states.

PubMed

Arias, Hugo R; Feuerbach, Dominik; Targowska-Duda, Katarzyna M; Jozwiak, Krzysztof

2011-09-01

The interaction of ibogaine analogs with nicotinic acetylcholine receptors (AChRs) in different conformational states was studied by functional and structural approaches. The results established that ibogaine analogs: (a) inhibit (±)-epibatidine-induced Ca²⁺ influx in human embryonic muscle AChRs with the following potency sequence (IC(50) in μM): (±)-18-methylaminocoronaridine (5.9±0.3)∼(±)-18-methoxycoronaridine (18-MC) (6.8±0.8)>(-)-ibogaine (17±3)∼(+)-catharanthine (20±1)>(±)-albifloranine (46±13), (b) bind to the [³H]TCP binding site with higher affinity when the Torpedo AChR is in the desensitized state compared to that in the resting state. Similar results were obtained using [³H]18-MC. These and docking results suggest a steric interaction between TCP and ibogaine analogs for the same site, (c) enhance [³H]cytisine binding to resting but not to desensitized AChRs, with desensitizing potencies (apparent EC₅₀) that correlate very well with the pK(i) values in the desensitized state, and (d) there are good bilinear correlations between the ligand molecular volumes and their affinities in the desensitized and resting states, with an optimal volume of ∼345 ų for the ibogaine site. These results indicate that the size of the binding sites for ibogaine analogs, located between the serine and nonpolar rings and shared with TCP, is an important structural feature for binding and for inducing desensitization. Copyright © 2011 Elsevier Ltd. All rights reserved.

Probing C-O bond activation on gas-phase transition metal clusters: Infrared multiple photon dissociation spectroscopy of Fe, Ru, Re, and W cluster CO complexes

NASA Astrophysics Data System (ADS)

Lyon, Jonathan T.; Gruene, Philipp; Fielicke, André; Meijer, Gerard; Rayner, David M.

2009-11-01

The binding of carbon monoxide to iron, ruthenium, rhenium, and tungsten clusters is studied by means of infrared multiple photon dissociation spectroscopy. The CO stretching mode is used to probe the interaction of the CO molecule with the metal clusters and thereby the activation of the C-O bond. CO is found to adsorb molecularly to atop positions on iron clusters. On ruthenium and rhenium clusters it also binds molecularly. In the case of ruthenium, binding is predominantly to atop sites, however higher coordinated CO binding is also observed for both metals and becomes prevalent for rhenium clusters containing more than nine atoms. Tungsten clusters exhibit a clear size dependence for molecular versus dissociative CO binding. This behavior denotes the crossover to the purely dissociative CO binding on the earlier transition metals such as tantalum.

Site-directed Mutagenesis Shows the Significance of Interactions with Phospholipids and the G-protein OsYchF1 for the Physiological Functions of the Rice GTPase-activating Protein 1 (OsGAP1).

PubMed

Yung, Yuk-Lin; Cheung, Ming-Yan; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yu, Mei-Hui; Chye, Mee-Len; Wong, Kam-Bo; Lam, Hon-Ming

2015-09-25

The C2 domain is one of the most diverse phospholipid-binding domains mediating cellular signaling. One group of C2-domain proteins are plant-specific and are characterized by their small sizes and simple structures. We have previously reported that a member of this group, OsGAP1, is able to alleviate salt stress and stimulate defense responses, and bind to both phospholipids and an unconventional G-protein, OsYchF1. Here we solved the crystal structure of OsGAP1 to a resolution of 1.63 Å. Using site-directed mutagenesis, we successfully differentiated between the clusters of surface residues that are required for binding to phospholipids versus OsYchF1, which, in turn, is critical for its role in stimulating defense responses. On the other hand, the ability to alleviate salt stress by OsGAP1 is dependent only on its ability to bind OsYchF1 and is independent of its phospholipid-binding activity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Removal of either N-glycan site from the envelope receptor binding domain of Moloney and Friend but not AKV mouse ecotropic gammaretroviruses alters receptor usage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knoper, Ryan C.; Ferrarone, John; Yan Yuhe

2009-09-01

Three N-linked glycosylation sites were removed from the envelope glycoproteins of Friend, Moloney, and AKV mouse ecotropic gammaretroviruses: gs1 and gs2, in the receptor binding domain; and gs8, in a region implicated in post-binding cell fusion. Mutants were tested for their ability to infect rodent cells expressing 4 CAT-1 receptor variants. Three mutants (Mo-gs1, Mo-gs2, and Fr-gs1) infect NIH 3T3 and rat XC cells, but are severely restricted in Mus dunni cells and Lec8, a Chinese hamster cell line susceptible to ecotropic virus. This restriction is reproduced in ferret cells expressing M. dunni dCAT-1, but not in cells expressing NIHmore » 3T3 mCAT-1. Virus binding assays, pseudotype assays, and the use of glycosylation inhibitors further suggest that restriction is primarily due to receptor polymorphism and, in M. dunni cells, to glycosylation of cellular proteins. Virus envelope glycan size or type does not affect infectivity. Thus, host range variation due to N-glycan deletion is receptor variant-specific, cell-specific, virus type-specific, and glycan site-specific.« less

Simulation of a model nanopore sensor: Ion competition underlies device behavior.

PubMed

Mádai, Eszter; Valiskó, Mónika; Dallos, András; Boda, Dezső

2017-12-28

We study a model nanopore sensor with which a very low concentration of analyte molecules can be detected on the basis of the selective binding of the analyte molecules to the binding sites on the pore wall. The bound analyte ions partially replace the current-carrier cations in a thermodynamic competition. This competition depends both on the properties of the nanopore and the concentrations of the competing ions (through their chemical potentials). The output signal given by the device is the current reduction caused by the presence of the analyte ions. The concentration of the analyte ions can be determined through calibration curves. We model the binding site with the square-well potential and the electrolyte as charged hard spheres in an implicit background solvent. We study the system with a hybrid method in which we compute the ion flux with the Nernst-Planck (NP) equation coupled with the Local Equilibrium Monte Carlo (LEMC) simulation technique. The resulting NP+LEMC method is able to handle both strong ionic correlations inside the pore (including finite size of ions) and bulk concentrations as low as micromolar. We analyze the effect of bulk ion concentrations, pore parameters, binding site parameters, electrolyte properties, and voltage on the behavior of the device.

Simulation of a model nanopore sensor: Ion competition underlies device behavior

NASA Astrophysics Data System (ADS)

Mádai, Eszter; Valiskó, Mónika; Dallos, András; Boda, Dezső

2017-12-01

We study a model nanopore sensor with which a very low concentration of analyte molecules can be detected on the basis of the selective binding of the analyte molecules to the binding sites on the pore wall. The bound analyte ions partially replace the current-carrier cations in a thermodynamic competition. This competition depends both on the properties of the nanopore and the concentrations of the competing ions (through their chemical potentials). The output signal given by the device is the current reduction caused by the presence of the analyte ions. The concentration of the analyte ions can be determined through calibration curves. We model the binding site with the square-well potential and the electrolyte as charged hard spheres in an implicit background solvent. We study the system with a hybrid method in which we compute the ion flux with the Nernst-Planck (NP) equation coupled with the Local Equilibrium Monte Carlo (LEMC) simulation technique. The resulting NP+LEMC method is able to handle both strong ionic correlations inside the pore (including finite size of ions) and bulk concentrations as low as micromolar. We analyze the effect of bulk ion concentrations, pore parameters, binding site parameters, electrolyte properties, and voltage on the behavior of the device.

Promiscuity and selectivity of small-molecule inhibitors across TAM receptor tyrosine kinases in pediatric leukemia.

PubMed

Liu, Mao-Hua; Chen, Shi-Bing; Yu, Juan; Liu, Cheng-Jun; Zhang, Xiao-Jing

2017-08-01

The TAM receptor tyrosine kinase family member Mer has been recognized as an attractive therapeutic target for pediatric leukemia. Beside Mer the family contains other two kinases, namely, Tyro3 and Axl, which are highly homologues with Mer and thus most existing small-molecule inhibitors show moderate or high promiscuity across the three kinases. Here, the structural basis and energetic property of selective binding of small-molecule inhibitors to the three kinases were investigated at molecular level. It is found that the selectivity is primarily determined by the size, shape and configuration of kinase's ATP-binding site; the Mer and Axl possess a small, closed active pocket as compared to the bulky, open pocket of Tyro3. The location and conformation of active-site residues of Mer and Axl are highly consistent, suggesting that small-molecule inhibitors generally have a low Mer-over-Axl selectivity and a high Mer-over-Tyro3 selectivity. We demonstrated that the difference in ATP binding potency to the three kinases is also responsible for inhibitor selectivity. We also found that the long-range interactions and allosteric effect arising from rest of the kinase's active site can indirectly influence inhibitor binding and selectivity. Copyright © 2017 Elsevier Inc. All rights reserved.

Localization of serotoni (5-hydroxytryptamine, 5-HT) with partial purification and characterization of a serotonin binding protein in the intestinal tissue of the nematode Ascaris suum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, R.E.

1989-01-01

An intracellular 5-HT binding protein (SBP) from intestinal tissue was partially purified and characterized. Binding of ({sup 3}H) 5-HT to the protein appeared to be Fe{sup +2}-sensitive and maximal (20.8pmol/mg protein) at 5 {times} 10{sup {minus}4}M Fe{sup +2} and 10{sup {minus}7}M ({sup 3}H) 5-HT. There were two 5-HT binding sites present at optimum Fe{sup +2} concentrations. The Bmax values of these sites were more sensitive to Fe{sup +2} than Kd values. Sulfhydryl reducing agents, cation chelators, Fe{sup +3}, Ca{sup +2} and antagonists of 5-HT uptake and storage inhibited binding of 5-HT to SBP. Gel exclusion chromatography indicated the presence ofmore » a 45Kda SBP that in 5 {times} 10{sup {minus}5}M Fe{sup +2} may form aggregates ranging in size from approximately 80 to >1000Kda. The data indicate these in vitro aggregates may correspond to the electron-opaque patches observed in situ. Ascaris suum may provide a model system to further elucidate the physiological role of analogous serotonin binding proteins that have been identified in mammalian systems.« less

Manipulation of a DNA aptamer-protein binding site through arylation of internal guanine residues.

PubMed

Van Riesen, Abigail J; Fadock, Kaila L; Deore, Prashant S; Desoky, Ahmed; Manderville, Richard A; Sowlati-Hashjin, Shahin; Wetmore, Stacey D

2018-05-23

Chemically modified aptamers have the opportunity to increase aptamer target binding affinity and provide structure-activity relationships to enhance our understanding of molecular target recognition by the aptamer fold. In the current study, 8-aryl-2'-deoxyguanosine nucleobases have been inserted into the G-tetrad and central TGT loop of the thrombin binding aptamer (TBA) to determine their impact on antiparallel G-quadruplex (GQ) folding and thrombin binding affinity. The aryl groups attached to the dG nucleobase vary greatly in aryl ring size and impact on GQ stability (∼20 °C change in GQ thermal melting (Tm) values) and thrombin binding affinity (17-fold variation in dissociation constant (Kd)). At G8 of the central TGT loop that is distal from the aptamer recognition site, the probes producing the most stable GQ structure exhibited the strongest thrombin binding affinity. However, within the G-tetrad, changes to the electron density of the dG component within the modified nucleobase can diminish thrombin binding affinity. Detailed molecular dynamics (MD) simulations on the modified TBA (mTBA) and mTBA-protein complexes demonstrate how the internal 8-aryl-dG modification can manipulate the interactions between the DNA nucleobases and the amino acid residues of thrombin. These results highlight the potential of internal fluorescent nuclobase analogs (FBAs) to broaden design options for aptasensor development.

Nanolithographic control of the spatial organization of cellular adhesion receptors at the single-molecule level

PubMed Central

Schvartzman, Mark; Palma, Matteo; Sable, Julia; Abramson, Justin; Hu, Xian; Sheetz, Michael P.; Wind, Shalom J.

2011-01-01

The ability to control the placement of individual molecules promises to enable a wide range of applications and is a key challenge in nanoscience and nanotechnology. Many biological interactions, in particular, are sensitive to the precise geometric arrangement of proteins. We have developed a technique which combines molecular-scale nanolithography with site-selective biochemistry to create biomimetic arrays of individual protein binding sites. The binding sites can be arranged in heterogeneous patterns of virtually any possible geometry with a nearly unlimited number of degrees of freedom. We have used these arrays to explore how the geometric organization of the extracellular matrix (ECM) binding ligand RGD (Arg-Gly-Asp) affects cell adhesion and spreading. Systematic variation of spacing, density and cluster size of individual integrin binding sites was used to elicit different cell behavior. Cell spreading assays on arrays of different geometric arrangements revealed a dramatic increase in spreading efficiency when at least 4 liganded sites were spaced within 60 nm or less, with no dependence on global density. This points to the existence of a minimal matrix adhesion unit for fibronectin defined in space and stoichiometry. Developing an understanding of the ECM geometries that activate specific cellular functional complexes is a critical step toward controlling cell behavior. Potential practical applications range from new therapeutic treatments to the rational design of tissue scaffolds that can optimize healing without scarring. More broadly, spatial control at the single-molecule level can elucidate factors controlling individual molecular interactions and can enable synthesis of new systems based on molecular-scale architectures. PMID:21319842

Selective binding of pyrene in subdomain IB of human serum albumin: Combining energy transfer spectroscopy and molecular modelling to understand protein binding flexibility

NASA Astrophysics Data System (ADS)

Ling, Irene; Taha, Mohamed; Al-Sharji, Nada A.; Abou-Zied, Osama K.

2018-04-01

The ability of human serum albumin (HSA) to bind medium-sized hydrophobic molecules is important for the distribution, metabolism, and efficacy of many drugs. Herein, the interaction between pyrene, a hydrophobic fluorescent probe, and HSA was thoroughly investigated using steady-state and time-resolved fluorescence techniques, ligand docking, and molecular dynamics (MD) simulations. A slight quenching of the fluorescence signal from Trp214 (the sole tryptophan residue in the protein) in the presence of pyrene was used to determine the ligand binding site in the protein, using Förster's resonance energy transfer (FRET) theory. The estimated FRET apparent distance between pyrene and Trp214 was 27 Å, which was closely reproduced by the docking analysis (29 Å) and MD simulation (32 Å). The highest affinity site for pyrene was found to be in subdomain IB from the docking results. The calculated equilibrium structure of the complex using MD simulation shows that the ligand is largely stabilized by hydrophobic interaction with Phe165, Phe127, and the nonpolar moieties of Tyr138 and Tyr161. The fluorescence vibronic peak ratio I1/I3 of bound pyrene inside HSA indicates the presence of polar effect in the local environment of pyrene which is less than that of free pyrene in buffer. This was clarified by the MD simulation results in which an average of 5.7 water molecules were found within 0.5 nm of pyrene in the binding site. Comparing the fluorescence signals and lifetimes of pyrene inside HSA to that free in buffer, the high tendency of pyrene to form dimer was almost completely suppressed inside HSA, indicating a high selectivity of the binding pocket toward pyrene monomer. The current results emphasize the ability of HSA, as a major carrier of several drugs and ligands in blood, to bind hydrophobic molecules in cavities other than subdomain IIA which is known to bind most hydrophobic drugs. This ability stems from the nature of the amino acids forming the binding sites of the protein that can easily adapt their shape to accommodate a variety of molecular structures.

[Substrate specificities of bile salt hydrolase 1 and its mutants from Lactobacillus salivarius].

PubMed

Bi, Jie; Fang, Fang; Qiu, Yuying; Yang, Qingli; Chen, Jian

2014-03-01

In order to analyze the correlation between critical residues in the catalytic centre of BSH and the enzyme substrate specificity, seven mutants of Lactobacillus salivarius bile salt hydrolase (BSH1) were constructed by using the Escherichia coli pET-20b(+) gene expression system, rational design and site-directed mutagenesis. These BSH1 mutants exhibited different hydrolytic activities against various conjugated bile salts through substrate specificities comparison. Among the residues being tested, Cys2 and Thr264 were deduced as key sites for BSH1 to catalyze taurocholic acid and glycocholic acid, respectively. Moreover, Cys2 and Thr264 were important for keeping the catalytic activity of BSH1. The high conservative Cys2 was not the only active site, other mutant amino acid sites were possibly involved in substrate binding. These mutant residues might influence the space and shape of the substrate-binding pockets or the channel size for substrate passing through and entering active site of BSH1, thus, the hydrolytic activity of BSH1 was changed to different conjugated bile salt.

Extended Graph-Based Models for Enhanced Similarity Search in Cavbase.

PubMed

Krotzky, Timo; Fober, Thomas; Hüllermeier, Eyke; Klebe, Gerhard

2014-01-01

To calculate similarities between molecular structures, measures based on the maximum common subgraph are frequently applied. For the comparison of protein binding sites, these measures are not fully appropriate since graphs representing binding sites on a detailed atomic level tend to get very large. In combination with an NP-hard problem, a large graph leads to a computationally demanding task. Therefore, for the comparison of binding sites, a less detailed coarse graph model is used building upon so-called pseudocenters. Consistently, a loss of structural data is caused since many atoms are discarded and no information about the shape of the binding site is considered. This is usually resolved by performing subsequent calculations based on additional information. These steps are usually quite expensive, making the whole approach very slow. The main drawback of a graph-based model solely based on pseudocenters, however, is the loss of information about the shape of the protein surface. In this study, we propose a novel and efficient modeling formalism that does not increase the size of the graph model compared to the original approach, but leads to graphs containing considerably more information assigned to the nodes. More specifically, additional descriptors considering surface characteristics are extracted from the local surface and attributed to the pseudocenters stored in Cavbase. These properties are evaluated as additional node labels, which lead to a gain of information and allow for much faster but still very accurate comparisons between different structures.

Internalisation of the bleomycin molecules responsible for bleomycin toxicity: a receptor-mediated endocytosis mechanism.

PubMed

Pron, G; Mahrour, N; Orlowski, S; Tounekti, O; Poddevin, B; Belehradek, J; Mir, L M

1999-01-01

Bleomycin (BLM) does not diffuse through the plasma membrane but nevertheless displays cytotoxic activity due to DNA break generation. The aim of the study was to describe the mechanism of BLM internalisation. We previously provided evidence for the existence of BLM-binding sites at the surface of DC-3F Chinese hamster fibroblasts, as well as of their involvement in BLM cytotoxicity on DC-3F cells and related BLM-resistant sublines. Here we report that A253 human cells and their BLM-resistant subline C-10E also possessed a membrane protein of ca. 250 kDa specifically binding BLM. Part of this C-10E cell resistance could be explained by a decrease in the number of BLM-binding sites exposed at the cell surface with respect to A253 cells. The comparison between A253 and DC-3F cells exposing a similar number of BLM-binding sites revealed that the faster the fluid phase endocytosis, the greater the cell sensitivity to BLM. Moreover, the experimental modification of endocytotic vesicle size showed that BLM cytotoxicity was directly correlated with the flux of plasma membrane area engulfed during endocytosis rather than with the fluid phase volume incorporated. Thus, BLM would be internalised by a receptor-mediated endocytosis mechanism which would first require BLM binding to its membrane receptor and then the transfer of the complex into intracellular endocytotic vesicles, followed by BLM entry into the cytosol, probably from a nonacidic compartment.

Density functional theory and surface reactivity study of bimetallic AgnYm (n+m = 10) clusters

NASA Astrophysics Data System (ADS)

Hussain, Riaz; Hussain, Abdullah Ijaz; Chatha, Shahzad Ali Shahid; Hussain, Riaz; Hanif, Usman; Ayub, Khurshid

2018-06-01

Density functional theory calculations have been performed on pure silver (Agn), yttrium (Ym) and bimetallic silver yttrium clusters AgnYm (n + m = 2-10) for reactivity descriptors in order to realize sites for nucleophilic and electrophilic attack. The reactivity descriptors of the clusters, studied as a function of cluster size and shape, reveal the presence of different type of reactive sites in a cluster. The size and shape of the pure silver, yttrium and bimetallic silver yttrium cluster (n = 2-10) strongly influences the number and position of active sites for an electrophilic and/or nucleophilic attack. The trends of reactivities through reactivity descriptors are confirmed through comparison with experimental data for CO binding with silver clusters. Moreover, the adsorption of CO on bimetallic silver yttrium clusters is also evaluated. The trends of binding energies support the reactivity descriptors values. Doping of pure cluster with the other element also influence the hardness, softness and chemical reactivity of the clusters. The softness increases as we increase the number of silver atoms in the cluster, whereas the hardness decreases. The chemical reactivity increases with silver doping whereas it decreases by increasing yttrium concentration. Silver atoms are nucleophilic in small clusters but changed to electrophilic in large clusters.

Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

1991-01-01

Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

NASA Astrophysics Data System (ADS)

Lengyel, Iván M.; Morelli, Luis G.

2017-04-01

Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

Properties of the anion-binding site of pharaonis Halorhodopsin studied by ultrafast pump-probe spectroscopy and low-temperature FTIR spectroscopy.

PubMed

Nakashima, Keisuke; Nakamura, Takumi; Takeuchi, Satoshi; Shibata, Mikihiro; Demura, Makoto; Tahara, Tahei; Kandori, Hideki

2009-06-18

Halorhodopsin (HR) is a light-driven chloride pump. Cl(-) is bound in the Schiff base region of the retinal chromophore, and unidirectional Cl(-) transport is probably enforced by the specific hydrogen-bonding interaction with the protonated Schiff base and internal water molecules. It is known that HR from Natronobacterium pharaonis (pHR) also pumps NO(3)(-) with similar efficiency, suggesting that NO(3)(-) binds to the Cl(-)-binding site. In the present study, we investigated the properties of the anion-binding site by means of ultrafast pump-probe spectroscopy and low-temperature FTIR spectroscopy. The obtained data were surprisingly similar between pHR-NO(3)(-) and pHR-Cl(-), even though the shapes and sizes of the two anions are quite different. Femtosecond pump-probe spectroscopy showed very similar excited-state dynamics between pHR-NO(3)(-) and pHR-Cl(-). Low-temperature FTIR spectroscopy of unlabeled and [zeta-(15)N]Lys-labeled pHR revealed almost identical hydrogen-bonding strengths of the protonated retinal Schiff base between pHR-NO(3)(-) and pHR-Cl(-), which is similarly strengthened after retinal isomerization. There were spectral variations for water stretching vibrations between pHR-NO(3)(-) and pHR-Cl(-), suggesting that the water molecules hydrate each anion. Nevertheless, the overall spectral features were similar for the two species. These observations strongly suggest that the anion-binding site has a flexible structure and that the interaction between retinal and the anions is weak, despite the presence of an electrostatic interaction. Such a flexible hydrogen-bonding network in the Schiff base region in HR appears to be in remarkable contrast to that in light-driven proton-pumping proteins.

Loss of the Otx2-Binding Site in the Nanog Promoter Affects the Integrity of Embryonic Stem Cell Subtypes and Specification of Inner Cell Mass-Derived Epiblast.

PubMed

Acampora, Dario; Omodei, Daniela; Petrosino, Giuseppe; Garofalo, Arcomaria; Savarese, Marco; Nigro, Vincenzo; Di Giovannantonio, Luca Giovanni; Mercadante, Vincenzo; Simeone, Antonio

2016-06-21

Mouse embryonic stem cells (ESCs) and the inner cell mass (ICM)-derived epiblast exhibit naive pluripotency. ESC-derived epiblast stem cells (EpiSCs) and the postimplantation epiblast exhibit primed pluripotency. Although core pluripotency factors are well-characterized, additional regulators, including Otx2, recently have been shown to function during the transition from naive to primed pluripotency. Here we uncover a role for Otx2 in the control of the naive pluripotent state. We analyzed Otx2-binding activity in ESCs and EpiSCs and identified Nanog, Oct4, and Sox2 as direct targets. To unravel the Otx2 transcriptional network, we targeted the strongest Otx2-binding site in the Nanog promoter, finding that this site modulates the size of specific ESC-subtype compartments in cultured cells and promotes Nanog expression in vivo, predisposing ICM differentiation to epiblast. Otx2-mediated Nanog regulation thus contributes to the integrity of the ESC state and cell lineage specification in preimplantation development. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Use of polyclonal and monoclonal antibodies to study hCG-receptor interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milius, R.P.

1985-01-01

Although the glycoprotein hormones lutropin (LH), follitropin (FSH), and thyrotropin (TSH) bind to different receptors, each contains an identical alpha subunit. Specificity is somehow endowed by theta subunits which are distinct for each hormone. Human choriogonadotropin (hCG) is a natural LH analog that contains a beta subunit nearly identical to that of LH. The roles of these subunits in the recognition and high affinity binding of hCG to receptor was examined. Polyclonal and monoclonal antibodies specific for the individual subunits of hCG were used to probe the hormone-receptor interaction. Conformation-specific and sequence-specific antibodies were examined for their abilities to bindmore » Triton X-100-solubilized /sup 125/I-hCG-receptor complex and to inhibit hormone binding to crude rat ovarian membranes containing receptor. Even though the immunoreactive sites are not located on the receptor binding surface of the beta subunit, most, but not all, of these polyclonal and monoclonal antibodies were able to inhibit /sup 125/I-hCG binding to receptor. Although the inhibition of binding may be due to steric interference due to the size of the antibody molecules, a two-step model for hCG binding to receptor is presented that also explains these results. In this model, the beta subunit initially binds with the receptor with a highly specific but low affinity interaction. This activates a site for the high affinity binding of the alpha subunit and stabilization of the complex. This is an attractive model as it may be applied to other glycoprotein hormones sharing an alpha subunit.« less

Speciation dynamics of metals in dispersion of nanoparticles with discrete distribution of charged binding sites.

PubMed

Polyakov, Pavel D; Duval, Jérôme F L

2014-02-07

We report a comprehensive theory to evaluate the kinetics of complex formation between metal ions and charged spherical nanoparticles. The latter consist of an ion-impermeable core surrounded by a soft shell layer characterized by a discrete axisymmetric 2D distribution of charged sites that bind metal ions. The theory explicitly integrates the conductive diffusion of metal ions from bulk solution toward the respective locations of the reactive sites within the particle shell volume. The kinetic constant k for outer-sphere nanoparticle-metal association is obtained from the sum of the contributions stemming from all reactive sites, each evaluated from the corresponding incoming flux of metal ions derived from steady-state Poisson-Nernst-Planck equations. Illustrations are provided to capture the basic intertwined impacts of particle size, overall particle charge, spatial heterogeneity in site distribution, type of particle (hard, core-shell or porous) and concentration of the background electrolyte on k. As a limit, k converges with predictions from previously reported analytical expressions derived for porous particles with low and high charge density, cases that correspond to coulombic and mean-field (smeared-out) electrostatic treatments, respectively. The conditions underlying the applicability of these latter approaches are rigorously identified in terms of (i) the extent of overlap between electric double layers around charged neighbouring sites, and (ii) the magnitude of the intraparticulate metal concentration gradient. For the first time, the proposed theory integrates the differentiated impact of the local potential around the charged binding sites amidst the overall particle field, together with that of the so-far discarded intraparticulate flux of metal ions.

Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sloan, J.W.

1984-01-01

These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

Competition for DNA binding sites using Promega DNA IQ™ paramagnetic beads.

PubMed

Frégeau, Chantal J; De Moors, Anick

2012-09-01

The Promega DNA IQ™ system is easily amenable to automation and has been an integral part of standard operating procedures for many forensic laboratories including those of the Royal Canadian Mounted Police (RCMP) since 2004. Due to some failure to extract DNA from samples that should have produced DNA using our validated automated DNA IQ™-based protocol, the competition for binding sites on the DNA IQ™ magnetic beads was more closely examined. Heme from heavily blooded samples interfered slightly with DNA binding. Increasing the concentration of Proteinase K during lysis of these samples did not enhance DNA recovery. However, diluting the sample lysate following lysis prior to DNA extraction overcame the reduction in DNA yield and preserved portions of the lysates for subsequent manual or automated extraction. Dye/chemicals from black denim lysates competed for binding sites on the DNA IQ™ beads and significantly reduced DNA recovery. Increasing the size or number of black denim cuttings during lysis had a direct adverse effect on DNA yield from various blood volumes. The dilution approach was successful on these samples and permitted the extraction of high DNA yields. Alternatively, shortening the incubation time for cell lysis to 30 min instead of the usual overnight at 56 °C prevented competition from black denim dye/chemicals and increased DNA yields. Crown Copyright © 2011. Published by Elsevier Ireland Ltd. All rights reserved.

A fragment-based approach applied to a highly flexible target: Insights and challenges towards the inhibition of HSP70 isoforms

NASA Astrophysics Data System (ADS)

Jones, Alan M.; Westwood, Isaac M.; Osborne, James D.; Matthews, Thomas P.; Cheeseman, Matthew D.; Rowlands, Martin G.; Jeganathan, Fiona; Burke, Rosemary; Lee, Diane; Kadi, Nadia; Liu, Manjuan; Richards, Meirion; McAndrew, Craig; Yahya, Norhakim; Dobson, Sarah E.; Jones, Keith; Workman, Paul; Collins, Ian; van Montfort, Rob L. M.

2016-10-01

The heat shock protein 70s (HSP70s) are molecular chaperones implicated in many cancers and of significant interest as targets for novel cancer therapies. Several HSP70 inhibitors have been reported, but because the majority have poor physicochemical properties and for many the exact mode of action is poorly understood, more detailed mechanistic and structural insight into ligand-binding to HSP70s is urgently needed. Here we describe the first comprehensive fragment-based inhibitor exploration of an HSP70 enzyme, which yielded an amino-quinazoline fragment that was elaborated to a novel ATP binding site ligand with different physicochemical properties to known adenosine-based HSP70 inhibitors. Crystal structures of amino-quinazoline ligands bound to the different conformational states of the HSP70 nucleotide binding domain highlighted the challenges of a fragment-based approach when applied to this particular flexible enzyme class with an ATP-binding site that changes shape and size during its catalytic cycle. In these studies we showed that Ser275 is a key residue in the selective binding of ATP. Additionally, the structural data revealed a potential functional role for the ATP ribose moiety in priming the protein for the formation of the ATP-bound pre-hydrolysis complex by influencing the conformation of one of the phosphate binding loops.

Effects of salts on protein-surface interactions: applications for column chromatography.

PubMed

Tsumoto, Kouhei; Ejima, Daisuke; Senczuk, Anna M; Kita, Yoshiko; Arakawa, Tsutomu

2007-07-01

Development of protein pharmaceuticals depends on the availability of high quality proteins. Various column chromatographies are used to purify proteins and characterize the purity and properties of the proteins. Most column chromatographies require salts, whether inorganic or organic, for binding, elution or simply better recovery and resolution. The salts modulate affinity of the proteins for particular columns and nonspecific protein-protein or protein-surface interactions, depending on the type and concentration of the salts, in both specific and nonspecific manners. Salts also affect the binding capacity of the column, which determines the size of the column to be used. Binding capacity, whether equilibrium or dynamic (under an approximation of a slow flow rate), depends on the binding constant, protein concentration and the number of the binding site on the column as well as nonspecific binding. This review attempts to summarize the mechanism of the salt effects on binding affinity and capacity for various column chromatographies and on nonspecific protein-protein or protein-surface interactions. Understanding such salt effects should also be useful in preventing nonspecific protein binding to various containers. Copyright 2007 Wiley-Liss, Inc.

Fibroblast growth factor regulates insulin-like growth factor-binding protein production by vascular smooth muscle cells.

PubMed

Ververis, J; Ku, L; Delafontaine, P

1994-02-01

Insulin-like growth factor I is an important mitogen for vascular smooth muscle cells, and its effects are regulated by several binding proteins. Western ligand blotting of conditioned medium from rat aortic smooth muscle cells detected a 24 kDa binding protein and a 28 kDa glycosylated variant of this protein, consistent with insulin-like growth factor binding protein-4 by size. Low amounts of a glycosylated 38 to 42 kDa doublet (consistent with binding protein-3) and a 31 kDa non-glycosylated protein also were present. Basic fibroblast growth factor markedly increased secretion of the 24 kDa binding protein and its 28 kDa glycosylated variant. This effect was dose- and time-dependent and was inhibited by co-incubation with cycloheximide. Crosslinking of [125I]-insulin-like growth factor I to cell monolayers revealed no surface-associated binding proteins, either basally or after agonist treatment. Induction of binding protein production by fibroblast growth factor at sites of vascular injury may be important in vascular proliferative responses in vivo.

A 23Na Multiple-Quantum-Filtered NMR Study of the Effect of the Cytoskeleton Conformation on the Anisotropic Motion of Sodium Ions in Red Blood Cells

NASA Astrophysics Data System (ADS)

Knubovets, Tatyana; Shinar, Hadassah; Eliav, Uzi; Navon, Gil

1996-01-01

Recently, it has been shown that23Na double-quantum-filtered NMR spectroscopy can be used to detect anisotropic motion of bound sodium ions in biological systems. The technique is based on the formation of the second-rank tensor when the quadrupolar interaction is not averaged to zero. Using this method, anisotropic motion of bound sodium in human and dog red blood cells was detected, and the effect was shown to depend on the integrity of the membrane cytoskeleton. In the present study, multiple-quantum-filtered techniques were applied in combination with a quadrupolar echo to measure the transverse-relaxation times,T2fandT2s. Line fitting was performed to obtain the values of the residual quadrupolar interaction, which was measured for sodium in a variety of mammalian erythrocytes of different size, shape, rheological properties, and sodium concentrations. Human unsealed white ghosts were used to study sodium bound at the anisotropic sites on the inner side of the RBC membrane. Modulations of the conformation of the cytoskeleton by the variation of either the ionic strength or pH of the suspending medium caused drastic changes in both the residual quadrupolar interaction andT2fdue to changes in the fraction of bound sodium ions as well as changes in the structure of the binding sites. By combining the two spectroscopic parameters, structural change can be followed. The changes in the structure of the sodium anisotropic binding sites deduced by this method were found to correlate with known conformational changes of the membrane cytoskeleton. Variations of the medium pH affected both the fraction of bound sodium ions and the structure of the anisotropic binding sites. Sodium and potassium were shown to bind to the anisotropic binding sites with the same affinity.

Ubiquinol-binding site in the alternative oxidase: mutagenesis reveals features important for substrate binding and inhibition.

PubMed

Albury, Mary S; Elliott, Catherine; Moore, Anthony L

2010-12-01

The alternative oxidase (AOX) is a non-protonmotive ubiquinol oxidase that is found in all plants, some fungi, green algae, bacteria and pathogenic protozoa. The lack of AOX in the mammalian host renders this protein an important potential therapeutic target in the treatment of pathogenic protozoan infections. Bioinformatic searches revealed that, within a putative ubiquinol-binding crevice in AOX, Gln242, Asn247, Tyr253, Ser256, His261 and Arg262 were highly conserved. To confirm that these amino-acid residues are important for ubiquinol-binding and hence activity substitution mutations were generated and characterised. Assessment of AOX activity in isolated Schizosaccharomyces pombe mitochondria revealed that mutation of either Gln242, Ser256, His261 and Arg262 resulted in >90% inhibition of antimycin A-insensitive respiration suggesting that hydroxyl, guanidino, imidazole groups, polar and charged residues in addition to the size of the amino-acid chain are important for ubiquinone-binding. Substitution of Asn247 with glutamine or Tyr253 with phenylalanine had little effect upon the respiratory rate indicating that these residues are not critical for AOX activity. However replacement of Tyr253 by alanine resulted in a 72% loss of activity suggesting that the benzoquinone group and not hydroxyl group is important for quinol binding. These results provide important new insights into the ubiquinol-binding site of the alternative oxidase, the identity of which maybe important for future rational drug design. Copyright © 2010 Elsevier B.V. All rights reserved.

Structural basis for inhibition of TLR2 by staphylococcal superantigen-like protein 3 (SSL3)

PubMed Central

Koymans, Kirsten J.; Feitsma, Louris J.; Brondijk, T. Harma C.; Aerts, Piet C.; Lukkien, Eddie; Lössl, Philip; van Kessel, Kok P. M.; de Haas, Carla J. C.; van Strijp, Jos A. G.; Huizinga, Eric G.

2015-01-01

Toll-like receptors (TLRs) are crucial in innate recognition of invading micro-organisms and their subsequent clearance. Bacteria are not passive bystanders and have evolved complex evasion mechanisms. Staphylococcus aureus secretes a potent TLR2 antagonist, staphylococcal superantigen-like protein 3 (SSL3), which prevents receptor stimulation by pathogen-associated lipopeptides. Here, we present crystal structures of SSL3 and its complex with TLR2. The structure reveals that formation of the specific inhibitory complex is predominantly mediated by hydrophobic contacts between SSL3 and TLR2 and does not involve interaction of TLR2–glycans with the conserved LewisX binding site of SSL3. In the complex, SSL3 partially covers the entrance to the lipopeptide binding pocket in TLR2, reducing its size by ∼50%. We show that this is sufficient to inhibit binding of agonist Pam2CSK4 effectively, yet allows SSL3 to bind to an already formed TLR2–Pam2CSK4 complex. The binding site of SSL3 overlaps those of TLR2 dimerization partners TLR1 and TLR6 extensively. Combined, our data reveal a robust dual mechanism in which SSL3 interferes with TLR2 activation at two stages: by binding to TLR2, it blocks ligand binding and thus inhibits activation. Second, by interacting with an already formed TLR2–lipopeptide complex, it prevents TLR heterodimerization and downstream signaling. PMID:26283364

Design, synthesis and biological evaluation of (S)-valine thiazole-derived cyclic and non-cyclic peptidomimetic oligomers as modulators of human P-glycoprotein (ABCB1)

PubMed Central

Singh, Satyakam; Prasad, Nagarajan Rajendra; Kapoor, Khyati; Chufan, Eduardo E.; Patel, Bhargav A.; Ambudkar, Suresh V.; Talele, Tanaji T.

2014-01-01

Multidrug resistance (MDR) caused by ATP-binding cassette (ABC) transporter P-glycoprotein (P-gp) through extrusion of anticancer drugs from the cells is a major cause of failure to cancer chemotherapy. Previously, selenazole containing cyclic peptides were reported as P-gp inhibitors and these were also used for co-crystallization with mouse P-gp, which has 87% homology to human P-gp. It has been reported that human P-gp, can simultaneously accommodate 2-3 moderate size molecules at the drug binding pocket. Our in-silico analysis based on the homology model of human P-gp spurred our efforts to investigate the optimal size of (S)-valine-derived thiazole units that can be accommodated at drug-binding pocket. Towards this goal, we synthesized varying lengths of linear and cyclic derivatives of (S)-valine-derived thiazole units to investigate the optimal size, lipophilicity and the structural form (linear and cyclic) of valine-derived thiazole peptides that can accommodate well in the P-gp binding pocket and affects its activity, previously an unexplored concept. Among these oligomers, lipophilic linear- (13) and cyclic-trimer (17) derivatives of QZ59S-SSS were found to be the most and equally potent inhibitors of human P-gp (IC50 = 1.5 μM). Cyclic trimer and linear trimer being equipotent, future studies can be focused on non-cyclic counterparts of cyclic peptides maintaining linear trimer length. Binding model of the linear trimer (13) within the drug-binding site on the homology model of human P-gp represents an opportunity for future optimization, specifically replacing valine and thiazole groups in the non-cyclic form. PMID:24288265

Design, synthesis, and biological evaluation of (S)-valine thiazole-derived cyclic and noncyclic peptidomimetic oligomers as modulators of human P-glycoprotein (ABCB1).

PubMed

Singh, Satyakam; Prasad, Nagarajan Rajendra; Kapoor, Khyati; Chufan, Eduardo E; Patel, Bhargav A; Ambudkar, Suresh V; Talele, Tanaji T

2014-01-03

Multidrug resistance caused by ATP binding cassette transporter P-glycoprotein (P-gp) through extrusion of anticancer drugs from the cells is a major cause of failure in cancer chemotherapy. Previously, selenazole-containing cyclic peptides were reported as P-gp inhibitors and were also used for co-crystallization with mouse P-gp, which has 87 % homology to human P-gp. It has been reported that human P-gp can simultaneously accommodate two to three moderately sized molecules at the drug binding pocket. Our in silico analysis, based on the homology model of human P-gp, spurred our efforts to investigate the optimal size of (S)-valine-derived thiazole units that can be accommodated at the drug binding pocket. Towards this goal, we synthesized varying lengths of linear and cyclic derivatives of (S)-valine-derived thiazole units to investigate the optimal size, lipophilicity, and structural form (linear or cyclic) of valine-derived thiazole peptides that can be accommodated in the P-gp binding pocket and affects its activity, previously an unexplored concept. Among these oligomers, lipophilic linear (13) and cyclic trimer (17) derivatives of QZ59S-SSS were found to be the most and equally potent inhibitors of human P-gp (IC50 =1.5 μM). As the cyclic trimer and linear trimer compounds are equipotent, future studies should focus on noncyclic counterparts of cyclic peptides maintaining linear trimer length. A binding model of the linear trimer 13 within the drug binding site on the homology model of human P-gp represents an opportunity for future optimization, specifically replacing valine and thiazole groups in the noncyclic form. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Amides Do Not Always Work: Observation of Guest Binding in an Amide-Functionalized Porous Metal-Organic Framework.

PubMed

Benson, Oguarabau; da Silva, Ivan; Argent, Stephen P; Cabot, Rafel; Savage, Mathew; Godfrey, Harry G W; Yan, Yong; Parker, Stewart F; Manuel, Pascal; Lennox, Matthew J; Mitra, Tamoghna; Easun, Timothy L; Lewis, William; Blake, Alexander J; Besley, Elena; Yang, Sihai; Schröder, Martin

2016-11-16

An amide-functionalized metal organic framework (MOF) material, MFM-136, shows a high CO 2 uptake of 12.6 mmol g -1 at 20 bar and 298 K. MFM-136 is the first example of an acylamide pyrimidyl isophthalate MOF without open metal sites and, thus, provides a unique platform to study guest binding, particularly the role of free amides. Neutron diffraction reveals that, surprisingly, there is no direct binding between the adsorbed CO 2 /CH 4 molecules and the pendant amide group in the pore. This observation has been confirmed unambiguously by inelastic neutron spectroscopy. This suggests that introduction of functional groups solely may not necessarily induce specific guest-host binding in porous materials, but it is a combination of pore size, geometry, and functional group that leads to enhanced gas adsorption properties.

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Guanine nucleotide-binding protein regulation of melatonin receptors in lizard brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rivkees, S.A.; Carlson, L.L.; Reppert, S.M.

Melatonin receptors were identified and characterized in crude membrane preparations from lizard brain by using {sup 125}I-labeled melatonin ({sup 125}I-Mel), a potent melatonin agonist. {sup 125}I-Mel binding sites were saturable; Scatchard analysis revealed high-affinity and lower affinity binding sites, with apparent K{sub d} of 2.3 {plus minus} 1.0 {times} 10{sup {minus}11} M and 2.06 {plus minus} 0.43 {times} 10{sup {minus}10} M, respectively. Binding was reversible and inhibited by melatonin and closely related analogs but not by serotonin or norepinephrine. Treatment of crude membranes with the nonhydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio)triphosphate (GTP({gamma}S)), significantly reduced the number of high-affinity receptors and increasedmore » the dissociation rate of {sup 125}I-Mel from its receptor. Furthermore, GTP({gamma}S) treatment of ligand-receptor complexes solubilized by Triton X-100 also led to a rapid dissociation of {sup 125}I-Mel from solubilized ligand-receptor complexes. Gel filtration chromatography of solubilized ligand-receptor complexes revealed two major peaks of radioactivity corresponding to M{sub r} > 400,000 and M{sub r} ca. 110,000. This elution profile was markedly altered by pretreatment with GTP({gamma}S) before solubilization; only the M{sub r} 110,000 peak was present in GTP({gamma}S)-pretreated membranes. The results strongly suggest that {sup 125}I-mel binding sites in lizard brain are melatonin receptors, with agonist-promoted guanine nucleotide-binding protein (G protein) coupling and that the apparent molecular size of receptors uncoupled from G proteins is about 110,000.« less

Density and distribution of hippocampal neurotransmitter receptors in autism: an autoradiographic study.

PubMed

Blatt, G J; Fitzgerald, C M; Guptill, J T; Booker, A B; Kemper, T L; Bauman, M L

2001-12-01

Neuropathological studies in autistic brains have shown small neuronal size and increased cell packing density in a variety of limbic system structures including the hippocampus, a change consistent with curtailment of normal development. Based on these observations in the hippocampus, a series of quantitative receptor autoradiographic studies were undertaken to determine the density and distribution of eight types of neurotransmitter receptors from four neurotransmitter systems (GABAergic, serotoninergic [5-HT], cholinergic, and glutamatergic). Data from these single concentration ligand binding studies indicate that the GABAergic receptor system (3[H]-flunitrazepam labeled benzodiazepine binding sites and 3[H]-muscimol labeled GABA(A) receptors) is significantly reduced in high binding regions, marking for the first time an abnormality in the GABA system in autism. In contrast, the density and distribution of the other six receptors studied (3[H]-80H-DPAT labeled 5-HT1A receptors, 3[H]-ketanserin labeled 5-HT2 receptors, 3[H]-pirenzepine labled M1 receptors, 3[H]-hemicholinium labeled high affinity choline uptake sites, 3[H]-MK801 labeled NMDA receptors, and 3[H]-kainate labeled kainate receptors) in the hippocampus did not demonstrate any statistically significant differences in binding.

Pd n Ag (4-n) and Pd n Pt (4-n) clusters on MgO (100): a density functional surface genetic algorithm investigation

DOE PAGES

Heard, Christopher J.; Heiles, Sven; Vajda, Stefan; ...

2014-08-07

We employed the novel surface mode of the Birmingham Cluster Genetic Algorithm (S-BCGA) for the global optimisation of noble metal tetramers upon an MgO(100) substrate at the GGA-DFT level of theory. The effect of element identity and alloying in surface-bound neutral subnanometre clusters is determined by energetic comparison between all compositions of Pd nAg (4-n) and Pd nPt (4-n). And while the binding strengths to the surface increase in the order Pt > Pd > Ag, the excess energy profiles suggest a preference for mixed clusters for both cases. The binding of CO is also modelled, showing that the adsorptionmore » site can be predicted solely by electrophilicity. Comparison to CO binding on a single metal atom shows a reversal of the 5s-d activation process for clusters, weakening the cluster surface interaction on CO adsorption. Charge localisation determines homotop, CO binding and surface site preferences. Furthermore, the electronic behaviour, which is intermediate between molecular and metallic particles allows for tunable features in the subnanometre size range.« less

Immunoelectron microscopic double labeling of alkaline phosphatase and penicillinase with colloidal gold in frozen thin sections of Bacillus licheniformis 749/C.

PubMed Central

Guan, T; Ghosh, A; Ghosh, B K

1985-01-01

The subcellular distribution of alkaline phosphatase and penicillinase was determined by double labeling frozen thin sections of Bacillus licheniformis 749/C with colloidal gold-immunoglobulin G (IgG). Antipenicillinase and anti-alkaline phosphatase antibodies were used to prepare complexes with 5- and 15-nm colloidal gold particles, respectively. The character of the labeling of membrane-bound alkaline phosphatase and penicillinase was different: the immunolabels for alkaline phosphatase (15-nm particles) were bound to a few sites at the inner surface of the plasma membrane, and the gold particles formed clusters of various sizes at the binding sites; the immunolabels for penicillinase (5-nm particles), on the other hand, were bound to the plasma membrane in a dispersed and random fashion. In the cytoplasm, immunolabels for both proteins were distributed randomly, and the character of their binding was similar. The labeling was specific: pretreating the frozen thin sections with different concentrations of anti-alkaline phosphatase or penicillinase blocked the binding of the immunolabel prepared with the same antibody. Binding could be fully blocked by pretreatment with 800 micrograms of either antibody per ml. Images PMID:3876329

Dendrimer-Linked Antifreeze Proteins Have Superior Activity and Thermal Recovery.

PubMed

Stevens, Corey A; Drori, Ran; Zalis, Shiran; Braslavsky, Ido; Davies, Peter L

2015-09-16

By binding to ice, antifreeze proteins (AFPs) depress the freezing point of a solution and inhibit ice recrystallization if freezing does occur. Previous work showed that the activity of an AFP was incrementally increased by fusing it to another protein. Even larger increases in activity were achieved by doubling the number of ice-binding sites by dimerization. Here, we have combined the two strategies by linking multiple outward-facing AFPs to a dendrimer to significantly increase both the size of the molecule and the number of ice-binding sites. Using a heterobifunctional cross-linker, we attached between 6 and 11 type III AFPs to a second-generation polyamidoamine (G2-PAMAM) dendrimer with 16 reactive termini. This heterogeneous sample of dendrimer-linked type III constructs showed a greater than 4-fold increase in freezing point depression over that of monomeric type III AFP. This multimerized AFP was particularly effective at ice recrystallization inhibition activity, likely because it can simultaneously bind multiple ice surfaces. Additionally, attachment to the dendrimer has afforded the AFP superior recovery from heat denaturation. Linking AFPs together via polymers can generate novel reagents for controlling ice growth and recrystallization.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

An Electrostatic Funnel in the GABA-Binding Pathway

PubMed Central

Lightstone, Felice C.

2016-01-01

The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

Interaction of Zwitterionic Penicillins with the OmpF Channel Facilitates Their Translocation

PubMed Central

Danelon, Christophe; Nestorovich, Ekaterina M.; Winterhalter, Mathias; Ceccarelli, Matteo; Bezrukov, Sergey M.

2006-01-01

To study translocation of β-lactam antibiotics of different size and charge across the outer bacterial membrane, we combine an analysis of ion currents through single trimeric outer membrane protein F (OmpF) porins in planar lipid bilayers with molecular dynamics simulations. Because the size of penicillin molecules is close to the size of the narrowest part of the OmpF pore, penicillins occlude the pore during their translocation. Favorably interacting penicillins cause time-resolvable transient blockages of the small-ion current through the channel and thereby provide information about their dynamics within the pore. Analyzing these random fluctuations, we find that ampicillin and amoxicillin have a relatively high affinity for OmpF. In contrast, no or only a weak interaction is detected for carbenicillin, azlocillin, and piperacillin. Molecular dynamics simulations suggest a possible pathway of these drugs through the OmpF channel and rationalize our experimental findings. For zwitterionic ampicillin and amoxicillin, we identify a region of binding sites near the narrowest part of the channel pore. Interactions with these sites partially compensate for the entropic cost of drug confinement by the channel. Whereas azlocillin and piperacillin are clearly too big to pass through the channel constriction, dianionic carbenicillin does not find an efficient binding region in the constriction zone. Carbenicillin's favorable interactions are limited to the extracellular vestibule. These observations confirm our earlier suggestion that a set of high-affinity sites at the narrowest part of the OmpF channel improves a drug's ability to cross the membrane via the pore. PMID:16339889

Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

PubMed Central

Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

2013-01-01

Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

Molecular-Scale Features that Govern the Effects of O-Glycosylation on a Carbohydrate-Binding Module

DOE PAGES

Guan, Xiaoyang; Chaffey, Patrick K.; Zeng, Chen; ...

2015-09-21

The protein glycosylation is a ubiquitous post-translational modification in all kingdoms of life. Despite its importance in molecular and cellular biology, the molecular-level ramifications of O-glycosylation on biomolecular structure and function remain elusive. Here, we took a small model glycoprotein and changed the glycan structure and size, amino acid residues near the glycosylation site, and glycosidic linkage while monitoring any corresponding changes to physical stability and cellulose binding affinity. The results of this study reveal the collective importance of all the studied features in controlling the most pronounced effects of O-glycosylation in this system. This study suggests the possibility ofmore » designing proteins with multiple improved properties by simultaneously varying the structures of O-glycans and amino acids local to the glycosylation site.« less

Role of Annular Lipids in the Functional Properties of Leucine Transporter LeuT Proteomicelles.

PubMed

LeVine, Michael V; Khelashvili, George; Shi, Lei; Quick, Matthias; Javitch, Jonathan A; Weinstein, Harel

2016-02-16

Recent work has shown that the choice of the type and concentration of detergent used for the solubilization of membrane proteins can strongly influence the results of functional experiments. In particular, the amino acid transporter LeuT can bind two substrate molecules in low concentrations of n-dodecyl β-d-maltopyranoside (DDM), whereas high concentrations reduce the molar binding stoichiometry to 1:1. Subsequent molecular dynamics (MD) simulations of LeuT in DDM proteomicelles revealed that DDM can penetrate to the extracellular vestibule and make stable contacts in the functionally important secondary substrate binding site (S2), suggesting a potential competitive mechanism for the reduction in binding stoichiometry. Because annular lipids can be retained during solubilization, we performed MD simulations of LeuT proteomicelles at various stages of the solubilization process. We find that at low DDM concentrations, lipids are retained around the protein and penetration of detergent into the S2 site does not occur, whereas at high concentrations, lipids are displaced and the probability of DDM binding in the S2 site is increased. This behavior is dependent on the type of detergent, however, as we find in the simulations that the detergent lauryl maltose-neopentyl glycol, which is approximately twice the size of DDM and structurally more closely resembles lipids, does not penetrate the protein even at very high concentrations. We present functional studies that confirm the computational findings, emphasizing the need for careful consideration of experimental conditions, and for cautious interpretation of data in gathering mechanistic information about membrane proteins.

Role of Annular Lipids in the Functional Properties of Leucine Transporter LeuT Proteomicelles

PubMed Central

2016-01-01

Recent work has shown that the choice of the type and concentration of detergent used for the solubilization of membrane proteins can strongly influence the results of functional experiments. In particular, the amino acid transporter LeuT can bind two substrate molecules in low concentrations of n-dodecyl β-d-maltopyranoside (DDM), whereas high concentrations reduce the molar binding stoichiometry to 1:1. Subsequent molecular dynamics (MD) simulations of LeuT in DDM proteomicelles revealed that DDM can penetrate to the extracellular vestibule and make stable contacts in the functionally important secondary substrate binding site (S2), suggesting a potential competitive mechanism for the reduction in binding stoichiometry. Because annular lipids can be retained during solubilization, we performed MD simulations of LeuT proteomicelles at various stages of the solubilization process. We find that at low DDM concentrations, lipids are retained around the protein and penetration of detergent into the S2 site does not occur, whereas at high concentrations, lipids are displaced and the probability of DDM binding in the S2 site is increased. This behavior is dependent on the type of detergent, however, as we find in the simulations that the detergent lauryl maltose-neopentyl glycol, which is approximately twice the size of DDM and structurally more closely resembles lipids, does not penetrate the protein even at very high concentrations. We present functional studies that confirm the computational findings, emphasizing the need for careful consideration of experimental conditions, and for cautious interpretation of data in gathering mechanistic information about membrane proteins. PMID:26811944

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

PubMed

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

Pd surface and Pt subsurface segregation in Pt1-c Pd c nanoalloys

NASA Astrophysics Data System (ADS)

De Clercq, A.; Giorgio, S.; Mottet, C.

2016-02-01

The structure and chemical arrangement of Pt1-c Pd c nanoalloys with the icosahedral and face centered cubic symmetry are studied using Monte Carlo simulations with a tight binding interatomic potential fitted to density-functional theory calculations. Pd surface segregation from the lowest to the highest coordinated sites is predicted by the theory together with a Pt enrichment at the subsurface, whatever the structure and the size of the nanoparticles, and which subsists when increasing the temperature. The onion-shell chemical configuration is found for both symmetries and is initiated from the Pd surface segregation. It is amplified in the icosahedral symmetry and small sizes but when considering larger sizes, the oscillating segregation profile occurs near the surface on about three to four shells whatever the structure. Pd segregation results from the significant lower cohesive energy of Pd as compared to Pt and the weak ordering tendency leads to the Pt subsurface segregation. The very weak size mismatch does not prevent the bigger atoms (Pt) from occupying subsurface sites which are in compression whereas the smaller ones (Pd) occupy the central site of the icosahedra where the compression is an order of magnitude higher.

Monte Carlo modeling of single-molecule cytoplasmic dynein.

PubMed

Singh, Manoranjan P; Mallik, Roop; Gross, Steven P; Yu, Clare C

2005-08-23

Molecular motors are responsible for active transport and organization in the cell, underlying an enormous number of crucial biological processes. Dynein is more complicated in its structure and function than other motors. Recent experiments have found that, unlike other motors, dynein can take different size steps along microtubules depending on load and ATP concentration. We use Monte Carlo simulations to model the molecular motor function of cytoplasmic dynein at the single-molecule level. The theory relates dynein's enzymatic properties to its mechanical force production. Our simulations reproduce the main features of recent single-molecule experiments that found a discrete distribution of dynein step sizes, depending on load and ATP concentration. The model reproduces the large steps found experimentally under high ATP and no load by assuming that the ATP binding affinities at the secondary sites decrease as the number of ATP bound to these sites increases. Additionally, to capture the essential features of the step-size distribution at very low ATP concentration and no load, the ATP hydrolysis of the primary site must be dramatically reduced when none of the secondary sites have ATP bound to them. We make testable predictions that should guide future experiments related to dynein function.

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

NASA Astrophysics Data System (ADS)

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-01

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

PubMed

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-05

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Allosteric binding sites in Rab11 for potential drug candidates

PubMed Central

2018-01-01

Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

Biomimetic/Optical Sensors for Detecting Bacterial Species

NASA Technical Reports Server (NTRS)

Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth

2006-01-01

Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites that bind only to molecules matched to the sites; other molecules are excluded. In a sensor according to the proposal, the MIP would feature molecular recognition sites that would bind the specific signaling molecules selectively according to their size, shape, and chemical functionality (see figure). As the film took up the signaling molecules in the molecular recognition sites, the index of refraction and thickness of the film would change, causing a wavelength shift of the peak of the resonance spectrum. It has been estimated that by measuring this wavelength shift, it should be possible to detect as little as 10 picomoles of a peptide signaling compound.

Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, A.M.; Vandesande, F.; Orban, G.A.

1991-03-08

The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

PubMed Central

Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

1999-01-01

A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

PubMed

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Selective binding of choline by a phosphate-coordination-based triple helicate featuring an aromatic box

DOE PAGES

Jia, Chuandong; Zuo, Wei; Yang, Dong; ...

2017-10-16

In nature, proteins have evolved sophisticated cavities tailored for capturing target guests selectively among competitors of similar size, shape, and charge. The fundamental principles guiding the molecular recognition, such as self-assembly and complementarity, have inspired the development of biomimetic receptors. In the current work, we report a self-assembled triple anion helicate (host 2) featuring a cavity resembling that of the choline-binding protein ChoX, as revealed by crystal and density functional theory (DFT)-optimized structures, which binds choline in a unique dual-site-binding mode. Here, this similarity in structure leads to a similarly high selectivity of host 2 for choline over its derivatives,more » as demonstrated by the NMR and fluorescence competition experiments. Furthermore, host 2 is able to act as a fluorescence displacement sensor for discriminating choline, acetylcholine, l-carnitine, and glycine betaine effectively.« less

Amides Do Not Always Work: Observation of Guest Binding in an Amide-Functionalized Porous Metal–Organic Framework

PubMed Central

2016-01-01

An amide-functionalized metal organic framework (MOF) material, MFM-136, shows a high CO2 uptake of 12.6 mmol g–1 at 20 bar and 298 K. MFM-136 is the first example of an acylamide pyrimidyl isophthalate MOF without open metal sites and, thus, provides a unique platform to study guest binding, particularly the role of free amides. Neutron diffraction reveals that, surprisingly, there is no direct binding between the adsorbed CO2/CH4 molecules and the pendant amide group in the pore. This observation has been confirmed unambiguously by inelastic neutron spectroscopy. This suggests that introduction of functional groups solely may not necessarily induce specific guest–host binding in porous materials, but it is a combination of pore size, geometry, and functional group that leads to enhanced gas adsorption properties. PMID:27665845

Pretargeting of carcinoembryonic antigen-expressing cancers with a trivalent bispecific fusion protein produced in myeloma cells.

PubMed

Rossi, Edmund A; Chang, Chien-Hsing; Losman, Michele J; Sharkey, Robert M; Karacay, Habibe; McBride, William; Cardillo, Thomas M; Hansen, Hans J; Qu, Zhengxing; Horak, Ivan D; Goldenberg, David M

2005-10-01

To characterize a novel trivalent bispecific fusion protein and evaluate its potential utility for pretargeted delivery of radionuclides to tumors. hBS14, a recombinant fusion protein that binds bispecifically to carcinoembryonic antigen (CEA) and the hapten, histamine-succinyl-glycine (HSG), was produced by transgenic myeloma cells and purified to near homogeneity in a single step using a novel HSG-based affinity chromatography system. Biochemical characterization included size-exclusion high-performance liquid chromatography (SE-HPLC), SDS-PAGE, and isoelectric focusing. Functional characterization was provided by BIAcore and SE-HPLC. The efficacy of hBS14 for tumor pretargeting was evaluated in CEA-expressing GW-39 human colon tumor-bearing nude mice using a bivalent HSG hapten (IMP-241) labeled with (111)In. Biochemical analysis showed that single-step affinity chromatography provided highly purified material. SE-HPLC shows a single protein peak consistent with the predicted molecular size of hBS14. SDS-PAGE analysis shows only two polypeptide bands, which are consistent with the calculated molecular weights of the hBS14 polypeptides. BIAcore showed the bispecific binding properties and suggested that hBS14 possesses two functional CEA-binding sites. This was supported by SE-HPLC immunoreactivity experiments. All of the data suggest that the structure of hBS14 is an 80 kDa heterodimer with one HSG and two CEA binding sites. Pretargeting experiments in the mouse model showed high uptake of radiopeptide in the tumor, with favorable tumor-to-nontumor ratios as early as 3 hours postinjection. The results indicate that hBS14 is an attractive candidate for use in a variety of pretargeting applications, particularly tumor therapy with radionuclides and drugs.

Conformational and chemical selection by a trans-acting editing domain

PubMed Central

Danhart, Eric M.; Bakhtina, Marina; Cantara, William A.; Kuzmishin, Alexandra B.; Ma, Xiao; Sanford, Brianne L.; Vargas-Rodriguez, Oscar; Košutić, Marija; Goto, Yuki; Suga, Hiroaki; Nakanishi, Kotaro; Micura, Ronald; Musier-Forsyth, Karin

2017-01-01

Molecular sieves ensure proper pairing of tRNAs and amino acids during aminoacyl-tRNA biosynthesis, thereby avoiding detrimental effects of mistranslation on cell growth and viability. Mischarging errors are often corrected through the activity of specialized editing domains present in some aminoacyl-tRNA synthetases or via single-domain trans-editing proteins. ProXp-ala is a ubiquitous trans-editing enzyme that edits Ala-tRNAPro, the product of Ala mischarging by prolyl-tRNA synthetase, although the structural basis for discrimination between correctly charged Pro-tRNAPro and mischarged Ala-tRNAAla is unclear. Deacylation assays using substrate analogs reveal that size discrimination is only one component of selectivity. We used NMR spectroscopy and sequence conservation to guide extensive site-directed mutagenesis of Caulobacter crescentus ProXp-ala, along with binding and deacylation assays to map specificity determinants. Chemical shift perturbations induced by an uncharged tRNAPro acceptor stem mimic, microhelixPro, or a nonhydrolyzable mischarged Ala-microhelixPro substrate analog identified residues important for binding and deacylation. Backbone 15N NMR relaxation experiments revealed dynamics for a helix flanking the substrate binding site in free ProXp-ala, likely reflecting sampling of open and closed conformations. Dynamics persist on binding to the uncharged microhelix, but are attenuated when the stably mischarged analog is bound. Computational docking and molecular dynamics simulations provide structural context for these findings and predict a role for the substrate primary α-amine group in substrate recognition. Overall, our results illuminate strategies used by a trans-editing domain to ensure acceptance of only mischarged Ala-tRNAPro, including conformational selection by a dynamic helix, size-based exclusion, and optimal positioning of substrate chemical groups. PMID:28768811

A Graphical Modelling Approach to the Dissection of Highly Correlated Transcription Factor Binding Site Profiles

PubMed Central

Stojnic, Robert; Fu, Audrey Qiuyan; Adryan, Boris

2012-01-01

Inferring the combinatorial regulatory code of transcription factors (TFs) from genome-wide TF binding profiles is challenging. A major reason is that TF binding profiles significantly overlap and are therefore highly correlated. Clustered occurrence of multiple TFs at genomic sites may arise from chromatin accessibility and local cooperation between TFs, or binding sites may simply appear clustered if the profiles are generated from diverse cell populations. Overlaps in TF binding profiles may also result from measurements taken at closely related time intervals. It is thus of great interest to distinguish TFs that directly regulate gene expression from those that are indirectly associated with gene expression. Graphical models, in particular Bayesian networks, provide a powerful mathematical framework to infer different types of dependencies. However, existing methods do not perform well when the features (here: TF binding profiles) are highly correlated, when their association with the biological outcome is weak, and when the sample size is small. Here, we develop a novel computational method, the Neighbourhood Consistent PC (NCPC) algorithms, which deal with these scenarios much more effectively than existing methods do. We further present a novel graphical representation, the Direct Dependence Graph (DDGraph), to better display the complex interactions among variables. NCPC and DDGraph can also be applied to other problems involving highly correlated biological features. Both methods are implemented in the R package ddgraph, available as part of Bioconductor (http://bioconductor.org/packages/2.11/bioc/html/ddgraph.html). Applied to real data, our method identified TFs that specify different classes of cis-regulatory modules (CRMs) in Drosophila mesoderm differentiation. Our analysis also found depletion of the early transcription factor Twist binding at the CRMs regulating expression in visceral and somatic muscle cells at later stages, which suggests a CRM-specific repression mechanism that so far has not been characterised for this class of mesodermal CRMs. PMID:23144600

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

Stoichiometry for binding and transport by the twin arginine translocation system.

PubMed

Celedon, Jose M; Cline, Kenneth

2012-05-14

Twin arginine translocation (Tat) systems transport large folded proteins across sealed membranes. Tat systems accomplish this feat with three membrane components organized in two complexes. In thylakoid membranes, cpTatC and Hcf106 comprise a large receptor complex containing an estimated eight cpTatC-Hcf106 pairs. Protein transport occurs when Tha4 joins the receptor complex as an oligomer of uncertain size that is thought to form the protein-conducting structure. Here, binding analyses with intact membranes or purified complexes indicate that each receptor complex could bind eight precursor proteins. Kinetic analysis of translocation showed that each precursor-bound site was independently functional for transport, and, with sufficient Tha4, all sites were concurrently active for transport. Tha4 titration determined that ∼26 Tha4 protomers were required for transport of each OE17 (oxygen-evolving complex subunit of 17 kD) precursor protein. Our results suggest that, when fully saturated with precursor proteins and Tha4, the Tat translocase is an ∼2.2-megadalton complex that can individually transport eight precursor proteins or cooperatively transport multimeric precursors.

Chelating effect in short polymers for the design of bidentate binders of increased affinity and selectivity

PubMed Central

Fortuna, Sara; Fogolari, Federico; Scoles, Giacinto

2015-01-01

The design of new strong and selective binders is a key step towards the development of new sensing devices and effective drugs. Both affinity and selectivity can be increased through chelation and here we theoretically explore the possibility of coupling two binders through a flexible linker. We prove the enhanced ability of double binders of keeping their target with a simple model where a polymer composed by hard spheres interacts with a spherical macromolecule, such as a protein, through two sticky spots. By Monte Carlo simulations and thermodynamic integration we show the chelating effect to hold for coupling polymers whose radius of gyration is comparable to size of the chelated particle. We show the binding free energy of flexible double binders to be higher than that of two single binders and to be maximized when the binding sites are at distances comparable to the mean free polymer end-to-end distance. The affinity of two coupled binders is therefore predicted to increase non linearly and in turn, by targeting two non-equivalent binding sites, this will lead to higher selectivity. PMID:26496975

Structural comparison of cytochromes P450 2A6, 2A13, and 2E1 with pilocarpine

DOE Office of Scientific and Technical Information (OSTI.GOV)

DeVore, Natasha M.; Meneely, Kathleen M.; Bart, Aaron G.

2013-11-20

Human xenobiotic-metabolizing cytochrome P450 (CYP) enzymes can each bind and monooxygenate a diverse set of substrates, including drugs, often producing a variety of metabolites. Additionally, a single ligand can interact with multiple CYP enzymes, but often the protein structural similarities and differences that mediate such overlapping selectivity are not well understood. Even though the CYP superfamily has a highly canonical global protein fold, there are large variations in the active site size, topology, and conformational flexibility. We have determined how a related set of three human CYP enzymes bind and interact with a common inhibitor, the muscarinic receptor agonist drugmore » pilocarpine. Pilocarpine binds and inhibits the hepatic CYP2A6 and respiratory CYP2A13 enzymes much more efficiently than the hepatic CYP2E1 enzyme. To elucidate key residues involved in pilocarpine binding, crystal structures of CYP2A6 (2.4 {angstrom}), CYP2A13 (3.0 {angstrom}), CYP2E1 (2.35 {angstrom}), and the CYP2A6 mutant enzyme, CYP2A6 I208S/I300F/G301A/S369G (2.1 {angstrom}) have been determined with pilocarpine in the active site. In all four structures, pilocarpine coordinates to the heme iron, but comparisons reveal how individual residues lining the active sites of these three distinct human enzymes interact differently with the inhibitor pilocarpine.« less

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

On the nature of cavities on protein surfaces: application to the identification of drug-binding sites.

PubMed

Nayal, Murad; Honig, Barry

2006-06-01

In this article we introduce a new method for the identification and the accurate characterization of protein surface cavities. The method is encoded in the program SCREEN (Surface Cavity REcognition and EvaluatioN). As a first test of the utility of our approach we used SCREEN to locate and analyze the surface cavities of a nonredundant set of 99 proteins cocrystallized with drugs. We find that this set of proteins has on average about 14 distinct cavities per protein. In all cases, a drug is bound at one (and sometimes more than one) of these cavities. Using cavity size alone as a criterion for predicting drug-binding sites yields a high balanced error rate of 15.7%, with only 71.7% coverage. Here we characterize each surface cavity by computing a comprehensive set of 408 physicochemical, structural, and geometric attributes. By applying modern machine learning techniques (Random Forests) we were able to develop a classifier that can identify drug-binding cavities with a balanced error rate of 7.2% and coverage of 88.9%. Only 18 of the 408 cavity attributes had a statistically significant role in the prediction. Of these 18 important attributes, almost all involved size and shape rather than physicochemical properties of the surface cavity. The implications of these results are discussed. A SCREEN Web server is available at http://interface.bioc.columbia.edu/screen. 2006 Wiley-Liss, Inc.

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

PubMed

Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

2017-07-01

Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

2005-01-01

The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

PubMed Central

Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

2015-01-01

The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

Selective increases in serotonin 5-HT1B/1D and 5-HT2A/2C binding sites in adult rat basal ganglia following lesions of serotonergic neurons.

PubMed

Compan, V; Segu, L; Buhot, M C; Daszuta, A

1998-05-18

Quantitative autoradiography was used to examine possible adaptive changes in serotonin 5-HT1B/1D and 5-HT2A/2C receptor binding sites in adult rat basal ganglia, after partial or severe lesions of serotonergic neurons produced by intraraphe injections of variable amounts of 5,7-dihydroxytryptamine. In controls, the 5-HT1B/1D sites labeled with S-CM-G[125I]TNH2 were evenly distributed in the core and the shell of the nucleus accumbens. The density of 5-HT1B/1D sites was higher in the ventral than dorsal part of the striatum and no regional differences were detected along the rostrocaudal axis of the structure. The 5-HT2A/2C sites labeled with [125I]DOI were preferentially distributed in the mediodorsal striatum and higher densities were detected in the shell than core of the nucleus accumbens. Following 5,7-dihydroxytryptamine injections, there were no changes in binding of either receptor subtype after partial lesions entailing 80-90% 5-HT depletions. After severe 5-HT depletions (over 95%), large increases in 5-HT1B/1D binding were observed in the substantia nigra (78%), but no changes took place in the globus pallidus. Increases in 5-HT1B/1D binding were also detected in the shell of the nucleus accumbens (27%). Similar sized increases in 5-HT2A/2C binding (22%) were restricted to the medial striatum. The present results suggest a preferential association between 5-HT1B/1D receptors and the striatonigral neurons containing substance P, as indicated by the striatal distribution of these receptors and their selective increases in the substantia nigra after severe 5-HT deprivation. We recently proposed a similar relationship between the 5-HT4 receptors and the striatopallidal neurons containing met-enkephalin. Moreover, the increases in 5-HT1B/1D binding in the substantia nigra and in the shell of the nucleus accumbens reinforce the view of an implication of this receptor subtype in motor functions. In contrast, the prominent increases in 5-HT2A/2C binding after severe 5-HT deprivation as restricted to the medial region of the striatum and suggest up-regulation of most probably 5-HT2C receptors in a region implicated in cognitive functions. Copyright 1998 Elsevier Science B. V.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

PubMed

Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

2013-07-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

PubMed Central

Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

2013-01-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

2009-05-22

Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

NASA Astrophysics Data System (ADS)

Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

2013-08-01

The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

Structural Isosteres of Phosphate Groups in the Protein Data Bank.

PubMed

Zhang, Yuezhou; Borrel, Alexandre; Ghemtio, Leo; Regad, Leslie; Boije Af Gennäs, Gustav; Camproux, Anne-Claude; Yli-Kauhaluoma, Jari; Xhaard, Henri

2017-03-27

We developed a computational workflow to mine the Protein Data Bank for isosteric replacements that exist in different binding site environments but have not necessarily been identified and exploited in compound design. Taking phosphate groups as examples, the workflow was used to construct 157 data sets, each composed of a reference protein complexed with AMP, ADP, ATP, or pyrophosphate as well other ligands. Phosphate binding sites appear to have a high hydration content and large size, resulting in U-shaped bioactive conformations recurrently found across unrelated protein families. A total of 16 413 replacements were extracted, filtered for a significant structural overlap on phosphate groups, and sorted according to their SMILES codes. In addition to the classical isosteres of phosphate, such as carboxylate, sulfone, or sulfonamide, unexpected replacements that do not conserve charge or polarity, such as aryl, aliphatic, or positively charged groups, were found.

Prediction of binding constants of protein ligands: A fast method for the prioritization of hits obtained from de novo design or 3D database search programs

NASA Astrophysics Data System (ADS)

Böhm, Hans-Joachim

1998-07-01

A dataset of 82 protein-ligand complexes of known 3D structure and binding constant Ki was analysed to elucidate the important factors that determine the strength of protein-ligand interactions. The following parameters were investigated: the number and geometry of hydrogen bonds and ionic interactions between the protein and the ligand, the size of the lipophilic contact surface, the flexibility of the ligand, the electrostatic potential in the binding site, water molecules in the binding site, cavities along the protein-ligand interface and specific interactions between aromatic rings. Based on these parameters, a new empirical scoring function is presented that estimates the free energy of binding for a protein-ligand complex of known 3D structure. The function distinguishes between buried and solvent accessible hydrogen bonds. It tolerates deviations in the hydrogen bond geometry of up to 0.25 Å in the length and up to 30 °Cs in the hydrogen bond angle without penalizing the score. The new energy function reproduces the binding constants (ranging from 3.7 × 10-2 M to 1 × 10-14 M, corresponding to binding energies between -8 and -80 kJ/mol) of the dataset with a standard deviation of 7.3 kJ/mol corresponding to 1.3 orders of magnitude in binding affinity. The function can be evaluated very fast and is therefore also suitable for the application in a 3D database search or de novo ligand design program such as LUDI. The physical significance of the individual contributions is discussed.

Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

1987-11-01

Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

Molecular modeling and residue interaction network studies on the mechanism of binding and resistance of the HCV NS5B polymerase mutants to VX-222 and ANA598.

PubMed

Xue, Weiwei; Jiao, Pingzu; Liu, Huanxiang; Yao, Xiaojun

2014-04-01

Hepatitis C virus (HCV) NS5B protein is an RNA-dependent RNA polymerase (RdRp) with essential functions in viral genome replication and represents a promising therapeutic target to develop direct-acting antivirals (DAAs). Multiple nonnucleoside inhibitors (NNIs) binding sites have been identified within the polymerase. VX-222 and ANA598 are two NNIs targeting thumb II site and palm I site of HCV NS5B polymerase, respectively. These two molecules have been shown to be very effective in phase II clinical trials. However, the emergence of resistant HCV replicon variants (L419M, M423T, I482L mutants to VX-222 and M414T, M414L, G554D mutants to ANA598) has significantly decreased their efficacy. To elucidate the molecular mechanism about how these mutations influenced the drug binding mode and decreased drug efficacy, we studied the binding modes of VX-222 and ANA598 to wild-type and mutant polymerase by molecular modeling approach. Molecular dynamics (MD) simulations results combined with binding free energy calculations indicated that the mutations significantly altered the binding free energy and the interaction for the drugs to polymerase. The further per-residue binding free energy decomposition analysis revealed that the mutations decreased the interactions with several key residues, such as L419, M423, L474, S476, I482, L497, for VX-222 and L384, N411, M414, Y415, Q446, S556, G557 for ANA598. These were the major origins for the resistance to these two drugs. In addition, by analyzing the residue interaction network (RIN) of the complexes between the drugs with wild-type and the mutant polymerase, we found that the mutation residues in the networks involved in the drug resistance possessed a relatively lower size of topology centralities. The shift of betweenness and closeness values of binding site residues in the mutant polymerase is relevant to the mechanism of drug resistance of VX-222 and ANA598. These results can provide an atomic-level understanding about the mechanisms of drug resistance conferred by the studied mutations and will be helpful to design more potent inhibitors which could effectively overcome drug resistance of antivirus agents. Copyright © 2014 Elsevier B.V. All rights reserved.

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

PubMed Central

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

PubMed

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

2013-09-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

PubMed Central

Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

2009-01-01

Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

2017-03-28

Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

Mechanism of host-guest complexation by cucurbituril.

PubMed

Márquez, César; Hudgins, Robert R; Nau, Werner M

2004-05-12

The factors affecting host-guest complexation between the molecular container compound cucurbit[6]uril (CB6) and various guests in aqueous solution are studied, and a detailed complexation mechanism in the presence of cations is derived. The formation of the supramolecular complex is studied in detail for cyclohexylmethylammonium ion as guest. The kinetics and thermodynamics of complexation is monitored by NMR as a function of temperature, salt concentration, and cation size. The binding constants and the ingression rate constants decrease with increasing salt concentration and cation-binding constant, in agreement with a competitive binding of the ammonium site of the guest and the metal cation with the ureido carbonyl portals of CB6. Studies as a function of guest size indicate that the effective container volume of the CB6 cavity is approximately 105 A(3). It is suggested that larger guests are excluded for two reasons: a high activation barrier for ingression imposed by the tight CB6 portals and a destabilization of the complex due to steric repulsion inside. For example, in the case of the nearly spherical azoalkane homologues 2,3-diazabicyclo[2.2.1]hept-2-ene (DBH, volume ca. 96 A(3)) and 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO, volume ca. 110 A(3)), the former forms the CB6 complex promptly with a sizable binding constant (1300 M(-1)), while the latter does not form a complex even after several months at optimized complexation conditions. Molecular mechanics calculations are performed for several CB6/guest complexes. A qualitative agreement is found between experimental and calculated activation energies for ingression as a function of both guest size and state of protonation. The potential role of constrictive binding by CB6 is discussed.

Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

PubMed

Abou-Zied, Osama K

2015-01-01

Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

PubMed Central

Pikler, G M; Webster, R A; Spelsberg, T C

1976-01-01

Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

Plasticity of the Binding Site of Renin: Optimized Selection of Protein Structures for Ensemble Docking.

PubMed

Strecker, Claas; Meyer, Bernd

2018-05-29

Protein flexibility poses a major challenge to docking of potential ligands in that the binding site can adopt different shapes. Docking algorithms usually keep the protein rigid and only allow the ligand to be treated as flexible. However, a wrong assessment of the shape of the binding pocket can prevent a ligand from adapting a correct pose. Ensemble docking is a simple yet promising method to solve this problem: Ligands are docked into multiple structures, and the results are subsequently merged. Selection of protein structures is a significant factor for this approach. In this work we perform a comprehensive and comparative study evaluating the impact of structure selection on ensemble docking. We perform ensemble docking with several crystal structures and with structures derived from molecular dynamics simulations of renin, an attractive target for antihypertensive drugs. Here, 500 ns of MD simulations revealed binding site shapes not found in any available crystal structure. We evaluate the importance of structure selection for ensemble docking by comparing binding pose prediction, ability to rank actives above nonactives (screening utility), and scoring accuracy. As a result, for ensemble definition k-means clustering appears to be better suited than hierarchical clustering with average linkage. The best performing ensemble consists of four crystal structures and is able to reproduce the native ligand poses better than any individual crystal structure. Moreover this ensemble outperforms 88% of all individual crystal structures in terms of screening utility as well as scoring accuracy. Similarly, ensembles of MD-derived structures perform on average better than 75% of any individual crystal structure in terms of scoring accuracy at all inspected ensembles sizes.

Cryo-electron microscopy and single molecule fluorescent microscopy detect CD4 receptor induced HIV size expansion prior to cell entry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pham, Son; CSIRO Australian Animal Health Laboratory, Victoria 3220; Tabarin, Thibault

Viruses are often thought to have static structure, and they only remodel after the viruses have entered target cells. Here, we detected a size expansion of virus particles prior to viral entry using cryo-electron microscopy (cryo-EM) and single molecule fluorescence imaging. HIV expanded both under cell-free conditions with soluble receptor CD4 (sCD4) targeting the CD4 binding site on the HIV-1 envelope protein (Env) and when HIV binds to receptor on cellular membrane. We have shown that the HIV Env is needed to facilitate receptor induced virus size expansions, showing that the ‘lynchpin’ for size expansion is highly specific. We demonstratemore » that the size expansion required maturation of HIV and an internal capsid core with wild type stability, suggesting that different HIV compartments are linked and are involved in remodelling. Our work reveals a previously unknown event in HIV entry, and we propose that this pre-entry priming process enables HIV particles to facilitate the subsequent steps in infection. - Highlights: • Cell free viruses are able to receive external trigger that leads to apparent size expansion. • Virus envelope and CD4 receptor engagement is the lynchpin of virus size expansion. • Internal capsid organisation can influence receptor mediated virus size expansion. • Pre-existing virus-associated lipid membrane in cell free virus can accommodate the receptor mediated virus size expansion.« less

Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

NASA Astrophysics Data System (ADS)

Schwartz, Rochelle D.; Kellar, Kenneth J.

1983-04-01

Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

Half-of-the-Sites Reactivity of the Castor Δ9-18:0-Acyl Carrier Protein Desaturase.

PubMed

Liu, Qin; Chai, Jin; Moche, Martin; Guy, Jodie; Lindqvist, Ylva; Shanklin, John

2015-09-01

Fatty acid desaturases regulate the unsaturation status of cellular lipids. They comprise two distinct evolutionary lineages, a soluble class found in the plastids of higher plants and an integral membrane class found in plants, yeast (Saccharomyces cerevisiae), animals, and bacteria. Both classes exhibit a dimeric quaternary structure. Here, we test the functional significance of dimeric organization of the soluble castor Δ9-18:0-acyl carrier protein desaturase, specifically, the hypothesis that the enzyme uses an alternating subunit half-of-the-sites reactivity mechanism whereby substrate binding to one subunit is coordinated with product release from the other subunit. Using a fluorescence resonance energy transfer assay, we demonstrated that dimers stably associate at concentrations typical of desaturase assays. An active site mutant T104K/S202E, designed to occlude the substrate binding cavity, was expressed, purified, and its properties validated by x-ray crystallography, size exclusion chromatography, and activity assay. Heterodimers comprising distinctly tagged wild-type and inactive mutant subunits were purified at 1:1 stoichiometry. Despite having only one-half the number of active sites, purified heterodimers exhibit equivalent activity to wild-type homodimers, consistent with half-of-the-sites reactivity. However, because multiple rounds of turnover were observed, we conclude that substrate binding to one subunit is not required to facilitate product release from the second subunit. The observed half-of-the-sites reactivity could potentially buffer desaturase activity from oxidative inactivation. That soluble desaturases require only one active subunit per dimer for full activity represents a mechanistic difference from the membrane class of desaturases such as the Δ9-acyl-CoA, Ole1p, from yeast, which requires two catalytically competent subunits for activity. © 2015 American Society of Plant Biologists. All Rights Reserved.

Half-of-the-Sites Reactivity of the Castor Δ9-18:0-Acyl Carrier Protein Desaturase1[OPEN

PubMed Central

Liu, Qin; Chai, Jin; Moche, Martin; Guy, Jodie; Lindqvist, Ylva; Shanklin, John

2015-01-01

Fatty acid desaturases regulate the unsaturation status of cellular lipids. They comprise two distinct evolutionary lineages, a soluble class found in the plastids of higher plants and an integral membrane class found in plants, yeast (Saccharomyces cerevisiae), animals, and bacteria. Both classes exhibit a dimeric quaternary structure. Here, we test the functional significance of dimeric organization of the soluble castor Δ9-18:0-acyl carrier protein desaturase, specifically, the hypothesis that the enzyme uses an alternating subunit half-of-the-sites reactivity mechanism whereby substrate binding to one subunit is coordinated with product release from the other subunit. Using a fluorescence resonance energy transfer assay, we demonstrated that dimers stably associate at concentrations typical of desaturase assays. An active site mutant T104K/S202E, designed to occlude the substrate binding cavity, was expressed, purified, and its properties validated by x-ray crystallography, size exclusion chromatography, and activity assay. Heterodimers comprising distinctly tagged wild-type and inactive mutant subunits were purified at 1:1 stoichiometry. Despite having only one-half the number of active sites, purified heterodimers exhibit equivalent activity to wild-type homodimers, consistent with half-of-the-sites reactivity. However, because multiple rounds of turnover were observed, we conclude that substrate binding to one subunit is not required to facilitate product release from the second subunit. The observed half-of-the-sites reactivity could potentially buffer desaturase activity from oxidative inactivation. That soluble desaturases require only one active subunit per dimer for full activity represents a mechanistic difference from the membrane class of desaturases such as the Δ9-acyl-CoA, Ole1p, from yeast, which requires two catalytically competent subunits for activity. PMID:26224800

Substance P binding sites in the nucleus tractus solitarius of the cat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maley, B.E.; Sasek, C.A.; Seybold, V.S.

1988-11-01

Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

PubMed

Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

2018-06-16

Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

PubMed Central

Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

1991-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

PubMed

Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

2008-11-21

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

PubMed

Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

1992-05-05

Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

[The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

PubMed

Kawasaki, Kazuyoshi; Ogawa, Seturou

2003-01-01

NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

PubMed

Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

2017-09-01

Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

PubMed Central

Das, Sourav; Kokardekar, Arshad

2009-01-01

Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

Molecular imprint of enzyme active site by camel nanobodies: rapid and efficient approach to produce abzymes with alliinase activity.

PubMed

Li, Jiang-Wei; Xia, Lijie; Su, Youhong; Liu, Hongchun; Xia, Xueqing; Lu, Qinxia; Yang, Chunjin; Reheman, Kalbinur

2012-04-20

Screening of inhibitory Ab1 antibodies is a critical step for producing catalytic antibodies in the anti-idiotypic approach. However, the incompatible surface of the active site of the enzyme and the antigen-binding site of heterotetrameric conventional antibodies become the limiting step. Because camelid-derived nanobodies possess the potential to preferentially bind to the active site of enzymes due to their small size and long CDR3, we have developed a novel approach to produce antibodies with alliinase activities by exploiting the molecular mimicry of camel nanobodies. By screening the camelid-derived variable region of the heavy chain cDNA phage display library with alliinase, we obtained an inhibitory nanobody VHHA4 that recognizes the active site. Further screening with VHHA4 from the same variable domain of the heavy chain of a heavy-chain antibody library led to a higher incidence of anti-idiotypic Ab2 abzymes with alliinase activities. One of the abzymes, VHHC10, showed the highest activity that can be inhibited by Ab1 VHHA4 and alliinase competitive inhibitor penicillamine and significantly suppressed the B16 tumor cell growth in the presence of alliin in vitro. The results highlight the feasibility of producing abzymes via anti-idiotypic nanobody approach.

Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

PubMed Central

Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

2015-01-01

Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

Photochemical and DFT studies on DNA-binding ability and antibacterial activity of lanthanum(III)-phenanthroline complex

NASA Astrophysics Data System (ADS)

Niroomand, Sona; Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Jahani, Shohreh; Moodi, Asieh

2017-02-01

The binding of the lanthanum(III) complex containing 1,10-phenanthroline (phen), [La(phen)3Cl3·OH2], to DNA is investigated by absorption and emission methods. This complex shows absorption decreasing in a charge transfer band, and fluorescence decrement when it binds to DNA. Electronic absorption spectroscopy (UV-Vis), fluorescence spectra, iodide quenching experiments, salt effect and viscosity measurements, ethidium bromide (EB) competition test, circular dichroism (CD) spectra as well as variable temperature experiments indicate that the La(III) complex binds to fish salmon (FS) DNA, presumably via groove binding mode. The binding constants (Kb) of the La(III) complex with DNA is (2.55 ± 0.02) × 106 M-1. Furthermore, the binding site size, n, the Stern-Volmer constant KSV and thermodynamic parameters; enthalpy change (ΔH0) and entropy change (ΔS0) and Gibb's free energy (ΔG0), are calculated according to relevant fluorescent data and the Van't Hoff equation. The La(III) complex has been screened for its antibacterial activities by the disc diffusion method. Also, in order to supplement the experimental findings, DFT computation and NBO analysis are carried out.

Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poat, J.A.; Cripps, H.E.; Iversen, L.L.

1988-05-01

Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

PubMed

Suzuki, N; Mihashi, K

1991-01-01

The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

A hierarchical approach to cooperativity in macromolecular and self-assembling binding systems.

PubMed

Garcés, Josep Lluís; Acerenza, Luis; Mizraji, Eduardo; Mas, Francesc

2008-04-01

The study of complex macromolecular binding systems reveals that a high number of states and processes are involved in their mechanism of action, as has become more apparent with the sophistication of the experimental techniques used. The resulting information is often difficult to interpret because of the complexity of the scheme (large size and profuse interactions, including cooperative and self-assembling interactions) and the lack of transparency that this complexity introduces into the interpretation of the indexes traditionally used to describe the binding properties. In particular, cooperative behaviour can be attributed to very different causes, such as direct chemical modification of the binding sites, conformational changes in the whole structure of the macromolecule, aggregation processes between different subunits, etc. In this paper, we propose a novel approach for the analysis of the binding properties of complex macromolecular and self-assembling systems. To quantify the binding behaviour, we use the global association quotient defined as K(c) = [occupied sites]/([free sites] L), L being the free ligand concentration. K(c) can be easily related to other measures of cooperativity (such as the Hill number or the Scatchard plot) and to the free energies involved in the binding processes at each ligand concentration. In a previous work, it was shown that K(c) could be decomposed as an average of equilibrium constants in two ways: intrinsic constants for Adair binding systems and elementary constants for the general case. In this study, we show that these two decompositions are particular cases of a more general expression, where the average is over partial association quotients, associated with subsystems from which the system is composed. We also show that if the system is split into different subsystems according to a binding hierarchy that starts from the lower, microscopic level and ends at the higher, aggregation level, the global association quotient can be decomposed following the hierarchical levels of macromolecular organisation. In this process, the partial association quotients of one level are expressed, in a recursive way, as a function of the partial quotients of the level that is immediately below, until the microscopic level is reached. As a result, the binding properties of very complex macromolecular systems can be analysed in detail, making the mechanistic explanation of their behaviour transparent. In addition, our approach provides a model-independent interpretation of the intrinsic equilibrium constants in terms of the elementary ones.

Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luthin, G.R.; Wolfe, B.B.

The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

PubMed

Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

1997-02-28

The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

Effects of Single Nucleotide Polymorphisms on Human N-Acetyltransferase 2 Structure and Dynamics by Molecular Dynamics Simulation

PubMed Central

Rajasekaran, M.; Abirami, Santhanam; Chen, Chinpan

2011-01-01

Background Arylamine N-acetyltransferase 2 (NAT2) is an important catalytic enzyme that metabolizes the carcinogenic arylamines, hydrazine drugs and chemicals. This enzyme is highly polymorphic in different human populations. Several polymorphisms of NAT2, including the single amino acid substitutions R64Q, I114T, D122N, L137F, Q145P, R197Q, and G286E, are classified as slow acetylators, whereas the wild-type NAT2 is classified as a fast acetylator. The slow acetylators are often associated with drug toxicity and efficacy as well as cancer susceptibility. The biological functions of these 7 mutations have previously been characterized, but the structural basis behind the reduced catalytic activity and reduced protein level is not clear. Methodology/Principal Findings We performed multiple molecular dynamics simulations of these mutants as well as NAT2 to investigate the structural and dynamical effects throughout the protein structure, specifically the catalytic triad, cofactor binding site, and the substrate binding pocket. None of these mutations induced unfolding; instead, their effects were confined to the inter-domain, domain 3 and 17-residue insert region, where the flexibility was significantly reduced relative to the wild-type. Structural effects of these mutations propagate through space and cause a change in catalytic triad conformation, cofactor binding site, substrate binding pocket size/shape and electrostatic potential. Conclusions/Significance Our results showed that the dynamical properties of all the mutant structures, especially in inter-domain, domain 3 and 17-residue insert region were affected in the same manner. Similarly, the electrostatic potential of all the mutants were altered and also the functionally important regions such as catalytic triad, cofactor binding site, and substrate binding pocket adopted different orientation and/or conformation relative to the wild-type that may affect the functions of the mutants. Overall, our study may provide the structural basis for reduced catalytic activity and protein level, as was experimentally observed for these polymorphisms. PMID:21980537

Existence of three subtypes of bradykinin B2 receptors in guinea pig.

PubMed

Seguin, L; Widdowson, P S; Giesen-Crouse, E

1992-12-01

We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

PubMed

Denys, A; Allain, F; Carpentier, M; Spik, G

1998-12-15

Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

PubMed

Nguyen, T V; Juorio, A V

1989-10-01

The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

Impact of germline and somatic missense variations on drug binding sites.

PubMed

Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

2017-03-01

Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

2012-06-28

mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

PubMed

Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

2011-05-31

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

PubMed

Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

2018-06-01

Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

Distinct p53 genomic binding patterns in normal and cancer-derived human cells

PubMed Central

McCorkle, Sean R; McCombie, WR; Dunn, John J

2011-01-01

Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

Ethylene binding site affinity in ripening apples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, S.M.; Sisler, E.C.

1993-09-01

Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Functional identification and characterization of sodium binding sites in Na symporters

PubMed Central

Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

2013-01-01

Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

PubMed Central

Navé, Jean-François; Benveniste, Pierre

1984-01-01

The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA.

PubMed

Ditlev, Sisse B; Florea, Raluca; Nielsen, Morten A; Theander, Thor G; Magez, Stefan; Boeuf, Philippe; Salanti, Ali

2014-01-01

Placental malaria is a major health problem for both pregnant women and their fetuses in malaria endemic regions. It is triggered by the accumulation of Plasmodium falciparum-infected erythrocytes (IE) in the intervillous spaces of the placenta and is associated with foetal growth restriction and maternal anemia. IE accumulation is supported by the binding of the parasite-expressed protein VAR2CSA to placental chondroitin sulfate A (CSA). Defining specific CSA-binding epitopes of VAR2CSA, against which to target the immune response, is essential for the development of a vaccine aimed at blocking IE adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i) the large size of VAR2CSA and (ii) the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs) are known to target epitopes that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH) domain is the antigen-binding site of camelid HcAbs, the so called Nanobody, which represents the smallest known (15 kDa) intact, native antigen-binding fragment. In this study, we have used the Nanobody technology, an approach new to malaria research, to generate small and functional antibody fragments recognizing unique epitopes broadly distributed on VAR2CSA.

Development of high-productivity, strong cation-exchange adsorbers for protein capture by graft polymerization from membranes with different pore sizes

PubMed Central

Chenette, Heather C.S.; Robinson, Julie R.; Hobley, Eboni; Husson, Scott M.

2012-01-01

This paper describes the surface modification of macroporous membranes using ATRP (atom transfer radical polymerization) to create cation-exchange adsorbers with high protein binding capacity at high product throughput. The work is motivated by the need for a more economical and rapid capture step in downstream processing of protein therapeutics. Membranes with three reported nominal pore sizes (0.2, 0.45, 1.0 μm) were modified with poly(3-sulfopropyl methacrylate, potassium salt) tentacles, to create a high density of protein binding sites. A special formulation was used in which the monomer was protected by a crown ether to enable surface-initiated ATRP of this cationic polyelectrolyte. Success with modification was supported by chemical analysis using Fourier-transform infrared spectroscopy and indirectly by measurement of pure water flux as a function of polymerization time. Uniformity of modification within the membranes was visualized with confocal laser scanning microscopy. Static and dynamic binding capacities were measured using lysozyme protein to allow comparisons with reported performance data for commercial cation-exchange materials. Dynamic binding capacities were measured for flow rates ranging from 13 to 109 column volumes (CV)/min. Results show that this unique ATRP formulation can be used to fabricate cation-exchange membrane adsorbers with dynamic binding capacities as high as 70 mg/mL at a throughput of 100 CV/min and unprecedented productivity of 300 mg/mL/min. PMID:23175597

Free energy landscape of siRNA-polycation complexation: Elucidating the effect of molecular geometry, polymer flexibility, and charge neutralization.

PubMed

Grasso, Gianvito; Deriu, Marco Agostino; Patrulea, Viorica; Borchard, Gerrit; Möller, Michael; Danani, Andrea

2017-01-01

The success of medical threatments with DNA and silencing interference RNA is strongly related to the design of efficient delivery technologies. Cationic polymers represent an attractive strategy to serve as nucleic-acid carriers with the envisioned advantages of efficient complexation, low cost, ease of production, well-defined size, and low polydispersity index. However, the balance between efficacy and toxicity (safety) of these polymers is a challenge and in need of improvement. With the aim of designing more effective polycationic-based gene carriers, many parameters such as carrier morphology, size, molecular weight, surface chemistry, and flexibility/rigidity ratio need to be taken into consideration. In the present work, the binding mechanism of three cationic polymers (polyarginine, polylysine and polyethyleneimine) to a model siRNA target is computationally investigated at the atomistic level. In order to better understand the polycationic carrier-siRNA interactions, replica exchange molecular dynamic simulations were carried out to provide an exhaustive exploration of all the possible binding sites, taking fully into account the siRNA flexibility together with the presence of explicit solvent and ions. Moreover, well-tempered metadynamics simulations were employed to elucidate how molecular geometry, polycation flexibility, and charge neutralization affect the siRNA-polycations free energy landscape in term of low-energy binding modes and unbinding free energy barriers. Significant differences among polymer binding modes have been detected, revealing the advantageous binding properties of polyarginine and polylysine compared to polyethyleneimine.

Free energy landscape of siRNA-polycation complexation: Elucidating the effect of molecular geometry, polymer flexibility, and charge neutralization

PubMed Central

Patrulea, Viorica; Borchard, Gerrit; Möller, Michael; Danani, Andrea

2017-01-01

The success of medical threatments with DNA and silencing interference RNA is strongly related to the design of efficient delivery technologies. Cationic polymers represent an attractive strategy to serve as nucleic-acid carriers with the envisioned advantages of efficient complexation, low cost, ease of production, well-defined size, and low polydispersity index. However, the balance between efficacy and toxicity (safety) of these polymers is a challenge and in need of improvement. With the aim of designing more effective polycationic-based gene carriers, many parameters such as carrier morphology, size, molecular weight, surface chemistry, and flexibility/rigidity ratio need to be taken into consideration. In the present work, the binding mechanism of three cationic polymers (polyarginine, polylysine and polyethyleneimine) to a model siRNA target is computationally investigated at the atomistic level. In order to better understand the polycationic carrier-siRNA interactions, replica exchange molecular dynamic simulations were carried out to provide an exhaustive exploration of all the possible binding sites, taking fully into account the siRNA flexibility together with the presence of explicit solvent and ions. Moreover, well-tempered metadynamics simulations were employed to elucidate how molecular geometry, polycation flexibility, and charge neutralization affect the siRNA-polycations free energy landscape in term of low-energy binding modes and unbinding free energy barriers. Significant differences among polymer binding modes have been detected, revealing the advantageous binding properties of polyarginine and polylysine compared to polyethyleneimine. PMID:29088239

Bombyx mori Nucleopolyhedrovirus Encodes a DNA-Binding Protein Capable of Destabilizing Duplex DNA

PubMed Central

Mikhailov, Victor S.; Mikhailova, Alla L.; Iwanaga, Masashi; Gomi, Sumiko; Maeda, Susumu

1998-01-01

A DNA-binding protein (designated DBP) with an apparent molecular mass of 38 kDa was purified to homogeneity from BmN cells (derived from Bombyx mori) infected with the B. mori nucleopolyhedrovirus (BmNPV). Six peptides obtained after digestion of the isolated protein with Achromobacter protease I were partially or completely sequenced. The determined amino acid sequences indicated that DBP was encoded by an open reading frame (ORF16) located at nucleotides (nt) 16189 to 17139 in the BmNPV genome (GenBank accession no. L33180). This ORF (designated dbp) is a homolog of Autographa californica multicapsid NPV ORF25, whose product has not been identified. BmNPV DBP is predicted to contain 317 amino acids (calculated molecular mass of 36.7 kDa) and to have an isoelectric point of 7.8. DBP showed a tendency to multimerization in the course of purification and was found to bind preferentially to single-stranded DNA. When bound to oligonucleotides, DBP protected them from hydrolysis by phage T4 DNA polymerase-associated 3′→5′ exonuclease. The sizes of the protected fragments indicated that a binding site size for DBP is about 30 nt per protein monomer. DBP, but not BmNPV LEF-3, was capable of unwinding partial DNA duplexes in an in vitro system. This helix-destabilizing ability is consistent with the prediction that DBP functions as a single-stranded DNA binding protein in virus replication. PMID:9525636

Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

PubMed Central

Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

2015-01-01

The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

Role of conserved nucleotides in building the 16S rRNA binding site of E. coli ribosomal protein S8.

PubMed Central

Allmang, C; Mougel, M; Westhof, E; Ehresmann, B; Ehresmann, C

1994-01-01

Ribosomal protein S8 specifically recognizes a helical and irregular region of 16S rRNA that is highly evolutionary constrained. Despite its restricted size, the precise conformation of this region remains a question of debate. Here, we used chemical probing to analyze the structural consequences of mutations in this RNA region. These data, combined with computer modelling and previously published data on protein binding were used to investigate the conformation of the RNA binding site. The experimental data confirm the model in which adenines A595, A640 and A642 bulge out in the deep groove. In addition to the already proposed non canonical U598-U641 interaction, the structure is stabilized by stacking interactions (between A595 and A640) and an array of hydrogen bonds involving bases and the sugar phosphate backbone. Mutations that alter the ability to form these interdependent interactions result in a local destabilization or reorganization. The specificity of recognition by protein S8 is provided by the irregular and distorted backbone and the two bulged adenines 640 and 642 in the deep groove. The third adenine (A595) is not a direct recognition site but must adopt a bulged position. The U598-U641 pair should not be directly in contact with the protein. Images PMID:7937081

Unusually weak oxygen binding, physical properties, partial sequence, autoxidation rate and a potential phosphorylation site of beluga whale (Delphinapterus leucas) myoglobin.

PubMed

Stewart, J M; Blakely, J A; Karpowicz, P A; Kalanxhi, E; Thatcher, B J; Martin, B M

2004-03-01

We purified myoglobin from beluga whale (Delphinapterus leucas) muscle (longissimus dorsi) with size exclusion and cation exchange chromatographies. The molecular mass was determined by mass spectrometry (17,081 Da) and the isoelectric pH (9.4) by capillary isoelectric focusing. The near-complete amino acid sequence was determined and a phylogeny indicated that beluga was in the same clad as Dall's and harbor porpoises. There were consensus motifs for a phosphorylation site on the protein surface with the most likely site at serine-117. This motif was common to all cetacean myoglobins examined. Two oxygen-binding studies at 37 degrees C indicated dissociation constants (20.5 and 23.6 microM) 5.7-6.6 times larger than horse myoglobin (3.6 microM). The autoxidation rate of beluga myoglobin at 37 degrees C, pH 7.2 was 0.218+/-0.028 h(-1), 1/3 larger than reported for myoglobin of terrestrial mammals. There was no clear sequence change to explain the difference in oxygen binding or autoxidation although substitutions (N66 and T67) in an invariant rich sequence (HGNTV) distal to the heme may play a role. Structural models based on the protein sequence and constructed on topologies of known templates (horse and sperm whale crystal structures) were not adequate to assess perturbation of the heme pocket.

Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

Autoradiographic localization of endothelin-1 binding sites in porcine skin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Y.D.; Springall, D.R.; Wharton, J.

Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Kcnip1 a Ca²⁺-dependent transcriptional repressor regulates the size of the neural plate in Xenopus.

PubMed

Néant, Isabelle; Mellström, Britt; Gonzalez, Paz; Naranjo, Jose R; Moreau, Marc; Leclerc, Catherine

2015-09-01

In amphibian embryos, our previous work has demonstrated that calcium transients occurring in the dorsal ectoderm at the onset of gastrulation are necessary and sufficient to engage the ectodermal cells into a neural fate by inducing neural specific genes. Some of these genes are direct targets of calcium. Here we search for a direct transcriptional mechanism by which calcium signals are acting. The only known mechanism responsible for a direct action of calcium on gene transcription involves an EF-hand Ca²⁺ binding protein which belongs to a group of four proteins (Kcnip1 to 4). Kcnip protein can act in a Ca²⁺-dependent manner as a transcriptional repressor by binding to a specific DNA sequence, the Downstream Regulatory Element (DRE) site. In Xenopus, among the four kcnips, we show that only kcnip1 is timely and spatially present in the presumptive neural territories and is able to bind DRE sites in a Ca²⁺-dependent manner. The loss of function of kcnip1 results in the expansion of the neural plate through an increased proliferation of neural progenitors. Later on, this leads to an impairment in the development of anterior neural structures. We propose that, in the embryo, at the onset of neurogenesis Kcnip1 is the Ca²⁺-dependent transcriptional repressor that controls the size of the neural plate. This article is part of a Special Issue entitled: 13th European Symposium on Calcium. Copyright © 2014. Published by Elsevier B.V.

MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

2004-10-28

We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

PubMed

Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

2017-02-07

Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

1987-07-01

Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

Structural and functional analysis of the YAP-binding domain of human TEAD2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Wei; Yu, Jianzhong; Tomchick, Diana R.

2010-06-15

The Hippo pathway controls organ size and suppresses tumorigenesis in metazoans by blocking cell proliferation and promoting apoptosis. The TEAD1-4 proteins (which contain a DNA-binding domain but lack an activation domain) interact with YAP (which lacks a DNA-binding domain but contains an activation domain) to form functional heterodimeric transcription factors that activate proliferative and prosurvival gene expression programs. The Hippo pathway inhibits the YAP-TEAD hybrid transcription factors by phosphorylating and promoting cytoplasmic retention of YAP. Here we report the crystal structure of the YAP-binding domain (YBD) of human TEAD2. TEAD2 YBD adopts an immunoglobulin-like {beta}-sandwich fold with two extra helix-turn-helixmore » inserts. NMR studies reveal that the TEAD-binding domain of YAP is natively unfolded and that TEAD binding causes localized conformational changes in YAP. In vitro binding and in vivo functional assays define an extensive conserved surface of TEAD2 YBD as the YAP-binding site. Therefore, our studies suggest that a short segment of YAP adopts an extended conformation and forms extensive contacts with a rigid surface of TEAD. Targeting a surface-exposed pocket of TEAD might be an effective strategy to disrupt the YAP-TEAD interaction and to reduce the oncogenic potential of YAP.« less

Binding of perlecan to transthyretin in vitro.

PubMed Central

Smeland, S; Kolset, S O; Lyon, M; Norum, K R; Blomhoff, R

1997-01-01

Transthyretin is one of two specific proteins involved in the transport of thyroid hormones in plasma; it possesses two binding sites for serum retinol-binding protein. In the present study we demonstrate that transthyretin also interacts in vitro with [35S]sulphate-labelled material from the medium of HepG2 cells. By using the same strategy as for purifying serum retinol-binding protein, [35S]sulphate-labelled medium was specifically eluted from a transthyretin-affinity column. Ion-exchange chromatography showed that the material was highly polyanionic, and its size and alkali susceptibility suggested that it was a proteoglycan. Structural analyses with chondroitinase ABC lyase and nitrous acid revealed that approx. 20% was chondroitin sulphate and 80% heparan sulphate. Immunoprecipitation showed that the [35S]sulphate-labelled material contained perlecan. Further analysis by binding studies revealed specific and saturable binding of 125I-transthyretin to perlecan-enriched Matrigel. Because inhibition of sulphation by treating HepG2 cells with sodium chlorate increased the affinity of the perlecan for transthyretin, and [3H]heparin was not retained by the transthyretin affinity column, the binding is probably mediated by the core protein and is not a protein-glycosaminoglycan interaction. Because perlecan is released from transthyretin in water, the binding might be due to hydrophobic interactions. PMID:9307034

Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

PubMed

Jiang, Peng; Singh, Mona; Coller, Hilary A

2013-01-01

Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

Fully Flexible Docking of Medium Sized Ligand Libraries with RosettaLigand

PubMed Central

DeLuca, Samuel; Khar, Karen; Meiler, Jens

2015-01-01

RosettaLigand has been successfully used to predict binding poses in protein-small molecule complexes. However, the RosettaLigand docking protocol is comparatively slow in identifying an initial starting pose for the small molecule (ligand) making it unfeasible for use in virtual High Throughput Screening (vHTS). To overcome this limitation, we developed a new sampling approach for placing the ligand in the protein binding site during the initial ‘low-resolution’ docking step. It combines the translational and rotational adjustments to the ligand pose in a single transformation step. The new algorithm is both more accurate and more time-efficient. The docking success rate is improved by 10–15% in a benchmark set of 43 protein/ligand complexes, reducing the number of models that typically need to be generated from 1000 to 150. The average time to generate a model is reduced from 50 seconds to 10 seconds. As a result we observe an effective 30-fold speed increase, making RosettaLigand appropriate for docking medium sized ligand libraries. We demonstrate that this improved initial placement of the ligand is critical for successful prediction of an accurate binding position in the ‘high-resolution’ full atom refinement step. PMID:26207742

A micro-reactor for preparing uniform molecularly imprinted polymer beads.

PubMed

Zourob, Mohammed; Mohr, Stephan; Mayes, Andrew G; Macaskill, Alexandra; Pérez-Moral, Natalia; Fielden, Peter R; Goddard, Nicholas J

2006-02-01

In this study, uniform spherical molecularly imprinted polymer beads were prepared via controlled suspension polymerization in a spiral-shaped microchannel using mineral oil and perfluorocarbon liquid as continuous phases. Monodisperse droplets containing the monomers, template, initiator, and porogenic solvent were introduced into the microchannel, and particles of uniform size were produced by subsequent UV polymerization, quickly and without wasting polymer materials. The droplet/particle size was varied by changing the flow conditions in the microfluidic device. The diameter of the resulting products typically had a coefficient of variation (CV) below 2%. The specific binding sites that were created during the imprinting process were analysed via radioligand binding analysis. The molecularly imprinted microspheres produced in the liquid perfluorocarbon continuous phase had a higher binding capacity compared with the particles produced in the mineral oil continuous phase, though it should be noted that the aim of this study was not to optimize or maximize imprinting performance, but rather to demonstrate broad applicability and compatibility with known MIP production methods. The successful imprinting against a model compound using two very different continuous phases (one requiring a surfactant to stabilize the droplets the other not) demonstrates the generality of this current simple approach.

Like-charged protein-polyelectrolyte complexation driven by charge patches

NASA Astrophysics Data System (ADS)

Yigit, Cemil; Heyda, Jan; Ballauff, Matthias; Dzubiella, Joachim

2015-08-01

We study the pair complexation of a single, highly charged polyelectrolyte (PE) chain (of 25 or 50 monomers) with like-charged patchy protein models (CPPMs) by means of implicit-solvent, explicit-salt Langevin dynamics computer simulations. Our previously introduced set of CPPMs embraces well-defined zero-, one-, and two-patched spherical globules each of the same net charge and (nanometer) size with mono- and multipole moments comparable to those of globular proteins with similar size. We observe large binding affinities between the CPPM and the like-charged PE in the tens of the thermal energy, kBT, that are favored by decreasing salt concentration and increasing charge of the patch(es). Our systematic analysis shows a clear correlation between the distance-resolved potentials of mean force, the number of ions released from the PE, and CPPM orientation effects. In particular, we find a novel two-site binding behavior for PEs in the case of two-patched CPPMs, where intermediate metastable complex structures are formed. In order to describe the salt-dependence of the binding affinity for mainly dipolar (one-patched) CPPMs, we introduce a combined counterion-release/Debye-Hückel model that quantitatively captures the essential physics of electrostatic complexation in our systems.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zeno, Wade F.; Johnson, Kaitlin E.; Sasaki, Darryl Y.

We use fluorescence microscopy to examine the dynamics of the crowding-induced mixing transition of liquid ordered (L o)–liquid disordered (L d) phase separated lipid bilayers when the following particles of increasing size bind to either the L o or L d phase: Ubiquitin, green fluorescent protein (GFP), and nanolipoprotein particles (NLPs) of two diameters. These proteinaceous particles contained histidine-tags, which were phase targeted by binding to iminodiacetic acid (IDA) head groups, via a Cu 2+ chelating mechanism, of lipids that specifically partition into either the Lo phase or Ld phase. The degree of steric pressure was controlled by varying themore » size of the bound particle (10–240 kDa) and the amount of binding sites present (i.e., DPIDA concentrations of 9 and 12 mol%) in the supported lipid multibilayer platform used here. We develop a mass transfer-based diffusional model to analyze the observed L o phase domain dissolution that, along with visual observations and activation energy calculations, provides insight into the sequence of events in crowding-induced mixing. Furthermore, our results suggest that the degree of steric pressure and target phase influence not only the efficacy of steric-pressure induced mixing, but the rate and controlling mechanism for which it occurs.« less

NtKRP, a kinesin-12 protein, regulates embryo/seed size and seed germination via involving in cell cycle progression at the G2/M transition.

PubMed

Tian, Shujuan; Wu, Jingjing; Li, Fen; Zou, Jianwei; Liu, Yuwen; Zhou, Bing; Bai, Yang; Sun, Meng-Xiang

2016-10-25

Kinesins comprise a superfamily of microtubule-based motor proteins involved in essential processes in plant development, but few kinesins have been functionally identified during seed development. Especially, few kinesins that regulate cell division during embryogenesis have been identified. Here we report the functional characterization of NtKRP, a motor protein of the kinesin-12 family. NtKRP is predominantly expressed in embryos and embryonic roots. NtKRP RNAi lines displayed reductions in cell numbers in the meristematic zone, in embryonic root length, and in mature embryo and seed sizes. Furthermore, we also show that CDKA;1 binds to NtKRP at the consensus phosphorylation sites and that the decreased cell numbers in NtKRP-silenced embryos are due to a delay in cell division cycle at the G2/M transition. In addition, binding between the cargo-binding tail domain of NtKRP and CDKA; 1 was also determined. Our results reveal a novel molecular pathway that regulates embryo/seed development and critical role of kinesin in temporal and spatial regulation of a specific issue of embryo developmental.

Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

PubMed

Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

2013-03-19

Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

PubMed Central

Tam, S W; Cook, L

1984-01-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

Type III restriction endonucleases are heterotrimeric: comprising one helicase–nuclease subunit and a dimeric methyltransferase that binds only one specific DNA

PubMed Central

Butterer, Annika; Pernstich, Christian; Smith, Rachel M.; Sobott, Frank; Szczelkun, Mark D.; Tóth, Júlia

2014-01-01

Fundamental aspects of the biochemistry of Type III restriction endonucleases remain unresolved despite being characterized by numerous research groups in the past decades. One such feature is the subunit stoichiometry of these hetero-oligomeric enzyme complexes, which has important implications for the reaction mechanism. In this study, we present a series of results obtained by native mass spectrometry and size exclusion chromatography with multi-angle light scattering consistent with a 1:2 ratio of Res to Mod subunits in the EcoP15I, EcoPI and PstII complexes as the main holoenzyme species and a 1:1 stoichiometry of specific DNA (sDNA) binding by EcoP15I and EcoPI. Our data are also consistent with a model where ATP hydrolysis activated by recognition site binding leads to release of the enzyme from the site, dissociation from the substrate via a free DNA end and cleavage of the DNA. These results are discussed critically in the light of the published literature, aiming to resolve controversies and discuss consequences in terms of the reaction mechanism. PMID:24510100

Linking CO 2 Sorption Performance to Polymer Morphology in Aminopolymer/Silica Composites through Neutron Scattering

DOE PAGES

Holewinski, Adam; Sakwa-Novak, Miles A.; Jones, Christopher W.

2015-08-26

Composites of poly(ethylenimine) (PEI) and mesoporous silica are effective, reversible adsorbents for CO 2, both from flue gas and in direct air-capture applications. The morphology of the PEI within the silica can strongly impact the overall carbon capture efficiency and rate of saturation. Here, we directly probe the spatial distribution of the supported polymer through small-angle neutron scattering (SANS). Combined with textural characterization from physisorption analysis, the data indicate that PEI first forms a thin conformal coating on the pore walls, but all additional polymer aggregates into plug(s) that grow along the pore axis. This model is consistent with observedmore » trends in amine-efficiency (CO 2/N binding ratio) and pore size distributions, and points to a trade-off between achieving high chemical accessibility of the amine binding sites, which are inaccessible when they strongly interact with the silica, and high accessibility for mass transport, which can be hampered by diffusion through PEI plugs. In conclusion, we illustrate this design principle by demonstrating higher CO 2 capacity and uptake rate for PEI supported in a hydrophobically modified silica, which exhibits repulsive interactions with the PEI, freeing up binding sites.« less

Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

PubMed

Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

2007-05-01

The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Location of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

Locations of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

Discovering amino acid patterns on binding sites in protein complexes

PubMed Central

Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

2011-01-01

Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Structures of Adnectin/Protein Complexes Reveal an Expanded Binding Footprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramamurthy, Vidhyashankar; Krystek, Jr., Stanley R.; Bush, Alexander

2014-10-02

Adnectins are targeted biologics derived from the tenth type III domain of human fibronectin ({sup 10}Fn3), a member of the immunoglobulin superfamily. Target-specific binders are selected from libraries generated by diversifying the three {sup 10}Fn3 loops that are analogous to the complementarity determining regions of antibodies. The crystal structures of two Adnectins were determined, each in complex with its therapeutic target, EGFR or IL-23. Both Adnectins bind different epitopes than those bound by known monoclonal antibodies. Molecular modeling suggests that some of these epitopes might not be accessible to antibodies because of the size and concave shape of the antibodymore » combining site. In addition to interactions from the Adnectin diversified loops, residues from the N terminus and/or the {beta} strands interact with the target proteins in both complexes. Alanine-scanning mutagenesis confirmed the calculated binding energies of these {beta} strand interactions, indicating that these nonloop residues can expand the available binding footprint.« less

Identification of a New Zinc Binding Chemotype by Fragment Screening.

PubMed

Chrysanthopoulos, Panagiotis K; Mujumdar, Prashant; Woods, Lucy A; Dolezal, Olan; Ren, Bin; Peat, Thomas S; Poulsen, Sally-Ann

2017-09-14

The discovery of a new zinc binding chemotype from screening a nonbiased fragment library is reported. Using the orthogonal fragment screening methods of native state mass spectrometry and surface plasmon resonance a 3-unsubstituted 2,4-oxazolidinedione fragment was found to have low micromolar binding affinity to the zinc metalloenzyme carbonic anhydrase II (CA II). This affinity approached that of fragment sized primary benzenesulfonamides, the classical zinc binding group found in most CA II inhibitors. Protein X-ray crystallography established that 3-unsubstituted 2,4-oxazolidinediones bound to CA II via an interaction of the acidic ring nitrogen with the CA II active site zinc, as well as two hydrogen bonds between the oxazolidinedione ring oxygen and the CA II protein backbone. Furthermore, 3-unsubstituted 2,4-oxazolidinediones appear to be a viable starting point for the development of an alternative class of CA inhibitor, wherein the medicinal chemistry pedigree of primary sulfonamides has dominated for several decades.

Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

PubMed

Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

2013-01-01

Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

PubMed Central

Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

2011-01-01

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

PubMed Central

Dubois, B W; Cherian, S F; Evers, A S

1993-01-01

There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biegon, A.; Rainbow, T.C.

1983-05-01

The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

PubMed Central

Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

2017-01-01

The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

NASA Astrophysics Data System (ADS)

Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

2017-01-01

Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

PubMed Central

Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

2008-01-01

The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

Calcium binding to an elastic portion of connectin/titin filaments.

PubMed

Tatsumi, R; Maeda, K; Hattori, A; Takahashi, K

2001-01-01

Alpha-connectin/titin-1 exists as an elastic filament that links a thick filament with the Z-disk, keeping thick filaments centered within the sarcomere during force generation. We have shown that the connectin filament has an affinity for calcium ions and its binding site(s) is restricted to the beta-connectin/titin-2 portion. We now report the localization and the characterization of calcium-binding sites on beta-connectin. Purified beta-connectin was digested by trypsin into 1700- and 400-kDa fragments. which were then subjected to fluorescence calcium-binding assays. The 400-kDa fragment possesses calcium-binding activity; the binding constant was 1.0 x 10(7) M(-1) and the molar ratio of bound calcium ions to the 400-kDa fragment reached a maximum of 12 at a free calcium ion concentration of approximately 1.0 microM. Antibodies against the 400-kDa fragment formed a sharp dense stripe at the boundary of the A and the I bands, indicating that the calcium-binding domain constitutes the N-terminal region of beta-connectin, that is, the elastic portion of connectin filaments. Furthermore, we estimated the N-terminal location of beta-connectin of various origins (n = 26). Myofibrils were treated with a solution containing 0.1 mM CaCl2 and 70 microM leupeptin to split connectin filaments into beta-connectin and a subfragment, and chain weights of these polypeptides were estimated according to their mobility in 2% polyacrylamide slab gels. The subfragment exhibited a similar chain weight of 1200+/-33 kDa (mean+/-SD), while alpha- and beta-connectins were variable in size according to their origin. These results suggest that the apparent length of the 1200-kDa subfragment portion is almost constant in all instances, about 0.34 microm at the slack condition, therefore that the C-terminus of the 1200-kDa subfragment, that is, the N-terminus of the calcium-binding domain, is at the N2 line region of parent filaments in situ. Because the secondary structure of the 400-kDa fragment was changed by the binding of calcium ions, connectin filaments could be expected to alter their elasticity during the contraction-relaxation cycle of skeletal muscle.

Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palacios, J.M.; Chinaglia, G.; Rigo, M.

1991-02-01

Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

PubMed

Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

2014-01-01

We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

PubMed Central

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

PubMed

Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

1996-10-11

In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

Binding Leverage as a Molecular Basis for Allosteric Regulation

PubMed Central

Mitternacht, Simon; Berezovsky, Igor N.

2011-01-01

Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Independent signaling by Drosophila insulin receptor for axon guidance and growth.

PubMed

Li, Caroline R; Guo, Dongyu; Pick, Leslie

2013-01-01

The Drosophila insulin receptor (DInR) regulates a diverse array of biological processes including growth, axon guidance, and sugar homeostasis. Growth regulation by DInR is mediated by Chico, the Drosophila homolog of vertebrate insulin receptor substrate proteins IRS1-4. In contrast, DInR regulation of photoreceptor axon guidance in the developing visual system is mediated by the SH2-SH3 domain adaptor protein Dreadlocks (Dock). In vitro studies by others identified five NPXY motifs, one in the juxtamembrane region and four in the signaling C-terminal tail (C-tail), important for interaction with Chico. Here we used yeast two-hybrid assays to identify regions in the DInR C-tail that interact with Dock. These Dock binding sites were in separate portions of the C-tail from the previously identified Chico binding sites. To test whether these sites are required for growth or axon guidance in whole animals, a panel of DInR proteins, in which the putative Chico and Dock interaction sites had been mutated individually or in combination, were tested for their ability to rescue viability, growth and axon guidance defects of dinr mutant flies. Sites required for viability were identified. Unexpectedly, mutation of both putative Dock binding sites, either individually or in combination, did not lead to defects in photoreceptor axon guidance. Thus, either sites also required for viability are necessary for DInR function in axon guidance and/or there is redundancy built into the DInR/Dock interaction such that Dock is able to interact with multiple regions of DInR. We also found that simultaneous mutation of all five NPXY motifs implicated in Chico interaction drastically decreased growth in both male and female adult flies. These animals resembled chico mutants, supporting the notion that DInR interacts directly with Chico in vivo to control body size. Mutation of these five NPXY motifs did not affect photoreceptor axon guidance, segregating the roles of DInR in the processes of growth and axon guidance.

Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

PubMed Central

2011-01-01

Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

Aqueous alkali halide solutions: can osmotic coefficients be explained on the basis of the ionic sizes alone?

PubMed

Kalyuzhnyi, Yu V; Vlachy, Vojko; Dill, Ken A

2010-06-21

We use the AMSA, associative mean spherical theory of associative fluids, to study ion-ion interactions in explicit water. We model water molecules as hard spheres with four off-center square-well sites and ions as charged hard spheres with sticky sites that bind to water molecules or other ions. We consider alkali halide salts. The choice of model parameters is based on two premises: (i) The strength of the interaction between a monovalent ion and a water molecule is inversely proportional to the ionic (crystal) diameter sigma(i). Smaller ions bind to water more strongly than larger ions do, taking into account the asymmetry of the cation-water and anion-water interactions. (ii) The number of contacts an ion can make is proportional to sigma2(i). In short, small ions bind waters strongly, but only a few of them. Large ions bind waters weakly, but many of them. When both a monovalent cation and anion are large, it yields a small osmotic coefficient of the salt, since the water molecules avoid the space in between large ions. On the other hand, salts formed from one small and one large ion remain hydrated and their osmotic coefficient is high. The osmotic coefficients, calculated using this model in combination with the integral equation theory developed for associative fluids, follow the experimental trends, including the unusual behavior of caesium salts.

Mechanistic Insights into Xenon Inhibition of NMDA Receptors from MD Simulations

PubMed Central

Liu, Lu Tian; Xu, Yan; Tang, Pei

2010-01-01

Inhibition of N-methyl-D-aspartate (NMDA) receptors has been viewed as a primary cause of xenon anesthesia, yet the mechanism is unclear. Here, we investigated interactions between xenon and the ligand-binding domain (LBD) of a NMDA receptor and examined xenon-induced structural and dynamical changes that are relevant to functional changes of the NMDA receptor. Several comparative molecular dynamics simulations were performed on two X-ray structures representing the open- and closed-cleft LBD of the NMDA receptor. We identified plausible xenon action sites in the LBD, including those nearby agonist sites, in the hinge region, and at the interface between two subunits. The xenon binding energy varies from −5.3 to −0.7 kcal/mol. Xenon's effect on the NMDA receptor is conformation-dependent and is produced through both competitive and non-competitive mechanisms. Xenon can promote cleft opening in the absence of agonists and consequently stabilizes the closed channel. Xenon can also bind at the interface of two subunits, alter the inter-subunit interaction, and lead to a reduction of the distance between GT-links. This reduction corresponds to a rearrangement of the channel toward a direction of pore size decreasing, implying a closed or desensitized channel. In addition to these non-competitive actions, xenon was found to weaken the glutamate binding, which could lead to low agonist efficacy and appear as competitive inhibition. PMID:20560662

Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

PubMed

Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

2016-11-01

Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

NASA Astrophysics Data System (ADS)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

An active-site phenylalanine directs substrate binding and C-H cleavage in the alpha-ketoglutarate-dependent dioxygenase TauD.

PubMed

McCusker, Kevin P; Klinman, Judith P

2010-04-14

Enzymes that cleave C-H bonds are often found to depend on well-packed hydrophobic cores that influence the distance between the hydrogen donor and acceptor. Residue F159 in taurine alpha-ketoglutarate dioxygenase (TauD) is demonstrated to play an important role in the binding and orientation of its substrate, which undergoes a hydrogen atom transfer to the active site Fe(IV)=O. Mutation of F159 to smaller hydrophobic side chains (L, V, A) leads to substantially reduced rates for substrate binding and for C-H bond cleavage, as well as increased contribution of the chemical step to k(cat) under steady-state turnover conditions. The greater sensitivity of these substrate-dependent processes to mutation at position 159 than observed for the oxygen activation process supports a previous conclusion of modularity of function within the active site of TauD (McCusker, K. P.; Klinman, J. P. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 19791-19795). Extraction of intrinsic deuterium kinetic isotope effects (KIEs) using single turnover transients shows 2- to 4-fold increase in the size of the KIE for F159V in relation to wild-type and F159L. It appears that there is a break in behavior following removal of a single methylene from the side chain of F159L to generate F159V, whereby the protein active site loses its ability to restore the internuclear distance between substrate and Fe(IV)=O that supports optimal hydrogenic wave function overlap.

Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zoghbi, M. E.; Altenberg, G. A.

The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

PubMed

Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

1986-08-15

The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

PubMed

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

2017-10-01

While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

RBind: computational network method to predict RNA binding sites.

PubMed

Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

2018-04-26

Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

PubMed

Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

2017-04-01

BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

A novel substance P binding site in bovine adrenal medulla.

PubMed

Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

1990-05-04

Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tam, S.W.; Cook, L.

1984-09-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

Probing the recognition surface of a DNA triplex: binding studies with intercalator-neomycin conjugates.

PubMed

Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skriba, Michael; Arya, Dev P

2010-07-06

Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA).2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalene diimide-neomycin (3) and anthraquinone-neomycin (4) conjugates were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2) conjugates, in our investigations. A combination of experiments, including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC), revealed that all four conjugates (1-4) stabilized poly(dA).2poly(dT) much more than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (T(m3-->2)) at which poly(dA).2poly(dT) dissociated into poly(dA).poly(dT) and poly(dT) increased dramatically (>12 degrees C) in the presence of intercalator-neomycin conjugates (1-4) even at a very low concentration (2 muM). In contrast to intercalator-neomycin conjugates, the increment of T(m3-->2) of poly(dA).2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin conjugates (1-4) to poly(dA).2poly(dT) was also confirmed by competition dialysis and a fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compounds 1-4 had slightly larger binding site size ( approximately 7-7.5) with poly(dA).2poly(dT) as compared to neomycin ( approximately 6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA).2poly(dT) were derived from an integrated van't Hoff equation using the T(m3-->2) values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA).2poly(dT) increased in the following order: neomycin < 1 < 3 < 4 < 2. Among them, the binding constant [(2.7 +/- 0.3) x 10(8) M(-1)] of 2 with poly(dA).2poly(dT) was the highest, almost 1000-fold greater than that of neomycin. The binding of compounds 1-4 with poly(dA).2poly(dT) was mostly enthalpy-driven and gave negative DeltaC(p) values. The results described here suggest that the binding affinity of intercalator-neomycin conjugates for poly(dA).2poly(dT) increases as a function of the surface area of the intercalator moiety.

Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

PubMed

Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

1996-01-04

In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

Accurate and sensitive quantification of protein-DNA binding affinity.

PubMed

Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

2018-04-17

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

Accurate and sensitive quantification of protein-DNA binding affinity

PubMed Central

Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

2018-01-01

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

PubMed Central

Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

2012-01-01

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

Structural basis underlying CAC RNA recognition by the RRM domain of dimeric RNA-binding protein RBPMS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Teplova, Marianna; Farazi, Thalia A.; Tuschl, Thomas

Abstract RNA-binding protein with multiple splicing (designated RBPMS) is a higher vertebrate mRNA-binding protein containing a single RNA recognition motif (RRM). RBPMS has been shown to be involved in mRNA transport, localization and stability, with key roles in axon guidance, smooth muscle plasticity, as well as regulation of cancer cell proliferation and migration. We report on structure-function studies of the RRM domain of RBPMS bound to a CAC-containing single-stranded RNA. These results provide insights into potential topologies of complexes formed by the RBPMS RRM domain and the tandem CAC repeat binding sites as detected by photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation. Thesemore » studies establish that the RRM domain of RBPMS forms a symmetrical dimer in the free state, with each monomer binding sequence-specifically to all three nucleotides of a CAC segment in the RNA bound state. Structure-guided mutations within the dimerization and RNA-binding interfaces of RBPMS RRM on RNA complex formation resulted in both disruption of dimerization and a decrease in RNA-binding affinity as observed by size exclusion chromatography and isothermal titration calorimetry. As anticipated from biochemical binding studies, over-expression of dimerization or RNA-binding mutants of Flag-HA-tagged RBPMS were no longer able to track with stress granules in HEK293 cells, thereby documenting the deleterious effects of such mutationsin vivo.« less

Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

PubMed

Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

2014-06-02

The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

PubMed Central

Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

2014-01-01

Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ford, K.A.; LaBarbera, A.R.

1988-11-01

The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

A genome-wide association study identifies multiple loci for variation in human ear morphology.

PubMed

Adhikari, Kaustubh; Reales, Guillermo; Smith, Andrew J P; Konka, Esra; Palmen, Jutta; Quinto-Sanchez, Mirsha; Acuña-Alonzo, Victor; Jaramillo, Claudia; Arias, William; Fuentes, Macarena; Pizarro, María; Barquera Lozano, Rodrigo; Macín Pérez, Gastón; Gómez-Valdés, Jorge; Villamil-Ramírez, Hugo; Hunemeier, Tábita; Ramallo, Virginia; Silva de Cerqueira, Caio C; Hurtado, Malena; Villegas, Valeria; Granja, Vanessa; Gallo, Carla; Poletti, Giovanni; Schuler-Faccini, Lavinia; Salzano, Francisco M; Bortolini, Maria-Cátira; Canizales-Quinteros, Samuel; Rothhammer, Francisco; Bedoya, Gabriel; Calderón, Rosario; Rosique, Javier; Cheeseman, Michael; Bhutta, Mahmood F; Humphries, Steve E; Gonzalez-José, Rolando; Headon, Denis; Balding, David; Ruiz-Linares, Andrés

2015-06-24

Here we report a genome-wide association study for non-pathological pinna morphology in over 5,000 Latin Americans. We find genome-wide significant association at seven genomic regions affecting: lobe size and attachment, folding of antihelix, helix rolling, ear protrusion and antitragus size (linear regression P values 2 × 10(-8) to 3 × 10(-14)). Four traits are associated with a functional variant in the Ectodysplasin A receptor (EDAR) gene, a key regulator of embryonic skin appendage development. We confirm expression of Edar in the developing mouse ear and that Edar-deficient mice have an abnormally shaped pinna. Two traits are associated with SNPs in a region overlapping the T-Box Protein 15 (TBX15) gene, a major determinant of mouse skeletal development. Strongest association in this region is observed for SNP rs17023457 located in an evolutionarily conserved binding site for the transcription factor Cartilage paired-class homeoprotein 1 (CART1), and we confirm that rs17023457 alters in vitro binding of CART1.

Whispering gallery mode resonators for rapid label-free biosensing in small volume droplets.

PubMed

Wildgen, Sarah M; Dunn, Robert C

2015-03-23

Rapid biosensing requires fast mass transport of the analyte to the surface of the sensing element. To optimize analysis times, both mass transport in solution and the geometry and size of the sensing element need to be considered. Small dielectric spheres, tens of microns in diameter, can act as label-free biosensors using whispering gallery mode (WGM) resonances. WGM resonances are sensitive to the effective refractive index, which changes upon analyte binding to recognition sites on functionalized resonators. The spherical geometry and tens of microns diameter of these resonators provides an efficient target for sensing while their compact size enables detection in limited volumes. Here, we explore conditions leading to rapid analyte detection using WGM resonators as label-free sensors in 10 μL sample droplets. Droplet evaporation leads to potentially useful convective mixing, but also limits the time over which analysis can be completed. We show that active droplet mixing combined with initial binding rate measurements is required for accurate nanomolar protein quantification within the first minute following injection.

Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

PubMed Central

Warfield, Becka M.

2017-01-01

RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

Biofunctional polymer nanoparticles for intra-articular targeting and retention in cartilage

NASA Astrophysics Data System (ADS)

Rothenfluh, Dominique A.; Bermudez, Harry; O'Neil, Conlin P.; Hubbell, Jeffrey A.

2008-03-01

The extracellular matrix of dense, avascular tissues presents a barrier to entry for polymer-based therapeutics, such as drugs encapsulated within polymeric particles. Here, we present an approach by which polymer nanoparticles, sufficiently small to enter the matrix of the targeted tissue, here articular cartilage, are further modified with a biomolecular ligand for matrix binding. This combination of ultrasmall size and biomolecular binding converts the matrix from a barrier into a reservoir, resisting rapid release of the nanoparticles and clearance from the tissue site. Phage display of a peptide library was used to discover appropriate targeting ligands by biopanning on denuded cartilage. The ligand WYRGRL was selected in 94 of 96 clones sequenced after five rounds of biopanning and was demonstrated to bind to collagen II α1. Peptide-functionalized nanoparticles targeted articular cartilage up to 72-fold more than nanoparticles displaying a scrambled peptide sequence following intra-articular injection in the mouse.

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

PubMed Central

Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

2013-01-01

Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

Calcium-activated butyrylcholinesterase in human skin protects acetylcholinesterase against suicide inhibition by neurotoxic organophosphates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schallreuter, Karin U.; Institute for Pigmentary Disorders in Association with EM Arndt University of Greifswald; University of Bradford

The human epidermis holds an autocrine acetylcholine production and degradation including functioning membrane integrated and cytosolic butyrylcholinesterase (BuchE). Here we show that BuchE activities increase 9-fold in the presence of calcium (0.5 x 10{sup -3}M) via a specific EF-hand calcium binding site, whereas acetylcholinesterase (AchE) is not affected. {sup 45}Calcium labelling and computer simulation confirmed the presence of one EF-hand binding site per subunit which is disrupted by H{sub 2}O{sub 2}-mediated oxidation. Moreover, we confirmed the faster hydrolysis by calcium-activated BuchE using the neurotoxic organophosphate O-ethyl-O-(4-nitrophenyl)-phenylphosphonothioate (EPN). Considering the large size of the human skin with 1.8 m{sup 2} surfacemore » area with its calcium gradient in the 10{sup -3}M range, our results implicate calcium-activated BuchE as a major protective mechanism against suicide inhibition of AchE by organophosphates in this non-neuronal tissue.« less

BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

PubMed

Wei, Qing; La, David; Kihara, Daisuke

2017-01-01

Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

NASA Astrophysics Data System (ADS)

Poornima, C. S.; Dean, P. M.

1995-12-01

Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sultatos, L.G.; Kaushik, R.

2008-08-01

The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

PubMed

Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

2017-01-01

Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyd, S.K.

1987-01-01

Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Zeller, L; Lightstone, F C

2002-01-01

The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

PubMed Central

Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

1993-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

Influence of sulfhydryl sites on metal binding by bacteria

NASA Astrophysics Data System (ADS)

Nell, Ryan M.; Fein, Jeremy B.

2017-02-01

The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

Extending rule-based methods to model molecular geometry and 3D model resolution.

PubMed

Hoard, Brittany; Jacobson, Bruna; Manavi, Kasra; Tapia, Lydia

2016-08-01

Computational modeling is an important tool for the study of complex biochemical processes associated with cell signaling networks. However, it is challenging to simulate processes that involve hundreds of large molecules due to the high computational cost of such simulations. Rule-based modeling is a method that can be used to simulate these processes with reasonably low computational cost, but traditional rule-based modeling approaches do not include details of molecular geometry. The incorporation of geometry into biochemical models can more accurately capture details of these processes, and may lead to insights into how geometry affects the products that form. Furthermore, geometric rule-based modeling can be used to complement other computational methods that explicitly represent molecular geometry in order to quantify binding site accessibility and steric effects. We propose a novel implementation of rule-based modeling that encodes details of molecular geometry into the rules and binding rates. We demonstrate how rules are constructed according to the molecular curvature. We then perform a study of antigen-antibody aggregation using our proposed method. We simulate the binding of antibody complexes to binding regions of the shrimp allergen Pen a 1 using a previously developed 3D rigid-body Monte Carlo simulation, and we analyze the aggregate sizes. Then, using our novel approach, we optimize a rule-based model according to the geometry of the Pen a 1 molecule and the data from the Monte Carlo simulation. We use the distances between the binding regions of Pen a 1 to optimize the rules and binding rates. We perform this procedure for multiple conformations of Pen a 1 and analyze the impact of conformation and resolution on the optimal rule-based model. We find that the optimized rule-based models provide information about the average steric hindrance between binding regions and the probability that antibodies will bind to these regions. These optimized models quantify the variation in aggregate size that results from differences in molecular geometry and from model resolution.

Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

PubMed Central

Liaw, S. H.; Kuo, I.; Eisenberg, D.

1995-01-01

Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen P.

2006-10-17

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen

2000-01-01

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

Acceleration of Binding Site Comparisons by Graph Partitioning.

PubMed

Krotzky, Timo; Klebe, Gerhard

2015-08-01

The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

GenProBiS: web server for mapping of sequence variants to protein binding sites.

PubMed

Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

2017-07-03

Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Using XAS and SXRF to Study Copper in Wilson Disease at the Molecular and Tissue Level

NASA Astrophysics Data System (ADS)

Ralle, Martina; Blackburn, Ninian J.; Lutsenko, Svetlana

2007-02-01

Wilson disease (WD) is a genetic disorder of copper metabolism associated with severe hepatic, neurological, and psychiatric abnormalities. In WD, the billiary copper excretion is impaired and copper accumulates in tissues, particularly in the liver and the brain. The affected gene, ATP7B, encodes the copper transporting ATPase, Wilson disease protein (WNDP). WNDP has six copper binding sites in the N-terminal portion of the molecule. Each site includes the conserved amino acid sequence MXCXXC, and binds 1 Cu(I) through its 2 cysteine residues. We performed X-ray absorption studies at the Cu Kα-edge on the recombinant N-terminal domain of WNDP (N-WNDP). Copper was bound to N-WNDP either in vivo or in vitro in the presence of different reducing agents. We found that in N-WNDP copper is predominantly coordinated in a linear fashion by two cysteines, with the appearance of a Cu-Cu interaction when all metal binding sites are filled. Increasing amounts of reducing agents containing sulfide or phosphine groups led to binding of the exogenous ligands to copper thereby increasing the coordination number of copper from two to three. To better understand the role of copper in WD, we utilized livers of the 6-weeks-old Atp7b-/- mice (an animal model for WD) in which the copper concentration was 10-20-fold higher compared to that of the control mice. The distribution of copper in hepatocytes was evaluated by synchrotron based X-ray fluorescence microprobe (SXRF). We demonstrate that we can prepare liver slices that retain copper and can detect copper with subcellular resolution. On the same sections μ-XANES (spot size: 5 micron) was used to determine the oxidation state of copper.

Stability and function of interdomain linker variants of glucoamylase 1 from Aspergillus niger.

PubMed

Sauer, J; Christensen, T; Frandsen, T P; Mirgorodskaya, E; McGuire, K A; Driguez, H; Roepstorff, P; Sigurskjold, B W; Svensson, B

2001-08-07

Several variants of glucoamylase 1 (GA1) from Aspergillus niger were created in which the highly O-glycosylated peptide (aa 468--508) connecting the (alpha/alpha)(6)-barrel catalytic domain and the starch binding domain was substituted at the gene level by equivalent segments of glucoamylases from Hormoconis resinae, Humicola grisea, and Rhizopus oryzae encoding 5, 19, and 36 amino acid residues. Variants were constructed in which the H. resinae linker was elongated by proline-rich sequences as this linker itself apparently was too short to allow formation of the corresponding protein variant. Size and isoelectric point of GA1 variants reflected differences in linker length, posttranslational modification, and net charge. While calculated polypeptide chain molecular masses for wild-type GA1, a nonnatural proline-rich linker variant, H. grisea, and R. oryzae linker variants were 65,784, 63,777, 63,912, and 65,614 Da, respectively, MALDI-TOF-MS gave values of 82,042, 73,800, 73,413, and 90,793 Da, respectively, where the latter value could partly be explained by an N-glycosylation site introduced near the linker C-terminus. The k(cat) and K(m) for hydrolysis of maltooligodextrins and soluble starch, and the rate of hydrolysis of barley starch granules were essentially the same for the variants as for wild-type GA1. beta-Cyclodextrin, acarbose, and two heterobidentate inhibitors were found by isothermal titration calorimetry to bind to the catalytic and starch binding domains of the linker variants, indicating that the function of the active site and the starch binding site was maintained. The stability of GA1 linker variants toward GdnHCl and heat, however, was reduced compared to wild-type.

Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

PubMed Central

Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

2011-01-01

Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

Interaction between phloretin and the red blood cell membrane

PubMed Central

1976-01-01

Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

A peek into tropomyosin binding and unfolding on the actin filament.

PubMed

Singh, Abhishek; Hitchcock-Degregori, Sarah E

2009-07-24

Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

sc-PDB: a 3D-database of ligandable binding sites--10 years on.

PubMed

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

PubMed

Ahmed, Ahmed H; Oswald, Robert E

2010-03-11

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

PubMed Central

Ahmed, Ahmed H.; Oswald, Robert E.

2010-01-01

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

PubMed

Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

2013-07-01

Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

PubMed

Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

2017-09-14

U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

PubMed

Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

2018-05-10

CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

Solvent mimicry with methylene carbene to probe protein topography.

PubMed

Gómez, Gabriela Elena; Monti, José Luis E; Mundo, Mariana Rocío; Delfino, José María

2015-10-06

The solvent accessible surface area (SASA) of the polypeptide chain plays a key role in protein folding, conformational change, and interaction. This fundamental biophysical parameter is elusive in experimental measurement. Our approach to this problem relies on the reaction of the minimal photochemical reagent diazirine (DZN) with polypeptides. This reagent (i) exerts solvent mimicry because its size is comparable to water and (ii) shows scant chemical selectivity because it generates extremely reactive methylene carbene. Methylation gives rise to the EM (extent of modification) signal, which is useful for scrutinizing the conformational change triggered by Ca(2+) binding to calmodulin (CaM). The increased EM observed for the full protein is dominated by the enhanced exposure of hydrophobic area in Ca(2+)-CaM. Fragmentation allowed us to quantify the methylene incorporation at specific sites. Peptide 91-106 reveals a major reorganization around the calcium 151 binding site, resulting in local ordering and a greater exposure of the hydrophobic surface. Additionally, this technique shows a high sensitivity to probe recognition between CaM and melittin (Mel). The large decrease in EM indicates the occlusion of a significant hydrophobic area upon complexation. Protection from labeling reveals a larger involvement of the N-terminal and central regions of CaM in this interaction. Despite its smaller size, Mel's differential exposure can also be quantified. Moreover, MS/MS fragmentation realizes the goal of extending the resolution of labeled sites at the amino acid level. Overall, DZN labeling emerges as a useful footprinting method capable of shedding light on physiological conformational changes and interactions.

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

PubMed

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

PubMed

Marshall, J C; Shakespear, R A; Odell, W D

1976-11-01

Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

Antibody-dendrimer conjugates: the number, not the size of the dendrimers, determines the immunoreactivity.

PubMed

Wängler, C; Moldenhauer, G; Eisenhut, M; Haberkorn, U; Mier, W

2008-04-01

Radioimmunotherapy using antibodies with favorable tumor targeting properties and high binding affinity is increasingly applied in cancer therapy. The potential of this valuable cancer treatment modality could be further improved by increasing the specific activity of the labeled proteins. This can be done either by coupling a large number of chelators which leads to a decreased immunoreactivity or by conjugating a small number of multimeric chelators. In order to systematically investigate the influence of conjugations on immunoreactivity with respect to size and number of the conjugates, the anti-EGFR antibody hMAb425 was reacted with PAMAM dendrimers of different size containing up to 128 chelating agents per conjugation site. An improved dendrimer synthesis protocol was established to obtain compounds of high homogeneity suitable for the formation of defined protein conjugates. The quantitative derivatization of the PAMAM dendrimers with DOTA moieties and the characterization of the products by isotopic dilution titration using (111)In/(nat)In are shown. The DOTA-containing dendrimers were conjugated with high efficiency to hMAb425 by applying Sulfo-SMCC as cross-linking agent and a 10- to 25-fold excess of the thiol-containing dendrimers. The determination of the immunoreactivities of the antibody-dendrimer conjugates by FACS analysis revealed a median retained immunoreactivity of 62.3% for 1.7 derivatization sites per antibody molecule, 55.4% for 2.8, 27.9% for 5.3, and 17.1% for 10.0 derivatization sites per antibody but no significant differences in immunoreactivity for different dendrimer sizes. These results show that the dendrimer size does not influence the immunoreactivity of the derivatized antibody significantly over a wide molecular weight range, whereas the number of derivatization sites has a crucial effect.

Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauch, Eva-Maria; Bernard, Steffen M.; La, David

Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

An alternate binding site for PPARγ ligands

PubMed Central

Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2014-01-01

PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

INTERACTION OF INTERSTITIAL CLUSTERS WITH RHENIUM, OSMIUM, AND TANTALUM IN TUNGSTEN

DOE Office of Scientific and Technical Information (OSTI.GOV)

Setyawan, Wahyu; Nandipati, Giridhar; Kurtz, Richard J.

2016-09-01

In the previous semi annual report, we explored the stability of interstitial clusters in W up to size seven. In this report, we study the binding of those clusters to Re, Os, and Ta atoms. For each cluster size, the three most stable configurations are considered to average the binding property. The average binding energy to a Re decreases from 0.79 eV for a size-1 cluster (a [111] dumbbell) to 0.65 eV for a size-7 cluster. For Os, the binding decreases from 1.61 eV for a [111] dumbbell to 1.34 eV for a size-7 cluster. Tantalum is repulsive to interstitialmore » clusters with binding energy ranges from -0.61 eV for a [111] dumbbell to -0.5 eV for a size-7 cluster.« less

Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

PubMed

Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

2015-11-01

Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

Oligomycin frames a common drug-binding site in the ATP synthase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

PubMed

Nisius, Britta; Gohlke, Holger

2012-09-24

Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

NMR spectroscopy of the ligand binding core of ionotropic glutamate receptor 2 bound to 5-substituted willardiine partial agonists

PubMed Central

Fenwick, Michael K.; Oswald, Robert E.

2008-01-01

Glutamate receptors mediate neuronal intercommunication in the central nervous system by coupling extracellular neurotransmitter-receptor interactions to ion channel conductivity. To gain insight into structural and dynamical factors that underlie this coupling, solution NMR experiments were performed on the bi-lobed ligand-binding core of glutamate receptor 2 in complexes with a set of willardiine partial agonists. These agonists are valuable for studying structure-function relationships because their 5-position substituent size is correlated with ligand efficacy and extent of receptor desensitization whereas the substituent electronegativity is correlated with ligand potency. NMR results show that the protein backbone amide chemical shift deviations correlate mainly with efficacy and extent of desensitization. Pronounced deviations occur at specific residues in the ligand-binding site and in the two helical segments that join the lobes by a disulfide bond. Experiments detecting conformational exchange show that micro- to millisecond timescale motions also occur near the disulfide bond and vary largely with efficacy and extent of desensitization. These results thus identify regions displaying structural and dynamical dissimilarity arising from differences in ligand-protein interactions and lobe closure which may play a critical role in receptor response. Furthermore, measures of line broadening and conformational exchange for a portion of the ligand-binding site correlate with ligand EC50 data. These results do not have any correlate in the currently available crystal structures and thus provide a novel view of ligand-binding events that may be associated with agonist potency differences. PMID:18387631

Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

PubMed

Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

2008-12-09

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

PubMed Central

Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

2009-01-01

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

PubMed

Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

2013-01-01

Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

[3H]MK-801 binding sites in post-mortem human frontal cortex.

PubMed

Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

1989-03-29

The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

PubMed

Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

2018-09-01

Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-03-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed Central

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-01-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

Enhanced resistance in Theobroma cacao against oomycete and fungal pathogens by secretion of phosphatidylinositol-3-phosphate-binding proteins.

PubMed

Helliwell, Emily E; Vega-Arreguín, Julio; Shi, Zi; Bailey, Bryan; Xiao, Shunyuan; Maximova, Siela N; Tyler, Brett M; Guiltinan, Mark J

2016-03-01

The internalization of some oomycete and fungal pathogen effectors into host plant cells has been reported to be blocked by proteins that bind to the effectors' cell entry receptor, phosphatidylinositol-3-phosphate (PI3P). This finding suggested a novel strategy for disease control by engineering plants to secrete PI3P-binding proteins. In this study, we tested this strategy using the chocolate tree Theobroma cacao. Transient expression and secretion of four different PI3P-binding proteins in detached leaves of T. cacao greatly reduced infection by two oomycete pathogens, Phytophthora tropicalis and Phytophthora palmivora, which cause black pod disease. Lesion size and pathogen growth were reduced by up to 85%. Resistance was not conferred by proteins lacking a secretory leader, by proteins with mutations in their PI3P-binding site, or by a secreted PI4P-binding protein. Stably transformed, transgenic T. cacao plants expressing two different PI3P-binding proteins showed substantially enhanced resistance to both P. tropicalis and P. palmivora, as well as to the fungal pathogen Colletotrichum theobromicola. These results demonstrate that secretion of PI3P-binding proteins is an effective way to increase disease resistance in T. cacao, and potentially in other plants, against a broad spectrum of pathogens. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Biophysical Characterization of the Strong Stabilization of the RNA Triplex poly(U)•poly(A)*poly(U) by 9-O-(ω-amino) Alkyl Ether Berberine Analogs

PubMed Central

Hossain, Maidul; Haq, Lucy; Suresh Kumar, Gopinatha

2012-01-01

Background Binding of two 9-O-(ω-amino) alkyl ether berberine analogs BC1 and BC2 to the RNA triplex poly(U)•poly(A)*poly(U) was studied by various biophysical techniques. Methodology/Principal Findings Berberine analogs bind to the RNA triplex non-cooperatively. The affinity of binding was remarkably high by about 5 and 15 times, respectively, for BC1 and BC2 compared to berberine. The site size for the binding was around 4.3 for all. Based on ferrocyanide quenching, fluorescence polarization, quantum yield values and viscosity results a strong intercalative binding of BC1 and BC2 to the RNA triplex has been demonstrated. BC1 and BC2 stabilized the Hoogsteen base paired third strand by about 18.1 and 20.5°C compared to a 17.5°C stabilization by berberine. The binding was entropy driven compared to the enthalpy driven binding of berbeine, most likely due to additional contacts within the grooves of the triplex and disruption of the water structure by the alkyl side chain. Conclusions/Significance Remarkably higher binding affinity and stabilization effect of the RNA triplex by the amino alkyl berberine analogs was achieved compared to berberine. The length of the alkyl side chain influence in the triplex stabilization phenomena. PMID:22666416

Positive selection on human gamete-recognition genes

PubMed Central

Stover, Daryn A.; Guerra, Vanessa; Mozaffari, Sahar V.; Ober, Carole; Mugal, Carina F.; Kaj, Ingemar

2018-01-01

Coevolution of genes that encode interacting proteins expressed on the surfaces of sperm and eggs can lead to variation in reproductive compatibility between mates and reproductive isolation between members of different species. Previous studies in mice and other mammals have focused in particular on evidence for positive or diversifying selection that shapes the evolution of genes that encode sperm-binding proteins expressed in the egg coat or zona pellucida (ZP). By fitting phylogenetic models of codon evolution to data from the 1000 Genomes Project, we identified candidate sites evolving under diversifying selection in the human genes ZP3 and ZP2. We also identified one candidate site under positive selection in C4BPA, which encodes a repetitive protein similar to the mouse protein ZP3R that is expressed in the sperm head and binds to the ZP at fertilization. Results from several additional analyses that applied population genetic models to the same data were consistent with the hypothesis of selection on those candidate sites leading to coevolution of sperm- and egg-expressed genes. By contrast, we found no candidate sites under selection in a fourth gene (ZP1) that encodes an egg coat structural protein not directly involved in sperm binding. Finally, we found that two of the candidate sites (in C4BPA and ZP2) were correlated with variation in family size and birth rate among Hutterite couples, and those two candidate sites were also in linkage disequilibrium in the same Hutterite study population. All of these lines of evidence are consistent with predictions from a previously proposed hypothesis of balancing selection on epistatic interactions between C4BPA and ZP3 at fertilization that lead to the evolution of co-adapted allele pairs. Such patterns also suggest specific molecular traits that may be associated with both natural reproductive variation and clinical infertility. PMID:29340252

sc-PDB: a 3D-database of ligandable binding sites—10 years on

PubMed Central

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

PubMed

Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

2018-05-29

Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

PubMed Central

Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

2008-01-01

The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

PubMed Central

Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

2012-01-01

Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

PubMed

Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

2014-01-01

We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

PubMed

Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

2018-03-23

The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

Lessons from hot spot analysis for fragment-based drug discovery

PubMed Central

Hall, David R.; Vajda, Sandor

2015-01-01

Analysis of binding energy hot spots at protein surfaces can provide crucial insights into the prospects for successful application of fragment-based drug discovery (FBDD), and whether a fragment hit can be advanced into a high affinity, druglike ligand. The key factor is the strength of the top ranking hot spot, and how well a given fragment complements it. We show that published data are sufficient to provide a sophisticated and quantitative understanding of how hot spots derive from protein three-dimensional structure, and how their strength, number and spatial arrangement govern the potential for a surface site to bind to fragment-sized and larger ligands. This improved understanding provides important guidance for the effective application of FBDD in drug discovery. PMID:26538314

Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

NASA Astrophysics Data System (ADS)

Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

2018-02-01

Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

2011-01-01

Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

A deep learning framework for modeling structural features of RNA-binding protein targets

PubMed Central

Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

2016-01-01

RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

PubMed Central

Middendorf, Thomas R.

2017-01-01

A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

PubMed

Mizuno, S; Ogawa, N; Mori, A

1982-12-01

Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

PubMed

Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

2014-03-01

Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

PubMed

Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

2006-07-01

High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

PubMed Central

Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

2010-01-01

The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

PubMed

Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

2017-07-05

Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

PubMed

Streiff, John H; Jones, Keith A

2008-10-01

The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

PubMed

Gold, Nicola D; Jackson, Richard M

2006-02-03

The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

Analysis of functional importance of binding sites in the Drosophila gap gene network model.

PubMed

Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

2015-01-01

The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

PubMed

Dudev, Todor; Chang, Li-Ying; Lim, Carmay

2005-03-23

Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

PubMed

Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

2005-04-19

The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

Adsorption-desorption mechanism of phosphate by immobilized nano-sized magnetite layer: interface and bulk interactions.

PubMed

Zach-Maor, Adva; Semiat, Raphael; Shemer, Hilla

2011-11-15

Phosphate adsorption mechanism by a homogenous porous layer of nano-sized magnetite particles immobilized onto granular activated carbon (nFe-GAC) was studied for both interface and bulk structures. X-ray Photoelectron Spectroscopy (XPS) analysis revealed phosphate bonding to the nFe-GAC predominantly through bidentate surface complexes. It was established that phosphate was adsorbed to the magnetite surface mainly via ligand exchange mechanism. Initially, phosphate was adsorbed by the active sites on the magnetite surface, after which it diffused into the interior of the nano-magnetite layer, as indicated by intraparticle diffusion model. This diffusion process continues regardless of interface interactions, revealing some of the outer magnetite binding sites for further phosphate uptake. Desorption, using NaOH solution, was found to be predominantly a surface reaction, at which hydroxyl ions replace the adsorbed phosphate ions only at the surface outer biding sites. Five successive fix-bed adsorption/regeneration cycles were successfully applied, without significant reduction in the nFe-GAC adsorption capacity and at high regeneration efficiency. Copyright © 2011 Elsevier Inc. All rights reserved.

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Yap1 as a New Therapeutic Target in Neurofibromatosis Type 2

DTIC Science & Technology

2014-05-01

binding sites (bold and underlined) present in the NOTCH2 promoter. Red box indicates area of genomic sequence (WT Notch2 prom) that was cloned into... Drosophila homolog of YAP. Cell 122, 421–434 22 Tao, W. et al. (1999) Human homologue of the Drosophila melanogaster lats tumour suppressor modulates... the hippo pathway basics The Hippo signaling cascade was first identified in Drosophila Melanogaster as an important regulator of organ size. The high

Assessment of mdm2 Alterations on p53 Expression in Breast Cancer

DTIC Science & Technology

2000-10-01

Figure 2. Schematic Comparison of mdm2 with PCR Products of Various Sizes. nuclear localization signal I p53 binding site X acidic domain zinc...susceptibility gene isolated by controlled homozygous functional knockout of allelic loci in mammalian cells. Cell. 85: 319-329, 1996. 36. Li, L., Li, X ...twelve years. Chinese Journal of Parasitology and Parasitic Diseases 10: 112-114, 1992. 7. Gao DQ, Cansesaa L, Mouradian MM, Jose P. Dopamine D2-long

Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

PubMed

Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

2014-01-01

Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giannopoulos, G.; Jackson, K.; Kredentser, J.

The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

PubMed

Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

2014-11-18

Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

NASA Astrophysics Data System (ADS)

Pang, Yuan-Ping; Kozikowski, Alan P.

1994-12-01

We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

PubMed

Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

2016-06-01

Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Dynamics of crowding-induced mixing in phase separated lipid bilayers

DOE PAGES

Zeno, Wade F.; Johnson, Kaitlin E.; Sasaki, Darryl Y.; ...

2016-10-10

We use fluorescence microscopy to examine the dynamics of the crowding-induced mixing transition of liquid ordered (L o)–liquid disordered (L d) phase separated lipid bilayers when the following particles of increasing size bind to either the L o or L d phase: Ubiquitin, green fluorescent protein (GFP), and nanolipoprotein particles (NLPs) of two diameters. These proteinaceous particles contained histidine-tags, which were phase targeted by binding to iminodiacetic acid (IDA) head groups, via a Cu 2+ chelating mechanism, of lipids that specifically partition into either the Lo phase or Ld phase. The degree of steric pressure was controlled by varying themore » size of the bound particle (10–240 kDa) and the amount of binding sites present (i.e., DPIDA concentrations of 9 and 12 mol%) in the supported lipid multibilayer platform used here. We develop a mass transfer-based diffusional model to analyze the observed L o phase domain dissolution that, along with visual observations and activation energy calculations, provides insight into the sequence of events in crowding-induced mixing. Furthermore, our results suggest that the degree of steric pressure and target phase influence not only the efficacy of steric-pressure induced mixing, but the rate and controlling mechanism for which it occurs.« less

Energetics and kinetics of cooperative cofilin-actin filament interactions.

PubMed

Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

2006-08-11

We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

2008-08-19

Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

Excess electrons in methanol clusters: Beyond the one-electron picture

NASA Astrophysics Data System (ADS)

Pohl, Gábor; Mones, Letif; Turi, László

2016-10-01

We performed a series of comparative quantum chemical calculations on various size negatively charged methanol clusters, ("separators=" CH 3 OH ) n - . The clusters are examined in their optimized geometries (n = 2-4), and in geometries taken from mixed quantum-classical molecular dynamics simulations at finite temperature (n = 2-128). These latter structures model potential electron binding sites in methanol clusters and in bulk methanol. In particular, we compute the vertical detachment energy (VDE) of an excess electron from increasing size methanol cluster anions using quantum chemical computations at various levels of theory including a one-electron pseudopotential model, several density functional theory (DFT) based methods, MP2 and coupled-cluster CCSD(T) calculations. The results suggest that at least four methanol molecules are needed to bind an excess electron on a hydrogen bonded methanol chain in a dipole bound state. Larger methanol clusters are able to form stronger interactions with an excess electron. The two simulated excess electron binding motifs in methanol clusters, interior and surface states, correlate well with distinct, experimentally found VDE tendencies with size. Interior states in a solvent cavity are stabilized significantly stronger than electron states on cluster surfaces. Although we find that all the examined quantum chemistry methods more or less overestimate the strength of the experimental excess electron stabilization, MP2, LC-BLYP, and BHandHLYP methods with diffuse basis sets provide a significantly better estimate of the VDE than traditional DFT methods (BLYP, B3LYP, X3LYP, PBE0). A comparison to the better performing many electron methods indicates that the examined one-electron pseudopotential can be reasonably used in simulations for systems of larger size.

Excess electrons in methanol clusters: Beyond the one-electron picture.

PubMed

Pohl, Gábor; Mones, Letif; Turi, László

2016-10-28

We performed a series of comparative quantum chemical calculations on various size negatively charged methanol clusters, CH 3 OH n - . The clusters are examined in their optimized geometries (n = 2-4), and in geometries taken from mixed quantum-classical molecular dynamics simulations at finite temperature (n = 2-128). These latter structures model potential electron binding sites in methanol clusters and in bulk methanol. In particular, we compute the vertical detachment energy (VDE) of an excess electron from increasing size methanol cluster anions using quantum chemical computations at various levels of theory including a one-electron pseudopotential model, several density functional theory (DFT) based methods, MP2 and coupled-cluster CCSD(T) calculations. The results suggest that at least four methanol molecules are needed to bind an excess electron on a hydrogen bonded methanol chain in a dipole bound state. Larger methanol clusters are able to form stronger interactions with an excess electron. The two simulated excess electron binding motifs in methanol clusters, interior and surface states, correlate well with distinct, experimentally found VDE tendencies with size. Interior states in a solvent cavity are stabilized significantly stronger than electron states on cluster surfaces. Although we find that all the examined quantum chemistry methods more or less overestimate the strength of the experimental excess electron stabilization, MP2, LC-BLYP, and BHandHLYP methods with diffuse basis sets provide a significantly better estimate of the VDE than traditional DFT methods (BLYP, B3LYP, X3LYP, PBE0). A comparison to the better performing many electron methods indicates that the examined one-electron pseudopotential can be reasonably used in simulations for systems of larger size.

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

PubMed

Konc, Janez; Janežič, Dušanka

2014-07-01

The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

2005-08-22

Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

PubMed Central

Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

2007-01-01

In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

PubMed

Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

1994-10-27

Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

Surface salt bridges modulate DNA wrapping by the type II DNA-binding protein TF1.

PubMed

Grove, Anne

2003-07-29

The histone-like protein HU is involved in compaction of the bacterial genome. Up to 37 bp of DNA may be wrapped about some HU homologues in a process that has been proposed to depend on a linked disruption of surface salt bridges that liberates cationic side chains for interaction with the DNA. Despite significant sequence conservation between HU homologues, binding sites from 9 to 37 bp have been reported. TF1, an HU homologue that is encoded by Bacillus subtilis bacteriophage SPO1, has nM affinity for 37 bp preferred sites in DNA with 5-hydroxymethyluracil (hmU) in place of thymine. On the basis of electrophoretic mobility shift assays, we show that TF1-DNA complex formation is associated with a net release of only approximately 0.5 cations. The structure of TF1 suggests that Asp13 can form a dehydrated surface salt bridge with Lys23; substitution of Asp13 with Ala increases the net release of cations to approximately 1. These data are consistent with complex formation linked to disruption of surface salt bridges. Substitution of Glu90 with Ala, which would expose Lys87 predicted to contact DNA immediately distal to a proline-mediated DNA kink, causes an increase in affinity and an abrogation of the preference for hmU-containing DNA. We propose that hmU preference is due to finely tuned interactions at the sites of kinking that expose a differential flexibility of hmU- and T-containing DNA. Our data further suggest that the difference in binding site size for HU homologues is based on a differential ability to stabilize the DNA kinks.

An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

PubMed Central

Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

2012-01-01

An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

Modulation of FadR Binding Capacity for Acyl-CoA Fatty Acids Through Structure-Guided Mutagenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacik, John-Paul; Yeager, Chris M.; Twary, Scott N.

FadR is a versatile global regulator in Escherichia coli that controls fatty acid metabolism and thereby modulates the ability of this bacterium to grow using fatty acids or acetate as the sole carbon source. FadR regulates fatty acid metabolism in response to intra-cellular concentrations of acyl-CoA lipids. The ability of FadR to bind acyl-CoA fatty acids is hence of significant interest for the engineering of biosynthetic pathways for the production of lipid-based biofuels and commodity chemicals. Based on the available crystal structure of E. coli bound to myristoyl- CoA, we predicted amino acid positions within the effector binding pocket thatmore » would alter the ability of FadR to bind acyl-CoA fatty acids without affecting DNA binding. We utilized fluorescence polarization to characterize the in-vitro binding properties of wild type and mutant FadR. We found that a Leu102Ala mutant enhanced binding of the effector, likely by increasing the size of the binding pocket for the acyl moiety of the molecule. Conversely, the elimination of the guanidine side chain (Arg213Ala and Arg213Met mutants) of the CoA moiety binding site severely diminished the ability of FadR to bind the acyl-CoA effector. These results demonstrate the ability to fine tune FadR binding capacity. The validation of an efficient method to fully characterize all the binding events involved in the specific activity (effector and DNA operator binding) of FadR has allowed us to increase our understanding of the role of specific amino acids in the binding and recognition of acyl-CoA fatty acids and will greatly facilitate efforts aimed at engineering tunable FadR regulators for synthetic biology.« less

Modulation of FadR Binding Capacity for Acyl-CoA Fatty Acids Through Structure-Guided Mutagenesis

DOE PAGES

Bacik, John-Paul; Yeager, Chris M.; Twary, Scott N.; ...

2015-09-18

FadR is a versatile global regulator in Escherichia coli that controls fatty acid metabolism and thereby modulates the ability of this bacterium to grow using fatty acids or acetate as the sole carbon source. FadR regulates fatty acid metabolism in response to intra-cellular concentrations of acyl-CoA lipids. The ability of FadR to bind acyl-CoA fatty acids is hence of significant interest for the engineering of biosynthetic pathways for the production of lipid-based biofuels and commodity chemicals. Based on the available crystal structure of E. coli bound to myristoyl- CoA, we predicted amino acid positions within the effector binding pocket thatmore » would alter the ability of FadR to bind acyl-CoA fatty acids without affecting DNA binding. We utilized fluorescence polarization to characterize the in-vitro binding properties of wild type and mutant FadR. We found that a Leu102Ala mutant enhanced binding of the effector, likely by increasing the size of the binding pocket for the acyl moiety of the molecule. Conversely, the elimination of the guanidine side chain (Arg213Ala and Arg213Met mutants) of the CoA moiety binding site severely diminished the ability of FadR to bind the acyl-CoA effector. These results demonstrate the ability to fine tune FadR binding capacity. The validation of an efficient method to fully characterize all the binding events involved in the specific activity (effector and DNA operator binding) of FadR has allowed us to increase our understanding of the role of specific amino acids in the binding and recognition of acyl-CoA fatty acids and will greatly facilitate efforts aimed at engineering tunable FadR regulators for synthetic biology.« less

AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

PubMed

Morley, B J; Garner, L L

1990-06-11

Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

NASA Astrophysics Data System (ADS)

Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

PubMed Central

Jalak, Jürgen; Väljamäe, Priit

2014-01-01

Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

PubMed Central

Gibbons, R. J.; Moreno, E. C.; Etherden, I.

1983-01-01

The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

1990-01-01

Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

The Structural Basis of ATP as an Allosteric Modulator

PubMed Central

Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

2014-01-01

Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

PubMed Central

Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

2014-01-01

A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

Flies expand the repertoire of protein structures that bind ice.

PubMed

Basu, Koli; Graham, Laurie A; Campbell, Robert L; Davies, Peter L

2015-01-20

An antifreeze protein (AFP) with no known homologs has been identified in Lake Ontario midges (Chironomidae). The midge AFP is expressed as a family of isoforms at low levels in adults, which emerge from fresh water in spring before the threat of freezing temperatures has passed. The 9.1-kDa major isoform derived from a preproprotein precursor is glycosylated and has a 10-residue tandem repeating sequence xxCxGxYCxG, with regularly spaced cysteines, glycines, and tyrosines comprising one-half its 79 residues. Modeling and molecular dynamics predict a tightly wound left-handed solenoid fold in which the cysteines form a disulfide core to brace each of the eight 10-residue coils. The solenoid is reinforced by intrachain hydrogen bonds, side-chain salt bridges, and a row of seven stacked tyrosines on the hydrophobic side that forms the putative ice-binding site. A disulfide core is also a feature of the similar-sized beetle AFP that is a β-helix with seven 12-residue coils and a comparable circular dichroism spectrum. The midge and beetle AFPs are not homologous and their ice-binding sites are radically different, with the latter comprising two parallel arrays of outward-pointing threonines. However, their structural similarities is an amazing example of convergent evolution in different orders of insects to cope with change to a colder climate and provide confirmation about the physical features needed for a protein to bind ice.

The decrease in the IgG-binding capacity of intensively dry heated whey proteins is associated with intense Maillard reaction, structural changes of the proteins and formation of RAGE-ligands.

PubMed

Liu, Fahui; Teodorowicz, Małgorzata; van Boekel, Martinus A J S; Wichers, Harry J; Hettinga, Kasper A

2016-01-01

Heat treatment is the most common way of milk processing, inducing structural changes as well as chemical modifications in milk proteins. These modifications influence the immune-reactivity and allergenicity of milk proteins. This study shows the influence of dry heating on the solubility, particle size, loss of accessible thiol and amino groups, degree of Maillard reaction, IgG-binding capacity and binding to the receptor for advanced glycation end products (RAGE) of thermally treated and glycated whey proteins. A mixture of whey proteins and lactose was dry heated at 130 °C up to 20 min to mimic the baking process in two different water activities, 0.23 to mimic the heating in the dry state and 0.59 for the semi-dry state. The dry heating was accompanied by a loss of soluble proteins and an increase in the size of dissolved aggregates. Most of the Maillard reaction sites were found to be located in the reported conformational epitope area on whey proteins. Therefore the structural changes, including exposure of the SH group, SH-SS exchange, covalent cross-links and the loss of available lysine, subsequently resulted in a decreased IgG-binding capacity (up to 33%). The binding of glycation products to RAGE increased with the heating time, which was correlated with the stage of the Maillard reaction and the decrease in the IgG-binding capacity. The RAGE-binding capacity was higher in samples with a lower water activity (0.23). These results indicate that the intensive dry heating of whey proteins as it occurs during baking may be of importance to the immunological properties of allergens in cow's milk, both due to chemical modifications of the allergens and formation of AGEs.

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

PubMed

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

PubMed

Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

2018-02-01

Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

Elimination of a ligand gating site generates a supersensitive olfactory receptor.

PubMed

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

2016-06-21

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

Elimination of a ligand gating site generates a supersensitive olfactory receptor

PubMed Central

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

2016-01-01

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

2009-06-08

The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

Interfering lipoproteins in magnetic field-assisted agglutination of superparamagnetic particles immunoassay.

PubMed

Cauet, Gilles; Daynès, Aurélien; Temurok, Nevzat

2016-04-01

The technology of magnetic field-assisted immuno-agglutination of superparamagnetic particles allows sensitive detection of biomarkers in whole blood. However, we observed non-specific agglutination (NSA), due to interfering plasma proteins, that negatively affects C-reactive protein immunoassay. The objective of the study was to identify the plasma proteins involved and to eliminate these interferences. Plasma was fractionated by size exclusion HPLC and each fraction was tested for non-specific agglutination. In addition, plasma proteins bound to magnetic particles were analyzed by SDS-gel electrophoresis and identified by mass spectrometry. We found that NSA was due to the binding of some lipoproteins to the particles. NSA was observed in the presence of purified LDL and VLDL but not HDL. NSA was mediated by the binding of ApoB100 to magnetic particles through its heparin binding sites. These interferences could be eliminated by addition of heparin or other polyanions like dextran sulfate to the assay buffer. NSA results from the binding of some plasma lipoproteins to magnetic particles. The use of a polyanion to eliminate these interferences allows the formulation of a stable reagent.

Protein Camouflage: Supramolecular Anion Recognition by Ubiquitin.

PubMed

Mallon, Madeleine; Dutt, Som; Schrader, Thomas; Crowley, Peter B

2016-04-15

Progress in the field of bio-supramolecular chemistry, the bottom-up assembly of protein-ligand systems, relies on a detailed knowledge of molecular recognition. To address this issue, we have characterised complex formation between human ubiquitin (HUb) and four supramolecular anions. The ligands were: pyrenetetrasulfonic acid (4PSA), p-sulfonato-calix[4]arene (SCLX4), bisphosphate tweezers (CLR01) and meso-tetrakis (4-sulfonatophenyl)porphyrin (TPPS), which vary in net charge, size, shape and hydrophobicity. All four ligands induced significant changes in the HSQC spectrum of HUb. Chemical shift perturbations and line-broadening effects were used to identify binding sites and to quantify affinities. Supporting data were obtained from docking simulations. It was found that these weakly interacting ligands bind to extensive surface patches on HUb. A comparison of the data suggests some general indicators for the protein-binding specificity of supramolecular anions. Differences in binding were observed between the cavity-containing and planar ligands. The former had a preference for the arginine-rich, flexible C terminus of HUb. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

PubMed Central

Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

1999-01-01

Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

PubMed Central

Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

2013-01-01

Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

1988-05-01

Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romm, E.; Marks, M.J.; Collins, A.C.

1990-01-01

Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

Binding of (/sup 3/H)Forskolin to rat brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seamon, K.B.; Vaillancourt, R.; Edwards, M.

1984-08-01

(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

Biophysical Fitness Landscapes for Transcription Factor Binding Sites

PubMed Central

Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

2014-01-01

Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

PubMed

Yokoyama, Ken Daigoro; Pollock, David D

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

PubMed Central

Yokoyama, Ken Daigoro; Pollock, David D.

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

Nucleotide-dependent bisANS binding to tubulin.

PubMed

Chakraborty, S; Sarkar, N; Bhattacharyya, B

1999-07-13

Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

1988-01-01

(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

Impact of disruption of secondary binding site S2 on dopamine transporter function.

PubMed

Zhen, Juan; Reith, Maarten E A

2016-09-01

The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

PubMed

Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

2011-11-14

The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

PubMed Central

Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

2001-01-01

Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

In Vitro and in Vivo Analysis of the Binding of the C Terminus of the HDL Receptor Scavenger Receptor Class B, Type I (SR-BI), to the PDZ1 Domain of Its Adaptor Protein PDZK1*

PubMed Central

Kocher, Olivier; Birrane, Gabriel; Tsukamoto, Kosuke; Fenske, Sara; Yesilaltay, Ayce; Pal, Rinku; Daniels, Kathleen; Ladias, John A. A.; Krieger, Monty

2010-01-01

The PDZ1 domain of the four PDZ domain-containing protein PDZK1 has been reported to bind the C terminus of the HDL receptor scavenger receptor class B, type I (SR-BI), and to control hepatic SR-BI expression and function. We generated wild-type (WT) and mutant murine PDZ1 domains, the mutants bearing single amino acid substitutions in their carboxylate binding loop (Lys14-Xaa4-Asn19-Tyr-Gly-Phe-Phe-Leu24), and measured their binding affinity for a 7-residue peptide corresponding to the C terminus of SR-BI (503VLQEAKL509). The Y20A and G21Y substitutions abrogated all binding activity. Surprisingly, binding affinities (Kd) of the K14A and F22A mutants were 3.2 and 4.0 μm, respectively, similar to 2.6 μm measured for the WT PDZ1. To understand these findings, we determined the high resolution structure of WT PDZ1 bound to a 5-residue sequence from the C-terminal SR-BI (505QEAKL509) using x-ray crystallography. In addition, we incorporated the K14A and Y20A substitutions into full-length PDZK1 liver-specific transgenes and expressed them in WT and PDZK1 knock-out mice. In WT mice, the transgenes did not alter endogenous hepatic SR-BI protein expression (intracellular distribution or amount) or lipoprotein metabolism (total plasma cholesterol, lipoprotein size distribution). In PDZK1 knock-out mice, as expected, the K14A mutant behaved like wild-type PDZK1 and completely corrected their hepatic SR-BI and plasma lipoprotein abnormalities. Unexpectedly, the 10–20-fold overexpressed Y20A mutant also substantially, but not completely, corrected these abnormalities. The results suggest that there may be an additional site(s) within PDZK1 that bind(s) SR-BI and mediate(s) productive SR-BI-PDZK1 interaction previously attributed exclusively to the canonical binding of the C-terminal SR-BI to PDZ1. PMID:20739281

In vitro and in vivo Analysis of the Binding of the C Terminus of the HDL Receptor Scavenger Receptor Class B type I (SR-BI) to the PDZ1 Domain of its Cytoplasmic Adaptor Protein PDZK1

DOE Office of Scientific and Technical Information (OSTI.GOV)

O Kocher; G Birrane; K Tsukamoto

2011-12-31

The PDZ1 domain of the four PDZ domain-containing protein PDZK1 has been reported to bind the C terminus of the HDL receptor scavenger receptor class B, type I (SR-BI), and to control hepatic SR-BI expression and function. We generated wild-type (WT) and mutant murine PDZ1 domains, the mutants bearing single amino acid substitutions in their carboxylate binding loop (Lys(14)-Xaa(4)-Asn(19)-Tyr-Gly-Phe-Phe-Leu(24)), and measured their binding affinity for a 7-residue peptide corresponding to the C terminus of SR-BI ((503)VLQEAKL(509)). The Y20A and G21Y substitutions abrogated all binding activity. Surprisingly, binding affinities (K(d)) of the K14A and F22A mutants were 3.2 and 4.0 ?M,more » respectively, similar to 2.6 ?M measured for the WT PDZ1. To understand these findings, we determined the high resolution structure of WT PDZ1 bound to a 5-residue sequence from the C-terminal SR-BI ((505)QEAKL(509)) using x-ray crystallography. In addition, we incorporated the K14A and Y20A substitutions into full-length PDZK1 liver-specific transgenes and expressed them in WT and PDZK1 knock-out mice. In WT mice, the transgenes did not alter endogenous hepatic SR-BI protein expression (intracellular distribution or amount) or lipoprotein metabolism (total plasma cholesterol, lipoprotein size distribution). In PDZK1 knock-out mice, as expected, the K14A mutant behaved like wild-type PDZK1 and completely corrected their hepatic SR-BI and plasma lipoprotein abnormalities. Unexpectedly, the 10-20-fold overexpressed Y20A mutant also substantially, but not completely, corrected these abnormalities. The results suggest that there may be an additional site(s) within PDZK1 that bind(s) SR-BI and mediate(s) productive SR-BI-PDZK1 interaction previously attributed exclusively to the canonical binding of the C-terminal SR-BI to PDZ1.« less

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Autoradiographic demonstration of oxytocin-binding sites in the macula densa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoeckel, M.E.; Freund-Mercier, M.J.

1989-08-01

Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

High-affinity cannabinoid binding site in brain: A possible marijuana receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nye, J.S.

The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

PubMed

Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

2006-04-24

A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

DTIC Science & Technology

positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

PubMed Central

Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

2010-01-01

Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

Pharmacophore screening of the protein data bank for specific binding site chemistry.

PubMed

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

2011-01-01

The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

PubMed

Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

2017-03-16

Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

1986-06-01

(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

PubMed

Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

2008-06-01

In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Subunit Dissociation and Metal Binding by Escherichia coli apo-Manganese Superoxide Dismutase

PubMed Central

Whittaker, Mei M.; Lerch, Thomas F.; Kirillova, Olga; Chapman, Michael S.; Whittaker, James W.

2010-01-01

Metal binding by apo-manganese superoxide dismutase (apo-MnSOD) is essential for functional maturation of the enzyme. Previous studies have demonstrated that metal binding by apo-MnSOD is conformationally gated, requiring protein reorganization for the metal to bind. We have now solved the X-ray crystal structure of apo-MnSOD at 1.9 Å resolution. The organization of active site residues is independent of the presence of the metal cofactor, demonstrating that protein itself templates the unusual metal coordination geometry. Electrophoretic analysis of mixtures of apo- and (Mn2)-MnSOD, dye-conjugated protein, or C-terminal Strep-tag II fusion protein reveals a dynamic subunit exchange process associated with cooperative metal binding by the two subunits of the dimeric protein. In contrast, (S126C) (SS) apo-MnSOD, which contains an inter-subunit covalent disulfide crosslink, exhibits anticooperative metal binding. The protein concentration dependence of metal uptake kinetics implies that protein dissociation is involved in metal binding by the wild type apo-protein, although other processes may also contribute to gating metal uptake. Protein concentration dependent small-zone size exclusion chromatography is consistent with apo-MnSOD dimer dissociation at low protein concentration (KD = 1×10−6 M). Studies on metal uptake by apo-MnSOD in Escherichia coli cells show that the protein exhibits similar behavior in vivo and in vitro. PMID:21044611

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, M.W.; Chen, J.P.; Wallis, C.

1992-02-26

({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

PubMed Central

Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

1998-01-01

The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

PubMed

Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

1991-11-01

The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

LEDGF/p75 interacts with mRNA splicing factors and targets HIV-1 integration to highly spliced genes

PubMed Central

Singh, Parmit Kumar; Plumb, Matthew R.; Ferris, Andrea L.; Iben, James R.; Wu, Xiaolin; Fadel, Hind J.; Luke, Brian T.; Esnault, Caroline; Poeschla, Eric M.; Hughes, Stephen H.; Kvaratskhelia, Mamuka; Levin, Henry L.

2015-01-01

The host chromatin-binding factor LEDGF/p75 interacts with HIV-1 integrase and directs integration to active transcription units. To understand how LEDGF/p75 recognizes transcription units, we sequenced 1 million HIV-1 integration sites isolated from cultured HEK293T cells. Analysis of integration sites showed that cancer genes were preferentially targeted, raising concerns about using lentivirus vectors for gene therapy. Additional analysis led to the discovery that introns and alternative splicing contributed significantly to integration site selection. These correlations were independent of transcription levels, size of transcription units, and length of the introns. Multivariate analysis with five parameters previously found to predict integration sites showed that intron density is the strongest predictor of integration density in transcription units. Analysis of previously published HIV-1 integration site data showed that integration density in transcription units in mouse embryonic fibroblasts also correlated strongly with intron number, and this correlation was absent in cells lacking LEDGF. Affinity purification showed that LEDGF/p75 is associated with a number of splicing factors, and RNA sequencing (RNA-seq) analysis of HEK293T cells lacking LEDGF/p75 or the LEDGF/p75 integrase-binding domain (IBD) showed that LEDGF/p75 contributes to splicing patterns in half of the transcription units that have alternative isoforms. Thus, LEDGF/p75 interacts with splicing factors, contributes to exon choice, and directs HIV-1 integration to transcription units that are highly spliced. PMID:26545813

Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

PubMed

Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

2016-07-19

The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

PubMed

Barnert, R H; Zeichhardt, H; Habermehl, K O

1992-02-01

Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

Cooperative interplay of let-7 mimic and HuR with MYC RNA.

PubMed

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

PubMed

Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

2018-06-06

Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

PubMed

Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

2015-12-01

CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

PubMed Central

Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

2007-01-01

Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

Investigation of glucose binding sites on insulin.

PubMed

Zoete, Vincent; Meuwly, Markus; Karplus, Martin

2004-05-15

Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

PubMed Central

James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

2015-01-01

Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

PubMed Central

Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

2017-01-01

Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

PubMed

Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

1988-01-01

The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

A computational study of the dechlorination of β-hexachlorocyclohexane (β-HCH) catalyzed by the haloalkane dehalogenase LinB.

PubMed

Manna, Rabindra Nath; Dybala-Defratyka, Agnieszka

2014-11-15

LinB, a haloalkane dehalogenase from Sphingomonas paucimobilis UT26, is known to metabolize halohydrocarbons to halide ions and the respective alcohols. Its broad substrate specificity allowed its consideration for bioremediation. Herein, we have shown its catalytic action toward β-hexachlorocyclohexane (β-HCH) - an example of large-size substrates that can be accommodated in its active site. We have analyzed the capability of combined QM/MM schemes to describe in detail the SN2 dechlorination reaction between β-HCH and Asp108 in the active site of LinB. Free energy surfaces have been calculated using one and two dimensional potentials of mean force (PMF) obtained at the PM3/MM (MM=amberff99SB, TIP3P) level of theory. The overestimated energetic barriers by the PM3 Hamiltonian were corrected using a DFT functional (M06-2X). The resulted activation energies (16 and 19 kcal mol(-1) from 1D and 2D-PMF profiles, respectively) for the dechlorination reaction of β-HCH in the active site of LinB enzyme are in qualitative agreement with the experimentally determined value of 17 kcal mol(-1). The binding of β-HCH to the active site of LinB has been compared to the binding of smaller 1-chlorobutane (1-CB) and larger δ-hexabromocyclododecane (δ-HBCD). Copyright © 2014 Elsevier Inc. All rights reserved.

Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

PubMed

Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

2017-03-17

Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

PubMed Central

Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2008-01-01

Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

NASA Astrophysics Data System (ADS)

Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

2018-03-01

To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

PubMed Central

Keck, P C; Huston, J S

1996-01-01

Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

The physical size of transcription factors is key to transcriptional regulation in chromatin domains

NASA Astrophysics Data System (ADS)

Maeshima, Kazuhiro; Kaizu, Kazunari; Tamura, Sachiko; Nozaki, Tadasu; Kokubo, Tetsuro; Takahashi, Koichi

2015-02-01

Genetic information, which is stored in the long strand of genomic DNA as chromatin, must be scanned and read out by various transcription factors. First, gene-specific transcription factors, which are relatively small (˜50 kDa), scan the genome and bind regulatory elements. Such factors then recruit general transcription factors, Mediators, RNA polymerases, nucleosome remodellers, and histone modifiers, most of which are large protein complexes of 1-3 MDa in size. Here, we propose a new model for the functional significance of the size of transcription factors (or complexes) for gene regulation of chromatin domains. Recent findings suggest that chromatin consists of irregularly folded nucleosome fibres (10 nm fibres) and forms numerous condensed domains (e.g., topologically associating domains). Although the flexibility and dynamics of chromatin allow repositioning of genes within the condensed domains, the size exclusion effect of the domain may limit accessibility of DNA sequences by transcription factors. We used Monte Carlo computer simulations to determine the physical size limit of transcription factors that can enter condensed chromatin domains. Small gene-specific transcription factors can penetrate into the chromatin domains and search their target sequences, whereas large transcription complexes cannot enter the domain. Due to this property, once a large complex binds its target site via gene-specific factors it can act as a ‘buoy’ to keep the target region on the surface of the condensed domain and maintain transcriptional competency. This size-dependent specialization of target-scanning and surface-tethering functions could provide novel insight into the mechanisms of various DNA transactions, such as DNA replication and repair/recombination.

Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

PubMed

Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

2017-09-01

Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Catalytic site interactions in yeast OMP synthase.

PubMed

Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

2014-01-15

The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

PubMed

Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

2006-01-01

Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

Controlling and fine tuning the physical properties of two identical metal coordination sites in de novo designed three stranded coiled coil peptides.

PubMed

Iranzo, Olga; Chakraborty, Saumen; Hemmingsen, Lars; Pecoraro, Vincent L

2011-01-19

Herein we report how de novo designed peptides can be used to investigate whether the position of a metal site along a linear sequence that folds into a three-stranded α-helical coiled coil defines the physical properties of Cd(II) ions in either CdS(3) or CdS(3)O (O-being an exogenous water molecule) coordination environments. Peptides are presented that bind Cd(II) into two identical coordination sites that are located at different topological positions at the interior of these constructs. The peptide GRANDL16PenL19IL23PenL26I binds two Cd(II) as trigonal planar 3-coordinate CdS(3) structures whereas GRANDL12AL16CL26AL30C sequesters two Cd(II) as pseudotetrahedral 4-coordinate CdS(3)O structures. We demonstrate how for the first peptide, having a more rigid structure, the location of the identical binding sites along the linear sequence does not affect the physical properties of the two bound Cd(II). However, the sites are not completely independent as Cd(II) bound to one of the sites ((113)Cd NMR chemical shift of 681 ppm) is perturbed by the metalation state (apo or [Cd(pep)(Hpep)(2)](+) or [Cd(pep)(3)](-)) of the second center ((113)Cd NMR chemical shift of 686 ppm). GRANDL12AL16CL26AL30C shows a completely different behavior. The physical properties of the two bound Cd(II) ions indeed depend on the position of the metal center, having pK(a2) values for the equilibrium [Cd(pep)(Hpep)(2)](+) → [Cd(pep)(3)](-) + 2H(+) (corresponding to deprotonation and coordination of cysteine thiols) that range from 9.9 to 13.9. In addition, the L26AL30C site shows dynamic behavior, which is not observed for the L12AL16C site. These results indicate that for these systems one cannot simply assign a "4-coordinate structure" and assume certain physical properties for that site since important factors such as packing of the adjacent Leu, size of the intended cavity (endo vs exo) and location of the metal site play crucial roles in determining the final properties of the bound Cd(II).

Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muccioli, G.; Guardabassi, A.; Pattono, P.

1990-03-01

The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

Study of DNA binding sites using the Rényi parametric entropy measure.

PubMed

Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

2004-04-07

Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

Structural investigation of C4b-binding protein by molecular modeling: localization of putative binding sites.

PubMed

Villoutreix, B O; Härdig, Y; Wallqvist, A; Covell, D G; García de Frutos, P; Dahlbäck, B

1998-06-01

C4b-binding protein (C4BP) contributes to the regulation of the classical pathway of the complement system and plays an important role in blood coagulation. The main human C4BP isoform is composed of one beta-chain and seven alpha-chains essentially built from three and eight complement control protein (CCP) modules, respectively, followed by a nonrepeat carboxy-terminal region involved in polymerization of the chains. C4BP is known to interact with heparin, C4b, complement factor I, serum amyloid P component, streptococcal Arp and Sir proteins, and factor VIII/VIIIa via its alpha-chains and with protein S through its beta-chain. The principal aim of the present study was to localize regions of C4BP involved in the interaction with C4b, Arp, and heparin. For this purpose, a computer model of the 8 CCP modules of C4BP alpha-chain was constructed, taking into account data from previous electron microscopy (EM) studies. This structure was investigated in the context of known and/or new experimental data. Analysis of the alpha-chain model, together with monoclonal antibody studies and heparin binding experiments, suggests that a patch of positively charged residues, at the interface between the first and second CCP modules, plays an important role in the interaction between C4BP and C4b/Arp/Sir/heparin. Putative binding sites, secondary-structure prediction for the central core, and an overall reevaluation of the size of the C4BP molecule are also presented. An understanding of these intermolecular interactions should contribute to the rational design of potential therapeutic agents aiming at interfering specifically some of these protein-protein interactions.

Dimeric Architecture of the Hendra Virus Attachment Glycoprotein: Evidence for a Conserved Mode of Assembly▿ †

PubMed Central

Bowden, Thomas A.; Crispin, Max; Harvey, David J.; Jones, E. Yvonne; Stuart, David I.

2010-01-01

Hendra virus is a negative-sense single-stranded RNA virus within the Paramyxoviridae family which, together with Nipah virus, forms the Henipavirus genus. Infection with bat-borne Hendra virus leads to a disease with high mortality rates in humans. We determined the crystal structure of the unliganded six-bladed β-propeller domain and compared it to the previously reported structure of Hendra virus attachment glycoprotein (HeV-G) in complex with its cellular receptor, ephrin-B2. As observed for the related unliganded Nipah virus structure, there is plasticity in the Glu579-Pro590 and Lys236-Ala245 ephrin-binding loops prior to receptor engagement. These data reveal that henipaviral attachment glycoproteins undergo common structural transitions upon receptor binding and further define the structural template for antihenipaviral drug design. Our analysis also provides experimental evidence for a dimeric arrangement of HeV-G that exhibits striking similarity to those observed in crystal structures of related paramyxovirus receptor-binding glycoproteins. The biological relevance of this dimer is further supported by the positional analysis of glycosylation sites from across the paramyxoviruses. In HeV-G, the sites lie away from the putative dimer interface and remain accessible to α-mannosidase processing on oligomerization. We therefore propose that the overall mode of dimer assembly is conserved for all paramyxoviruses; however, while the geometry of dimerization is rather closely similar for those viruses that bind flexible glycan receptors, significant (up to 60°) and different reconfigurations of the subunit packing (associated with a significant decrease in the size of the dimer interface) have accompanied the independent switching to high-affinity protein receptor binding in Hendra and measles viruses. PMID:20375167

SITEHOUND-web: a server for ligand binding site identification in protein structures.

PubMed

Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

2009-07-01

SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

PubMed

Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

2016-03-01

Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

Binding site and affinity prediction of general anesthetics to protein targets using docking.

PubMed

Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

2012-05-01

The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

PubMed Central

Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

2012-01-01

Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

PubMed Central

Ravindranath, Pradeep Anand; Sanner, Michel F.

2016-01-01

Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

PubMed Central

Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

2008-01-01

Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

Independent signaling by Drosophila insulin receptor for axon guidance and growth

PubMed Central

Li, Caroline R.; Guo, Dongyu; Pick, Leslie

2014-01-01

The Drosophila insulin receptor (DInR) regulates a diverse array of biological processes including growth, axon guidance, and sugar homeostasis. Growth regulation by DInR is mediated by Chico, the Drosophila homolog of vertebrate insulin receptor substrate proteins IRS1–4. In contrast, DInR regulation of photoreceptor axon guidance in the developing visual system is mediated by the SH2-SH3 domain adaptor protein Dreadlocks (Dock). In vitro studies by others identified five NPXY motifs, one in the juxtamembrane region and four in the signaling C-terminal tail (C-tail), important for interaction with Chico. Here we used yeast two-hybrid assays to identify regions in the DInR C-tail that interact with Dock. These Dock binding sites were in separate portions of the C-tail from the previously identified Chico binding sites. To test whether these sites are required for growth or axon guidance in whole animals, a panel of DInR proteins, in which the putative Chico and Dock interaction sites had been mutated individually or in combination, were tested for their ability to rescue viability, growth and axon guidance defects of dinr mutant flies. Sites required for viability were identified. Unexpectedly, mutation of both putative Dock binding sites, either individually or in combination, did not lead to defects in photoreceptor axon guidance. Thus, either sites also required for viability are necessary for DInR function in axon guidance and/or there is redundancy built into the DInR/Dock interaction such that Dock is able to interact with multiple regions of DInR. We also found that simultaneous mutation of all five NPXY motifs implicated in Chico interaction drastically decreased growth in both male and female adult flies. These animals resembled chico mutants, supporting the notion that DInR interacts directly with Chico in vivo to control body size. Mutation of these five NPXY motifs did not affect photoreceptor axon guidance, segregating the roles of DInR in the processes of growth and axon guidance. PMID:24478707

Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

PubMed

Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

2006-04-15

We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

PubMed Central

Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

2015-01-01

Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

Mechanism of human antibody-mediated neutralization of Marburg virus.

PubMed

Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

2015-02-26

The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

PubMed

Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

2013-02-21

Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

Lessons from Hot Spot Analysis for Fragment-Based Drug Discovery.

PubMed

Hall, David R; Kozakov, Dima; Whitty, Adrian; Vajda, Sandor

2015-11-01

Analysis of binding energy hot spots at protein surfaces can provide crucial insights into the prospects for successful application of fragment-based drug discovery (FBDD), and whether a fragment hit can be advanced into a high-affinity, drug-like ligand. The key factor is the strength of the top ranking hot spot, and how well a given fragment complements it. We show that published data are sufficient to provide a sophisticated and quantitative understanding of how hot spots derive from a protein 3D structure, and how their strength, number, and spatial arrangement govern the potential for a surface site to bind to fragment-sized and larger ligands. This improved understanding provides important guidance for the effective application of FBDD in drug discovery. Copyright © 2015 Elsevier Ltd. All rights reserved.

Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Souza, E.B.; Kuyatt, B.L.

1987-01-01

Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less