Sample records for binding sites analysis

  1. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  2. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  4. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  5. A web server for analysis, comparison and prediction of protein ligand binding sites.

    PubMed

    Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

    2016-03-25

    One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

  6. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  7. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

    PubMed Central

    Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

    2011-01-01

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

  9. Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

    PubMed

    Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

    2011-01-14

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

  10. Dynamic motif occupancy (DynaMO) analysis identifies transcription factors and their binding sites driving dynamic biological processes

    PubMed Central

    Kuang, Zheng; Ji, Zhicheng

    2018-01-01

    Abstract Biological processes are usually associated with genome-wide remodeling of transcription driven by transcription factors (TFs). Identifying key TFs and their spatiotemporal binding patterns are indispensable to understanding how dynamic processes are programmed. However, most methods are designed to predict TF binding sites only. We present a computational method, dynamic motif occupancy analysis (DynaMO), to infer important TFs and their spatiotemporal binding activities in dynamic biological processes using chromatin profiling data from multiple biological conditions such as time-course histone modification ChIP-seq data. In the first step, DynaMO predicts TF binding sites with a random forests approach. Next and uniquely, DynaMO infers dynamic TF binding activities at predicted binding sites using their local chromatin profiles from multiple biological conditions. Another landmark of DynaMO is to identify key TFs in a dynamic process using a clustering and enrichment analysis of dynamic TF binding patterns. Application of DynaMO to the yeast ultradian cycle, mouse circadian clock and human neural differentiation exhibits its accuracy and versatility. We anticipate DynaMO will be generally useful for elucidating transcriptional programs in dynamic processes. PMID:29325176

  11. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  12. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  13. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  14. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  15. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  16. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  17. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  18. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    PubMed

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  19. Dynamic motif occupancy (DynaMO) analysis identifies transcription factors and their binding sites driving dynamic biological processes.

    PubMed

    Kuang, Zheng; Ji, Zhicheng; Boeke, Jef D; Ji, Hongkai

    2018-01-09

    Biological processes are usually associated with genome-wide remodeling of transcription driven by transcription factors (TFs). Identifying key TFs and their spatiotemporal binding patterns are indispensable to understanding how dynamic processes are programmed. However, most methods are designed to predict TF binding sites only. We present a computational method, dynamic motif occupancy analysis (DynaMO), to infer important TFs and their spatiotemporal binding activities in dynamic biological processes using chromatin profiling data from multiple biological conditions such as time-course histone modification ChIP-seq data. In the first step, DynaMO predicts TF binding sites with a random forests approach. Next and uniquely, DynaMO infers dynamic TF binding activities at predicted binding sites using their local chromatin profiles from multiple biological conditions. Another landmark of DynaMO is to identify key TFs in a dynamic process using a clustering and enrichment analysis of dynamic TF binding patterns. Application of DynaMO to the yeast ultradian cycle, mouse circadian clock and human neural differentiation exhibits its accuracy and versatility. We anticipate DynaMO will be generally useful for elucidating transcriptional programs in dynamic processes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  1. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  2. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  3. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  4. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  5. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  6. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  7. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  8. Binding of fluoresceinated epidermal growth factor to A431 cell sub-populations studied using a model-independent analysis of flow cytometric fluorescence data.

    PubMed Central

    Chatelier, R C; Ashcroft, R G; Lloyd, C J; Nice, E C; Whitehead, R H; Sawyer, W H; Burgess, A W

    1986-01-01

    A method is developed for determining ligand-cell association parameters from a model-free analysis of data obtained with a flow cytometer. The method requires measurement of the average fluorescence per cell as a function of ligand and cell concentration. The analysis is applied to data obtained for the binding of fluoresceinated epidermal growth factor to a human epidermoid carcinoma cell line, A431. The results indicate that the growth factor binds to two classes of sites on A431 cells: 4 X 10(4) sites with a dissociation constant (KD) of less than or equal to 20 pM, and 1.5 X 10(6) sites with a KD of 3.7 nM. A derived plot of the average fluorescence per cell versus the average number of bound ligands per cell is used to construct binding isotherms for four sub-populations of A431 cells fractionated on the basis of low-angle light scatter. The four sub-populations bind the ligand with equal affinity but differ substantially in terms of the number of binding sites per cell. We also use this new analysis to critically evaluate the use of 'Fluorotrol' as a calibration standard in flow cytometry. PMID:3015587

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN

    Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less

  10. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  11. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  12. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  13. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  14. Identical linkage and cooperativity of oxygen and carbon monoxide binding to Octopus dofleini hemocyanin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Connelly, P.R.; Gill, S.J.; Miller, K.I.

    1989-02-21

    Employment of high-precision thin-layer methods has enabled detailed functional characterization of oxygen and carbon monoxide binding for (1) the fully assembled form with 70 binding sites and (2) the isolated chains with 7 binding sites of octopus dofleini hemocyanin. The striking difference in the cooperativities of the two ligands for the assembled decamer is revealed through an examination of the binding capacities and the partition coefficient, determined as functions of the activities of both ligands. A global analysis of the data sets supported by a two-state allosteric model assuming an allosteric unit of 7. Higher level allosteric interactions were notmore » indicated. This contrasts to results obtained for arthropod hemocyanins. Oxygen and carbon monoxide experiments performed on the isolated subunit chain confirmed the presence of functional heterogeneity reported previously. The analysis shows two types of binding sites in the ratio of 4:3.« less

  15. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  16. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  17. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  18. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  19. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  20. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  1. Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

    PubMed Central

    Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

    2014-01-01

    Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

  2. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  3. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  4. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  5. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  6. Exploration of gated ligand binding recognizes an allosteric site for blocking FABP4-protein interaction.

    PubMed

    Li, Yan; Li, Xiang; Dong, Zigang

    2015-12-28

    Fatty acid binding protein 4 (FABP4), reversibly binding to fatty acids and other lipids with high affinities, is a potential target for treatment of cancers. The binding site of FABP4 is buried in an interior cavity and thereby ligand binding/unbinding is coupled with opening/closing of FABP4. It is a difficult task both experimentally and computationally to illuminate the entry or exit pathway, especially with the conformational gating. In this report we combine extensive computer simulations, clustering analysis, and the Markov state model to investigate the binding mechanism of FABP4 and troglitazone. Our simulations capture spontaneous binding and unbinding events as well as the conformational transition of FABP4 between the open and closed states. An allosteric binding site on the protein surface is recognized for the development of novel FABP4 inhibitors. The binding affinity is calculated and compared with the experimental value. The kinetic analysis suggests that ligand residence on the protein surface may delay the binding process. Overall, our results provide a comprehensive picture of ligand diffusion on the protein surface, ligand migration into the buried cavity, and the conformational change of FABP4 at an atomic level.

  7. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  8. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  9. Analysis of an artificial zinc finger epigenetic modulator: widespread binding but limited regulation

    PubMed Central

    Grimmer, Matthew R.; Stolzenburg, Sabine; Ford, Ethan; Lister, Ryan; Blancafort, Pilar; Farnham, Peggy J.

    2014-01-01

    Artificial transcription factors (ATFs) and genomic nucleases based on a DNA binding platform consisting of multiple zinc finger domains are currently being developed for clinical applications. However, no genome-wide investigations into their binding specificity have been performed. We have created six-finger ATFs to target two different 18 nt regions of the human SOX2 promoter; each ATF is constructed such that it contains or lacks a super KRAB domain (SKD) that interacts with a complex containing repressive histone methyltransferases. ChIP-seq analysis of the effector-free ATFs in MCF7 breast cancer cells identified thousands of binding sites, mostly in promoter regions; the addition of an SKD domain increased the number of binding sites ∼5-fold, with a majority of the new sites located outside of promoters. De novo motif analyses suggest that the lack of binding specificity is due to subsets of the finger domains being used for genomic interactions. Although the ATFs display widespread binding, few genes showed expression differences; genes repressed by the ATF-SKD have stronger binding sites and are more enriched for a 12 nt motif. Interestingly, epigenetic analyses indicate that the transcriptional repression caused by the ATF-SKD is not due to changes in active histone modifications. PMID:25122745

  10. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  11. Analysis of factors influencing hydration site prediction based on molecular dynamics simulations.

    PubMed

    Yang, Ying; Hu, Bingjie; Lill, Markus A

    2014-10-27

    Water contributes significantly to the binding of small molecules to proteins in biochemical systems. Molecular dynamics (MD) simulation based programs such as WaterMap and WATsite have been used to probe the locations and thermodynamic properties of hydration sites at the surface or in the binding site of proteins generating important information for structure-based drug design. However, questions associated with the influence of the simulation protocol on hydration site analysis remain. In this study, we use WATsite to investigate the influence of factors such as simulation length and variations in initial protein conformations on hydration site prediction. We find that 4 ns MD simulation is appropriate to obtain a reliable prediction of the locations and thermodynamic properties of hydration sites. In addition, hydration site prediction can be largely affected by the initial protein conformations used for MD simulations. Here, we provide a first quantification of this effect and further indicate that similar conformations of binding site residues (RMSD < 0.5 Å) are required to obtain consistent hydration site predictions.

  12. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  13. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  14. Global Mapping of Transcription Factor Binding Sites by Sequencing Chromatin Surrogates: a Perspective on Experimental Design, Data Analysis, and Open Problems.

    PubMed

    Wei, Yingying; Wu, George; Ji, Hongkai

    2013-05-01

    Mapping genome-wide binding sites of all transcription factors (TFs) in all biological contexts is a critical step toward understanding gene regulation. The state-of-the-art technologies for mapping transcription factor binding sites (TFBSs) couple chromatin immunoprecipitation (ChIP) with high-throughput sequencing (ChIP-seq) or tiling array hybridization (ChIP-chip). These technologies have limitations: they are low-throughput with respect to surveying many TFs. Recent advances in genome-wide chromatin profiling, including development of technologies such as DNase-seq, FAIRE-seq and ChIP-seq for histone modifications, make it possible to predict in vivo TFBSs by analyzing chromatin features at computationally determined DNA motif sites. This promising new approach may allow researchers to monitor the genome-wide binding sites of many TFs simultaneously. In this article, we discuss various experimental design and data analysis issues that arise when applying this approach. Through a systematic analysis of the data from the Encyclopedia Of DNA Elements (ENCODE) project, we compare the predictive power of individual and combinations of chromatin marks using supervised and unsupervised learning methods, and evaluate the value of integrating information from public ChIP and gene expression data. We also highlight the challenges and opportunities for developing novel analytical methods, such as resolving the one-motif-multiple-TF ambiguity and distinguishing functional and non-functional TF binding targets from the predicted binding sites. The online version of this article (doi:10.1007/s12561-012-9066-5) contains supplementary material, which is available to authorized users.

  15. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  16. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  17. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

    2004-08-06

    The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

  18. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  19. Genome-wide analysis of AR binding and comparison with transcript expression in primary human fetal prostate fibroblasts and cancer associated fibroblasts.

    PubMed

    Nash, Claire; Boufaied, Nadia; Mills, Ian G; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

    2017-05-05

    The androgen receptor (AR) is a transcription factor, and key regulator of prostate development and cancer, which has discrete functions in stromal versus epithelial cells. AR expressed in mesenchyme is necessary and sufficient for prostate development while loss of stromal AR is predictive of prostate cancer progression. Many studies have characterized genome-wide binding of AR in prostate tumour cells but none have used primary mesenchyme or stroma. We applied ChIPseq to identify genomic AR binding sites in primary human fetal prostate fibroblasts and patient derived cancer associated fibroblasts, as well as the WPMY1 cell line overexpressing AR. We identified AR binding sites that were specific to fetal prostate fibroblasts (7534), cancer fibroblasts (629), WPMY1-AR (2561) as well as those common among all (783). Primary fibroblasts had a distinct AR binding profile versus prostate cancer cell lines and tissue, and showed a localisation to gene promoter binding sites 1 kb upstream of the transcriptional start site, as well as non-classical AR binding sequence motifs. We used RNAseq to define transcribed genes associated with AR binding sites and derived cistromes for embryonic and cancer fibroblasts as well as a cistrome common to both. These were compared to several in vivo ChIPseq and transcript expression datasets; which identified subsets of AR targets that were expressed in vivo and regulated by androgens. This analysis enabled us to deconvolute stromal AR targets active in stroma within tumour samples. Taken together, our data suggest that the AR shows significantly different genomic binding site locations in primary prostate fibroblasts compared to that observed in tumour cells. Validation of our AR binding site data with transcript expression in vitro and in vivo suggests that the AR target genes we have identified in primary fibroblasts may contribute to clinically significant and biologically important AR-regulated changes in prostate tissue. Copyright © 2017. Published by Elsevier B.V.

  20. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  2. Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

    PubMed

    Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

    2015-09-10

    The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

  3. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  4. pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families

    PubMed Central

    Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas

    2014-01-01

    The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248

  5. Carbohydrate binding sites in a pancreatic alpha-amylase-substrate complex, derived from X-ray structure analysis at 2.1 A resolution.

    PubMed Central

    Qian, M.; Haser, R.; Payan, F.

    1995-01-01

    The X-ray structure analysis of a crystal of pig pancreatic alpha-amylase (PPA, EC 3.2.1.1.) that was soaked with the substrate maltopentaose showed electron density corresponding to two independent carbohydrate recognition sites on the surface of the molecule. Both binding sites are distinct from the active site described in detail in our previous high-resolution study of a complex between PPA and a carbohydrate inhibitor (Qian M, Buisson G, Duée E, Haser H, Payan F, 1994, Biochemistry 33:6284-6294). One of the binding sites previously identified in a 5-A-resolution electron density map, lies at a distance of 20 A from the active site cleft and can accommodate two glucose units. The second affinity site for sugar units is located close to the calcium binding site. The crystal structure of the maltopentaose complex was refined at 2.1 A resolution, to an R-factor of 17.5%, with an RMS deviation in bond distances of 0.007 A. The model includes all 496 residues of the enzyme, 1 calcium ion, 1 chloride ion, 425 water molecules, and 3 bound sugar rings. The binding sites are characterized and described in detail. The present complex structure provides the evidence of an increased stability of the structure upon interaction with the substrate and allows identification of an N-terminal pyrrolidonecarboxylic acid in PPA. PMID:7613472

  6. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  7. LncRNA/DNA binding analysis reveals losses and gains and lineage specificity of genomic imprinting in mammals.

    PubMed

    Liu, Haihua; Shang, Xiaoxiao; Zhu, Hao

    2017-05-15

    Genomic imprinting is regulated by lncRNAs and is important for embryogenesis, physiology and behaviour in mammals. Aberrant imprinting causes diseases and disorders. Experimental studies have examined genomic imprinting primarily in humans and mice, thus leaving some fundamental issues poorly addressed. The cost of experimentally examining imprinted genes in many tissues in diverse species makes computational analysis of lncRNAs' DNA binding sites valuable. We performed lncRNA/DNA binding analysis in imprinting clusters from multiple mammalian clades and discovered the following: (i) lncRNAs and imprinting sites show significant losses and gains and distinct lineage-specificity; (ii) binding of lncRNAs to promoters of imprinted genes may occur widely throughout the genome; (iii) a considerable number of imprinting sites occur in only evolutionarily more derived species; and (iv) multiple lncRNAs may bind to the same imprinting sites, and some lncRNAs have multiple DNA binding motifs. These results suggest that the occurrence of abundant lncRNAs in mammalian genomes makes genomic imprinting a mechanism of adaptive evolution at the epigenome level. The data and program are available at the database LongMan at lncRNA.smu.edu.cn. zhuhao@smu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  8. Elucidating the druggable interface of protein-protein interactions using fragment docking and coevolutionary analysis.

    PubMed

    Bai, Fang; Morcos, Faruck; Cheng, Ryan R; Jiang, Hualiang; Onuchic, José N

    2016-12-13

    Protein-protein interactions play a central role in cellular function. Improving the understanding of complex formation has many practical applications, including the rational design of new therapeutic agents and the mechanisms governing signal transduction networks. The generally large, flat, and relatively featureless binding sites of protein complexes pose many challenges for drug design. Fragment docking and direct coupling analysis are used in an integrated computational method to estimate druggable protein-protein interfaces. (i) This method explores the binding of fragment-sized molecular probes on the protein surface using a molecular docking-based screen. (ii) The energetically favorable binding sites of the probes, called hot spots, are spatially clustered to map out candidate binding sites on the protein surface. (iii) A coevolution-based interface interaction score is used to discriminate between different candidate binding sites, yielding potential interfacial targets for therapeutic drug design. This approach is validated for important, well-studied disease-related proteins with known pharmaceutical targets, and also identifies targets that have yet to be studied. Moreover, therapeutic agents are proposed by chemically connecting the fragments that are strongly bound to the hot spots.

  9. X-ray Crystallographic Analysis of [alpha]-Ketoheterocycle Inhibitors Bound to a Humanized Variant of Fatty Acid Amide Hydrolase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mileni, Mauro; Garfunkle, Joie; Ezzili, Cyrine

    2010-11-03

    Three cocrystal X-ray structures of the {alpha}-ketoheterocycle inhibitors 3-5 bound to a humanized variant of fatty acid amide hydrolase (FAAH) are disclosed and comparatively discussed alongside those of 1 (OL-135) and its isomer 2. These five X-ray structures systematically probe each of the three active site regions key to substrate or inhibitor binding: (1) the conformationally mobile acyl chain-binding pocket and membrane access channel responsible for fatty acid amide substrate and inhibitor acyl chain binding, (2) the atypical active site catalytic residues and surrounding oxyanion hole that covalently binds the core of the {alpha}-ketoheterocycle inhibitors captured as deprotonated hemiketals mimickingmore » the tetrahedral intermediate of the enzyme-catalyzed reaction, and (3) the cytosolic port and its uniquely important imbedded ordered water molecules and a newly identified anion binding site. The detailed analysis of their key active site interactions and their implications on the interpretation of the available structure-activity relationships are discussed providing important insights for future design.« less

  10. Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

    PubMed Central

    Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

    2014-01-01

    Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  12. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  13. Increased thyrotropin binding in hyperfunctioning thyroid nodules.

    PubMed

    Müller-Gärtner, H W; Schneider, C; Bay, V; Tadt, A; Rehpenning, W; de Heer, K; Jessel, M

    1987-08-01

    The object of this study was to investigate TSH receptors in hyperfunctioning thyroid nodules (HFN). In HFN, obtained from seven patients, 125-I-TSH binding as determined by equilibrium binding analysis on particulate membrane preparations, was found to be significantly increased as compared with normal thyroid tissues (five patients; P less than 0.001). Scatchard analysis of TSH-binding revealed two kinds of binding sites for both normal thyroid tissue and HFN, and displayed significantly increased association constants of high- and low-affinity binding sites in HFN (Ka = 11.75 +/- 6.8 10(9) M-1, P less than 0.001 and Ka = 2.1 +/- 1.0 10(7) M-1, P less than 0.025; x +/- SEM) as compared with normal thyroid tissue (Ka = 0.25 +/- 0.06 10(9) M-1, Ka = 0.14 +/- 0.03 10(7) M-1; x +/- SEM). The capacity of the high-affinity binding sites in HFN was found to be decreased (1.8 +/- 1.1 pmol/mg protein, x +/- SEM) in comparison with normal thyroid tissue (4.26 +/- 1.27 pmol/mg protein; x +/- SEM). TSH-receptor autoradiography applied to cryostatic tissue sections confirmed increased TSH binding of the follicular epithelium in HFN. These data suggest that an increased affinity of TSH-receptor sites in HFN in iodine deficient areas may be an important event in thyroid autonomy.

  14. Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.

    PubMed Central

    Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N

    1989-01-01

    Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  16. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  17. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

    2004-08-06

    Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

  18. An integrated workflow for analysis of ChIP-chip data.

    PubMed

    Weigelt, Karin; Moehle, Christoph; Stempfl, Thomas; Weber, Bernhard; Langmann, Thomas

    2008-08-01

    Although ChIP-chip is a powerful tool for genome-wide discovery of transcription factor target genes, the steps involving raw data analysis, identification of promoters, and correlation with binding sites are still laborious processes. Therefore, we report an integrated workflow for the analysis of promoter tiling arrays with the Genomatix ChipInspector system. We compare this tool with open-source software packages to identify PU.1 regulated genes in mouse macrophages. Our results suggest that ChipInspector data analysis, comparative genomics for binding site prediction, and pathway/network modeling significantly facilitate and enhance whole-genome promoter profiling to reveal in vivo sites of transcription factor-DNA interactions.

  19. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  20. Analysis of Factors Influencing Hydration Site Prediction Based on Molecular Dynamics Simulations

    PubMed Central

    2015-01-01

    Water contributes significantly to the binding of small molecules to proteins in biochemical systems. Molecular dynamics (MD) simulation based programs such as WaterMap and WATsite have been used to probe the locations and thermodynamic properties of hydration sites at the surface or in the binding site of proteins generating important information for structure-based drug design. However, questions associated with the influence of the simulation protocol on hydration site analysis remain. In this study, we use WATsite to investigate the influence of factors such as simulation length and variations in initial protein conformations on hydration site prediction. We find that 4 ns MD simulation is appropriate to obtain a reliable prediction of the locations and thermodynamic properties of hydration sites. In addition, hydration site prediction can be largely affected by the initial protein conformations used for MD simulations. Here, we provide a first quantification of this effect and further indicate that similar conformations of binding site residues (RMSD < 0.5 Å) are required to obtain consistent hydration site predictions. PMID:25252619

  1. Specific strychnine binding sites on acrosome-associated membranes of golden hamster spermatozoa.

    PubMed

    Llanos, Miguel N; Ronco, Ana M; Aguirre, María C

    2003-06-27

    This study demonstrates for the first time, that membrane vesicles originated from the hamster sperm head after the occurrence of the acrosome reaction, possess specific strychnine binding sites. [3H]Strychnine binding was saturable and reversible, being displaced by unlabeled strychnine (IC(50)=26.7+/-2.3 microM). Kinetic analysis revealed one binding site with K(d)=120nM and B(max)=142fmol/10(6) spermatozoa. Glycine receptor agonists beta-alanine and taurine inhibited strychnine binding by 20-30%. Surprisingly, glycine stimulated binding by about 40-50%. Results obtained in this study strongly suggest the presence of glycine receptors-with distinctive kinetic properties on the periacrosomal plasma membrane of hamster spermatozoa. Localization of this receptor fits well with its previously proposed role in acrosomal exocytosis during mammalian fertilization.

  2. Purification and sequencing of the active site tryptic peptide from penicillin-binding protein 1b of Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nicholas, R.A.; Suzuki, H.; Hirota, Y.

    This paper reports the sequence of the active site peptide of penicillin-binding protein 1b from Escherichia coli. Purified penicillin-binding protein 1b was labeled with (/sup 14/C)penicillin G, digested with trypsin, and partially purified by gel filtration. Upon further purification by high-pressure liquid chromatography, two radioactive peaks were observed, and the major peak, representing over 75% of the applied radioactivity, was submitted to amino acid analysis and sequencing. The sequence Ser-Ile-Gly-Ser-Leu-Ala-Lys was obtained. The active site nucleophile was identified by digesting the purified peptide with aminopeptidase M and separating the radioactive products on high-pressure liquid chromatography. Amino acid analysis confirmed thatmore » the serine residue in the middle of the sequence was covalently bonded to the (/sup 14/C)penicilloyl moiety. A comparison of this sequence to active site sequences of other penicillin-binding proteins and beta-lactamases is presented.« less

  3. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  4. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  5. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  6. Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

    PubMed

    Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

    2015-09-01

    The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

  7. Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

    PubMed Central

    Zhao, A; Guo, A; Liu, Z; Pape, L

    1997-01-01

    The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

  8. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  9. A novel methodological approach for the analysis of host-ligand interactions.

    PubMed

    Strat, Daniela; Missailidis, Sotiris; Drake, Alex F

    2007-02-02

    Traditional analysis of drug-binding data relies upon the Scatchard formalism. These methods rely upon the fitting of a linear equation providing intercept and gradient data that relate to physical properties, such as the binding constant, cooperativity coefficients and number of binding sites. However, the existence of different binding modes with different binding constants makes the implementation of these models difficult. This article describes a novel approach to the binding model of host-ligand interactions by using a derived analytical function describing the observed signal. The benefit of this method is that physically significant parameters, that is, binding constants and number of binding sites, are automatically derived by the use of a minimisation routine. This methodology was utilised to analyse the interactions between a novel antitumour agent and DNA. An optical spectroscopy study confirms that the pentacyclic acridine derivative (DH208) binds to nucleic acids. Two binding modes can be identified: a stronger one that involves intercalation and a weaker one that involves oriented outer-sphere binding. In both cases the plane of the bound acridine ring is parallel to the nucleic acid bases, orthogonal to the phosphate backbone. Ultraviolet (UV) and circular dichroism (CD) data were fitted using the proposed model. The binding constants and the number of binding sites derived from the model remained consistent across the different techniques used. The different wavelengths at which the measurements were made maintained the coherence of the results.

  10. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  11. Characterization of a protein that binds multiple sequences in mammalian type C retrovirus enhancers.

    PubMed Central

    Sun, W; O'Connell, M; Speck, N A

    1993-01-01

    Mammalian type C retrovirus enhancer factor 1 (MCREF-1) is a nuclear protein that binds several directly repeated sequences (CNGGN6CNGG) in the Moloney and Friend murine leukemia virus (MLV) enhancers (N. R. Manley, M. O'Connell, W. Sun, N. A. Speck, and N. Hopkins, J. Virol. 67:1967-1975, 1993). In this paper, we describe the partial purification of MCREF-1 from calf thymus nuclei and further characterize the binding properties of MCREF-1. MCREF-1 binds four sites in the Moloney MLV enhancer and three sites in the Friend MLV enhancer. Ethylation interference analysis suggests that the MCREF-1 binding site spans two adjacent minor grooves of DNA. Images PMID:8445719

  12. MDB: the Metalloprotein Database and Browser at The Scripps Research Institute

    PubMed Central

    Castagnetto, Jesus M.; Hennessy, Sean W.; Roberts, Victoria A.; Getzoff, Elizabeth D.; Tainer, John A.; Pique, Michael E.

    2002-01-01

    The Metalloprotein Database and Browser (MDB; http://metallo.scripps.edu) at The Scripps Research Institute is a web-accessible resource for metalloprotein research. It offers the scientific community quantitative information on geometrical parameters of metal-binding sites in protein structures available from the Protein Data Bank (PDB). The MDB also offers analytical tools for the examination of trends or patterns in the indexed metal-binding sites. A user can perform interactive searches, metal-site structure visualization (via a Java applet), and analysis of the quantitative data by accessing the MDB through a web browser without requiring an external application or platform-dependent plugin. The MDB also has a non-interactive interface with which other web sites and network-aware applications can seamlessly incorporate data or statistical analysis results from metal-binding sites. The information contained in the MDB is periodically updated with automated algorithms that find and index metal sites from new protein structures released by the PDB. PMID:11752342

  13. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  14. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  15. ProMateus—an open research approach to protein-binding sites analysis

    PubMed Central

    Neuvirth, Hani; Heinemann, Uri; Birnbaum, David; Tishby, Naftali; Schreiber, Gideon

    2007-01-01

    The development of bioinformatic tools by individual labs results in the abundance of parallel programs for the same task. For example, identification of binding site regions between interacting proteins is done using: ProMate, WHISCY, PPI-Pred, PINUP and others. All servers first identify unique properties of binding sites and then incorporate them into a predictor. Obviously, the resulting prediction would improve if the most suitable parameters from each of those predictors would be incorporated into one server. However, because of the variation in methods and databases, this is currently not feasible. Here, the protein-binding site prediction server is extended into a general protein-binding sites research tool, ProMateus. This web tool, based on ProMate's infrastructure enables the easy exploration and incorporation of new features and databases by the user, providing an evaluation of the benefit of individual features and their combination within a set framework. This transforms the individual research into a community exercise, bringing out the best from all users for optimized predictions. The analysis is demonstrated on a database of protein protein and protein-DNA interactions. This approach is basically different from that used in generating meta-servers. The implications of the open-research approach are discussed. ProMateus is available at http://bip.weizmann.ac.il/promate. PMID:17488838

  16. pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families.

    PubMed

    Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas

    2014-07-01

    The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Analysis of flavin oxidation and electron-transfer inhibition in Plasmodium falciparum dihydroorotate dehydrogenase.

    PubMed

    Malmquist, Nicholas A; Gujjar, Ramesh; Rathod, Pradipsinh K; Phillips, Margaret A

    2008-02-26

    Plasmodium falciparum dihydroorotate dehydrogenase (pfDHODH) is a flavin-dependent mitochondrial enzyme that provides the only route to pyrimidine biosynthesis in the parasite. Clinically significant inhibitors of human DHODH (e.g., A77 1726) bind to a pocket on the opposite face of the flavin cofactor from dihydroorotate (DHO). This pocket demonstrates considerable sequence variability, which has allowed species-specific inhibitors of the malarial enzyme to be identified. Ubiquinone (CoQ), the physiological oxidant in the reaction, has been postulated to bind this site despite a lack of structural evidence. To more clearly define the residues involved in CoQ binding and catalysis, we undertook site-directed mutagenesis of seven residues in the structurally defined A77 1726 binding site, which we term the species-selective inhibitor site. Mutation of several of these residues (H185, F188, and F227) to Ala substantially decreased the affinity of pfDHODH-specific inhibitors (40-240-fold). In contrast, only a modest increase in the Kmapp for CoQ was observed, although mutation of Y528 in particular caused a substantial reduction in kcat (40-100-fold decrease). Pre-steady-state kinetic analysis by single wavelength stopped-flow spectroscopy showed that the mutations had no effect on the rate of the DHO-dependent reductive half-reaction, but most reduced the rate of the CoQ-dependent flavin oxidation step (3-20-fold decrease), while not significantly altering the Kdox for CoQ. As with the mutants, inhibitors that bind this site block the CoQ-dependent oxidative half-reaction without affecting the DHO-dependent step. These results identify residues involved in inhibitor binding and electron transfer to CoQ. Importantly, the data provide compelling evidence that the binding sites for CoQ and species-selective site inhibitors do not overlap, and they suggest instead that inhibitors act either by blocking the electron path between flavin and CoQ or by stabilizing a conformation that excludes CoQ binding.

  18. Site-specific protein backbone and side-chain NMR chemical shift and relaxation analysis of human vinexin SH3 domain using a genetically encoded {sup 15}N/{sup 19}F-labeled unnatural amino acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Pan; School of Life Science, University of Science and Technology of China, Hefei, Anhui 230026; Xi, Zhaoyong

    Research highlights: {yields} Chemical synthesis of {sup 15}N/{sup 19}F-trifluomethyl phenylalanine. {yields} Site-specific incorporation of {sup 15}N/{sup 19}F-trifluomethyl phenylalanine to SH3. {yields} Site-specific backbone and side chain chemical shift and relaxation analysis. {yields} Different internal motions at different sites of SH3 domain upon ligand binding. -- Abstract: SH3 is a ubiquitous domain mediating protein-protein interactions. Recent solution NMR structural studies have shown that a proline-rich peptide is capable of binding to the human vinexin SH3 domain. Here, an orthogonal amber tRNA/tRNA synthetase pair for {sup 15}N/{sup 19}F-trifluoromethyl-phenylalanine ({sup 15}N/{sup 19}F-tfmF) has been applied to achieve site-specific labeling of SH3 at threemore » different sites. One-dimensional solution NMR spectra of backbone amide ({sup 15}N){sup 1}H and side-chain {sup 19}F were obtained for SH3 with three different site-specific labels. Site-specific backbone amide ({sup 15}N){sup 1}H and side-chain {sup 19}F chemical shift and relaxation analysis of SH3 in the absence or presence of a peptide ligand demonstrated different internal motions upon ligand binding at the three different sites. This site-specific NMR analysis might be very useful for studying large-sized proteins or protein complexes.« less

  19. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  20. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  1. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  2. Comprehensive meta-analysis of Signal Transducers and Activators of Transcription (STAT) genomic binding patterns discerns cell-specific cis-regulatory modules

    PubMed Central

    2013-01-01

    Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription) family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM), which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors. PMID:23324445

  3. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

    PubMed

    Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

    2010-08-03

    Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  4. Analysis of a two-domain binding site for the urokinase-type plasminogen activator-plasminogen activator inhibitor-1 complex in low-density-lipoprotein-receptor-related protein.

    PubMed

    Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C

    2001-07-01

    The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.

  5. Photoactivable antibody binding protein: site-selective and covalent coupling of antibody.

    PubMed

    Jung, Yongwon; Lee, Jeong Min; Kim, Jung-won; Yoon, Jeongwon; Cho, Hyunmin; Chung, Bong Hyun

    2009-02-01

    Here we report new photoactivable antibody binding proteins, which site-selectively capture antibodies and form covalent conjugates with captured antibodies upon irradiation. The proteins allow the site-selective tagging and/or immobilization of antibodies with a highly preferred orientation and omit the need for prior antibody modifications. The minimal Fc-binding domain of protein G, a widely used antibody binding protein, was genetically and chemically engineered to contain a site-specific photo cross-linker, benzophenone. In addition, the domain was further mutated to have an enhanced Fc-targeting ability. This small engineered protein was successfully cross-linked only to the Fc region of the antibody without any nonspecific reactivity. SPR analysis indicated that antibodies can be site-selectively biotinylated through the present photoactivable protein. Furthermore, the system enabled light-induced covalent immobilization of antibodies directly on various solid surfaces, such as those of glass slides, gold chips, and small particles. Antibody coupling via photoactivable antibody binding proteins overcomes several limitations of conventional approaches, such as random chemical reactions or reversible protein binding, and offers a versatile tool for the field of immunosensors.

  6. Characterization of interaction between doxycycline and human serum albumin by capillary electrophoresis-frontal analysis.

    PubMed

    Sun, Hanwen; He, Pan

    2009-06-01

    The binding of doxycycline to HSA under simulated physiological conditions (pH 7.4, 67 mM phosphate, I=0.17, drug concentration 100 microM, HSA concentration up to 475 microM, 36.5 degrees C) was studied by CE-frontal analysis. The number of primary binding sites, binding constant and physiological protein-binding percentage were 1.9, 1.51 x 10(3) M(-1) and 59.80%, respectively. In addition, the thermodynamic parameters including enthalpy change (DeltaH), entropy change (DeltaS) and free energy change (DeltaG) of the reaction were obtained in order to characterize the acting forces between doxycycline and HSA. Furthermore, to better understand the nature of doxycycline-HSA binding and to get information about potential interaction with other drugs, displacement experiments were performed. The results showed that doxycycline binds at site II of HSA.

  7. Analogs of methyllycaconitine as novel noncompetitive inhibitors of nicotinic receptors: pharmacological characterization, computational modeling, and pharmacophore development.

    PubMed

    McKay, Dennis B; Chang, Cheng; González-Cestari, Tatiana F; McKay, Susan B; El-Hajj, Raed A; Bryant, Darrell L; Zhu, Michael X; Swaan, Peter W; Arason, Kristjan M; Pulipaka, Aravinda B; Orac, Crina M; Bergmeier, Stephen C

    2007-05-01

    As a novel approach to drug discovery involving neuronal nicotinic acetylcholine receptors (nAChRs), our laboratory targeted nonagonist binding sites (i.e., noncompetitive binding sites, negative allosteric binding sites) located on nAChRs. Cultured bovine adrenal cells were used as neuronal models to investigate interactions of 67 analogs of methyllycaconitine (MLA) on native alpha3beta4* nAChRs. The availability of large numbers of structurally related molecules presents a unique opportunity for the development of pharmacophore models for noncompetitive binding sites. Our MLA analogs inhibited nicotine-mediated functional activation of both native and recombinant alpha3beta4* nAChRs with a wide range of IC(50) values (0.9-115 microM). These analogs had little or no inhibitory effects on agonist binding to native or recombinant nAChRs, supporting noncompetitive inhibitory activity. Based on these data, two highly predictive 3D quantitative structure-activity relationship (comparative molecular field analysis and comparative molecular similarity index analysis) models were generated. These computational models were successfully validated and provided insights into the molecular interactions of MLA analogs with nAChRs. In addition, a pharmacophore model was constructed to analyze and visualize the binding requirements to the analog binding site. The pharmacophore model was subsequently applied to search structurally diverse molecular databases to prospectively identify novel inhibitors. The rapid identification of eight molecules from database mining and our successful demonstration of in vitro inhibitory activity support the utility of these computational models as novel tools for the efficient retrieval of inhibitors. These results demonstrate the effectiveness of computational modeling and pharmacophore development, which may lead to the identification of new therapeutic drugs that target novel sites on nAChRs.

  8. Analysis of the interactions between GMF and Arp2/3 complex in two binding sites by molecular dynamics simulation.

    PubMed

    Popinako, A; Antonov, M; Dibrova, D; Chemeris, A; Sokolova, O S

    2018-02-05

    The Arp2/3 complex plays a key role in nucleating actin filaments branching. The glia maturation factor (GMF) competes with activators for interacting with the Arp2/3 complex and initiates the debranching of actin filaments. In this study, we performed a comparative analysis of interactions between GMF and the Arp2/3 complex and identified new amino acid residues involved in GMF binding to the Arp2/3 complex at two separate sites, revealed by X-ray and single particle EM techniques. Using molecular dynamics simulations we demonstrated the quantitative and qualitative changes in hydrogen bonds upon binding with GMF. We identified the specific amino acid residues in GMF and Arp2/3 complex that stabilize the interactions and estimated the mean force profile for the GMF using umbrella sampling. Phylogenetic and structural analyses of the recently defined GMF binding site on the Arp3 subunit indicate a new mechanism for Arp2/3 complex inactivation that involves interactions between the Arp2/3 complex and GMF at two binding sites. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. [Interaction of human factor X with thromboplastin].

    PubMed

    Kiselev, S V; Zubairov, D M; Timarbaev, V N

    2003-01-01

    The binding of 125I-labeled human factor X to native and papaine-treated tissue tromboplastin in the presence of CaCl2 or EDTA was studied. The Scatchard analysis suggests the existence of high (Kd=l,8 x10(-9) M) and low affinity binding sites on the thromboplastin surface. The removal of Ca2+ reduced affinity of factor X to the high affinity sites. This was accompanied by some increase of their number. Proteolysis by papaine decreased affinity of high affinity sites and caused the increase of their number in the presence of Ca2+. In the absence of Ca2+ the affinity remained unchanged, but the number of sites decreased. At low concentrations of factor X positive cooperativity for high affinity binding sites was observed. It did not depend on the presence of Ca2+. The results indirectly confirm the role of hydrophobic interactons in Ca2+ dependent binding of factor X to thromboplastin and the fact that heterogeneity of this binding is determined by mesophase structure of the thromboplastin phospholipids.

  10. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

    PubMed

    Marsh, Lorraine

    2015-01-01

    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

  11. Batrachotoxin Changes the Properties of the Muscarinic Receptor in Rat Brain and Heart: Possible Interaction(s) between Muscarinic Receptors and Sodium Channels

    NASA Astrophysics Data System (ADS)

    Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai

    1985-05-01

    The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).

  12. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    PubMed

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  14. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  15. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  16. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Comparative analysis of allyl isothiocyanate (AITC)-induced carbohydrate oxidation changes via TRPV1 between mice and chickens.

    PubMed

    Kawabata, Fuminori; Kawabata, Yuko; Liang, Ruojun; Nishimura, Shotaro; Tabata, Shoji

    2017-01-01

    Postprandial hyperglycemia is a risk factor for cardiovascular diseases. It has been reported that intragastric administration of allyl isothiocyanate (AITC), which is one of the pungent ingredients of wasabi and horseradish but it is not included in hot chili pepper, increased carbohydrate oxidation and reduced postprandial increase of blood glucose via transient receptor potential vanilloid 1 (TRPV1)in mice. However, the action site of AITC on TRPV1 for increasing carbohydrate oxidation is unclear. Both mammalian and chicken TRPV1 (cTRPV1) are activated by heat and acid, but unlike its mammalian counterpart, cTRPV1 is only faintly activated by capsaicin. This difference is due to the 8 chicken-specific amino acid residues around transmembrane 3, which is the main site of capsaicin-binding in rat TRPV1. Moreover, AITC-induced activation of mouse TRPV1 (mTRPV1) is largely dependent on S513, a residue that is involved in capsaicin-binding. Thus, we hypothesized that the increase of carbohydrate oxidation by AITC in mammals is induced by the binding of AITC to the capsaicin-binding site of TRPV1. In this study, we performed a comparative study using chickens and mice, since chickens are thought to partly lack the capsaicin-binding site of TRPV1. We examined the effects of AITC on the respiratory quotient (RQ), the index of carbohydrate oxidation and fat oxidation, in chickens and mice. Respiratory gas analysis revealed that AITC does not increase the RQ in chickens, and Ca 2+ imaging methods and a whole cell-patch clamp analysis showed that AITC does not activate cTRPV1. These results implied that the capsaicin-binding site is an important region for increasing carbohydrate oxidation by AITC administration in animals.

  18. An efficient method to transcription factor binding sites imputation via simultaneous completion of multiple matrices with positional consistency.

    PubMed

    Guo, Wei-Li; Huang, De-Shuang

    2017-08-22

    Transcription factors (TFs) are DNA-binding proteins that have a central role in regulating gene expression. Identification of DNA-binding sites of TFs is a key task in understanding transcriptional regulation, cellular processes and disease. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) enables genome-wide identification of in vivo TF binding sites. However, it is still difficult to map every TF in every cell line owing to cost and biological material availability, which poses an enormous obstacle for integrated analysis of gene regulation. To address this problem, we propose a novel computational approach, TFBSImpute, for predicting additional TF binding profiles by leveraging information from available ChIP-seq TF binding data. TFBSImpute fuses the dataset to a 3-mode tensor and imputes missing TF binding signals via simultaneous completion of multiple TF binding matrices with positional consistency. We show that signals predicted by our method achieve overall similarity with experimental data and that TFBSImpute significantly outperforms baseline approaches, by assessing the performance of imputation methods against observed ChIP-seq TF binding profiles. Besides, motif analysis shows that TFBSImpute preforms better in capturing binding motifs enriched in observed data compared with baselines, indicating that the higher performance of TFBSImpute is not simply due to averaging related samples. We anticipate that our approach will constitute a useful complement to experimental mapping of TF binding, which is beneficial for further study of regulation mechanisms and disease.

  19. Isolation of anticancer drug TAXOL from Pestalotiopsis breviseta with apoptosis and B-Cell lymphoma protein docking studies.

    PubMed

    Kathiravan, G; Sureban, Sripathi M; Sree, Harsha N; Bhuvaneshwari, V; Kramony, Evelin

    2012-12-01

    Extraction and investigation of TAXOL from Pestalotiopsis breviseta (Sacc.) using protein docking, which is a computational technique that samples conformations of small molecules in protein-binding sites. Scoring functions are used to assess which of these conformations best complements the protein binding site and active site prediction. Coelomycetous fungi P. breviseta (Sacc.) Steyaert was screened for the production of TAXOL, an anticancer drug. TAXOL PRODUCTION WAS CONFIRMED BY THE FOLLOWING METHODS: Ultraviolet (UV) spectroscopic analysis, Infrared analysis, High performance liquid chromatography analysis (HPLC), and Liquid chromatography mass spectrum (LC-MASS). TAXOL produced by the fungi was compared with authentic TAXOL, and protein docking studies were performed. The BCL2 protein of human origin showed a higher affinity toward the compound paclitaxel. It has the binding energy value of -13.0061 (KJ/Mol) with four hydrogen bonds.

  20. Isolation of anticancer drug TAXOL from Pestalotiopsis breviseta with apoptosis and B-Cell lymphoma protein docking studies

    PubMed Central

    Kathiravan, G.; Sureban, Sripathi M.; Sree, Harsha N.; Bhuvaneshwari, V.; Kramony, Evelin

    2012-01-01

    Background: Extraction and investigation of TAXOL from Pestalotiopsis breviseta (Sacc.) using protein docking, which is a computational technique that samples conformations of small molecules in protein-binding sites. Scoring functions are used to assess which of these conformations best complements the protein binding site and active site prediction. Materials and Methods: Coelomycetous fungi P. breviseta (Sacc.) Steyaert was screened for the production of TAXOL, an anticancer drug. Results: TAXOL production was confirmed by the following methods: Ultraviolet (UV) spectroscopic analysis, Infrared analysis, High performance liquid chromatography analysis (HPLC), and Liquid chromatography mass spectrum (LC-MASS). TAXOL produced by the fungi was compared with authentic TAXOL, and protein docking studies were performed. Conclusion: The BCL2 protein of human origin showed a higher affinity toward the compound paclitaxel. It has the binding energy value of −13.0061 (KJ/Mol) with four hydrogen bonds. PMID:24808664

  1. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  2. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  3. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  4. Structural Basis for Certain Naturally Occurring Bioflavonoids to Function as Reducing Co-Substrates of Cyclooxygenase I and II

    PubMed Central

    Zhu, Bao Ting

    2010-01-01

    Background Recent studies showed that some of the dietary bioflavonoids can strongly stimulate the catalytic activity of cyclooxygenase (COX) I and II in vitro and in vivo, presumably by facilitating enzyme re-activation. In this study, we sought to understand the structural basis of COX activation by these dietary compounds. Methodology/Principal Findings A combination of molecular modeling studies, biochemical analysis and site-directed mutagenesis assay was used as research tools. Three-dimensional quantitative structure-activity relationship analysis (QSAR/CoMFA) predicted that the ability of bioflavonoids to activate COX I and II depends heavily on their B-ring structure, a moiety known to be associated with strong antioxidant ability. Using the homology modeling and docking approaches, we identified the peroxidase active site of COX I and II as the binding site for bioflavonoids. Upon binding to this site, bioflavonoid can directly interact with hematin of the COX enzyme and facilitate the electron transfer from bioflavonoid to hematin. The docking results were verified by biochemical analysis, which reveals that when the cyclooxygenase activity of COXs is inhibited by covalent modification, myricetin can still stimulate the conversion of PGG2 to PGE2, a reaction selectively catalyzed by the peroxidase activity. Using the site-directed mutagenesis analysis, we confirmed that Q189 at the peroxidase site of COX II is essential for bioflavonoids to bind and re-activate its catalytic activity. Conclusions/Significance These findings provide the structural basis for bioflavonoids to function as high-affinity reducing co-substrates of COXs through binding to the peroxidase active site, facilitating electron transfer and enzyme re-activation. PMID:20808785

  5. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  6. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  7. ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data

    PubMed Central

    2010-01-01

    Background Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) or ChIP followed by genome tiling array analysis (ChIP-chip) have become standard technologies for genome-wide identification of DNA-binding protein target sites. A number of algorithms have been developed in parallel that allow identification of binding sites from ChIP-seq or ChIP-chip datasets and subsequent visualization in the University of California Santa Cruz (UCSC) Genome Browser as custom annotation tracks. However, summarizing these tracks can be a daunting task, particularly if there are a large number of binding sites or the binding sites are distributed widely across the genome. Results We have developed ChIPpeakAnno as a Bioconductor package within the statistical programming environment R to facilitate batch annotation of enriched peaks identified from ChIP-seq, ChIP-chip, cap analysis of gene expression (CAGE) or any experiments resulting in a large number of enriched genomic regions. The binding sites annotated with ChIPpeakAnno can be viewed easily as a table, a pie chart or plotted in histogram form, i.e., the distribution of distances to the nearest genes for each set of peaks. In addition, we have implemented functionalities for determining the significance of overlap between replicates or binding sites among transcription factors within a complex, and for drawing Venn diagrams to visualize the extent of the overlap between replicates. Furthermore, the package includes functionalities to retrieve sequences flanking putative binding sites for PCR amplification, cloning, or motif discovery, and to identify Gene Ontology (GO) terms associated with adjacent genes. Conclusions ChIPpeakAnno enables batch annotation of the binding sites identified from ChIP-seq, ChIP-chip, CAGE or any technology that results in a large number of enriched genomic regions within the statistical programming environment R. Allowing users to pass their own annotation data such as a different Chromatin immunoprecipitation (ChIP) preparation and a dataset from literature, or existing annotation packages, such as GenomicFeatures and BSgenome, provides flexibility. Tight integration to the biomaRt package enables up-to-date annotation retrieval from the BioMart database. PMID:20459804

  8. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  9. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  10. oPOSSUM: integrated tools for analysis of regulatory motif over-representation

    PubMed Central

    Ho Sui, Shannan J.; Fulton, Debra L.; Arenillas, David J.; Kwon, Andrew T.; Wasserman, Wyeth W.

    2007-01-01

    The identification of over-represented transcription factor binding sites from sets of co-expressed genes provides insights into the mechanisms of regulation for diverse biological contexts. oPOSSUM, an internet-based system for such studies of regulation, has been improved and expanded in this new release. New features include a worm-specific version for investigating binding sites conserved between Caenorhabditis elegans and C. briggsae, as well as a yeast-specific version for the analysis of co-expressed sets of Saccharomyces cerevisiae genes. The human and mouse applications feature improvements in ortholog mapping, sequence alignments and the delineation of multiple alternative promoters. oPOSSUM2, introduced for the analysis of over-represented combinations of motifs in human and mouse genes, has been integrated with the original oPOSSUM system. Analysis using user-defined background gene sets is now supported. The transcription factor binding site models have been updated to include new profiles from the JASPAR database. oPOSSUM is available at http://www.cisreg.ca/oPOSSUM/ PMID:17576675

  11. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  12. Alteration of methotrexate binding to human serum albumin induced by oxidative stress. Spectroscopic comparative study

    NASA Astrophysics Data System (ADS)

    Maciążek-Jurczyk, M.; Sułkowska, A.; Równicka-Zubik, J.

    2016-01-01

    Changes of oxidative modified albumin conformation by comparison of non-modified (HSA) and modified (oHSA) human serum albumin absorption spectra, Red Edge Excitation Shift (REES) effect and fluorescence synchronous spectra were investigated. Studies of absorption spectra indicated that changes in the value of absorbance associated with spectral changes in the region from 200 to 250 nm involve structural alterations related to variations in peptide backbone conformation. Analysis of the REES effect allowed for the observation of changes caused by oxidation in the region of the hydrophobic pocket containing the tryptophanyl residue. Synchronous fluorescence spectroscopy confirmed changes of the position of the tryptophanyl and tyrosil residues fluorescent band. Effect of oxidative stress on binding of methotrexate (MTX) was investigated by spectrofluorescence, UV-VIS and 1HNMR spectroscopy. MTX caused the fluorescence quenching of non-modified (HSA) and modified (oHSA) human serum albumin molecule. The values of binding constants, Hill's coefficients and a number of binding sites in the protein molecule in the high affinity binding site were calculated for the binary MTX-HSA and MTX-oHSA systems. For these systems, qualitative analysis in the low affinity binding sites was performed with the use of the 1HNMR technique.

  13. Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

    PubMed

    Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

    2016-06-01

    The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  14. Modulation of enrofloxacin binding in OmpF by Mg2+ as revealed by the analysis of fast flickering single-porin current

    PubMed Central

    Brauser, Annemarie; Schroeder, Indra; Gutsmann, Thomas; Cosentino, Cristian; Moroni, Anna; Winterhalter, Mathias

    2012-01-01

    One major determinant of the efficacy of antibiotics on Gram-negative bacteria is the passage through the outer membrane. During transport of the fluoroquinolone enrofloxacin through the trimeric outer membrane protein OmpF of Escherichia coli, the antibiotic interacts with two binding sites within the pore, thus partially blocking the ionic current. The modulation of one affinity site by Mg2+ reveals further details of binding sites and binding kinetics. At positive membrane potentials, the slow blocking events induced by enrofloxacin in Mg2+-free media are converted to flickery sojourns at the highest apparent current level (all three pores flickering). This indicates weaker binding in the presence of Mg2+. Analysis of the resulting amplitude histograms with β distributions revealed the rate constants of blocking (kOB) and unblocking (kBO) in the range of 1,000 to 120,000 s−1. As expected for a bimolecular reaction, kOB was proportional to blocker concentration and kBO independent of it. kOB was approximately three times lower for enrofloxacin coming from the cis side than from the trans side. The block was not complete, leading to a residual conductivity of the blocked state being ∼25% of that of the open state. Interpretation of the results has led to the following model: fast flickering as caused by interaction of Mg2+ and enrofloxacin is related to the binding site at the trans side, whereas the cis site mediates slow blocking events which are also found without Mg2+. The difference in the accessibility of the binding sites also explains the dependency of kOB on the side of enrofloxacin addition and yields a means of determining the most plausible orientation of OmpF in the bilayer. The voltage dependence suggests that the dipole of the antibiotic has to be adequately oriented to facilitate binding. PMID:22689827

  15. Synthesis of rigidified flavin–guanidinium ion conjugates and investigation of their photocatalytic properties

    PubMed Central

    Schmaderer, Harald; Bhuyan, Mouchumi

    2009-01-01

    Summary Flavin chromophores can mediate redox reactions upon irradiation by blue light. In an attempt to increase their catalytic efficacy, flavin derivatives bearing a guanidinium ion as oxoanion binding site were prepared. Chromophore and substrate binding site are linked by a rigid Kemp’s acid structure. The molecular structure of the new flavins was confirmed by an X-ray structure analysis and their photocatalytic activity was investigated in benzyl ester cleavage, nitroarene reduction and a Diels–Alder reaction. The modified flavins photocatalyze the reactions, but the introduced substrate binding site does not enhance their performance. PMID:19590745

  16. Synthesis of rigidified flavin-guanidinium ion conjugates and investigation of their photocatalytic properties.

    PubMed

    Schmaderer, Harald; Bhuyan, Mouchumi; König, Burkhard

    2009-05-28

    Flavin chromophores can mediate redox reactions upon irradiation by blue light. In an attempt to increase their catalytic efficacy, flavin derivatives bearing a guanidinium ion as oxoanion binding site were prepared. Chromophore and substrate binding site are linked by a rigid Kemp's acid structure. The molecular structure of the new flavins was confirmed by an X-ray structure analysis and their photocatalytic activity was investigated in benzyl ester cleavage, nitroarene reduction and a Diels-Alder reaction. The modified flavins photocatalyze the reactions, but the introduced substrate binding site does not enhance their performance.

  17. DNA-bending properties of TF1.

    PubMed

    Schneider, G J; Sayre, M H; Geiduschek, E P

    1991-10-05

    Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.

  18. Conformational Sampling and Binding Site Assessment of Suppression of Tumorigenicity 2 Ectodomain

    PubMed Central

    Yang, Chao-Yie; Delproposto, James; Chinnaswamy, Krishnapriya; Brown, William Clay; Wang, Shuying; Stuckey, Jeanne A.; Wang, Xinquan

    2016-01-01

    Suppression of Tumorigenicity 2 (ST2), a member of the interleukin-1 receptor (IL-1R) family, activates type 2 immune responses to pathogens and tissue damage via binding to IL-33. Dysregulated responses contribute to asthma, graft-versus-host and autoinflammatory diseases and disorders. To study ST2 structure for inhibitor development, we performed the principal component (PC) analysis on the crystal structures of IL1-1R1, IL1-1R2, ST2 and the refined ST2 ectodomain (ST2ECD) models, constructed from previously reported small-angle X-ray scattering data. The analysis facilitates mapping of the ST2ECD conformations to PC subspace for characterizing structural changes. Extensive coverage of ST2ECD conformations was then obtained using the accelerated molecular dynamics simulations started with the IL-33 bound ST2ECD structure as instructed by their projected locations on the PC subspace. Cluster analysis of all conformations further determined representative conformations of ST2ECD ensemble in solution. Alignment of the representative conformations with the ST2/IL-33 structure showed that the D3 domain of ST2ECD (containing D1-D3 domains) in most conformations exhibits no clashes with IL-33 in the crystal structure. Our experimental binding data informed that the D1-D2 domain of ST2ECD contributes predominantly to the interaction between ST2ECD and IL-33 underscoring the importance of the D1-D2 domain in binding. Computational binding site assessment revealed one third of the total detected binding sites in the representative conformations may be suitable for binding to potent small molecules. Locations of these sites include the D1-D2 domain ST2ECD and modulation sites conformed to ST2ECD conformations. Our study provides structural models and analyses of ST2ECD that could be useful for inhibitor discovery. PMID:26735493

  19. The conserved potassium channel filter can have distinct ion binding profiles: Structural analysis of rubidium, cesium, and barium binding in NaK2K

    PubMed Central

    Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant

    2014-01-01

    Potassium channels are highly selective for K+ over the smaller Na+. Intriguingly, they are permeable to larger monovalent cations such as Rb+ and Cs+ but are specifically blocked by the similarly sized Ba2+. In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K+ channels KcsA and MthK. Rb+ bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs+, however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba2+ binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba2+ block. In the presence of K+, Ba2+ bound to the NaK2K channel at site 3 in conjunction with a K+ at site 1; this led to a prolonged block of the channel (the external K+-dependent Ba2+ lock-in state). In the absence of K+, however, Ba2+ acts as a permeating blocker. We found that, under these conditions, Ba2+ bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba2+ binding profile in the presence and absence of K+ thus provides a structural explanation for the short and prolonged Ba2+ block observed in NaK2K. PMID:25024267

  20. The conserved potassium channel filter can have distinct ion binding profiles: structural analysis of rubidium, cesium, and barium binding in NaK2K.

    PubMed

    Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant; Jiang, Youxing

    2014-08-01

    Potassium channels are highly selective for K(+) over the smaller Na(+). Intriguingly, they are permeable to larger monovalent cations such as Rb(+) and Cs(+) but are specifically blocked by the similarly sized Ba(2+). In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K(+) channels KcsA and MthK. Rb(+) bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs(+), however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba(2+) binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba(2+) block. In the presence of K(+), Ba(2+) bound to the NaK2K channel at site 3 in conjunction with a K(+) at site 1; this led to a prolonged block of the channel (the external K(+)-dependent Ba(2+) lock-in state). In the absence of K(+), however, Ba(2+) acts as a permeating blocker. We found that, under these conditions, Ba(2+) bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba(2+) binding profile in the presence and absence of K(+) thus provides a structural explanation for the short and prolonged Ba(2+) block observed in NaK2K. © 2014 Lam et al.

  1. Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

    PubMed

    Kel, AlexanderE

    2017-02-01

    Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

  2. Binding of puerarin to human serum albumin: a spectroscopic analysis and molecular docking.

    PubMed

    He, Yang; Wang, Yiwei; Tang, Lifei; Liu, Hui; Chen, Wei; Zheng, Zhongliang; Zou, Guolin

    2008-03-01

    Puerarin is a widely used compound in Chinese traditional medicine and exhibits many pharmacological activities. Binding of puerarin to human serum albumin (HSA) was investigated by ultraviolet absorbance, fluorescence, circular dichroism and molecular docking. Puerarin caused a static quenching of intrinsic fluorescence of HSA, the quenching data was analyzed by Stern-Volmer equation. There was one primary puerarin binding site on HSA with a binding constant of 4.12 x 10(4) M(-1) at 298 K. Thermodynamic analysis by Van Hoff equation found enthalpy change (DeltaH(0)) and entropy change (DeltaS(0)) were -28.01 kJ/mol and -5.63 J/mol K respectively, which indicated the hydrogen bond and Van der Waas interaction were the predominant forces in the binding process. Competitive experiments showed a displacement of warfarin by puerarin, which revealed that the binding site was located at the drug site I. Puerarin was about 2.22 nm far from the tryptophan according to the observed fluorescence resonance energy transfer between HSA and puerarin. Molecular docking suggested the hydrophobic residues such as tyrosine (Tyr) 150, Tyr 148, Tyr 149 and polar residues such as lysine (Lys) 199, Lys 195, arginine 257 and histidine 242 played an important role in the binding reaction.

  3. PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context

    PubMed Central

    Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing

    2016-01-01

    Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor (http://hlt.hitsz.edu.cn:8080/PDNAsite/) is made available for free public accessible to the biological research community. PMID:27282833

  4. Structural analysis of peptides that fill sites near the active center of the two different enzyme molecules by artificial intelligence and computer simulations

    NASA Astrophysics Data System (ADS)

    Nishiyama, Katsuhiko

    2018-05-01

    Using artificial intelligence, the binding styles of 167 tetrapeptides were predicted in the active site of papain and cathepsin K. Five tetrapeptides (Asn-Leu-Lys-Trp, Asp-Gln-Trp-Gly, Cys-Gln-Leu-Arg, Gln-Leu-Trp-Thr and Arg-Ser-Glu-Arg) were found to bind sites near the active center of both papain and cathepsin K. These five tetrapeptides have the potential to also bind sites of other cysteine proteases, and structural characteristics of these tetrapeptides should aid the design of a common inhibitor of cysteine proteases. Smart application of artificial intelligence should accelerate data mining of important complex systems.

  5. In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

    PubMed

    Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

    2012-05-01

    Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.

  6. Tissue expression analysis, cloning and characterization of the 5'-regulatory region of the bovine FABP3 gene.

    PubMed

    Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen

    2016-09-01

    Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.

  7. Binding of nucleotides by T4 DNA ligase and T4 RNA ligase: optical absorbance and fluorescence studies.

    PubMed Central

    Cherepanov, A V; de Vries, S

    2001-01-01

    The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015

  8. Multiple sup 3 H-oxytocin binding sites in rat myometrial plasma membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Crankshaw, D.; Gaspar, V.; Pliska, V.

    1990-01-01

    The affinity spectrum method has been used to analyse binding isotherms for {sup 3}H-oxytocin to rat myometrial plasma membranes. Three populations of binding sites with dissociation constants (Kd) of 0.6-1.5 x 10(-9), 0.4-1.0 x 10(-7) and 7 x 10(-6) mol/l were identified and their existence verified by cluster analysis based on similarities between Kd, binding capacity and Hill coefficient. When experimental values were compared to theoretical curves constructed using the estimated binding parameters, good fits were obtained. Binding parameters obtained by this method were not influenced by the presence of GTP gamma S (guanosine-5'-O-3-thiotriphosphate) in the incubation medium. The bindingmore » parameters agree reasonably well with those found in uterine cells, they support the existence of a medium affinity site and may allow for an explanation of some of the discrepancies between binding and response in this system.« less

  9. Quantitative autoradiography of muscarinic and benzodiazepine receptors in the forebrain of the turtle, Pseudemys scripta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlegel, J.R.; Kriegstein, A.R.

    1987-11-22

    The distribution of muscarinic and benzodiazepine receptors was investigated in the turtle forebrain by the technique of in vitro receptor autoradiography. Muscarinic binding sites were labeled with 1 nM /sup 3/H-quinuclidinyl benzilate (/sup 3/H-QNB), and benzodiazepine sites were demonstrated with the aid of 1 nM /sup 3/H-flunitrazepam (/sup 3/H-FLU). Autoradiograms generated on /sup 3/H-Ultrofilm apposed to tissue slices revealed regionally specific distributions of muscarinic and benzodiazepine binding sites that are comparable with those for mammalian brain. Dense benzodiazepine binding was found in the anterior olfactory nucleus, the lateral and dorsal cortices, and the dorsal ventricular ridge (DVR), a structure withmore » no clear mammalian homologue. Muscarinic binding sites were most dense in the striatum, accumbens, DVR, lateral geniculate, and the anterior olfactory nucleus. Cortical binding sites were studied in greater detail by quantitative analysis of autoradiograms generated by using emulsion-coated coverslips. Laminar gradients of binding were observed that were specific for each radioligand; /sup 3/H-QNB sites were most dense in the inner molecular layer in all cortical regions, whereas /sup 3/H-FLU binding was generally most concentrated in the outer molecular layer and was least dense through all layers in the dorsomedial cortex. Because pyramidal cells are arranged in register in turtle cortex, the laminar patterns of receptor binding may reflect different receptor density gradients along pyramidal cell dendrites.« less

  10. The effect of glycosylation on the transferrin structure: A molecular dynamic simulation analysis.

    PubMed

    Ghanbari, Z; Housaindokht, M R; Bozorgmehr, M R; Izadyar, M

    2016-09-07

    Transferrins have been defined by the highly cooperative binding of iron and a carbonate anion to form a Fe-CO3-Tf ternary complex. As such, the layout of the binding site residues affects transferrin function significantly; In contrast to N-lobe, C-lobe binding site of the transferrin structure has been less characterized and little research which surveyed the interaction of carbonate with transferrin in the C-lobe binding site has been found. In the present work, molecular dynamic simulation was employed to gain access into the molecular level understanding of carbonate binding site and their interactions in each lobe. Residues responsible for carbonate binding of transferrin structure were pointed out. In addition, native human transferrin is a glycoprotein that two N-linked complex glycan chains located in the C-lobe. Usually, in the molecular dynamic simulation for simplifying, glycan is removed from the protein structure. Here, we explore the effect of glycosylation on the transferrin structure. Glycosylation appears to have an effect on the layout of the binding site residue and transferrin structure. On the other hand, sometimes the entire transferrin formed by separated lobes that it allows the results to be interpreted in a straightforward manner rather than more parameters required for full length protein. But, it should be noted that there are differences between the separated lobe and full length transferrin, hence, a comparative analysis by the molecular dynamic simulation was performed to investigate such structural variations. Results revealed that separation in C-lobe caused a significant structural variation in comparison to N-lobe. Consequently, the separated lobes and the full length one are different, showing the importance of the interlobe communication and the impact of the lobes on each other in the transferrin structure. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  12. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

    PubMed Central

    Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

  13. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

    PubMed

    Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

  14. Complementation analysis of mutants of nitric oxide synthase reveals that the active site requires two hemes.

    PubMed Central

    Xie, Q W; Leung, M; Fuortes, M; Sassa, S; Nathan, C

    1996-01-01

    For catalytic activity, nitric oxide synthases (NOSs) must be dimeric. Previous work revealed that the requirements for stable dimerization included binding of tetrahydrobiopterin (BH4), arginine, and heme. Here we asked what function is served by dimerization. We assessed the ability of individually inactive mutants of mouse inducible NOS (iNOS; NOS2), each deficient in binding a particular cofactor or cosubstrate, to complement each other by generating NO upon cotransfection into human epithelial cells. The ability of the mutants to homodimerize was gauged by gel filtration and/or PAGE under partially denaturing conditions, both followed by immunoblot. Their ability to heterodimerize was assessed by coimmunoprecipitation. Heterodimers that contained only one COOH-terminal hemimer and only one BH4-binding site could both form and function, even though the NADPH-, FAD-, and FMN-binding domains (in the COOH-terminal hemimer) and the BH4-binding sites (in the NH2-terminal hemimer) were contributed by opposite chains. Heterodimers that contained only one heme-binding site (Cys-194) could also form, either in cis or in trans to the nucleotide-binding domains. However, for NO production, both chains had to bind heme. Thus, NO production by iNOS requires dimerization because the active site requires two hemes. Images Fig. 2 Fig. 3 Fig. 4 Fig. 7 PMID:8643499

  15. Iron binding to human heavy-chain ferritin.

    PubMed

    Pozzi, Cecilia; Di Pisa, Flavio; Bernacchioni, Caterina; Ciambellotti, Silvia; Turano, Paola; Mangani, Stefano

    2015-09-01

    Maxi-ferritins are ubiquitous iron-storage proteins with a common cage architecture made up of 24 identical subunits of five α-helices that drive iron biomineralization through catalytic iron(II) oxidation occurring at oxidoreductase sites (OS). Structures of iron-bound human H ferritin were solved at high resolution by freezing ferritin crystals at different time intervals after exposure to a ferrous salt. Multiple binding sites were identified that define the iron path from the entry ion channels to the oxidoreductase sites. Similar data are available for another vertebrate ferritin: the M protein from Rana catesbeiana. A comparative analysis of the iron sites in the two proteins identifies new reaction intermediates and underlines clear differences in the pattern of ligands that define the additional iron sites that precede the oxidoreductase binding sites along this path. Stopped-flow kinetics assays revealed that human H ferritin has different levels of activity compared with its R. catesbeiana counterpart. The role of the different pattern of transient iron-binding sites in the OS is discussed with respect to the observed differences in activity across the species.

  16. Association between genetic variation within vitamin D receptor-DNA binding sites and risk of basal cell carcinoma.

    PubMed

    Lin, Yuan; Chahal, Harvind S; Wu, Wenting; Cho, Hyunje G; Ransohoff, Katherine J; Dai, Hongji; Tang, Jean Y; Sarin, Kavita Y; Han, Jiali

    2017-05-01

    An increasing number of studies have reported a protective association between vitamin D and cancer risk. The vitamin D endocrine system regulates transcriptional programs involved in inflammation, cell growth and differentiation through the binding of vitamin D receptor (VDR) to specific VDR elements. However, limited attention has been given to the role of variation within VDR binding sites in the development of basal cell carcinoma (BCC). Across 2,776 previously identified VDR binding sites, we identified 2,540 independent single-nucleotide polymorphisms (SNPs) and examined their associations with BCC risk in a genome-wide association meta-analysis totaling 17,187 BCC cases and 287,054 controls from two data sets. After multiple testing corrections, we identified two SNPs at new loci (rs16917546 at 10q21.1: odds ratio (OR) = 1.06, p = 3.16 × 10 -7 and rs79824801 at 12q13.3: OR = 1.10, p = 1.88 × 10 -5 ) for the first time as independently related to BCC risk in meta-analysis; and both SNPs were nominally significant in two data sets. In addition, the SNP rs3769823 within VDR binding site at a previously reported BCC susceptibility locus (2q33.1, rs13014235) also exhibited a significant association (OR = 1.12, p = 3.99 × 10 -18 ). A mutually adjusted model suggested that rs3769823 explained the signal in this region. Our findings support the hypothesis that inherited common variation in VDR binding sites affects the development of BCC. © 2017 UICC.

  17. Characterization of the proton binding sites of extracellular polymeric substances in an anaerobic membrane bioreactor.

    PubMed

    Liu, Yi; Chang, Sheng; Defersha, Fantahun M

    2015-07-01

    This paper focuses on the characterization of the chemical compositions and acidic constants of the extracellular polymeric substances (EPSs) in an anaerobic membrane bioreactor treating synthetic brewery wastewater by using chemical analysis, linear programming analysis (LPA) of titration data, and FT-IR analysis. The linear programming analysis of titration data revealed that the EPSs have proton binding sites with pKa values from pKa ≤ 6, between 6 and 7, and approximately 9.8. The strong acidic sites (pKa ≤ 6) and some weak acidic sites (7.5 < pKa < 9.0) were found to be readily removed by 0.45-μm membrane filtration. In addition, the FT-IR analysis confirmed the presence of proteins, carbohydrates, nucleic acids, and lipids in the EPS samples. Based on the FT-IR analysis and the main chemical functional groups at the bacterial cell surfaces, the identified proton binding sites were related to carboxyl, phosphate, and hydroxyl/amine groups with pKa values of 4.6 ± 0.7, 6.6 ± 0.01, and 9.7 ± 0.1, respectively, with the corresponding respective intensities of 0.31 ± 0.05, 0.96 ± 0.3, and 1.53 ± 0.3 mmole/g-EPS. The pKa values and intensities of the proton binding sites are the fundamental molecular properties of EPSs that affect the EPS charge, molecular interactions, and metal complexation characteristics. Determination of such properties can advance Derjaguin-Landau-Verwey-Overbeek (DLVO)-based concentration polarization modeling, facilitate the estimation of the osmotic pressure of the EPS concentration polarization layers, and lead to a deeper understanding of the role of metal complexation in membrane fouling. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.

    PubMed

    Wang, Jinling; de Montellano, Paul R Ortiz

    2003-05-30

    Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.

  19. Lactose binding to galectin-1 modulates structural dynamics, increases conformational entropy, and occurs with apparent negative cooperativity.

    PubMed

    Nesmelova, Irina V; Ermakova, Elena; Daragan, Vladimir A; Pang, Mabel; Menéndez, Margarita; Lagartera, Laura; Solís, Dolores; Baum, Linda G; Mayo, Kevin H

    2010-04-16

    Galectins are a family of lectins with a conserved carbohydrate recognition domain that interacts with beta-galactosides. By binding cell surface glycoconjugates, galectin-1 (gal-1) is involved in cell adhesion and migration processes and is an important regulator of tumor angiogenesis. Here, we used heteronuclear NMR spectroscopy and molecular modeling to investigate lactose binding to gal-1 and to derive solution NMR structures of gal-1 in the lactose-bound and unbound states. Structure analysis shows that the beta-strands and loops around the lactose binding site, which are more open and dynamic in the unbound state, fold in around the bound lactose molecule, dampening internal motions at that site and increasing motions elsewhere throughout the protein to contribute entropically to the binding free energy. CD data support the view of an overall more open structure in the lactose-bound state. Analysis of heteronuclear single quantum coherence titration binding data indicates that lactose binds the two carbohydrate recognition domains of the gal-1 dimer with negative cooperativity, in that the first lactose molecule binds more strongly (K(1)=21+/-6 x 10(3) M(-1)) than the second (K(2)=4+/-2 x 10(3) M(-1)). Isothermal calorimetry data fit using a sequential binding model present a similar picture, yielding K(1)=20+/-10 x 10(3) M(-1) and K(2)=1.67+/-0.07 x 10(3) M(-1). Molecular dynamics simulations provide insight into structural dynamics of the half-loaded lactose state and, together with NMR data, suggest that lactose binding at one site transmits a signal through the beta-sandwich and loops to the second binding site. Overall, our results provide new insight into gal-1 structure-function relationships and to protein-carbohydrate interactions in general. Copyright (c) 2010. Published by Elsevier Ltd.

  20. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  1. Two nucleotide binding sites modulate ( sup 3 H) glyburide binding to rat cortex membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, D.E.; Gopalakrishnan, M.; Triggle, D.J.

    1991-03-11

    The effects of nucleotides on the binding of the ATP-dependent K{sup +}-channel antagonist ({sup 3}H)glyburide (GLB) to rat cortex membranes were examined. Nucleotide triphosphates (NTPs) and nucleotide diphosphate (NDPs) inhibited the binding of GLB. This effect was dependent on the presence of dithiothreitol (DTT). Inhibition of binding by NTPs, with the exception of ATP{gamma}S, was dependent on the presence of Mg{sup 2+}. GLB binding showed a biphasic response to ADP: up to 3 mM, ADP inhibited binding, and above this concentration GLB binding increased rapidly, and was restored to normal levels by 10 mM ADP. In the presence of Mg{supmore » 2+}, ADP did not stimulate binding. Saturation analysis in the presence of Mg{sup 2+} and increasing concentrations of ADP showed that ADP results primarily in a change of the B{sub max} for GLB binding. The differential effects of NTPS and NDPs indicate that two nucleotide binding sites regulate GLB binding.« less

  2. Molecular Determinants for Substrate Interactions with the Glycine Transporter GlyT2.

    PubMed

    Carland, Jane E; Thomas, Michael; Mostyn, Shannon N; Subramanian, Nandhitha; O'Mara, Megan L; Ryan, Renae M; Vandenberg, Robert J

    2018-03-21

    Transporters in the SLC6 family play key roles in regulating neurotransmission and are the targets for a wide range of therapeutics. Important insights into the transport mechanisms and the specificity of drug interactions of SLC6 transporters have been obtained from the crystal structures of a bacterial homologue of the family, LeuT Aa , and more recently the Drosophila dopamine transporter and the human serotonin transporter. However, there is disputed evidence that the bacterial leucine transporter, LeuT Aa , contains two substrate binding sites that work cooperatively in the mechanism of transport, with the binding of a second substrate being required for the release of the substrate from the primary site. An alternate proposal is that there may be low affinity binding sites that serve to direct the flow of substrates to the primary site. We have used a combination of molecular dynamics simulations of substrate interactions with a homology model of GlyT2, together with radiolabeled amino acid uptake assays and electrophysiological analysis of wild-type and mutant transporters, to provide evidence that substrate selectivity of GlyT2 is determined entirely by the primary substrate binding site and, furthermore, if a secondary site exists then it is a low affinity nonselective amino acid binding site.

  3. Molecular simulations of multimodal ligand-protein binding: elucidation of binding sites and correlation with experiments.

    PubMed

    Freed, Alexander S; Garde, Shekhar; Cramer, Steven M

    2011-11-17

    Multimodal chromatography, which employs more than one mode of interaction between ligands and proteins, has been shown to have unique selectivity and high efficacy for protein purification. To test the ability of free solution molecular dynamics (MD) simulations in explicit water to identify binding regions on the protein surface and to shed light on the "pseudo affinity" nature of multimodal interactions, we performed MD simulations of a model protein ubiquitin in aqueous solution of free ligands. Comparisons of MD with NMR spectroscopy of ubiquitin mutants in solutions of free ligands show a good agreement between the two with regard to the preferred binding region on the surface of the protein and several binding sites. MD simulations also identify additional binding sites that were not observed in the NMR experiments. "Bound" ligands were found to be sufficiently flexible and to access a number of favorable conformations, suggesting only a moderate loss of ligand entropy in the "pseudo affinity" binding of these multimodal ligands. Analysis of locations of chemical subunits of the ligand on the protein surface indicated that electrostatic interaction units were located on the periphery of the preferred binding region on the protein. The analysis of the electrostatic potential, the hydrophobicity maps, and the binding of both acetate and benzene probes were used to further study the localization of individual ligand moieties. These results suggest that water-mediated electrostatic interactions help the localization and orientation of the MM ligand to the binding region with additional stability provided by nonspecific hydrophobic interactions.

  4. Structural insights into xenobiotic and inhibitor binding to human aldehyde oxidase.

    PubMed

    Coelho, Catarina; Foti, Alessandro; Hartmann, Tobias; Santos-Silva, Teresa; Leimkühler, Silke; Romão, Maria João

    2015-10-01

    Aldehyde oxidase (AOX) is a xanthine oxidase (XO)-related enzyme with emerging importance due to its role in the metabolism of drugs and xenobiotics. We report the first crystal structures of human AOX1, substrate free (2.6-Å resolution) and in complex with the substrate phthalazine and the inhibitor thioridazine (2.7-Å resolution). Analysis of the protein active site combined with steady-state kinetic studies highlight the unique features, including binding and substrate orientation at the active site, that characterize human AOX1 as an important drug-metabolizing enzyme. Structural analysis of the complex with the noncompetitive inhibitor thioridazine revealed a new, unexpected and fully occupied inhibitor-binding site that is structurally conserved among mammalian AOXs and XO. The new structural insights into the catalytic and inhibition mechanisms of human AOX that we now report will be of great value for the rational analysis of clinical drug interactions involving inhibition of AOX1 and for the prediction and design of AOX-stable putative drugs.

  5. Structure and Self-Assembly of the Calcium Binding Matrix Protein of Human Metapneumovirus

    PubMed Central

    Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T.; Grimes, Jonathan M.

    2014-01-01

    Summary The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca2+ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca2+ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. PMID:24316400

  6. Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

    PubMed Central

    Augustin, Regina; Lichtenthaler, Stefan F.; Greeff, Michael; Hansen, Jens; Wurst, Wolfgang; Trümbach, Dietrich

    2011-01-01

    The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD) pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases. PMID:21559189

  7. Contacts between the factor TUF and RPG sequences.

    PubMed

    Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

    1990-08-25

    The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

  8. The Bacterial Response Regulator ArcA Uses a Diverse Binding Site Architecture to Regulate Carbon Oxidation Globally

    PubMed Central

    Park, Dan M.; Akhtar, Md. Sohail; Ansari, Aseem Z.; Landick, Robert; Kiley, Patricia J.

    2013-01-01

    Despite the importance of maintaining redox homeostasis for cellular viability, how cells control redox balance globally is poorly understood. Here we provide new mechanistic insight into how the balance between reduced and oxidized electron carriers is regulated at the level of gene expression by mapping the regulon of the response regulator ArcA from Escherichia coli, which responds to the quinone/quinol redox couple via its membrane-bound sensor kinase, ArcB. Our genome-wide analysis reveals that ArcA reprograms metabolism under anaerobic conditions such that carbon oxidation pathways that recycle redox carriers via respiration are transcriptionally repressed by ArcA. We propose that this strategy favors use of catabolic pathways that recycle redox carriers via fermentation akin to lactate production in mammalian cells. Unexpectedly, bioinformatic analysis of the sequences bound by ArcA in ChIP-seq revealed that most ArcA binding sites contain additional direct repeat elements beyond the two required for binding an ArcA dimer. DNase I footprinting assays suggest that non-canonical arrangements of cis-regulatory modules dictate both the length and concentration-sensitive occupancy of DNA sites. We propose that this plasticity in ArcA binding site architecture provides both an efficient means of encoding binding sites for ArcA, σ70-RNAP and perhaps other transcription factors within the same narrow sequence space and an effective mechanism for global control of carbon metabolism to maintain redox homeostasis. PMID:24146625

  9. Highly accessible AU-rich regions in 3' untranslated regions are hotspots for binding of regulatory factors.

    PubMed

    Plass, Mireya; Rasmussen, Simon H; Krogh, Anders

    2017-04-01

    Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3'UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing "free" target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of regulation of post-transcriptional regulatory networks.

  10. Highly accessible AU-rich regions in 3’ untranslated regions are hotspots for binding of regulatory factors

    PubMed Central

    2017-01-01

    Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3’UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing “free” target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of regulation of post-transcriptional regulatory networks. PMID:28410363

  11. The crystal structures of the psychrophilic subtilisin S41 and the mesophilic subtilisin Sph reveal the same calcium-loaded state.

    PubMed

    Almog, Orna; González, Ana; Godin, Noa; de Leeuw, Marina; Mekel, Marlene J; Klein, Daniela; Braun, Sergei; Shoham, Gil; Walter, Richard L

    2009-02-01

    We determine and compare the crystal structure of two proteases belonging to the subtilisin superfamily: S41, a cold-adapted serine protease produced by Antarctic bacilli, at 1.4 A resolution and Sph, a mesophilic serine protease produced by Bacillus sphaericus, at 0.8 A resolution. The purpose of this comparison was to find out whether multiple calcium ion binding is a molecular factor responsible for the adaptation of S41 to extreme low temperatures. We find that these two subtilisins have the same subtilisin fold with a root mean square between the two structures of 0.54 A. The final models for S41 and Sph include a calcium-loaded state of five ions bound to each of these two subtilisin molecules. None of these calcium-binding sites correlate with the high affinity known binding site (site A) found for other subtilisins. Structural analysis of the five calcium-binding sites found in these two crystal structures indicate that three of the binding sites have two side chains of an acidic residue coordinating the calcium ion, whereas the other two binding sites have either a main-chain carbonyl, or only one acidic residue side chain coordinating the calcium ion. Thus, we conclude that three of the sites are of high affinity toward calcium ions, whereas the other two are of low affinity. Because Sph is a mesophilic subtilisin and S41 is a psychrophilic subtilisin, but both crystal structures were found to bind five calcium ions, we suggest that multiple calcium ion binding is not responsible for the adaptation of S41 to low temperatures. Copyright 2008 Wiley-Liss, Inc.

  12. Identifying Interactions that Determine Fragment Binding at Protein Hotspots.

    PubMed

    Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L

    2016-05-12

    Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.

  13. Use of 2-(/sup 125/I)iodomelatonin to characterize melatonin binding sites in chicken retina

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dubocovich, M.L.; Takahashi, J.S.

    2-(/sup 125/I)Iodomelatonin binds with high affinity to a site possessing the pharmacological characteristics of a melatonin receptor in chicken retinal membranes. The specific binding of 2-(/sup 125/I)iodomelatonin is stable, saturable, and reversible. Saturation experiments indicated that 2-(/sup 125/I)iodomelatonin labeled a single class of sites with an affinity constant (Kd) of 434 +/- 56 pM and a total number of binding sites (Bmax) of 74.0 +/- 13.6 fmol/mg of protein. The affinity constant obtained from kinetic analysis was in close agreement with that obtained in saturation experiments. Competition experiments showed a monophasic reduction of 2-(/sup 125/I)iodomelatonin binding with a pharmacological ordermore » of indole amine affinities characteristic of a melatonin receptor: 2-iodomelatonin greater than 6-chloromelatonin greater than or equal to melatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 6-hydroxymelatonin greater than or equal to 6-methoxymelatonin much greater than N-acetyltryptamine greater than N-acetyl-5-hydroxytryptamine greater than 5-methoxytryptamine greater than 5-hydroxytryptamine (inactive). The affinities of these melatonin analogs in competing for 2-(/sup 125/I)iodomelatonin binding sites were correlated closely with their potencies for inhibition of the calcium-dependent release of (3H)dopamine from chicken and rabbit retinas, indicating association of the binding site with a functional response regulated by melatonin. The results indicate that 2-(/sup 125/I)iodomelatonin is a selective, high-affinity radioligand for the identification and characterization of melatonin receptor sites.« less

  14. Mechanism of pathogen recognition by human dectin-2.

    PubMed

    Feinberg, Hadar; Jégouzo, Sabine A F; Rex, Maximus J; Drickamer, Kurt; Weis, William I; Taylor, Maureen E

    2017-08-11

    Dectin-2, a C-type lectin on macrophages and other cells of the innate immune system, functions in response to pathogens, particularly fungi. The carbohydrate-recognition domain (CRD) in dectin-2 is linked to a transmembrane sequence that interacts with the common Fc receptor γ subunit to initiate immune signaling. The molecular mechanism by which dectin-2 selectively binds to pathogens has been investigated by characterizing the CRD expressed in a bacterial system. Competition binding studies indicated that the CRD binds to monosaccharides with modest affinity and that affinity was greatly enhanced for mannose-linked α1-2 or α1-4 to a second mannose residue. Glycan array analysis confirmed selective binding of the CRD to glycans that contain Manα1-2Man epitopes. Crystals of the CRD in complex with a mammalian-type high-mannose Man 9 GlcNAc 2 oligosaccharide exhibited interaction with Manα1-2Man on two different termini of the glycan, with the reducing-end mannose residue ligated to Ca 2+ in a primary binding site and the nonreducing terminal mannose residue occupying an adjacent secondary site. Comparison of the binding sites in DC-SIGN and langerin, two other pathogen-binding receptors of the innate immune system, revealed why these two binding sites accommodate only terminal Manα1-2Man structures, whereas dectin-2 can bind Manα1-2Man in internal positions in mannans and other polysaccharides. The specificity and geometry of the dectin-2-binding site provide the molecular mechanism for binding of dectin-2 to fungal mannans and also to bacterial lipopolysaccharides, capsular polysaccharides, and lipoarabinomannans that contain the Manα1-2Man disaccharide unit. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

    2011-07-29

    Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

  16. A spectroscopic study of phenylbutazone and aspirin bound to serum albumin in rheumatoid diseases

    NASA Astrophysics Data System (ADS)

    Maciążek-Jurczyk, M.; Sułkowska, A.; Bojko, B.; Równicka-Zubik, J.; Sułkowski, W. W.

    2011-11-01

    Interaction of phenylbutazone (PBZ) and aspirin (ASA), two drugs recommended in rheumatoid diseases (RDs), when binding to human (HSA) and bovine (BSA) serum albumins, has been studied by quenching of fluorescence and proton nuclear magnetic resonance ( 1HNMR) techniques. On the basis of spectrofluorescence measurements high affinity binding sites of PBZ and ASA on albumin as well as their interaction within the binding sites were described. A low affinity binding site has been studied by proton nuclear magnetic resonance spectroscopy. Using fluorescence spectroscopy the location of binding site in serum albumin (SA) for PBZ and ASA was found. Association constants Ka were determined for binary (i.e. PBZ-SA and ASA-SA) and ternary complexes (i.e. PBZ-[ASA]-SA and ASA-[PBZ]-SA). PBZ and ASA change the affinity of each other to the binding site in serum albumin (SA). The presence of ASA causes the increase of association constants KaI of PBZ-SA complex. Similarly, PBZ influences KaI of ASA-SA complex. This phenomenon shows that the strength of binding and the stability of the complexes increase in the presence of the second drug. The decrease of KaII values suggests that the competition between PBZ and ASA in binding to serum albumin in the second class of binding sites occurs. The analysis of 1HNMR spectral parameters i.e. changes of chemical shifts and relaxation times of the drug indicate that the presence of ASA weakens the interaction of PBZ with albumin. Similarly PBZ weakens the interaction of ASA with albumin. This conclusion points to the necessity of using a monitoring therapy owning to the possible increase of uncontrolled toxic effects.

  17. Complex Structure and Biochemical Characterization of the Staphylococcus aureus Cyclic Diadenylate Monophosphate (c-di-AMP)-binding Protein PstA, the Founding Member of a New Signal Transduction Protein Family*

    PubMed Central

    Campeotto, Ivan; Zhang, Yong; Mladenov, Miroslav G.; Freemont, Paul S.; Gründling, Angelika

    2015-01-01

    Signaling nucleotides are integral parts of signal transduction systems allowing bacteria to cope with and rapidly respond to changes in the environment. The Staphylococcus aureus PII-like signal transduction protein PstA was recently identified as a cyclic diadenylate monophosphate (c-di-AMP)-binding protein. Here, we present the crystal structures of the apo- and c-di-AMP-bound PstA protein, which is trimeric in solution as well as in the crystals. The structures combined with detailed bioinformatics analysis revealed that the protein belongs to a new family of proteins with a similar core fold but with distinct features to classical PII proteins, which usually function in nitrogen metabolism pathways in bacteria. The complex structure revealed three identical c-di-AMP-binding sites per trimer with each binding site at a monomer-monomer interface. Although distinctly different from other cyclic-di-nucleotide-binding sites, as the half-binding sites are not symmetrical, the complex structure also highlighted common features for c-di-AMP-binding sites. A comparison between the apo and complex structures revealed a series of conformational changes that result in the ordering of two anti-parallel β-strands that protrude from each monomer and allowed us to propose a mechanism on how the PstA protein functions as a signaling transduction protein. PMID:25505271

  18. Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

    PubMed

    Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

    2013-06-14

    Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

  19. Active sites prediction and binding analysis E1-E2 protein human papillomavirus with biphenylsulfonacetic acid

    NASA Astrophysics Data System (ADS)

    Iryani, I.; Amelia, F.; Iswendi, I.

    2018-04-01

    Cervix cancer triggered by Human papillomavirus infection is the second cause to woman death in worldwide. The binding site of E1-E2 protein of HPV 16 is not known from a 3-D structure yet, so in this study we address this issue to study the structure of E1-E2 protein from Human papillomavirus type 16 and to find its potential binding sites using biphenylsulfonacetic acid as inhibitor. Swiss model was used for 3D structure prediction and PDB: 2V9P (E1 protein) and 2NNU (E2 protein) having 52.32% and 100% identity respectively was selected as a template. The 3D model structure developed of E1 and E2 in the core and allowed regions were 99.2% and 99.5%. The ligand binding sites were predicted using online server meta pocket 2.0 and MOE 2009.10 was used for docking. E1-and E2 protein of HPV-16 has three potential binding site that can interact with the inhibitors. The Docking biphenylsulfonacetic acid using these binding sites shows that ligand interact with the protein through hydrogen bonds on Lys 403, Arg 410, His 551 in the first pocket, on Tyr 32, Leu 99 in the second pocket, and Lys 558m Lys 517 in the third pocket.

  20. Functional characterization of transcription factor binding sites for HNF1-alpha, HNF3-beta (FOXA2), HNF4-alpha, Sp1 and Sp3 in the human prothrombin gene enhancer.

    PubMed

    Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L

    2003-08-01

    Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.

  1. Prediction of Ordered Water Molecules in Protein Binding Sites from Molecular Dynamics Simulations: The Impact of Ligand Binding on Hydration Networks.

    PubMed

    Rudling, Axel; Orro, Adolfo; Carlsson, Jens

    2018-02-26

    Water plays a major role in ligand binding and is attracting increasing attention in structure-based drug design. Water molecules can make large contributions to binding affinity by bridging protein-ligand interactions or by being displaced upon complex formation, but these phenomena are challenging to model at the molecular level. Herein, networks of ordered water molecules in protein binding sites were analyzed by clustering of molecular dynamics (MD) simulation trajectories. Locations of ordered waters (hydration sites) were first identified from simulations of high resolution crystal structures of 13 protein-ligand complexes. The MD-derived hydration sites reproduced 73% of the binding site water molecules observed in the crystal structures. If the simulations were repeated without the cocrystallized ligands, a majority (58%) of the crystal waters in the binding sites were still predicted. In addition, comparison of the hydration sites obtained from simulations carried out in the absence of ligands to those identified for the complexes revealed that the networks of ordered water molecules were preserved to a large extent, suggesting that the locations of waters in a protein-ligand interface are mainly dictated by the protein. Analysis of >1000 crystal structures showed that hydration sites bridged protein-ligand interactions in complexes with different ligands, and those with high MD-derived occupancies were more likely to correspond to experimentally observed ordered water molecules. The results demonstrate that ordered water molecules relevant for modeling of protein-ligand complexes can be identified from MD simulations. Our findings could contribute to development of improved methods for structure-based virtual screening and lead optimization.

  2. Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages

    NASA Astrophysics Data System (ADS)

    Djordjevic, Marko

    2005-11-01

    Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely resembles temperate phages, such as lambda. It, however, encodes its own T7-like RNA polymerase (characteristic of virulent phages), whose role in gene expression was unclear. Our analysis resulted in quantitative understanding of the role of both host and phage RNA polymerase, and in the identification of the previously unknown promoter sequence for Xp10 RNA polymerase. More generally, an increasing number of phage genomes are being sequenced every year, and we expect that methods of quantitative data analysis that we introduced will provide an efficient way to study gene expression strategies of novel bacterial viruses.

  3. Sensitive and accurate identification of protein–DNA binding events in ChIP-chip assays using higher order derivative analysis

    PubMed Central

    Barrett, Christian L.; Cho, Byung-Kwan

    2011-01-01

    Immuno-precipitation of protein–DNA complexes followed by microarray hybridization is a powerful and cost-effective technology for discovering protein–DNA binding events at the genome scale. It is still an unresolved challenge to comprehensively, accurately and sensitively extract binding event information from the produced data. We have developed a novel strategy composed of an information-preserving signal-smoothing procedure, higher order derivative analysis and application of the principle of maximum entropy to address this challenge. Importantly, our method does not require any input parameters to be specified by the user. Using genome-scale binding data of two Escherichia coli global transcription regulators for which a relatively large number of experimentally supported sites are known, we show that ∼90% of known sites were resolved to within four probes, or ∼88 bp. Over half of the sites were resolved to within two probes, or ∼38 bp. Furthermore, we demonstrate that our strategy delivers significant quantitative and qualitative performance gains over available methods. Such accurate and sensitive binding site resolution has important consequences for accurately reconstructing transcriptional regulatory networks, for motif discovery, for furthering our understanding of local and non-local factors in protein–DNA interactions and for extending the usefulness horizon of the ChIP-chip platform. PMID:21051353

  4. Text Mining Improves Prediction of Protein Functional Sites

    PubMed Central

    Cohn, Judith D.; Ravikumar, Komandur E.

    2012-01-01

    We present an approach that integrates protein structure analysis and text mining for protein functional site prediction, called LEAP-FS (Literature Enhanced Automated Prediction of Functional Sites). The structure analysis was carried out using Dynamics Perturbation Analysis (DPA), which predicts functional sites at control points where interactions greatly perturb protein vibrations. The text mining extracts mentions of residues in the literature, and predicts that residues mentioned are functionally important. We assessed the significance of each of these methods by analyzing their performance in finding known functional sites (specifically, small-molecule binding sites and catalytic sites) in about 100,000 publicly available protein structures. The DPA predictions recapitulated many of the functional site annotations and preferentially recovered binding sites annotated as biologically relevant vs. those annotated as potentially spurious. The text-based predictions were also substantially supported by the functional site annotations: compared to other residues, residues mentioned in text were roughly six times more likely to be found in a functional site. The overlap of predictions with annotations improved when the text-based and structure-based methods agreed. Our analysis also yielded new high-quality predictions of many functional site residues that were not catalogued in the curated data sources we inspected. We conclude that both DPA and text mining independently provide valuable high-throughput protein functional site predictions, and that integrating the two methods using LEAP-FS further improves the quality of these predictions. PMID:22393388

  5. Fluorescence Spectroscopic Studies on the Complexation of Antidiabetic Drugs with Glycosylated Serum Albumin

    NASA Astrophysics Data System (ADS)

    Seedher, N.; Kanojia, M.

    2013-11-01

    Glycosylation decreases the association constant values and hence the binding affinity of human serum albumin (HSA) for the antidiabetic drugs under study. The percentage of HAS-bound drug at physiological temperature was only about 21-38 % as compared to 46-74 % for non-glycosylated HSA. Thus the percentage of free drug available for an antihyperglycemic effect was about double (62-79 %) compared to the values for non-glycosylated HSA. Much higher free drug concentrations available for pharmacological effect can lead to the risk of hypoglycemia. Hydrophobic interactions were predominantly involved in the binding. In the binding of gliclazide, hydrogen bonding and electrostatic interactions were involved. Site specificity for glycosylated HSA was the same as that for non-glycosylated HSA; gliclazide and repaglinide bind only at site II whereas glimepiride and glipizide bind at both sites I and II. Glycosylation, however, caused conformational changes in albumin, and the binding region within site II was different for glycosylated and non-glycosylated albumin. Stern-Volmer analysis also indicated the conformational changes in albumin as a result of glycosylation and showed that the dynamic quenching mechanism was valid for fluorescence of both glycosylated and non-glycosylated HSA.

  6. Locating the Binding Sites of Pb(II) Ion with Human and Bovine Serum Albumins

    PubMed Central

    Belatik, Ahmed; Hotchandani, Surat; Carpentier, Robert; Tajmir-Riahi, Heidar-Ali

    2012-01-01

    Lead is a potent environmental toxin that has accumulated above its natural level as a result of human activity. Pb cation shows major affinity towards protein complexation and it has been used as modulator of protein-membrane interactions. We located the binding sites of Pb(II) with human serum (HSA) and bovine serum albumins (BSA) at physiological conditions, using constant protein concentration and various Pb contents. FTIR, UV-visible, CD, fluorescence and X-ray photoelectron spectroscopic (XPS) methods were used to analyse Pb binding sites, the binding constant and the effect of metal ion complexation on HSA and BSA stability and conformations. Structural analysis showed that Pb binds strongly to HSA and BSA via hydrophilic contacts with overall binding constants of KPb-HSA = 8.2 (±0.8)×104 M−1 and KPb-BSA = 7.5 (±0.7)×104 M−1. The number of bound Pb cation per protein is 0.7 per HSA and BSA complexes. XPS located the binding sites of Pb cation with protein N and O atoms. Pb complexation alters protein conformation by a major reduction of α-helix from 57% (free HSA) to 48% (metal-complex) and 63% (free BSA) to 52% (metal-complex) inducing a partial protein destabilization. PMID:22574219

  7. Antagonism of ligand-gated ion channel receptors: two domains of the glycine receptor alpha subunit form the strychnine-binding site.

    PubMed Central

    Vandenberg, R J; French, C R; Barry, P H; Shine, J; Schofield, P R

    1992-01-01

    The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. Glycine activation of the receptor is antagonized by the convulsant alkaloid strychnine. Using in vitro mutagenesis and functional analysis of the cDNA encoding the alpha 1 subunit of the human GlyR, we have identified several amino acid residues that form the strychnine-binding site. These residues were identified by transient expression of mutated cDNAs in mammalian (293) cells and examination of resultant [3H]strychnine binding, glycine displacement of [3H]strychnine, and electrophysiological responses to the application of glycine and strychnine. This mutational analysis revealed that residues from two separate domains within the alpha 1 subunit form the binding site for the antagonist strychnine. The first domain includes the amino acid residues Gly-160 and Tyr-161, and the second domain includes the residues Lys-200 and Tyr-202. These results, combined with analyses of other ligand-gated ion channel receptors, suggest a conserved tertiary structure and a common mechanism for antagonism in this receptor superfamily. PMID:1311851

  8. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

    1992-03-01

    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary.

  9. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed Central

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

    1992-01-01

    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

  10. Interaction between Saikosaponin D, Paeoniflorin, and Human Serum Albumin.

    PubMed

    Liang, Guo-Wu; Chen, Yi-Cun; Wang, Yi; Wang, Hong-Mei; Pan, Xiang-Yu; Chen, Pei-Hong; Niu, Qing-Xia

    2018-01-27

    Saikosaponin D (SSD) and paeoniflorin (PF) are the major active constituents of Bupleuri Radix and Paeonia lactiflora Pall , respectively, and have been widely used in China to treat liver and other diseases for many centuries. We explored the binding of SSD/PF to human serum albumin (HSA) by using fluorospectrophotometry, circular dichroism (CD) and molecular docking. Both SSD and PF produced a conformational change in HSA. Fluorescence quenching was accompanied by a blue shift in the fluorescence spectra. Co-binding of PF and SSD also induced quenching and a conformational change in HSA. The Stern-Volmer equation showed that quenching was dominated by static quenching. The binding constant for ternary interaction was below that for binary interaction. Site-competitive experiments demonstrated that SSD/PF bound to site I (subdomain IIA) and site II (subdomain IIIA) in HSA. Analysis of thermodynamic parameters indicated that hydrogen bonding and van der Waals forces were mostly responsible for the binary association. Also, there was energy transfer upon binary interaction. Molecular docking supported the experimental findings in conformation, binding sites and binding forces.

  11. Three-dimensional (3D) structure prediction and function analysis of the chitin-binding domain 3 protein HD73_3189 from Bacillus thuringiensis HD73.

    PubMed

    Zhan, Yiling; Guo, Shuyuan

    2015-01-01

    Bacillus thuringiensis (Bt) is capable of producing a chitin-binding protein believed to be functionally important to bacteria during the stationary phase of its growth cycle. In this paper, the chitin-binding domain 3 protein HD73_3189 from B. thuringiensis has been analyzed by computer technology. Primary and secondary structural analyses demonstrated that HD73_3189 is negatively charged and contains several α-helices, aperiodical coils and β-strands. Domain and motif analyses revealed that HD73_3189 contains a signal peptide, an N-terminal chitin binding 3 domains, two copies of a fibronectin-like domain 3 and a C-terminal carbohydrate binding domain classified as CBM_5_12. Moreover, analysis predicted the protein's associated localization site to be the cell wall. Ligand site prediction determined that amino acid residues GLU-312, TRP-334, ILE-341 and VAL-382 exposed on the surface of the target protein exhibit polar interactions with the substrate.

  12. Structural Basis for Antifreeze Activity of Ice-binding Protein from Arctic Yeast*

    PubMed Central

    Lee, Jun Hyuck; Park, Ae Kyung; Do, Hackwon; Park, Kyoung Sun; Moh, Sang Hyun; Chi, Young Min; Kim, Hak Jun

    2012-01-01

    Arctic yeast Leucosporidium sp. produces a glycosylated ice-binding protein (LeIBP) with a molecular mass of ∼25 kDa, which can lower the freezing point below the melting point once it binds to ice. LeIBP is a member of a large class of ice-binding proteins, the structures of which are unknown. Here, we report the crystal structures of non-glycosylated LeIBP and glycosylated LeIBP at 1.57- and 2.43-Å resolution, respectively. Structural analysis of the LeIBPs revealed a dimeric right-handed β-helix fold, which is composed of three parts: a large coiled structural domain, a long helix region (residues 96–115 form a long α-helix that packs along one face of the β-helix), and a C-terminal hydrophobic loop region (243PFVPAPEVV251). Unexpectedly, the C-terminal hydrophobic loop region has an extended conformation pointing away from the body of the coiled structural domain and forms intertwined dimer interactions. In addition, structural analysis of glycosylated LeIBP with sugar moieties attached to Asn185 provides a basis for interpreting previous biochemical analyses as well as the increased stability and secretion of glycosylated LeIBP. We also determined that the aligned Thr/Ser/Ala residues are critical for ice binding within the B face of LeIBP using site-directed mutagenesis. Although LeIBP has a common β-helical fold similar to that of canonical hyperactive antifreeze proteins, the ice-binding site is more complex and does not have a simple ice-binding motif. In conclusion, we could identify the ice-binding site of LeIBP and discuss differences in the ice-binding modes compared with other known antifreeze proteins and ice-binding proteins. PMID:22303017

  13. Evidence for a single class of somatostatin receptors in ground squirrel cerebral cortex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krantic, S.; Petrovic, V.M.; Quirion, R.

    1989-01-01

    In the present study we characterized high-affinity somatostatin (SRIF) binding sites (Kd = 2.06 +/- 0.32 nM and Bmax = 295 +/- 28 fmol/mg protein) in cerebral cortex membrane preparations of European ground squirrel using /sup 125/I-(Tyr0-D-Trp8)-SRIF14 as a radioligand. The inhibition of radioligand specific binding by SRIF14, as well as by its agonists (SRIF28, Tyr0-D-Trp8-SRIF14, SMS 201 995) was complete and monophasic, thus revealing a single population of somatostatinergic binding sites. Radioautographic analysis of /sup 125/I-(Tyr0-D-Trp8)-SRIF14 labeled brain sections confirmed the results of our biochemical study. The homogeneity of SRIF binding sites in the ground squirrel neocortex was notmore » dependent on the animal's life-cycle phase.« less

  14. Binding of mitomycin C to blood proteins: A spectroscopic analysis and molecular docking

    NASA Astrophysics Data System (ADS)

    Jang, Jongchol; Liu, Hui; Chen, Wei; Zou, Guolin

    2009-06-01

    Mitomycin C (MMC) was the first recognized bioreductive alkylating agent, and has been widely used clinically for antitumor therapy. The binding of MMC to two human blood proteins, human serum albumin (HSA) and human hemoglobin (HHb), have been investigated by fluorescence quenching, synchronous fluorescence, circular dichroism (CD) spectroscopy and molecular docking methods. The fluorescence data showed that binding of MMC to proteins caused strong fluorescence quenching of proteins through a static quenching way, and each protein had only one binding site for the drug. The binding constants of MMC to HSA and HHb at 298 K were 2.71 × 10 4 and 2.56 × 10 4 L mol -1, respectively. Thermodynamic analysis suggested that both hydrophobic interaction and hydrogen bonding played major roles in the binding of MMC to HSA or HHb. The CD spectroscopy indicated that the secondary structures of the two proteins were not changed in the presence of MMC. The study of molecular docking showed that MMC was located in the entrance of site I of HSA, and in the central cavity of HHb.

  15. Electrostatic steering and ionic tethering in enzyme-ligand binding: insights from simulations.

    PubMed

    Wade, R C; Gabdoulline, R R; Lüdemann, S K; Lounnas, V

    1998-05-26

    To bind at an enzyme's active site, a ligand must diffuse or be transported to the enzyme's surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and beta-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as "ionic tethering." We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme's surroundings even when the substrate is nonpolar.

  16. In silico investigation into the interactions between murine 5-HT3 receptor and the principle active compounds of ginger (Zingiber officinale).

    PubMed

    Lohning, Anna E; Marx, Wolfgang; Isenring, Liz

    2016-11-01

    Gingerols and shogaols are the primary non-volatile actives within ginger (Zingiber officinale). These compounds have demonstrated in vitro to exert 5-HT 3 receptor antagonism which could benefit chemotherapy-induced nausea and vomiting (CINV). The site and mechanism of action by which these compounds interact with the 5-HT 3 receptor is not fully understood although research indicates they may bind to a currently unidentified allosteric binding site. Using in silico techniques, such as molecular docking and GRID analysis, we have characterized the recently available murine 5-HT 3 receptor by identifying sites of strong interaction with particular functional groups at both the orthogonal (serotonin) site and a proposed allosteric binding site situated at the interface between the transmembrane region and the extracellular domain. These were assessed concurrently with the top-scoring poses of the docked ligands and included key active gingerols, shogaols and dehydroshogaols as well as competitive antagonists (e.g. setron class of pharmacologically active drugs), serotonin and its structural analogues, curcumin and capsaicin, non-competitive antagonists and decoys. Unexpectedly, we found that the ginger compounds and their structural analogs generally outscored other ligands at both sites. Our results correlated well with previous site-directed mutagenesis studies in identifying key binding site residues. We have identified new residues important for binding the ginger compounds. Overall, the results suggest that the ginger compounds and their structural analogues possess a high binding affinity to both sites. Notwithstanding the limitations of such theoretical analyses, these results suggest that the ginger compounds could act both competitively or non-competitively as has been shown for palonosetron and other modulators of CYS loop receptors. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Immunological characterization of eristostatin and echistatin binding sites on alpha IIb beta 3 and alpha V beta 3 integrins.

    PubMed Central

    Marcinkiewicz, C; Rosenthal, L A; Mosser, D M; Kunicki, T J; Niewiarowski, S

    1996-01-01

    Two disintegrins with a high degree of amino acid sequence similarity, echistatin and eristostatin, showed a low level of interaction with Chinese hamster ovary (CHO) cells, but they bound to CHO cells transfected with alpha IIb beta 3 genes (A5 cells) and to CHO cells transfected with alpha v beta 3 genes (VNRC3 cells) in a reversible and saturable manner. Scatchard analysis revealed that eristostatin bound to 816000 sites per A5 cell (Kd 28 nM) and to 200000 sites (Kd 14 nM) per VNRC3 cell respectively. However, VNRC3 cells did not bind to immobilized eristostatin. Echistatin bound to 495000 sites (Kd 53 nM) per A5 cell and to 443000 sites (Kd 20 nM) per VNRC3 cell. As determined by flow cytometry, radiobinding assay and adhesion studies, binding of both disintegrins to A5 cells and resting platelets and binding of echistatin to VNRC3 cells resulted in the expression of ligand-induced binding sites (LIBS) on the beta 3 subunit. Eristostatin inhibited, more strongly than echistatin, the binding of three monoclonal antibodies: OPG2 (RGD motif dependent), A2A9 (alpha IIb beta 3 complex dependent) and 7E3 (alpha IIb beta 3 and alpha v beta 3 complex dependent) to A5 cells, to resting and to activated platelets and to purified alpha IIb beta 3. Experiments in which echistatin and eristostatin were used alone or in combination to inhibit the binding of 7E3 and OPG2 antibodies to resting platelets suggested that these two disintegrins bind to different but overlapping sites on alpha IIb beta 3 integrin. Monoclonal antibody LM 609 and echistatin seemed to bind to different sites on alpha v beta 3 integrin. However, echistatin inhibited binding of 7E3 antibody to VNRC3 cells and to purified alpha v beta 3 suggesting that alpha v beta 3 and alpha IIb beta 3 might share the same epitope to which both echistatin and 7E3 bind. Eristostatin had no effect in these systems, providing further evidence that it binds to a different epitope on alpha v beta 3. PMID:8760368

  18. Thermodynamic and structural insights into CSL-DNA complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Friedmann, David R.; Kovall, Rhett A.

    The Notch pathway is an intercellular signaling mechanism that plays important roles in cell fates decisions throughout the developing and adult organism. Extracellular complexation of Notch receptors with ligands ultimately results in changes in gene expression, which is regulated by the nuclear effector of the pathway, CSL (C-promoter binding factor 1 (CBF-1), suppressor of hairless (Su(H)), lin-12 and glp-1 (Lag-1)). CSL is a DNA binding protein that is involved in both repression and activation of transcription from genes that are responsive to Notch signaling. One well-characterized Notch target gene is hairy and enhancer of split-1 (HES-1), which is regulated bymore » a promoter element consisting of two CSL binding sites oriented in a head-to-head arrangement. Although previous studies have identified in vivo and consensus binding sites for CSL, and crystal structures of these complexes have been determined, to date, a quantitative description of the energetics that underlie CSL-DNA binding is unknown. Here, we provide a thermodynamic and structural analysis of the interaction between CSL and the two individual sites that comprise the HES-1 promoter element. Our comprehensive studies that analyze binding as a function of temperature, salt, and pH reveal moderate, but distinct, differences in the affinities of CSL for the two HES-1 binding sites. Similarly, our structural results indicate that overall CSL binds both DNA sites in a similar manner; however, minor changes are observed in both the conformation of CSL and DNA. Taken together, our results provide a quantitative and biophysical basis for understanding how CSL interacts with DNA sites in vivo.« less

  19. Sequence analysis of serum albumins reveals the molecular evolution of ligand recognition properties.

    PubMed

    Fanali, Gabriella; Ascenzi, Paolo; Bernardi, Giorgio; Fasano, Mauro

    2012-01-01

    Serum albumin (SA) is a circulating protein providing a depot and carrier for many endogenous and exogenous compounds. At least seven major binding sites have been identified by structural and functional investigations mainly in human SA. SA is conserved in vertebrates, with at least 49 entries in protein sequence databases. The multiple sequence analysis of this set of entries leads to the definition of a cladistic tree for the molecular evolution of SA orthologs in vertebrates, thus showing the clustering of the considered species, with lamprey SAs (Lethenteron japonicum and Petromyzon marinus) in a separate outgroup. Sequence analysis aimed at searching conserved domains revealed that most SA sequences are made up by three repeated domains (about 600 residues), as extensively characterized for human SA. On the contrary, lamprey SAs are giant proteins (about 1400 residues) comprising seven repeated domains. The phylogenetic analysis of the SA family reveals a stringent correlation with the taxonomic classification of the species available in sequence databases. A focused inspection of the sequences of ligand binding sites in SA revealed that in all sites most residues involved in ligand binding are conserved, although the versatility towards different ligands could be peculiar of higher organisms. Moreover, the analysis of molecular links between the different sites suggests that allosteric modulation mechanisms could be restricted to higher vertebrates.

  20. Basic Fibroblast Growth Factor Activates Serum Response Factor Gene Expression by Multiple Distinct Signaling Mechanisms

    PubMed Central

    Spencer, Jeffrey A.; Major, Michael L.; Misra, Ravi P.

    1999-01-01

    Serum response factor (SRF) plays a central role in the transcriptional response of mammalian cells to a variety of extracellular signals. It is a key regulator of many cellular early response genes which are believed to be involved in cell growth and differentiation. The mechanism by which SRF activates transcription in response to mitogenic agents has been extensively studied; however, significantly less is known about regulation of the SRF gene itself. Previously, we identified distinct regulatory elements in the SRF promoter that play a role in activation, including a consensus ETS domain binding site, a consensus overlapping Sp/Egr-1 binding site, and two SRF binding sites. We further showed that serum induces SRF by a mechanism that requires an intact SRF binding site, also termed a CArG box. In the present study we demonstrate that in response to stimulation of cells by a purified growth factor, basic fibroblast growth factor (bFGF), the SRF promoter is upregulated by a complex pathway that involves at least two independent mechanisms: a CArG box-independent mechanism that is mediated by an ETS binding site, and a novel CArG box-dependent mechanism that requires both an Sp factor binding site and the CArG motifs for maximal stimulation. Our analysis indicates that the CArG/Sp element activation mechanism is mediated by distinct signaling pathways. The CArG box-dependent component is targeted by a Rho-mediated pathway, and the Sp binding site-dependent component is targeted by a Ras-mediated pathway. Both SRF and bFGF have been implicated in playing an important role in mediating cardiogenesis during development. The implications of our findings for SRF expression during development are discussed. PMID:10330138

  1. Studies of the mechanism of selectivity of protein tyrosine phosphatase 1B (PTP1B) bidentate inhibitors using molecular dynamics simulations and free energy calculations.

    PubMed

    Fang, Lei; Zhang, Huai; Cui, Wei; Ji, Mingjun

    2008-10-01

    Bidentate inhibitors of protein tyrosine phosphatase 1B (PTP1B) are considered as a group of ideal inhibitors with high binding potential and high selectivity in treating type II diabetes. In this paper, the binding models of five bidentate inhibitors to PTP1B, TCPTP, and SHP-2 were investigated and compared by using molecular dynamics (MD) simulations and free energy calculations. The binding free energies were computed using the Molecular Mechanics/Poisson-Boltzmann Surface Area (MM/PBSA) methodology. The calculation results show that the predicted free energies of the complexes are well consistent with the experimental data. The Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) free energy decomposition analysis indicates that the residues ARG24, ARG254, and GLN262 in the second binding site of PTP1B are essential for the high selectivity of inhibitors. Furthermore, the residue PHE182 close to the active site is also important for the selectivity and the binding affinity of the inhibitors. According to our analysis, it can be concluded that in most cases the polarity of the portion of the inhibitor that binds to the second binding site of the protein is positive to the affinity of the inhibitors while negative to the selectivity of the inhibitors. We expect that the information we obtained here can help to develop potential PTP1B inhibitors with more promising specificity.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strittmatter, S.M.; Snyder, S.H.

    We demonstrate that (3H)captopril selectively labels angiotensin converting enzyme (EC 3.14.15.1) (ACE) and employ this technique to probe enzyme-inhibitor interactions. (3H)Captopril binding sites copurify with ACE activity from rat lung or rat brain. At each stage of the purification the Vmax/Bmax ratio, or kcat is 17,000 min-1 with hippuryl-L-histidyl-L-leucine as substrate. The specificity of (3H)captopril binding is apparent in the similar pharmacologic profile of inhibition in crude and pure enzyme preparations. Furthermore, binding sites and enzyme activity comigrate in gel filtration and sucrose gradient sedimentation experiments. Equilibrium analysis of (3H)captopril binding to purified ACE reveals a Bmax of 6 nmol/mgmore » of protein (KD = 2 nM), demonstrating the presence of one inhibitor binding site per polypeptide chain. The kinetics of (3H)captopril binding are characterized by monophasic association and dissociation rate constants of 0.026 nM-1 min-1 and 0.034 min-1, respectively. The affinity of ACE for both (3H) captopril and enalaprilat is greater at 37 degrees than at 0 degree, demonstrating that these interactions are entropically driven, perhaps by an isomerization of the enzyme molecule. The ionic requirements for (3H)captopril binding and substrate catalysis differ. Chloride and bromide ion, but not fluoride, are about 100-fold more potent stimulators of binding than catalysis. When the active site Zn2+ ion is replaced by Co2+, catalysis was stimulated 2-fold, whereas binding activity was decreased by 70%.« less

  3. Cloud Computing for Protein-Ligand Binding Site Comparison

    PubMed Central

    2013-01-01

    The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery. PMID:23762824

  4. Cloud computing for protein-ligand binding site comparison.

    PubMed

    Hung, Che-Lun; Hua, Guan-Jie

    2013-01-01

    The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery.

  5. Structural basis for the interaction of antibiotics with peptidyl transferase center in eubacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlunzen, Frank; Zarivach, Raz; Harms, Jörg

    2009-10-07

    Ribosomes, the site of protein synthesis, are a major target for natural and synthetic antibiotics. Detailed knowledge of antibiotic binding sites is central to understanding the mechanisms of drug action. Conversely, drugs are excellent tools for studying the ribosome function. To elucidate the structural basis of ribosome-antibiotic interactions, we determined the high-resolution X-ray structures of the 50S ribosomal subunit of the eubacterium Deinococcus radiodurans, complexed with the clinically relevant antibiotics chloramphenicol, clindamycin and the three macrolides erythromycin, clarithromycin and roxithromycin. We found that antibiotic binding sites are composed exclusively of segments of 23S ribosomal RNA at the peptidyl transferase cavitymore » and do not involve any interaction of the drugs with ribosomal proteins. Here we report the details of antibiotic interactions with the components of their binding sites. Our results also show the importance of putative Mg{sup +2} ions for the binding of some drugs. This structural analysis should facilitate rational drug design.« less

  6. Glomerular anionic site distribution in nonproteinuric rats. A computer-assisted morphometric analysis.

    PubMed

    Pilia, P A; Swain, R P; Williams, A V; Loadholt, C B; Ainsworth, S K

    1985-12-01

    The cationic ultrastructural tracer polyethyleneimine (PEI: pI approximately equal to 11.0), binds electrophysically to uniformly spaced discrete electron-dense anionic sites present in the laminae rarae of the rat glomerular basement membrane (GBM), mesangial reflections of the GBM, Bowman's capsule, and tubular basement membranes when administered intravenously. Computer-assisted morphometric analysis of glomerular anionic sites reveals that the maximum concentration of stainable lamina rara externa (lre) sites (21/10,000 A GBM) occurs 60 minutes after PEI injection with a site-site interspacing of 460 A. Lamina rara interna (lri) sites similarly demonstrate a maximum concentration (20/10,000 A GBM) at 60 minutes with a periodicity of 497 A. The concentration and distribution of anionic sites within the lri was irregular in pattern and markedly decreased in number, while the lre possesses an electrical field that is highly regular at all time intervals analyzed (15, 30, 60, 120, 180, 240, and 300 minutes). Immersion and perfusion of renal tissue with PEI reveals additional heavy staining of the epithelial and endothelial cell sialoprotein coatings. PEI appears to bind to glomerular anionic sites reversibly: ie, between 60 and 180 minutes the concentration of stained sites decreases. At 300 minutes, the interspacing once again approaches the 60-minute concentration. This suggests a dynamic turnover or dissociation followed by a reassociation of glomerular negatively charged PEI binding sites. In contrast, morphometric analysis of anionic sites stained with lysozyme and protamine sulfate reveals interspacings of 642 A and 585 A, respectively; in addition, these tracers produce major glomerular ultrastructural alterations and induce transient proteinuria. PEI does not induce proteinuria in rats, nor does it produce glomerular morphologic alterations when ten times the tracer dosage is administered intravenously. These findings indicate that the choice of ultrastructural charge tracer, the method of administering the tracer, and the time selected for analysis of tissue after administration of tracer significantly influences results. Morphometric analysis of the distribution of glomerular anionic sites in nonproteinuric rats provides a method of evaluating quantitative alterations of the glomerular charge barrier in renal disease models.

  7. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  8. NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

    PubMed Central

    Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

    1995-01-01

    The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

  9. An anti-hapten camelid antibody reveals a cryptic binding site with significant energetic contributions from a nonhypervariable loop

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fanning, Sean W.; Horn, James R.

    2014-03-05

    Conventional anti-hapten antibodies typically bind low-molecular weight compounds (haptens) in the crevice between the variable heavy and light chains. Conversely, heavy chain-only camelid antibodies, which lack a light chain, must rely entirely on a single variable domain to recognize haptens. While several anti-hapten VHHs have been generated, little is known regarding the underlying structural and thermodynamic basis for hapten recognition. Here, an anti-methotrexate VHH (anti-MTX VHH) was generated using grafting methods whereby the three complementarity determining regions (CDRs) were inserted onto an existing VHH framework. Thermodynamic analysis of the anti-MTX VHH CDR1-3 Graft revealed a micromolar binding affinity, while themore » crystal structure of the complex revealed a somewhat surprising noncanonical binding site which involved MTX tunneling under the CDR1 loop. Due to the close proximity of MTX to CDR4, a nonhypervariable loop, the CDR4 loop sequence was subsequently introduced into the CDR1-3 graft, which resulted in a dramatic 1000-fold increase in the binding affinity. Crystal structure analysis of both the free and complex anti-MTX CDR1-4 graft revealed CDR4 plays a significant role in both intermolecular contacts and binding site conformation that appear to contribute toward high affinity binding. Additionally, the anti-MTX VHH possessed relatively high specificity for MTX over closely related compounds aminopterin and folate, demonstrating that VHH domains are capable of binding low-molecular weight ligands with high affinity and specificity, despite their reduced interface.« less

  10. CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

    PubMed Central

    Qiao, Huan; May, James M.

    2013-01-01

    SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

  11. Conformation-selective inhibitors reveal differences in the activation and phosphate-binding loops of the tyrosine kinases Abl and Src

    PubMed Central

    Hari, Sanjay B.; Perera, B. Gayani K.; Ranjitkar, Pratistha; Seeliger, Markus A.; Maly, Dustin J.

    2013-01-01

    Over the last decade, an increasingly diverse array of potent and selective inhibitors that target the ATP-binding sites of protein kinases have been developed. Many of these inhibitors, like the clinically approved drug imatinib (Gleevec), stabilize a specific catalytically inactive ATP-binding site conformation of their kinases targets. Imatinib is notable in that it is highly selective for its kinase target, Abl, over other closely-related tyrosine kinases, like Src. In addition, imatinib is highly sensitive to the phosphorylation state of Abl's activation loop, which is believed to be a general characteristic of all inhibitors that stabilize a similar inactive ATP-binding site conformation. In this report, we perform a systematic analysis of a diverse series of ATP-competitive inhibitors that stabilize a similar inactive ATP-binding site conformation as imatinib with the tyrosine kinases Src and Abl. In contrast to imatinib, many of these inhibitors have very similar potencies against Src and Abl. Furthermore, only a subset of this class of inhibitors is sensitive to the phosphorylation state of the activation loop of these kinases. In attempting to explain this observation, we have uncovered an unexpected correlation between Abl's activation loop and another flexible active site feature, called the phosphate-binding loop (p-loop). These studies shed light on how imatinib is able to obtain its high target selectivity and reveal how the conformational preference of flexible active site regions can vary between closely related kinases. PMID:24106839

  12. Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2.

    PubMed

    Subramanian, Nandhitha; Scopelitti, Amanda J; Carland, Jane E; Ryan, Renae M; O'Mara, Megan L; Vandenberg, Robert J

    2016-01-01

    The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10.

  13. Identification of a 3rd Na+ Binding Site of the Glycine Transporter, GlyT2

    PubMed Central

    Subramanian, Nandhitha; Scopelitti, Amanda J.; Carland, Jane E.; Ryan, Renae M.; O’Mara, Megan L.; Vandenberg, Robert J.

    2016-01-01

    The Na+/Cl- dependent glycine transporters GlyT1 and GlyT2 regulate synaptic glycine concentrations. Glycine transport by GlyT2 is coupled to the co-transport of three Na+ ions, whereas transport by GlyT1 is coupled to the co-transport of only two Na+ ions. These differences in ion-flux coupling determine their respective concentrating capacities and have a direct bearing on their functional roles in synaptic transmission. The crystal structures of the closely related bacterial Na+-dependent leucine transporter, LeuTAa, and the Drosophila dopamine transporter, dDAT, have allowed prediction of two Na+ binding sites in GlyT2, but the physical location of the third Na+ site in GlyT2 is unknown. A bacterial betaine transporter, BetP, has also been crystallized and shows structural similarity to LeuTAa. Although betaine transport by BetP is coupled to the co-transport of two Na+ ions, the first Na+ site is not conserved between BetP and LeuTAa, the so called Na1' site. We hypothesized that the third Na+ binding site (Na3 site) of GlyT2 corresponds to the BetP Na1' binding site. To identify the Na3 binding site of GlyT2, we performed molecular dynamics (MD) simulations. Surprisingly, a Na+ placed at the location consistent with the Na1' site of BetP spontaneously dissociated from its initial location and bound instead to a novel Na3 site. Using a combination of MD simulations of a comparative model of GlyT2 together with an analysis of the functional properties of wild type and mutant GlyTs we have identified an electrostatically favorable novel third Na+ binding site in GlyT2 formed by Trp263 and Met276 in TM3, Ala481 in TM6 and Glu648 in TM10. PMID:27337045

  14. Synaptosomal binding of 125I-labelled daboiatoxin, a new PLA2 neurotoxin from the venom of Daboia russelli siamensis.

    PubMed

    Maung-Maung-Thwin; Gopalakrishnakone, P; Yuen, R; Tan, C H

    1996-02-01

    Daboiatoxin (DbTx), the PLA2 neurotoxin from Daboia russelli siamensis venom, was shown to bind specifically and saturably to rat cerebrocortical synaptosomes and synaptic membrane fragments. Two families of binding sites were detected by equilibrium binding analysis in the presence and absence of Ca2+. Scatchard analysis of biphasic plateaus revealed Kdl 5 nM and Bmax1, 6 pmoles/mg protein, and Kd2 80 nM and Bmax2 20 pmoles/mg protein, respectively, for the high- and low-affinity binding sites. The binding of 125I-DbTx to synaptosomes did not show marked dependence on Ca2+, Mg2+, Co2+ and Sr2+. Native DbTx was the only strong competitor to 125I-DbTx synaptosomal binding (IC50 12.5 nM, KI 5.5 nM). Two other crotalid PLA2 neurotoxins, crotoxin CB and mojave toxin basic subunit, and nontoxic C. Atrox PLA2 enzyme, were relatively weaker inhibitors, while two viperid PLA2 neurotoxins, ammodytoxin A and VRV PL V, were very weak inhibitors. Crotoxin CA was a poor inhibitor even at microM concentrations, whereas no inhibitory effect at all was observed with crotoxin CACB, ammodytoxin C, VRV PL VIIIa, taipoxin, beta-bungarotoxin, or with PLA2 enzymes from N. naja venom, E. schistosa venom, bee venom and porcine pancreas. All other pharmacologically active ligands examined (epinephrine, norepinephrine, histamine, choline, dopamine, serotonin, GABA, naloxone, WB-4101, atropine, hexamethonium and alpha-bun-garotoxin) also failed to interfere with 125I-DbTx binding. As those competitors that showed partial inhibition were effective only at microM concentration range compared to the Kd (5 nM) of 125I-DbTx synaptosomal binding, DbTx could well recognize a different neuronal binding site. Rabbit anti-DbTx polyclonal antisera completely blocked the specific binding. When a range of Ca2+ and K+ channels modulators were examined, Ca2+ channel blockers (omega-conotoxins GVIA and MVIIC, taicatoxin, calciseptine and nitrendiprene) did not affect the binding even at high concentrations, while charybdotoxin was the only K+ channel effector that could partially displace 125I-DbTx synaptosomal binding amongst the K+ channel blockers tested (apamin, dendrotoxin-I, iberiotoxin, MCD-peptide, 4-aminopyridine and tetraethylammonium), suggesting that neither K+ nor Ca2+ channels are associated with DbTx binding sites.

  15. Mechanisms of Zn(II) binded to collagen and its effect on the capacity of eco-friendly Zn-Cr combination tanning system.

    PubMed

    Cao, Shan; Liu, Bing; Cheng, Baozhen; Lu, Fuping; Wang, Yanping; Li, Yu

    2017-01-05

    The eco-friendly combination tanning process has been developed to reduce chromium in existing researches, which is based on zinc tanning agents. This can be considered as a less-chrome substitute for current tanning process. To gain deeper understanding of the binding mechanisms of zinc-collagen interaction, which are affected by tanning pH, experiments have been carried out. Analysis in this paper reveals how chemical bonds from the collagen's main function groups combine with zinc. XPS and NIR data was analyzed for further understanding of where the zinc binding sites lie on collagen fibers at different pH. The results indicate that high pH is helpful to amino-binding sites while low pH promotes carboxyl-binding sites on collagen fibers. Furthermore, from the effect of Zinc-chrome combination tanning, we can see that the new method reduces the chromium dosage in tanning process compared to the conventional chrome tanning method. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Reduction of GABA/sub B/ receptor binding induced by climbing fiber degeneration in the rat cerebellum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kato, K.; Fukuda, H.

    1985-07-22

    When the rat cerebellar climbing fibers degenerated, as induced by lesioning the inferior olive with 3-acetylpyridine (3-AP), GABA/sub B/ receptor binding determined with /sup 3/H-(+/-)baclofen was reduced in the cerebellum but not in the cerebral cortex of rats. Computer analysis of saturation data revealed two components of the binding sites, and indicated that decrease of the binding in the cerebellum was due to reduction in receptor density, mainly of the high-affinity sites, the B/sub max/ of which was reduced to one-third that in the control animals. In vitro treatment with 3-AP, of the membranes prepared from either the cerebellum ormore » the cerebral cortex, induced no alteration in the binding sites, thereby indicating that the alteration of GABA/sub B/ sites induced by in vivo treatment with 3-AP is not due to a direct action of 3-AP on the receptor. GABA/sub A/ and benzodiazepine receptor binding labelled with /sup 3/H-muscimol and /sup 3/H-diazepam, respectively, in both of brain regions was not affected by destruction of the inferior olive. These results provide evidence that some of the GABA/sub B/ sites but neither GABA/sub A/ nor benzodiazepine receptors in the cerebellum are located at the climbing fiber terminals. 28 references, 4 figures, 2 tables.« less

  17. Deactivation of the E. coli pH stress sensor CadC by cadaverine.

    PubMed

    Haneburger, Ina; Fritz, Georg; Jurkschat, Nicole; Tetsch, Larissa; Eichinger, Andreas; Skerra, Arne; Gerland, Ulrich; Jung, Kirsten

    2012-11-23

    At acidic pH and in the presence of lysine, the pH sensor CadC activates transcription of the cadBA operon encoding the lysine/cadaverine antiporter CadB and the lysine decarboxylase CadA. In effect, these proteins contribute to acid stress adaptation in Escherichia coli. cadBA expression is feedback inhibited by cadaverine, and a cadaverine binding site is predicted within the central cavity of the periplasmic domain of CadC on the basis of its crystallographic analysis. Our present study demonstrates that this site only partially accounts for the cadaverine response in vivo. Instead, evidence for a second, pivotal binding site was collected, which overlaps with the pH-responsive patch of amino acids located at the dimer interface of the periplasmic domain. The temporal response of the E. coli Cad module upon acid shock was measured and modeled for two CadC variants with mutated cadaverine binding sites. These studies supported a cascade-like binding and deactivation model for the CadC dimer: binding of cadaverine within the pair of central cavities triggers a conformational transition that exposes two further binding sites at the dimer interface, and the occupation of those stabilizes the inactive conformation. Altogether, these data represent a striking example for the deactivation of a pH sensor. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Hydropathic analysis and biological evaluation of stilbene derivatives as colchicine site microtubule inhibitors with anti-leukemic activity

    PubMed Central

    TRIPATHI, ASHUTOSH; DURRANT, DAVID; LEE, RAY M.; BARUCHELLO, RICCARDO; ROMAGNOLI, ROMEO; SIMONI, DANIELE; KELLOGG, GLEN E.

    2009-01-01

    The crucial role of the microtubule in the cell division has identified tubulin as a target for the development of therapeutics for cancer; in particular tubulin is a target for antineoplastic agents that act by interfering with the dynamic stability of microtubules. A molecular modeling study was carried out to accurately represent the complex structure and the binding mode of a new class of stilbene-based tubulin inhibitors that bind at the αβ-tubulin colchicine site. Computational docking along with HINT score analysis fitted these inhibitors into the colchicine site and revealed detailed structure-activity information useful for inhibitor design. Quantitative analysis of the results was in good agreement with the in vitro antiproliferative activity of these derivatives (ranging from 3 nM to 100 μM) such that calculated and measured free energies of binding correlate with an r2 of 0.89 (standard error ± 0.85 kcal mol−1). This correlation suggests that the activity of unknown compounds may be predicted. PMID:19912057

  19. Structure and self-assembly of the calcium binding matrix protein of human metapneumovirus.

    PubMed

    Leyrat, Cedric; Renner, Max; Harlos, Karl; Huiskonen, Juha T; Grimes, Jonathan M

    2014-01-07

    The matrix protein (M) of paramyxoviruses plays a key role in determining virion morphology by directing viral assembly and budding. Here, we report the crystal structure of the human metapneumovirus M at 2.8 Å resolution in its native dimeric state. The structure reveals the presence of a high-affinity Ca²⁺ binding site. Molecular dynamics simulations (MDS) predict a secondary lower-affinity site that correlates well with data from fluorescence-based thermal shift assays. By combining small-angle X-ray scattering with MDS and ensemble analysis, we captured the structure and dynamics of M in solution. Our analysis reveals a large positively charged patch on the protein surface that is involved in membrane interaction. Structural analysis of DOPC-induced polymerization of M into helical filaments using electron microscopy leads to a model of M self-assembly. The conservation of the Ca²⁺ binding sites suggests a role for calcium in the replication and morphogenesis of pneumoviruses. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Systematic prediction of control proteins and their DNA binding sites

    PubMed Central

    Sorokin, Valeriy; Severinov, Konstantin; Gelfand, Mikhail S.

    2009-01-01

    We present here the results of a systematic bioinformatics analysis of control (C) proteins, a class of DNA-binding regulators that control time-delayed transcription of their own genes as well as restriction endonuclease genes in many type II restriction-modification systems. More than 290 C protein homologs were identified and DNA-binding sites for ∼70% of new and previously known C proteins were predicted by a combination of phylogenetic footprinting and motif searches in DNA upstream of C protein genes. Additional analysis revealed that a large proportion of C protein genes are translated from leaderless RNA, which may contribute to time-delayed nature of genetic switches operated by these proteins. Analysis of genetic contexts of newly identified C protein genes revealed that they are not exclusively associated with restriction-modification genes; numerous instances of associations with genes originating from mobile genetic elements were observed. These instances might be vestiges of ancient horizontal transfers and indicate that during evolution ancestral restriction-modification system genes were the sites of mobile elements insertions. PMID:19056824

  1. The involvement of the sodium-potassium pump in postjunctional supersensitivity of the guinea-pig vas deferens as assessed by [3H]ouabain binding.

    PubMed

    Wong, S K; Westfall, D P; Fedan, J S; Fleming, W W

    1981-10-01

    Previous evidence has suggested that postjunctional supersensitivity of the guinea-pig vas deferens results, in part, from partial depolarization of the cell membrane. The depolarization is believed to result from a reduction in the activity of the Na-K pump. Indeed, the Na, K+ -adenosine triphosphatase activity of subcellular fractions from supersensitive vas deferens is reduced. In order to determine whether the biochemical alteration seen in subcellular fractions correlate with Na-K pump sites in intact tissues, we have studied the binding of [3H] ouabain to intact vas deferens. [3H]ouabain binds to membrane sites which have the characteristics expected of Na+, K+ - adenosine triphosphatase. Specific binding was saturable and reversible. Scatchard analysis of ouabain-binding in control tissues yielded a single class of binding sites with a dissociation constant (KD) of 156 +/- 7 nM and a maximum number of binding sites (Bmax) of 558.7 +/- 15.6 fmol/mg wet wt. [3H]Ouabain binding was displaceable by several cardiac glycosides and aglycones, but not by steroid hormones or sodium vanadate. Alteration of concentrations of Na+ and K+ markedly affected ouabain binding. Denervation (with 6-hydroxydopamine), decentralization or reserpine treatment for 1 day, which do not produce supersensitivity, did not alter the Bmax, whereas 5 to 7 days after these procedures, when supersensitivity was present, the Bmax was significantly reduced by 20 to 40%. The KD was not changed by any of the treatments. These data provide additional support for the concept that a reduction in the NaK pump sites contributes to postjunctional supersensitivity.

  2. Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

    PubMed

    Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

  3. Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

    PubMed Central

    Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

  4. A Comparative Study of the Application of Fluorescence Excitation-Emission Matrices Combined with Parallel Factor Analysis and Nonnegative Matrix Factorization in the Analysis of Zn Complexation by Humic Acids

    PubMed Central

    Boguta, Patrycja; Pieczywek, Piotr M.; Sokołowska, Zofia

    2016-01-01

    The main aim of this study was the application of excitation-emission fluorescence matrices (EEMs) combined with two decomposition methods: parallel factor analysis (PARAFAC) and nonnegative matrix factorization (NMF) to study the interaction mechanisms between humic acids (HAs) and Zn(II) over a wide concentration range (0–50 mg·dm−3). The influence of HA properties on Zn(II) complexation was also investigated. Stability constants, quenching degree and complexation capacity were estimated for binding sites found in raw EEM, EEM-PARAFAC and EEM-NMF data using mathematical models. A combination of EEM fluorescence analysis with one of the proposed decomposition methods enabled separation of overlapping binding sites and yielded more accurate calculations of the binding parameters. PARAFAC and NMF processing allowed finding binding sites invisible in a few raw EEM datasets as well as finding totally new maxima attributed to structures of the lowest humification. Decomposed data showed an increase in Zn complexation with an increase in humification, aromaticity and molecular weight of HAs. EEM-PARAFAC analysis also revealed that the most stable compounds were formed by structures containing the highest amounts of nitrogen. The content of oxygen-functional groups did not influence the binding parameters, mainly due to fact of higher competition of metal cation with protons. EEM spectra coupled with NMF and especially PARAFAC processing gave more adequate assessments of interactions as compared to raw EEM data and should be especially recommended for modeling of complexation processes where the fluorescence intensities (FI) changes are weak or where the processes are interfered with by the presence of other fluorophores. PMID:27782078

  5. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.

    2015-01-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

  6. The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase

    NASA Astrophysics Data System (ADS)

    Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy

    2016-04-01

    Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.

  7. Mannose-recognition mutant of the galactose/N-acetylgalactosamine-specific C-type lectin CEL-I engineered by site-directed mutagenesis.

    PubMed

    Moriuchi, Hiromi; Unno, Hideaki; Goda, Shuichiro; Tateno, Hiroaki; Hirabayashi, Jun; Hatakeyama, Tomomitsu

    2015-07-01

    CEL-I is a galactose/N-acetylgalactosamine-specific C-type lectin isolated from the sea cucumber Cucumaria echinata. Its carbohydrate-binding site contains a QPD (Gln-Pro-Asp) motif, which is generally recognized as the galactose specificity-determining motif in the C-type lectins. In our previous study, replacement of the QPD motif by an EPN (Glu-Pro-Asn) motif led to a weak binding affinity for mannose. Therefore, we examined the effects of an additional mutation in the carbohydrate-binding site on the specificity of the lectin. Trp105 of EPN-CEL-I was replaced by a histidine residue using site-directed mutagenesis, and the binding affinity of the resulting mutant, EPNH-CEL-I, was examined by sugar-polyamidoamine dendrimer assay, isothermal titration calorimetry, and glycoconjugate microarray analysis. Tertiary structure of the EPNH-CEL-I/mannose complex was determined by X-ray crystallographic analysis. Sugar-polyamidoamine dendrimer assay and glycoconjugate microarray analysis revealed a drastic change in the specificity of EPNH-CEL-I from galactose/N-acetylgalactosamine to mannose. The association constant of EPNH-CEL-I for mannose was determined to be 3.17×10(3) M(-1) at 25°C. Mannose specificity of EPNH-CEL-I was achieved by stabilization of the binding of mannose in a correct orientation, in which the EPN motif can form proper hydrogen bonds with 3- and 4-hydroxy groups of the bound mannose. Specificity of CEL-I can be engineered by mutating a limited number of amino acid residues in addition to the QPD/EPN motifs. Versatility of the C-type carbohydrate-recognition domain structure in the recognition of various carbohydrate chains could become a promising platform to develop novel molecular recognition proteins. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. The structure of free L11 and functional dynamics of L11 in free, L11-rRNA(58 nt) binary and L11-rRNA(58 nt)-thiostrepton ternary complexes.

    PubMed

    Lee, Donghan; Walsh, Joseph D; Yu, Ping; Markus, Michelle A; Choli-Papadopoulou, Theodora; Schwieters, Charles D; Krueger, Susan; Draper, David E; Wang, Yun-Xing

    2007-04-06

    The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a "reversible switch" in facilitating the coordinated movements associated with EF-G-driven GTP hydrolysis. The reversible switch mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11 complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: first, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a beta-sheet and a 3(10)-helix-turn-helix element in the N terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N terminus, as implied by a decrease of radius of gyration from 18.5 A to 16.2 A. Second, the regions, which undergo large conformation changes, exhibit motions on milliseconds-microseconds or nanoseconds-picoseconds time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 3(10)-helix in L11.

  9. The Structure of Free L11 and Functional Dynamics of L11 in Free, L11-rRNA(58nt) Binary and L11-rRNA(58nt)-thiostrepton Ternary Complexes

    PubMed Central

    Lee, Donghan; Walsh, Joseph D.; Yu, Ping; Markus, Michelle A.; Choli-Papadopoulou, Theodora; Schwieters, Charles D.; Krueger, Susan; Draper, David E.; Wang, Yun-Xing

    2007-01-01

    Summary The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a “reversible switch” in facilitating the coordinated movements associated with EF-G–driven GTP hydrolysis. The “reversible switch” mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: First, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a β-sheets and a 310-helix-turn-helix element in the N-terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N-terminus, as implied by a decrease of radius of gyration from 18.5 Å to 16.2 Å. Second, the regions, which undergo large conformation changes, exhibit motions on ms-μs or ns-ps time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 310-helix in L11. PMID:17292917

  10. Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

    DOE PAGES

    Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong; ...

    2016-09-01

    DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less

  11. Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong

    DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less

  12. Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

    PubMed Central

    Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2007-01-01

    We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

  13. Characterization of strychnine-sensitive glycine receptor in the intact frog retina: modulation by protein kinases.

    PubMed

    Salceda, Rocío; Aguirre-Ramirez, Marisela

    2005-03-01

    We studied 3H-glycine and 3H-strychnine specific binding to glycine receptor (GlyR) in intact isolated frog retinas. To avoid glycine binding to glycine uptake sites, experiments were performed at low ligand concentrations in a sodium-free medium. The binding of both radiolabeled ligands was saturated. Scatchard analysis of bound glycine and strychnine revealed a KD of 2.5 and 2.0 microM, respectively. Specific binding of glycine was displaced by beta-alanine, sarcosine, and strychnine. Strychnine binding was displaced 50% by glycine, and sarcosine. Properties of the strychnine-binding site in the GlyR were modified by sarcosine. Binding of both radioligands was considerably reduced by compounds that inhibit or activate adenylate cyclase and increased cAMP levels. A phorbol ester activator of PKC remarkably decreased glycine and strychnine binding. These results suggest modulation of GlyR in response to endogenous activation of protein kinases A and C, as well as protein phosphorylation modulating GlyR function in retina.

  14. Evaluation of water displacement energetics in protein binding sites with grid cell theory.

    PubMed

    Gerogiokas, G; Southey, M W Y; Mazanetz, M P; Heifetz, A; Hefeitz, A; Bodkin, M; Law, R J; Michel, J

    2015-04-07

    Excess free energies, enthalpies and entropies of water in protein binding sites were computed via classical simulations and Grid Cell Theory (GCT) analyses for three pairs of congeneric ligands in complex with the proteins scytalone dehydratase, p38α MAP kinase and EGFR kinase respectively. Comparative analysis is of interest since the binding modes for each ligand pair differ in the displacement of one binding site water molecule, but significant variations in relative binding affinities are observed. Protocols that vary in their use of restraints on protein and ligand atoms were compared to determine the influence of protein-ligand flexibility on computed water structure and energetics, and to assess protocols for routine analyses of protein-ligand complexes. The GCT-derived binding affinities correctly reproduce experimental trends, but the magnitude of the predicted changes in binding affinities is exaggerated with respect to results from a previous Monte Carlo Free Energy Perturbation study. Breakdown of the GCT water free energies into enthalpic and entropic components indicates that enthalpy changes dominate the observed variations in energetics. In EGFR kinase GCT analyses revealed that replacement of a pyrimidine by a cyanopyridine perturbs water energetics up three hydration shells away from the ligand.

  15. CorA Is a Copper Repressible Surface-Associated Copper(I)-Binding Protein Produced in Methylomicrobium album BG8

    PubMed Central

    Johnson, Kenneth A.; Ve, Thomas; Larsen, Øivind; Pedersen, Rolf B.; Lillehaug, Johan R.; Jensen, Harald B.; Helland, Ronny; Karlsen, Odd A.

    2014-01-01

    CorA is a copper repressible protein previously identified in the methanotrophic bacterium Methylomicrobium album BG8. In this work, we demonstrate that CorA is located on the cell surface and binds one copper ion per protein molecule, which, based on X-ray Absorption Near Edge Structure analysis, is in the reduced state (Cu(I)). The structure of endogenously expressed CorA was solved using X-ray crystallography. The 1.6 Å three-dimensional structure confirmed the binding of copper and revealed that the copper atom was coordinated in a mononuclear binding site defined by two histidines, one water molecule, and the tryptophan metabolite, kynurenine. This arrangement of the copper-binding site is similar to that of its homologous protein MopE* from Metylococcus capsulatus Bath, confirming the importance of kynurenine for copper binding in these proteins. Our findings show that CorA has an overall fold similar to MopE, including the unique copper(I)-binding site and most of the secondary structure elements. We suggest that CorA plays a role in the M. album BG8 copper acquisition. PMID:24498370

  16. Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-08-01

    The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

  17. Functional Analysis of AP-2 α and μ2 Subunits

    PubMed Central

    Motley, Alison M.; Berg, Nicola; Taylor, Marcus J.; Sahlender, Daniela A.; Hirst, Jennifer; Owen, David J.

    2006-01-01

    The AP-2 adaptor complex plays a key role in cargo recognition and clathrin-coated vesicle formation at the plasma membrane. To investigate the functions of individual binding sites and domains of the AP-2 complex in vivo, we have stably transfected HeLa cells with wild-type and mutant small interfering RNA–resistant α and μ2 subunits and then used siRNA knockdowns to deplete the endogenous proteins. Mutating the PtdIns(4,5)P2 binding site of α, the phosphorylation site of μ2, or the YXXΦ binding site of μ2 impairs AP-2 function, as assayed by transferrin uptake. In contrast, removing the C-terminal appendage domain of α, or mutating the PtdIns(4,5)P2 binding site of μ2, has no apparent effect. However, adding a C-terminal GFP tag to α renders it completely nonfunctional. These findings demonstrate that there is some functional redundancy in the binding sites of the various AP-2 subunits, because no single mutation totally abolishes function. They also help to explain why GFP-tagged AP-2 never appears to leave the plasma membrane in some live cell imaging studies. Finally, they establish a new model system that can be used both for additional structure-function analyses, and as a way of testing tagged constructs for function in vivo. PMID:17035630

  18. In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

    PubMed

    Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

    2014-12-01

    Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

  19. CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

    PubMed Central

    Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

    1995-01-01

    Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

  20. Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan

    Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase activemore » site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.« less

  1. Mojo Hand, a TALEN design tool for genome editing applications.

    PubMed

    Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C

    2013-01-16

    Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.

  2. Characterization of little skate (Leucoraja erinacea) recombinant transthyretin: Zinc-dependent 3,3',5-triiodo-l-thyronine binding.

    PubMed

    Suzuki, Shunsuke; Kasai, Kentaro; Yamauchi, Kiyoshi

    2015-01-01

    Transthyretin (TTR) diverged from an ancestral 5-hydroxyisourate hydrolase (HIUHase) by gene duplication at some early stage of chordate evolution. To clarify how TTR had participated in the thyroid system as an extracellular thyroid hormone (TH) binding protein, TH binding properties of recombinant little skate Leucoraja erinacea TTR was investigated. At the amino acid level, skate TTR showed 37-46% identities with the other vertebrate TTRs. Because the skate TTR had a unique histidine-rich segment in the N-terminal region, it could be purified by Ni-affinity chromatography. The skate TTR was a 46-kDa homotetramer of 14.5kDa subunits, and had one order of magnitude higher affinity for 3,3',5-triiodo-l-thyronine (T3) and some halogenated phenols than for l-thyroxine. However, the skate TTR had no HIUHase activity. Ethylenediaminetetraacetic acid (EDTA) treatment inhibited [(125)I]T3 binding activity whereas the addition of Zn(2+) to the EDTA-treated TTR recovered [(125)I]T3 binding activity in a Zn(2+) concentration-dependent manner. Scatchard analysis revealed the presence of two classes of binding site for T3, with dissociation constants of 0.24 and 17nM. However, the high-affinity sites were completely abolished with 1mM EDTA, whereas the remaining low-affinity sites decreased binding capacity. The number of zinc per TTR was quantified to be 4.5-6.3. Our results suggest that skate TTR has tight Zn(2+)-binding sites, which are essential for T3 binding to at least the high-affinity sites. Zn(2+) binding to the N-terminal histidine-rich segment may play an important role in acquisition or reinforcement of TH binding ability during early evolution of TTR. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Classification of typical and atypical antipsychotic drugs on the basis of dopamine D-1, D-2 and serotonin2 pKi values.

    PubMed

    Meltzer, H Y; Matsubara, S; Lee, J C

    1989-10-01

    The pKi values of 13 reference typical and 7 reference atypical antipsychotic drugs (APDs) for rat striatal dopamine D-1 and D-2 receptor binding sites and cortical serotonin (5-HT2) receptor binding sites were determined. The atypical antipsychotics had significantly lower pKi values for the D-2 but not 5-HT2 binding sites. There was a trend for a lower pKi value for the D-1 binding site for the atypical APD. The 5-HT2 and D-1 pKi values were correlated for the typical APD whereas the 5-HT2 and D-2 pKi values were correlated for the atypical APD. A stepwise discriminant function analysis to determine the independent contribution of each pKi value for a given binding site to the classification as a typical or atypical APD entered the D-2 pKi value first, followed by the 5-HT2 pKi value. The D-1 pKi value was not entered. A discriminant function analysis correctly classified 19 of 20 of these compounds plus 14 of 17 additional test compounds as typical or atypical APD for an overall correct classification rate of 89.2%. The major contributors to the discriminant function were the D-2 and 5-HT2 pKi values. A cluster analysis based only on the 5-HT2/D2 ratio grouped 15 of 17 atypical + one typical APD in one cluster and 19 of 20 typical + two atypical APDs in a second cluster, for an overall correct classification rate of 91.9%. When the stepwise discriminant function was repeated for all 37 compounds, only the D-2 and 5-HT2 pKi values were entered into the discriminant function.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Comparison and correlation of binding mode of ATP in the kinase domains of Hexokinase family

    PubMed Central

    Kumar, Yellapu Nanda; Kumar, Pasupuleti Santhosh; Sowjenya, Gopal; Rao, Valasani Koteswara; Yeswanth, Sthanikam; Prasad, Uppu Venkateswara; Pradeepkiran, Jangampalli Adi; Sarma, PVGK; Bhaskar, Matcha

    2012-01-01

    Hexokinases (HKs) are the enzymes that catalyses the ATP dependent phosphorylation of Hexose sugars to Hexose-6-Phosphate (Hex-6-P). There exist four different forms of HKs namely HK-I, HK-II, HK-III and HK-IV and all of them share a common ATP binding site core surrounded by more variable sequence that determine substrate affinities. Although they share a common binding site but they differ in their kinetic functions, hence the present study is aimed to analyze the binding mode of ATP. The analysis revealed that the four ATP binding domains are showing 13 identical, 7 similar and 6 dissimilar residues with similar structural conformation. Molecular docking of ATP into the kinase domains using Molecular Operating Environment (MOE) soft ware tool clearly showed the variation in the binding mode of ATP with variable docking scores. This probably explains the variable phosphorylation rates among hexokinases family. PMID:22829728

  5. Igs expressed by chronic lymphocytic leukemia B cells show limited binding-site structure variability.

    PubMed

    Marcatili, Paolo; Ghiotto, Fabio; Tenca, Claudya; Chailyan, Anna; Mazzarello, Andrea N; Yan, Xiao-Jie; Colombo, Monica; Albesiano, Emilia; Bagnara, Davide; Cutrona, Giovanna; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Chiorazzi, Nicholas; Tramontano, Anna; Fais, Franco

    2013-06-01

    Ag selection has been suggested to play a role in chronic lymphocytic leukemia (CLL) pathogenesis, but no large-scale analysis has been performed so far on the structure of the Ag-binding sites (ABSs) of leukemic cell Igs. We sequenced both H and L chain V(D)J rearrangements from 366 CLL patients and modeled their three-dimensional structures. The resulting ABS structures were clustered into a small number of discrete sets, each containing ABSs with similar shapes and physicochemical properties. This structural classification correlates well with other known prognostic factors such as Ig mutation status and recurrent (stereotyped) receptors, but it shows a better prognostic value, at least in the case of one structural cluster for which clinical data were available. These findings suggest, for the first time, to our knowledge, on the basis of a structural analysis of the Ab-binding sites, that selection by a finite quota of antigenic structures operates on most CLL cases, whether mutated or unmutated.

  6. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  7. Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites

    PubMed Central

    Dupont, Daniel M.; Thuesen, Cathrine K.; Bøtkjær, Kenneth A.; Behrens, Manja A.; Dam, Karen; Sørensen, Hans P.; Pedersen, Jan S.; Ploug, Michael; Jensen, Jan K.; Andreasen, Peter A.

    2015-01-01

    Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126) with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site. PMID:25793507

  8. Electrostatic steering and ionic tethering in enzyme–ligand binding: Insights from simulations

    PubMed Central

    Wade, Rebecca C.; Gabdoulline, Razif R.; Lüdemann, Susanna K.; Lounnas, Valère

    1998-01-01

    To bind at an enzyme’s active site, a ligand must diffuse or be transported to the enzyme’s surface, and, if the binding site is buried, the ligand must diffuse through the protein to reach it. Although the driving force for ligand binding is often ascribed to the hydrophobic effect, electrostatic interactions also influence the binding process of both charged and nonpolar ligands. First, electrostatic steering of charged substrates into enzyme active sites is discussed. This is of particular relevance for diffusion-influenced enzymes. By comparing the results of Brownian dynamics simulations and electrostatic potential similarity analysis for triose-phosphate isomerases, superoxide dismutases, and β-lactamases from different species, we identify the conserved features responsible for the electrostatic substrate-steering fields. The conserved potentials are localized at the active sites and are the primary determinants of the bimolecular association rates. Then we focus on a more subtle effect, which we will refer to as “ionic tethering.” We explore, by means of molecular and Brownian dynamics simulations and electrostatic continuum calculations, how salt links can act as tethers between structural elements of an enzyme that undergo conformational change upon substrate binding, and thereby regulate or modulate substrate binding. This is illustrated for the lipase and cytochrome P450 enzymes. Ionic tethering can provide a control mechanism for substrate binding that is sensitive to the electrostatic properties of the enzyme’s surroundings even when the substrate is nonpolar. PMID:9600896

  9. Locating the binding sites of folic acid with milk α- and β-caseins.

    PubMed

    Bourassa, P; Tajmir-Riahi, H A

    2012-01-12

    We located the binding sites of folic acid with milk α- and β-caseins at physiological conditions, using constant protein concentration and various folic acid contents. FTIR, UV-visible, and fluorescence spectroscopic methods as well as molecular modeling were used to analyze folic acid binding sites, the binding constant, and the effect of folic acid interaction on the stability and conformation of caseins. Structural analysis showed that folic acid binds caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(folic acid-α-caseins) = 4.8 (±0.6) × 10(4) M(-1) and K(folic acid-β-caseins) = 7.0 (±0.9) × 10(4) M(-1). The number of bound acid molecules per protein was 1.5 (±0.4) for α-casein and 1.4 (±0.3) for β-casein complexes. Molecular modeling showed different binding sites for folic acid on α- and β-caseins. The participation of several amino acids in folic acid-protein complexes was observed, which was stabilized by hydrogen bonding network and the free binding energy of -7.7 kcal/mol (acid-α-casein) and -8.1 kcal/mol (acid-β-casein). Folic acid complexation altered protein secondary structure by the reduction of α-helix from 35% (free α-casein) to 33% (acid-complex) and 32% (free β-casein) to 26% (acid-complex) indicating a partial protein destabilization. Caseins might act as carriers for transportation of folic acid to target molecules.

  10. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  11. An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

    PubMed

    Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

    2014-01-01

    Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances ChIP-seq data analysis and allows the identification of multiple SUMOylated TF binding sites simultaneously, which can then be utilized for other functional PTM binding site prediction in future.

  12. Studies on the cellular localization of spinal cord substance P receptors.

    PubMed

    Helke, C J; Charlton, C G; Wiley, R G

    1986-10-01

    Substance P-immunoreactivity and specific substance P binding sites are present in the spinal cord. Receptor autoradiography showed the discrete localization of substance P binding sites in both sensory and motor regions of the spinal cord and functional studies suggested an important role for substance P receptor activation in autonomic outflow, nociception, respiration and somatic motor function. In the current studies, we investigated the cellular localization of substance P binding sites in rat spinal cord using light microscopic autoradiography combined with several lesioning techniques. Unilateral injections of the suicide transport agent, ricin, into the superior cervical ganglion reduced substance P binding and cholinesterase-stained preganglionic sympathetic neurons in the intermediolateral cell column. However, unilateral electrolytic lesions of ventral medullary substance P neurons which project to the intermediolateral cell column did not alter the density of substance P binding in the intermediolateral cell column. Likewise, 6-hydroxydopamine and 5,7-dihydroxytryptamine, which destroy noradrenergic and serotonergic nerve terminals, did not reduce the substance P binding in the intermediolateral cell column. It appears, therefore, that the substance P binding sites are located postsynaptically on preganglionic sympathetic neurons rather than presynaptically on substance P-immunoreactive processes (i.e. as autoreceptors) or on monoamine nerve terminals. Unilateral injections of ricin into the phrenic nerve resulted in the unilateral destruction of phrenic motor neurons in the cervical spinal cord and caused a marked reduction in the substance P binding in the nucleus. Likewise, sciatic nerve injections of ricin caused a loss of associated motor neurons in the lateral portion of the ventral horn of the lumbar spinal cord and a reduction in the substance P binding. Sciatic nerve injections of ricin also destroyed afferent nerves of the associated dorsal root ganglia and increased the density of substance P binding in the dorsal horn. Capsaicin, which destroys small diameter primary sensory neurons, similarly increased the substance P binding in the dorsal horn. These studies show that the cellular localization of substance P binding sites can be determined by analysis of changes in substance P binding to discrete regions of spinal cord after selective lesions of specific groups of neurons. The data show the presence of substance P binding sites on preganglionic sympathetic neurons in the intermediolateral cell column and on somatic motor neurons in the ventral horn, including the phrenic motor nucleus.(ABSTRACT TRUNCATED AT 400 WORDS)

  13. Identification of metal ion binding sites based on amino acid sequences

    PubMed Central

    Cao, Xiaoyong; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

    2017-01-01

    The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html. PMID:28854211

  14. Identification of metal ion binding sites based on amino acid sequences.

    PubMed

    Cao, Xiaoyong; Hu, Xiuzhen; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

    2017-01-01

    The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html.

  15. NFI-Ski interactions mediate transforming growth factor beta modulation of human papillomavirus type 16 early gene expression.

    PubMed

    Baldwin, Amy; Pirisi, Lucia; Creek, Kim E

    2004-04-01

    Human papillomaviruses (HPVs) are present in virtually all cervical cancers. An important step in the development of malignant disease, including cervical cancer, involves a loss of sensitivity to transforming growth factor beta (TGF-beta). HPV type 16 (HPV16) early gene expression, including that of the E6 and E7 oncoprotein genes, is under the control of the upstream regulatory region (URR), and E6 and E7 expression in HPV16-immortalized human epithelial cells is inhibited at the transcriptional level by TGF-beta. While the URR contains a myriad of transcription factor binding sites, including seven binding sites for nuclear factor I (NFI), the specific sequences within the URR or the transcription factors responsible for TGF-beta modulation of the URR remain unknown. To identify potential transcription factors and binding sites involved in TGF-beta modulation of the URR, we performed DNase I footprint analysis on the HPV16 URR using nuclear extracts from TGF-beta-sensitive HPV16-immortalized human keratinocytes (HKc/HPV16) treated with and without TGF-beta. Differentially protected regions were found to be located around NFI binding sites. Electrophoretic mobility shift assays, using the NFI binding sites as probes, showed decreased binding upon TGF-beta treatment. This decrease in binding was not due to reduced NFI protein or NFI mRNA levels. Mutational analysis of individual and multiple NFI binding sites in the URR defined their role in TGF-beta sensitivity of the promoter. Overexpression of the NFI family members in HKc/HPV16 decreased the ability of TGF-beta to inhibit the URR. Since the oncoprotein Ski has been shown to interact with and increase the transcriptional activity of NFI and since cellular Ski levels are decreased by TGF-beta treatment, we explored the possibility that Ski may provide a link between TGF-beta signaling and NFI activity. Anti-NFI antibodies coimmunoprecipitated endogenous Ski in nuclear extracts from HKc/HPV16, confirming that NFI and Ski interact in these cells. Ski levels dramatically decreased upon TGF-beta treatment of HKc/HPV16, and overexpression of Ski eliminated the ability of TGF-beta to inhibit the URR. Based on these studies, we propose that TGF-beta inhibition of HPV16 early gene expression is mediated by a decrease in Ski levels, which in turn dramatically reduces NFI activity.

  16. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  17. Progesterone receptor membrane component-1 (PGRMC1) is the mediator of progesterone's antiapoptotic action in spontaneously immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid treatment and functional analysis of PGRMC1 mutations.

    PubMed

    Peluso, John J; Romak, Jonathan; Liu, Xiufang

    2008-02-01

    Progesterone (P4) receptor membrane component-1 (PGRMC1) and its binding partner, plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1) are thought to form a complex that functions as membrane receptor for P4. The present investigations confirm PGRMC1's role in this membrane receptor complex by demonstrating that depleting PGMRC1 with PGRMC1 small interfering RNA results in a 60% decline in [(3)H]P4 binding and the loss of P4's antiapoptotic action. Studies conducted on partially purified GFP-PGRMC1 fusion protein indicate that [(3)H]P4 specifically binds to PGRMC1 at a single site with an apparent K(d) of about 35 nm. In addition, experiments using various deletion mutations reveal that the entire PGRMC1 molecule is required for maximal [(3)H]P4 binding and P4 responsiveness. Analysis of the binding data also suggests that the P4 binding site is within a segment of PGRMC1 that is composed of the transmembrane domain and the initial segment of the C terminus. Interestingly, PAIRBP1 appears to bind to the C terminus between amino acids 70-130, which is distal to the putative P4 binding site. Taken together, these data provide compelling evidence that PGRMC1 is the P4 binding protein that mediates P4's antiapoptotic action. Moreover, the deletion mutation studies indicate that each domain of PGRMC1 plays an essential role in modulating PGRMC1's capacity to both bind and respond to P4. Additional studies are required to more precisely delineate the role of each PGRMC1 domain in transducing P4's antiapoptotic action.

  18. Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.

    PubMed

    Raabe, T; Olivier, J P; Dickson, B; Liu, X; Gish, G D; Pawson, T; Hafen, E

    1995-06-01

    The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is required for Drk binding, probably because it provides a recognition site for the Drk SH2 domain. Interestingly, a mutation at this site does not completely block Sev function in vivo. This may suggest that Sev can signal in a Drk-independent, parallel pathway or that Drk can also bind to an intermediate docking protein. Analysis of the Drk-Sos interaction has identified a high affinity binding site for Drk SH3 domains in the Sos tail. We show that the N-terminal Drk SH3 domain is primarily responsible for binding to the tail of Sos in vitro, and for signalling to Ras in vivo.

  19. Structure-Based Design and Synthesis of Potent and Selective Matrix Metalloproteinase 13 Inhibitors.

    PubMed

    Choi, Jun Yong; Fuerst, Rita; Knapinska, Anna M; Taylor, Alexander B; Smith, Lyndsay; Cao, Xiaohang; Hart, P John; Fields, Gregg B; Roush, William R

    2017-07-13

    We describe the use of comparative structural analysis and structure-guided molecular design to develop potent and selective inhibitors (10d and (S)-17b) of matrix metalloproteinase 13 (MMP-13). We applied a three-step process, starting with a comparative analysis of the X-ray crystallographic structure of compound 5 in complex with MMP-13 with published structures of known MMP-13·inhibitor complexes followed by molecular design and synthesis of potent but nonselective zinc-chelating MMP inhibitors (e.g., 10a and 10b). After demonstrating that the pharmacophores of the chelating inhibitors (S)-10a, (R)-10a, and 10b were binding within the MMP-13 active site, the Zn 2+ chelating unit was replaced with nonchelating polar residues that bridged over the Zn 2+ binding site and reached into a solvent accessible area. After two rounds of structural optimization, these design approaches led to small molecule MMP-13 inhibitors 10d and (S)-17b, which bind within the substrate-binding site of MMP-13 and surround the catalytically active Zn 2+ ion without chelating to the metal. These compounds exhibit at least 500-fold selectivity versus other MMPs.

  20. A gratuitous β-Lactamase inducer uncovers hidden active site dynamics of the Staphylococcus aureus BlaR1 sensor domain.

    PubMed

    Frederick, Thomas E; Peng, Jeffrey W

    2018-01-01

    Increasing evidence shows that active sites of proteins have non-trivial conformational dynamics. These dynamics include active site residues sampling different local conformations that allow for multiple, and possibly novel, inhibitor binding poses. Yet, active site dynamics garner only marginal attention in most inhibitor design efforts and exert little influence on synthesis strategies. This is partly because synthesis requires a level of atomic structural detail that is frequently missing in current characterizations of conformational dynamics. In particular, while the identity of the mobile protein residues may be clear, the specific conformations they sample remain obscure. Here, we show how an appropriate choice of ligand can significantly sharpen our abilities to describe the interconverting binding poses (conformations) of protein active sites. Specifically, we show how 2-(2'-carboxyphenyl)-benzoyl-6-aminopenicillanic acid (CBAP) exposes otherwise hidden dynamics of a protein active site that binds β-lactam antibiotics. When CBAP acylates (binds) the active site serine of the β-lactam sensor domain of BlaR1 (BlaRS), it shifts the time scale of the active site dynamics to the slow exchange regime. Slow exchange enables direct characterization of inter-converting protein and bound ligand conformations using NMR methods. These methods include chemical shift analysis, 2-d exchange spectroscopy, off-resonance ROESY of the bound ligand, and reduced spectral density mapping. The active site architecture of BlaRS is shared by many β-lactamases of therapeutic interest, suggesting CBAP could expose functional motions in other β-lactam binding proteins. More broadly, CBAP highlights the utility of identifying chemical probes common to structurally homologous proteins to better expose functional motions of active sites.

  1. Analysis of zinc binding sites in protein crystal structures.

    PubMed

    Alberts, I L; Nadassy, K; Wodak, S J

    1998-08-01

    The geometrical properties of zinc binding sites in a dataset of high quality protein crystal structures deposited in the Protein Data Bank have been examined to identify important differences between zinc sites that are directly involved in catalysis and those that play a structural role. Coordination angles in the zinc primary coordination sphere are compared with ideal values for each coordination geometry, and zinc coordination distances are compared with those in small zinc complexes from the Cambridge Structural Database as a guide of expected trends. We find that distances and angles in the primary coordination sphere are in general close to the expected (or ideal) values. Deviations occur primarily for oxygen coordinating atoms and are found to be mainly due to H-bonding of the oxygen coordinating ligand to protein residues, bidentate binding arrangements, and multi-zinc sites. We find that H-bonding of oxygen containing residues (or water) to zinc bound histidines is almost universal in our dataset and defines the elec-His-Zn motif. Analysis of the stereochemistry shows that carboxyl elec-His-Zn motifs are geometrically rigid, while water elec-His-Zn motifs show the most geometrical variation. As catalytic motifs have a higher proportion of carboxyl elec atoms than structural motifs, they provide a more rigid framework for zinc binding. This is understood biologically, as a small distortion in the zinc position in an enzyme can have serious consequences on the enzymatic reaction. We also analyze the sequence pattern of the zinc ligands and residues that provide elecs, and identify conserved hydrophobic residues in the endopeptidases that also appear to contribute to stabilizing the catalytic zinc site. A zinc binding template in protein crystal structures is derived from these observations.

  2. Berberine Induces Toxicity in HeLa Cells through Perturbation of Microtubule Polymerization by Binding to Tubulin at a Unique Site.

    PubMed

    Raghav, Darpan; Ashraf, Shabeeba M; Mohan, Lakshmi; Rathinasamy, Krishnan

    2017-05-23

    Berberine has been used traditionally for its diverse pharmacological actions. It exhibits remarkable anticancer activities and is currently under clinical trials. In this study, we report that the anticancer activity of berberine could be partly due to its inhibitory actions on tubulin and microtubule assembly. Berberine inhibited the proliferation of HeLa cells with an IC 50 of 18 μM and induced significant depolymerization of interphase and mitotic microtubules. At its IC 50 , berberine exerted a moderate G2/M arrest and mitotic block as detected by fluorescence-activated cell sorting analysis and fluorescence microscopy, respectively. In a wound closure assay, berberine inhibited the migration of HeLa cells at concentrations lower than its IC 50 , indicating its excellent potential as an anticancer agent. In vitro studies with tubulin isolated from goat brain indicated that berberine binds to tubulin at a single site with a K d of 11 μM. Berberine inhibited the assembly of tubulin into microtubules and also disrupted the preformed microtubules polymerized in the presence of glutamate and paclitaxel. Competition experiments indicated that berberine could partially displace colchicine from its binding site. Results from fluorescence resonance energy transfer, computational docking, and molecular dynamics simulations suggest that berberine forms a stable complex with tubulin and binds at a novel site 24 Å from the colchicine site on the β-tubulin. Data obtained from synchronous fluorescence analysis of the tryptophan residues of tubulin and from the Fourier transform infrared spectroscopy studies revealed that binding of berberine alters the conformation of the tubulin heterodimer, which could be the molecular mechanism behind the depolymerizing effects on tubulin assembly.

  3. [3H]aniracetam binds to specific recognition sites in brain membranes.

    PubMed

    Fallarino, F; Genazzani, A A; Silla, S; L'Episcopo, M R; Camici, O; Corazzi, L; Nicoletti, F; Fioretti, M C

    1995-08-01

    [3H]Aniracetam bound to specific and saturable recognition sites in membranes prepared from discrete regions of rat brain. In crude membrane preparation from rat cerebral cortex, specific binding was Na+ independent, was still largely detectable at low temperature (4 degrees C), and underwent rapid dissociation. Scatchard analysis of [3H]aniracetam binding revealed a single population of sites with an apparent KD value of approximately 70 nM and a maximal density of 3.5 pmol/mg of protein. Specifically bound [3H]aniracetam was not displaced by various metabolites of aniracetam, nor by other pyrrolidinone-containing nootropic drugs such as piracetam or oxiracetam. Subcellular distribution studies showed that a high percentage of specific [3H]aniracetam binding was present in purified synaptosomes or mitochondria, whereas specific binding was low in the myelin fraction. The possibility that at least some [3H]aniracetam binding sites are associated with glutamate receptors is supported by the evidence that specific binding was abolished when membranes were preincubated at 37 degrees C under fast shaking (a procedure that substantially reduced the amount of glutamate trapped in the membranes) and could be restored after addition of either glutamate or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) but not kainate. The action of AMPA was antagonized by DNQX, which also reduced specific [3H]aniracetam binding in unwashed membranes. High levels of [3H]aniracetam binding were detected in hippocampal, cortical, or cerebellar membranes, which contain a high density of excitatory amino acid receptors.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. In-Silico Analysis of Binding Site Features and Substrate Selectivity in Plant Flavonoid-3-O Glycosyltransferases (F3GT) through Molecular Modeling, Docking and Dynamics Simulation Studies

    PubMed Central

    Sharma, Ranu; Panigrahi, Priyabrata; Suresh, C.G.

    2014-01-01

    Flavonoids are a class of plant secondary metabolites that act as storage molecules, chemical messengers, as well as participate in homeostasis and defense processes. They possess pharmaceutical properties important for cancer treatment such as antioxidant and anti-tumor activities. The drug-related properties of flavonoids can be improved by glycosylation. The enzymes glycosyltransferases (GTs) glycosylate acceptor molecules in a regiospecific manner with the help of nucleotide sugar donor molecules. Several plant GTs have been characterized and their amino acid sequences determined. However, three-dimensional structures of only a few are reported. Here, phylogenetic analysis using amino acid sequences have identified a group of GTs with the same regiospecific activity. The structures of these closely related GTs were modeled using homologous GT structures. Their substrate binding sites were elaborated by docking flavonoid acceptor and UDP-sugar donor molecules in the modeled structures. Eight regions near the acceptor binding site in the N- and C- terminal domain of GTs have been identified that bind and specifically glycosylate the 3-OH group of acceptor flavonoids. Similarly, a conserved motif in the C-terminal domain is known to bind a sugar donor substrate. In certain GTs, the substitution of a specific glutamine by histidine in this domain changes the preference of sugar from glucose to galactose as a result of changed pattern of interactions. The molecular modeling, docking, and molecular dynamics simulation studies have revealed the chemical and topological features of the binding site and thus provided insights into the basis of acceptor and donor recognition by GTs. PMID:24667893

  5. ITC-derived binding affinity may be biased due to titrant (nano)-aggregation. Binding of halogenated benzotriazoles to the catalytic domain of human protein kinase CK2

    PubMed Central

    Winiewska, Maria; Bugajska, Ewa

    2017-01-01

    The binding of four bromobenzotriazoles to the catalytic subunit of human protein kinase CK2 was assessed by two complementary methods: Microscale Thermophoresis (MST) and Isothermal Titration Calorimetry (ITC). New algorithm proposed for the global analysis of MST pseudo-titration data enabled reliable determination of binding affinities for two distinct sites, a relatively strong one with the Kd of the order of 100 nM and a substantially weaker one (Kd > 1 μM). The affinities for the strong binding site determined for the same protein-ligand systems using ITC were in most cases approximately 10-fold underestimated. The discrepancy was assigned directly to the kinetics of ligand nano-aggregates decay occurring upon injection of the concentrated ligand solution to the protein sample. The binding affinities determined in the reverse ITC experiment, in which ligands were titrated with a concentrated protein solution, agreed with the MST-derived data. Our analysis suggests that some ITC-derived Kd values, routinely reported together with PDB structures of protein-ligand complexes, may be biased due to the uncontrolled ligand (nano)-aggregation, which may occur even substantially below the solubility limit. PMID:28273138

  6. Fluorescence analysis of competition of phenylbutazone and methotrexate in binding to serum albumin in combination treatment in rheumatology

    NASA Astrophysics Data System (ADS)

    Maciążek-Jurczyk, M.; Sułkowska, A.; Bojko, B.; Równicka, J.; Sułkowski, W. W.

    2009-04-01

    Combination of several drugs is often necessary especially during long-them therapy. The competition between drugs can cause a decrease of the amount of a drug bound to albumin. This results in an increase of the free, biological active fraction of the drug. The aim of the presented study was to describe the competition between phenylbutazone (Phe) and methotrexate (MTX), two drugs recommended for the treatment of rheumatology in binding to bovine (BSA) and human (HSA) serum albumin in the high affinity binding site. Fluorescence analysis was used to estimate the effect of drugs on the protein fluorescence and to define the binding and quenching properties of drugs-serum albumin complexes. The effect of the displacement of one drug from the complex of the other with serum albumin has been described on the basis of the comparison of the quenching curves and binding constants for the binary and ternary systems. The conclusion that both Phe and MTX form a binding site in the same subdomain (IIA) points to the necessity of using a monitoring therapy owning to the possible increase of the uncontrolled toxic effects.

  7. The binding sites for benztropines and dopamine in the dopamine transporter overlap

    PubMed Central

    Bisgaard, Heidi; Larsen, M. Andreas B.; Mazier, Sonia; Beuming, Thijs; Newman, Amy Hauck; Weinstein, Harel; Shi, Lei; Loland, Claus J.; Gether, Ulrik

    2013-01-01

    Analogues of benztropines (BZTs) are potent inhibitors of the dopamine transporter (DAT) but are less effective than cocaine as behavioral stimulants. As a result, there have been efforts to evaluate these compounds as leads for potential medication for cocaine addiction. Here we use computational modeling together with site-directed mutagenesis to characterize the binding site for BZTs in DAT. Docking into molecular models based on the structure of the bacterial homologue LeuT supported a BZT binding site that overlaps with the substrate binding pocket. In agreement, mutations of residues within the pocket, including Val1523.46* to Ala or Ile, Ser4228.60 to Ala and Asn1573.51 to Cys or Ala, resulted in decreased affinity for BZT and the analog JHW007, as assessed in [3H]dopamine uptake inhibition assays and/or [3H]CFT competition binding assay. A putative polar interaction of one of the phenyl ring fluorine substituents in JHW007 with Asn1573.51 was used as a criterion for determining likely binding poses and establish a structural context for the mutagenesis findings. The analysis positioned the other fluorine substituted phenyl ring of JHW007 in close proximity to Ala47910.51/Ala48010.52 in transmembrane segment (TM) 10. The lack of such an interaction for BZT led to a more tilted orientation, as compared to JHW007, bringing one of the phenyl rings even closer to Ala47910.51/Ala48010.52. Mutation of Ala47910.51 and Ala48010.52 to valines supported these predictions with a larger decrease in the affinity for BZT than for JHW007. Summarized, our data suggest that BZTs display a classical competitive binding mode with binding sites overlapping those of cocaine and dopamine. PMID:20816875

  8. The heat shock protein 90 antagonist novobiocin interacts with a previously unrecognized ATP-binding domain in the carboxyl terminus of the chaperone.

    PubMed

    Marcu, M G; Chadli, A; Bouhouche, I; Catelli, M; Neckers, L M

    2000-11-24

    Heat shock protein 90 (Hsp90), one of the most abundant chaperones in eukaryotes, participates in folding and stabilization of signal-transducing molecules including steroid hormone receptors and protein kinases. The amino terminus of Hsp90 contains a non-conventional nucleotide-binding site, related to the ATP-binding motif of bacterial DNA gyrase. The anti-tumor agents geldanamycin and radicicol bind specifically at this site and induce destabilization of Hsp90-dependent client proteins. We recently demonstrated that the gyrase inhibitor novobiocin also interacts with Hsp90, altering the affinity of the chaperone for geldanamycin and radicicol and causing in vitro and in vivo depletion of key regulatory Hsp90-dependent kinases including v-Src, Raf-1, and p185(ErbB2). In the present study we used deletion/mutation analysis to identify the site of interaction of novobiocin with Hsp90, and we demonstrate that the novobiocin-binding site resides in the carboxyl terminus of the chaperone. Surprisingly, this motif also recognizes ATP, and ATP and novobiocin efficiently compete with each other for binding to this region of Hsp90. Novobiocin interferes with association of the co-chaperones Hsc70 and p23 with Hsp90. These results identify a second site on Hsp90 where the binding of small molecule inhibitors can significantly impact the function of this chaperone, and they support the hypothesis that both amino- and carboxyl-terminal domains of Hsp90 interact to modulate chaperone activity.

  9. Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

    PubMed

    Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

    2008-01-01

    This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

  10. Epigallocatechin-3-gallate preferentially induces aggregation of amyloidogenic immunoglobulin light chains

    PubMed Central

    Hora, Manuel; Carballo-Pacheco, Martin; Weber, Benedikt; Morris, Vanessa K.; Wittkopf, Antje; Buchner, Johannes; Strodel, Birgit; Reif, Bernd

    2017-01-01

    Antibody light chain amyloidosis is a rare disease caused by fibril formation of secreted immunoglobulin light chains (LCs). The huge variety of antibody sequences puts a serious challenge to drug discovery. The green tea polyphenol epigallocatechin-3-gallate (EGCG) is known to interfere with fibril formation in general. Here we present solution- and solid-state NMR studies as well as MD simulations to characterise the interaction of EGCG with LC variable domains. We identified two distinct EGCG binding sites, both of which include a proline as an important recognition element. The binding sites were confirmed by site-directed mutagenesis and solid-state NMR analysis. The EGCG-induced protein complexes are unstructured. We propose a general mechanistic model for EGCG binding to a conserved site in LCs. We find that EGCG reacts selectively with amyloidogenic mutants. This makes this compound a promising lead structure, that can handle the immense sequence variability of antibody LCs. PMID:28128355

  11. Crystal structure of glucose isomerase in complex with xylitol inhibitor in one metal binding mode.

    PubMed

    Bae, Ji-Eun; Kim, In Jung; Nam, Ki Hyun

    2017-11-04

    Glucose isomerase (GI) is an intramolecular oxidoreductase that interconverts aldoses and ketoses. These characteristics are widely used in the food, detergent, and pharmaceutical industries. In order to obtain an efficient GI, identification of novel GI genes and substrate binding/inhibition have been studied. Xylitol is a well-known inhibitor of GI. In Streptomyces rubiginosus, two crystal structures have been reported for GI in complex with xylitol inhibitor. However, a structural comparison showed that xylitol can have variable conformation at the substrate binding site, e.g., a nonspecific binding mode. In this study, we report the crystal structure of S. rubiginosus GI in a complex with xylitol and glycerol. Our crystal structure showed one metal binding mode in GI, which we presumed to represent the inactive form of the GI. The metal ion was found only at the M1 site, which was involved in substrate binding, and was not present at the M2 site, which was involved in catalytic function. The O 2 and O 4 atoms of xylitol molecules contributed to the stable octahedral coordination of the metal in M1. Although there was no metal at the M2 site, no large conformational change was observed for the conserved residues coordinating M2. Our structural analysis showed that the metal at the M2 site was not important when a xylitol inhibitor was bound to the M1 site in GI. Thus, these findings provided important information for elucidation or engineering of GI functions. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Two-phase positive inotropic effects of ouabain and the presence of multiple classes of ouabain binding sites in the ferret heart

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ng, Y.C.; Akera, T.

    1986-03-05

    Characteristics of more than one class of ouabain receptors which appear to exist in ferret heart were examined. In isolated papillary muscle, 1 to 30 nM ouabain produced a positive inotropic effect in the presence of 5 ..mu..M propranolol and 2 ..mu..M phentolamine. Higher concentrations of ouabain (0.1 to 10 ..mu..M) produced an additional and prominent inotropic effect. In partially purified Na, K-ATPase, ouabain caused a monophasic inhibition; however, the concentration-inhibition curve spanned over 5 log units, indicating that ouabain is interacting with more than a single class of the enzyme. Scatchard analysis of specific /sup 3/H-ouabain binding revealed approximatelymore » equal abundance of high and low affinity binding sites. The K/sub D/ value for high affinity sites was approximately 20 nM whereas that for low affinity sites was about 45 times higher. When phosphoenzyme was formed in the presence of (..gamma..-/sup 32/P)-ATP, Mg/sup 2 +/ and Na/sup +/ and subjected to SDS gel electrophoresis, two distinct K/sup +/-sensitive bands with about 100,000 dalton molecular weight were detected. Molecular weight difference between these two bands was approximately 2500 dalton. Phosphorylation of either band was abolished by 1 ..mu..M ouabain suggesting that both bands may correspond to the high-affinity binding sites. These results indicate that high and low affinity ouabain binding sites exists in approximately equal abundance in the ferret heart, and that binding of ouabain to these sites cases Na,K-ATPase inhibition and the positive inotropic effect.« less

  13. The mongoose acetylcholine receptor alpha-subunit: analysis of glycosylation and alpha-bungarotoxin binding.

    PubMed

    Asher, O; Jensen, B S; Lupu-Meiri, M; Oron, Y; Fuchs, S

    1998-04-17

    The mongoose AChR alpha-subunit has been cloned and shown to be highly homologous to other AChR alpha-subunits, with only six differences in amino acid residues at positions that are conserved in animal species that bind alpha-bungarotoxin (alpha-BTX). Four of these six substitutions cluster in the ligand binding site, and one of them, Asn-187, forms a consensus N-glycosylation site. The mongoose glycosylated alpha-subunit has a higher apparent molecular mass than that of the rat glycosylated alpha-subunit, probably resulting from the additional glycosylation at Asn-187 of the mongoose subunit. The in vitro translated mongoose alpha-subunit, in a glycosylated or non-glycosylated form, does not bind alpha-BTX, indicating that lack of alpha-BTX binding can be achieved also in the absence of glycosylation.

  14. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  15. Ontogeny of growth hormone (GH) binding in the domestic turkey: evidence of sexual dimorphism and developmental changes in relationship to plasma GH.

    PubMed

    Vasilatos-Younken, R; Gray, K S; Bacon, W L; Nestor, K E; Long, D W; Rosenberger, J L

    1990-07-01

    The post-hatch ontogeny of hepatic GH binding and its relationship to GH plasma profile characteristics in male and female turkeys of slow- (RBC-2) and fast-growing (F; selected from RBC-2) genetic lines were determined. Specific binding of 125I-labelled recombinant chicken GH to crude hepatic membrane preparations (100,000 g pellet) was determined at 2, 4, 8, 14 and 24 weeks of age for both total (occupied plus free; 4 mol MgCl2/l pretreatment) and free (without MgCl2 pretreatment) binding sites. Characteristics of the plasma GH profile were measured at each age by serial blood sampling through indwelling jugular vein catheters. When specific binding to either free or total sites was expressed on a whole organ basis (i.e. hepatic GH-binding capacity/bird), binding increased dramatically (P less than 0.0001) with increasing age over both lines and sexes. Total binding capacity (free plus occupied sites) per bird was greater for females than for males at 24 weeks of age (P less than 0.04), as birds reached sexual maturity, but did not differ between fast- and slow-growing lines at any age. Available binding capacity (free sites) per bird was greater for the faster growing F than RBC-2 line at the older ages when body size was most divergent (14 and 24 weeks of age; P less than 0.01, P less than 0.06 respectively), but did not differ between sexes. Correlation analysis at individual ages revealed a progressive change in the nature of the relationship between hepatic GH binding, plasma GH and somatic growth.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Structural analysis of the receptor binding domain of botulinum neurotoxin serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanfeng; Buchko, Garry W.; Qin, Lin

    2010-10-28

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65 Å resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences aremore » located at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10 Å relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

  17. Structural Analysis of the Receptor Binding Domain of Botulinum Neurotoxin Serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Y Zhang; G Buchko; L Qin

    2011-12-31

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65{angstrom} resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences are locatedmore » at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10{angstrom} relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

  18. Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

    PubMed

    Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

    2013-02-01

    The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

  19. Docking and Hydropathic Scoring of Polysubstituted Pyrrole Compounds with Anti-Tubulin Activity

    PubMed Central

    Tripathi, Ashutosh; Fornabaio, Micaela; Kellogg, Glen E.; Gupton, John T.; Gewirtz, David A.; Yeudall, W. Andrew; Vega, Nina E.; Mooberry, Susan L.

    2008-01-01

    Compounds that bind at the colchicine site of tubulin have drawn considerable attention with studies indicating that these agents suppress microtubule dynamics and inhibit tubulin polymerization. Data for eighteen polysubstituted pyrrole compounds are reported, including antiproliferative activity against human MDA-MB-435 cells and calculated free energies of binding following docking the compounds into models of αβ-tubulin. These docking calculations coupled with HINT interaction analyses are able to represent the complex structures and the binding modes of inhibitors such that calculated and measured free energies of binding correlate with an r2 of 0.76. Structural analysis of the binding pocket identifies important intermolecular contacts that mediate binding. As seen experimentally, the complex with JG-03-14 (3,5-dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2- carboxylic acid ethyl ester) is the most stable. These results illuminate the binding process and should be valuable in the design of new pyrrole-based colchicine site inhibitors as these compounds have very accessible syntheses. PMID:18083520

  20. [Glutamate-binding membrane proteins from human platelets].

    PubMed

    Gurevich, V S; Popov, Iu G; Gorodinskiĭ, A I; Dambinova, S A

    1991-09-01

    Solubilization of the total membrane fraction of human platelets in a 2% solution of sodium deoxycholate and subsequent affinity chromatography on glutamate agarose resulted in two protein fractions possessing a glutamate-binding activity. As can be evidenced from radioligand binding data, the first fraction contains two types of binding sites (Kd1 = 1 microM, Bmax 1 = 100 pmol/mg of protein; Kd2 = 9.3 microMm Bmax2 = 395 pmol/mg of protein). The second fraction has only one type of binding sites (Kd = 1 microM, Bmax = = 110 pmol/mg of protein). SDS-PAAG electrophoresis revealed the presence in the first fraction of proteins with Mr of 14, 24, 56 and 155 kDa, whereas the second fraction was found to contain 14, 46, 71 and 155 kDa proteins. Solid phase immunoenzymatic analysis using poly- and monoclonal specific antibodies against mammalian brain glutamate-binding proteins revealed a marked immunochemical similarity of the isolated protein fractions with human brain synaptic membrane glutamate-binding proteins.

  1. Activation of Ftz-F1-Responsive Genes through Ftz/Ftz-F1 Dependent Enhancers

    PubMed Central

    Field, Amanda; Xiang, Jie; Anderson, W. Ray; Graham, Patricia; Pick, Leslie

    2016-01-01

    The orphan nuclear receptor Ftz-F1 is expressed in all somatic nuclei in Drosophila embryos, but mutations result in a pair-rule phenotype. This was explained by the interaction of Ftz-F1 with the homeodomain protein Ftz that is expressed in stripes in the primordia of segments missing in either ftz-f1 or ftz mutants. Ftz-F1 and Ftz were shown to physically interact and coordinately activate the expression of ftz itself and engrailed by synergistic binding to composite Ftz-F1/Ftz binding sites. However, attempts to identify additional target genes on the basis of Ftz-F1/ Ftz binding alone has met with only limited success. To discern rules for Ftz-F1 target site selection in vivo and to identify additional target genes, a microarray analysis was performed comparing wildtype and ftz-f1 mutant embryos. Ftz-F1-responsive genes most highly regulated included engrailed and nine additional genes expressed in patterns dependent on both ftz and ftz-f1. Candidate enhancers for these genes were identified by combining BDTNP Ftz ChIP-chip data with a computational search for Ftz-F1 binding sites. Of eight enhancer reporter genes tested in transgenic embryos, six generated expression patterns similar to the corresponding endogenous gene and expression was lost in ftz mutants. These studies identified a new set of Ftz-F1 targets, all of which are co-regulated by Ftz. Comparative analysis of enhancers containing Ftz/Ftz-F1 binding sites that were or were not bona fide targets in vivo suggested that GAF negatively regulates enhancers that contain Ftz/Ftz-F1 binding sites but are not actually utilized. These targets include other regulatory factors as well as genes involved directly in morphogenesis, providing insight into how pair-rule genes establish the body pattern. PMID:27723822

  2. Rpn1 provides adjacent receptor sites for substrate binding and deubiquitination by the proteasome

    PubMed Central

    Shi, Yuan; Chen, Xiang; Elsasser, Suzanne; Stocks, Bradley B.; Tian, Geng; Lee, Byung-Hoon; Shi, Yanhong; Zhang, Naixia; de Poot, Stefanie A. H.; Tuebing, Fabian; Sun, Shuangwu; Vannoy, Jacob; Tarasov, Sergey G.; Engen, John R.; Finley, Daniel; Walters, Kylie J.

    2016-01-01

    Structured Abstract INTRODUCTION The ubiquitin-proteasome system comprises hundreds of distinct pathways of degradation, which converge at the step of ubiquitin recognition by the proteasome. Five proteasomal ubiquitin receptors have been identified, two that are intrinsic to the proteasome (Rpn10 and Rpn13) and three reversibly associated proteasomal ubiquitin receptors (Rad23, Dsk2, and Ddi1). RATIONALE We found that the five known proteasomal ubiquitin receptors of yeast are collectively nonessential for ubiquitin recognition by the proteasome. We therefore screened for additional ubiquitin receptors in the proteasome and identified subunit Rpn1 as a candidate. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the structure of the binding site within Rpn1, which we term the T1 site. Mutational analysis of this site showed its functional importance within the context of intact proteasomes. T1 binds both ubiquitin and ubiquitin-like (UBL) proteins, in particular the substrate-delivering shuttle factor Rad23. A second site within the Rpn1 toroid, T2, recognizes the UBL domain of deubiquitinating enzyme Ubp6, as determined by hydrogen-deuterium exchange mass spectrometry analysis and validated by amino acid substitution and functional assays. The Rpn1 toroid thus serves a critical scaffolding role within the proteasome, helping to assemble multiple proteasome cofactors as well as substrates. RESULTS Our results indicate that proteasome subunit Rpn1 can recognize both ubiquitin and UBL domains of substrate shuttling factors that themselves bind ubiquitin and function as reversibly-associated proteasomal ubiquitin receptors. Recognition is mediated by the T1 site within the Rpn1 toroid, which supports proteasome function in vivo. We found that the capacity of T1 to recognize both ubiquitin and UBL proteins was shared with Rpn10 and Rpn13. The surprising multiplicity of ubiquitin-recognition domains within the proteasome may promote enhanced, multipoint binding of ubiquitin chains. The structures of the T1 site in its free state and complexed with monoubiquitin or K48-linked diubiquitin were solved, revealing that three neighboring outer helices from the T1 toroid engage two ubiquitins. This binding mode leads to a preference for certain ubiquitin chain types, especially K6- and K48-linked chains, in a distinct configuration that can position substrates close to the entry port of the proteasome. The fate of proteasome-docked ubiquitin conjugates is determined by a competition between deubiquitination and substrate degradation. We find that proximal to the T1 site within the Rpn1 toroid is a second UBL-binding site, T2, that does not assist in ubiquitin chain recognition, but rather in chain disassembly, by binding to the UBL domain of deubiquitinating enzyme Ubp6. Importantly, the UBL interactors at T1 and T2 are distinct, assigning substrate localization to T1 and substrate deubiquitination to T2. CONCLUSION A ligand-binding hotspot was identified in the Rpn1 toroid, consisting of two adjacent receptor sites, T1 and T2. The Rpn1 toroid represents a novel class of binding domains for ubiquitin and UBL proteins. This study thus defines a novel two-site recognition domain intrinsic to the proteasome that uses homologous ubiquitin/UBL-class ligands to assemble substrates, substrate shuttling factors, and a deubiquitinating enzyme in close proximity. A ligand-binding hotspot in the proteasome for assembling substrates and cofactors Schematic (top) and model structure (bottom, left) mapping the UBL-binding Rpn1 T1 (indigo) and T2 (orange) sites. (Bottom, right) Enlarged region of the proteasome to illustrate the Rpn1 T1 and T2 sites bound to a ubiquitin chain (yellow) and deubiquitinating enzyme Ubp6 (green), respectively. PDB 4CR2 and 2B9R were used for this figure. Hundreds of pathways for degradation converge at ubiquitin recognition by proteasome. Here we found that the five known proteasomal ubiquitin receptors are collectively nonessential for ubiquitin recognition, and identified a sixth receptor, Rpn1. A site (T1) in the Rpn1 toroid recognized ubiquitin and ubiquitin-like (UBL) domains of substrate shuttling factors. T1 structures with monoubiquitin or K48 diubiquitin show three neighboring outer helices engaging two ubiquitins. T1 contributes a distinct substrate-binding pathway with preference for K48-linked chains. Proximal to T1 within the Rpn1 toroid is a second UBL-binding site (T2) that assists in ubiquitin chain disassembly, by binding the UBL of deubiquitinating enzyme Ubp6. Thus a two-site recognition domain intrinsic to the proteasome uses homologous ubiquitin/UBL-class ligands to assemble substrates, shuttling factors, and a deubiquitinating enzyme. PMID:26912900

  3. Receptor type I and type II binding regions and the peptidyl-prolyl isomerase site of cyclophilin B are required for enhancement of T-lymphocyte adhesion to fibronectin.

    PubMed

    Carpentier, Mathieu; Allain, Fabrice; Slomianny, Marie-Christine; Durieux, Sandrine; Vanpouille, Christophe; Haendler, Bernard; Spik, Geneviève

    2002-04-23

    Cyclophilin B (CyPB), a cyclosporin A (CsA) binding protein, interacts with two types of binding sites at the surface of T-lymphocytes. The type I sites correspond to functional receptors involved in endocytosis and the type II sites to sulfated glycosaminoglycans (GAGs). Mutational analysis of CyPB has revealed that W128, which is part of the CsA-binding pocket, is implicated in the binding to the functional type I receptors and that two amino acid clusters located in the N-terminus ensure the binding to GAGs. The peptidyl-prolyl isomerase activity of CyPB is not required for receptor binding. We have recently demonstrated that CyPB enhances adhesion of peripheral blood T-lymphocytes to fibronectin, a component of the extracellular matrix. We intended to identify additional amino acids involved in the binding of CyPB to its functional type I receptor and to determine regions responsible for the stimulation of peripheral blood T-lymphocyte adhesion. We determined that residues R76, G77, K132, D155, and D158 of the calcineurin (CN) interacting region were implicated in the recognition of type I receptor but not of GAGs. We also found that two different changes in the N-terminal extension that abated binding to GAGs prevented adhesion of peripheral blood T-lymphocytes to coated CyPB, whereas abbrogation of the PPIase activity had no effect. On the other hand, the adhesion of peripheral blood T-lymphocytes to coated fibronectin was not stimulated by CyPB mutants devoid of either type I receptor or GAGs binding activity or by mutants of the PPIase site. Altogether, the results demonstrate that different regions of CyPB are involved in peripheral blood T-lymphocyte activation and imply a novel important physiological function for peptidyl-prolyl isomerase activity.

  4. Simultaneous addition of two ligands: a potential strategy for estimating divalent ion affinities in EF-hand proteins by isothermal titration calorimetry.

    PubMed

    Henzl, Michael T; Markus, Lindsey A; Davis, Meredith E; McMillan, Andrew T

    2013-03-01

    Capable of providing a detailed thermodynamic picture of noncovalent association reactions, isothermal titration calorimetry (ITC) has become a popular method for studying protein-ligand interactions. We routinely employ the technique to study divalent ion-binding by two-site EF-hand proteins from the parvalbumin- and polcalcin lineages. The combination of high Ca(2+) affinity and relatively low Mg(2+) affinity, and the attendant complication of parameter correlation, conspire to make the simultaneous extraction of binding constants and -enthalpies for both ions challenging. Although global analysis of multiple ITC experiments can overcome these hurdles, our current experimental protocol includes upwards of 10 titrations - requiring a substantial investment in labor, machine time, and material. This paper explores the potential for using a smaller suite of experiments that includes simultaneous titrations with Ca(2+) and Mg(2+) at different ratios of the two ions. The results obtained for four proteins, differing substantially in their divalent ion-binding properties, suggest that the approach has merit. The Ca(2+)- and Mg(2+)-binding constants afforded by the streamlined analysis are in reasonable agreement with those obtained from the standard analysis protocol. Likewise, the abbreviated analysis provides comparable values for the Ca(2+)-binding enthalpies. However, the streamlined analysis can yield divergent values for the Mg(2+)-binding enthalpies - particularly those for lower affinity sites. This shortcoming can be remedied, in large measure, by including data from a direct Ca(2+) titration in the presence of a high, fixed Mg(2+) concentration. Copyright © 2013. Published by Elsevier Inc.

  5. Malathion-induced inhibition of human plasma cholinesterase studied by the fluorescence spectroscopy method

    NASA Astrophysics Data System (ADS)

    Pavelkić, V. M.; Krinulović, K. S.; Savić, J. Z.; Ilić, M. A.

    2008-05-01

    The in vitro effect of technical grade malathion was assessed via the kinetic parameters of human plasma butyrylcholinesterase (BChE) using N-methylindoxyl acetate as a substrate for BChE. An inhibitor kinetics study demonstrated the existence of a biphasic inhibition curve, indicating high-and low-affinity binding sites of malathion. The IC 50 values as calculated from the experimental inhibition curves were 1.33 × 10-9 and 1.48 × 10-5 M for the high-and low-affinity binding sites, respectively; Hill’s analysis gave 1.29 × 10-9 and 1.38 × 10-6 M. The Cornish-Bowden plots and their secondary plots indicated that the nature of inhibition was of mixed type with the predominant competitive character of both affinity binding sites.

  6. A systematic analysis of factors localized to damaged chromatin reveals PARP-dependent recruitment of transcription factors

    PubMed Central

    Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.

    2015-01-01

    Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182

  7. Characterization of the Igf-II Binding Site of the IGF-II/MAN-6-P Receptor Extracellular Domain.

    NASA Astrophysics Data System (ADS)

    Garmroudi, Farideh

    1995-01-01

    In mammals, insulin-like growth factor II (IGF -II) and glycoproteins bearing the mannose 6-phosphate (Man -6-P) recognition marker bind with high affinity to the same receptor. The functional consequences of IGF-II binding to the receptor at the cell surface are not clear. In these studies, we sought to broaden our understanding of the functional regions of the receptor regarding its IGF -II binding site. The IGF-II binding/cross-linking domain of the IGF-II/Man-6-P receptor was mapped by sequencing receptor fragments covalently attached to IGF-II. Purified rat placental or bovine liver receptors were affinity-labeled, with ^{125}I-IGF-II and digested with endoproteinase Glu-C. Analysis of digests by gel electrophoresis revealed a major radiolabeled band of 18 kDa, which was purified by gel filtration chromatography followed by reverse-phase HPLC and electroblotting. Sequence analysis revealed that, the peptide S(H)VNSXPMF, located within extracellular repeat 10 and beginning with serine 1488 of the bovine receptor, was the best candidate for the IGF-II cross-linked peptide. These data indicated that residues within repeats 10-11 were important for IGF -II binding. To define the location of the IGF-II binding site further, a nested set of six human receptor cDNA constructs was designed to produce epitope-tagged fusion proteins encompassing the region between repeats 8 and 11 of the human IGF-II/Man-6-P receptor extracellular domain. These truncated receptors were transiently expressed in COS-7 cells, immunoprecipitated and analyzed for their abilities to bind and cross-link to IGF-II. All of the constructs were capable of binding/cross-linking to IGF-II, except for the 9.0-11 construct. Displacement curve analysis indicated that the truncated receptors were approximately equivalent in IGF-II binding affinity, but were of 5- to 10-fold lower affinity than full-length receptors. Sequencing of the 9.0-11 construct indicated the presence of a point mutation substituting threonine for isoleucine at position 1621, which is located in the N-terminal half of repeat 11, and was found to abrogate IGF-II binding. Collectively, our work indicates that repeat 11 of the IGF-II/Man-6-P receptor's extracellular domain encompasses the elements both for binding and cross-linking to IGF-II.

  8. Radioligand Recognition of Insecticide Targets.

    PubMed

    Casida, John E

    2018-04-04

    Insecticide radioligands allow the direct recognition and analysis of the targets and mechanisms of toxic action critical to effective and safe pest control. These radioligands are either the insecticides themselves or analogs that bind at the same or coupled sites. Preferred radioligands and their targets, often in both insects and mammals, are trioxabicyclooctanes for the γ-aminobutyric acid (GABA) receptor, avermectin for the glutamate receptor, imidacloprid for the nicotinic receptor, ryanodine and chlorantraniliprole for the ryanodine receptor, and rotenone or pyridaben for NADH + ubiquinone oxidoreductase. Pyrethroids and other Na + channel modulator insecticides are generally poor radioligands due to lipophilicity and high nonspecific binding. For target site validation, the structure-activity relationships competing with the radioligand in the binding assays should be the same as that for insecticidal activity or toxicity except for rapidly detoxified or proinsecticide analogs. Once the radioligand assay is validated for relevance, it will often help define target site modifications on selection of resistant pest strains, selectivity between insects and mammals, and interaction with antidotes and other chemicals at modulator sites. Binding assays also serve for receptor isolation and photoaffinity labeling to characterize the interactions involved.

  9. Discovery of HDAC Inhibitors That Lack an Active Site Zn(2+)-Binding Functional Group.

    PubMed

    Vickers, Chris J; Olsen, Christian A; Leman, Luke J; Ghadiri, M Reza

    2012-06-14

    Natural and synthetic histone deacetylase (HDAC) inhibitors generally derive their strong binding affinity and high potency from a key functional group that binds to the Zn(2+) ion within the enzyme active site. However, this feature is also thought to carry the potential liability of undesirable off-target interactions with other metalloenzymes. As a step toward mitigating this issue, here, we describe the design, synthesis, and structure-activity characterizations of cyclic α3β-tetrapeptide HDAC inhibitors that lack the presumed indispensable Zn(2+)-binding group. The lead compounds (e.g., 15 and 26) display good potency against class 1 HDACs and are active in tissue culture against various human cancer cell lines. Importantly, enzymological analysis of 26 indicates that the cyclic α3β-tetrapeptide is a fast-on/off competitive inhibitor of HDACs 1-3 with K i values of 49, 33, and 37 nM, respectively. Our proof of principle study supports the idea that novel classes of HDAC inhibitors, which interact at the active-site opening, but not with the active site Zn(2+), can have potential in drug design.

  10. Characterization of R5020 and RU486 binding to progesterone receptor from calf uterus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hurd, C.; Moudgil, V.K.

    1988-05-17

    The authors have examined and compared the binding characteristics of the progesterone agonist R5020 (promegestrone, 17,21-dimethylpregna-4,9(10)-diene-3,20-dione) and the progesterone antagonist RU486 (mifepristone, 17..beta..-hydroxy-11..beta..-(4-(dimethylamino)phenyl)-17..cap alpha..-(prop-1-ynyl)-estra-4,9-dien-3-one) in calf uterine cytosol. Both steroids bound cytosol macromolecule(s) with high affinity, exhibiting K/sub d/ values of 5.6 and 3.6 nM for R5020 and RU486 binding, respectively. The binding of the steroids to the macromolecule(s) was rapid at 4/sup 0/C, showing saturation of binding sites at 1-2 h for (/sup 3/H)progesterone and 2-4 h for both (/sup 3/H)R5020 and (/sup 3/H)RU486. Addition of molybdate and glycerol to cytosol increased the extent of (/sup 3/H)R5020 binding. Themore » extent of (/sup 3/H)RU486 binding remained unchanged in the presence of molybdate, whereas glycerol had an inhibitory effect. Molybdate alone or in combination with glycerol stabilized the (/sup 3/H)R5020- and (/sup 3/H)RU486-receptor complexes at 37/sup 0/C. Competitive steroid binding analysis revealed that (/sup 3/H)progesterone, (/sup 3/H)R5020, and (/sup 3/H)RU486 compete for the same site(s) in the uterine cytosol, suggesting that all three bind to the progesterone receptor (PR). Sedimentation rate analysis showed that both steroids were bound to a molecule that sediments in the 8S region. The 8S (/sup 3/H)R5020 and (/sup 3/H)RU486 peaks were abolished by excess radioinert progesterone, RU486, or R5020. The results of this study suggest that, although there are some differences in the nature of their interaction with the PR, both R5020 and RU486 bind to the same 8S receptor in calf uterine cytosol.« less

  11. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  12. Synthesis, characterization, and binding assessment with human serum albumin of three bipyridine lanthanide(III) complexes.

    PubMed

    Aramesh-Boroujeni, Zahra; Bordbar, Abdol-Khalegh; Khorasani-Motlagh, Mozhgan; Sattarinezhad, Elham; Fani, Najme; Noroozifar, Meissam

    2018-05-18

    In this work, the terbium(III), dysprosium(III), and ytterbium(III) complexes containing 2, 2'-bipyridine (bpy) ligand have been synthesized and characterized using CHN elemental analysis, FT-IR, UV-Vis and 1 H-NMR techniques and their binding behavior with human serum albumin (HSA) was studied by UV-Vis, fluorescence and molecular docking examinations. The experimental data indicated that all three lanthanide complexes have high binding affinity to HSA with effective quenching of HSA fluorescence via static mechanism. The binding parameters, the type of interaction, the value of resonance energy transfer, and the binding distance between complexes and HSA were estimated from the analysis of fluorescence measurements and Förster theory. The thermodynamic parameters suggested that van der Waals interactions and hydrogen bonds play an important role in the binding mechanism. While, the energy transfer from HSA molecules to all these complexes occurs with high probability, the order of binding constants (BpyTb > BpyDy > BpyYb) represents the importance of radius of Ln 3+ ion in the complex-HSA interaction. The results of molecular docking calculation and competitive experiments assessed site 3 of HSA, located in subdomain IB, as the most probable binding site for these ligands and also indicated the microenvironment residues around the bound mentioned complexes. The computational results kept in good agreement with experimental data.

  13. CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

    NASA Technical Reports Server (NTRS)

    Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid

    2003-01-01

    Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

  14. Identification of a New Interaction Mode between the Src Homology 2 Domain of C-terminal Src Kinase (Csk) and Csk-binding Protein/Phosphoprotein Associated with Glycosphingolipid Microdomains♦

    PubMed Central

    Tanaka, Hiroaki; Akagi, Ken-ichi; Oneyama, Chitose; Tanaka, Masakazu; Sasaki, Yuichi; Kanou, Takashi; Lee, Young-Ho; Yokogawa, Daisuke; Dobenecker, Marc-Werner; Nakagawa, Atsushi; Okada, Masato; Ikegami, Takahisa

    2013-01-01

    Proteins with Src homology 2 (SH2) domains play major roles in tyrosine kinase signaling. Structures of many SH2 domains have been studied, and the regions involved in their interactions with ligands have been elucidated. However, these analyses have been performed using short peptides consisting of phosphotyrosine followed by a few amino acids, which are described as the canonical recognition sites. Here, we report the solution structure of the SH2 domain of C-terminal Src kinase (Csk) in complex with a longer phosphopeptide from the Csk-binding protein (Cbp). This structure, together with biochemical experiments, revealed the existence of a novel binding region in addition to the canonical phosphotyrosine 314-binding site of Cbp. Mutational analysis of this second region in cells showed that both canonical and novel binding sites are required for tumor suppression through the Cbp-Csk interaction. Furthermore, the data indicate an allosteric connection between Cbp binding and Csk activation that arises from residues in the βB/βC loop of the SH2 domain. PMID:23548896

  15. Evaluation of the binding interaction between bovine serum albumin and dimethyl fumarate, an anti-inflammatory drug by multispectroscopic methods

    NASA Astrophysics Data System (ADS)

    Jattinagoudar, Laxmi; Meti, Manjunath; Nandibewoor, Sharanappa; Chimatadar, Shivamurti

    2016-03-01

    The information of the quenching reaction of bovine serum albumin with dimethyl fumarate is obtained by multi-spectroscopic methods. The number of binding sites, n and binding constants, KA were determined at different temperatures. The effect of increasing temperature on Stern-Volmer quenching constants (KD) indicates that a dynamic quenching mechanism is involved in the interaction. The analysis of thermodynamic quantities namely, ∆H° and ∆S° suggested hydrophobic forces playing a major role in the interaction between dimethyl fumarate and bovine serum albumin. The binding site of dimethyl fumarate on bovine serum albumin was determined by displacement studies, using the site probes viz., warfarin, ibuprofen and digitoxin. The determination of magnitude of the distance of approach for molecular interactions between dimethyl fumarate and bovine serum albumin is calculated according to the theory of Förster energy transfer. The CD, 3D fluorescence spectra, synchronous fluorescence measurements and FT-IR spectral results were indicative of the change in secondary structure of the protein. The influence of some of the metal ions on the binding interaction was also studied.

  16. Interaction of SR 33557 with skeletal muscle calcium channel blocker receptors in the baboon: characterization of its binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sol-Rolland, J.; Joseph, M.; Rinaldi-Carmona, M.

    1991-05-01

    A procedure for the isolation of primate skeletal microsomal membranes was initiated. Membranes exhibited specific enzymatic markers such as 5'-nucleotidase, Ca{sup 2}{sup +},Mg({sup 2}{sup +})-adenosine triphosphatase and an ATP-dependent calcium uptake. Baboon skeletal microsomes bound specifically with high-affinity potent Ca{sup 2}{sup +} channel blockers such as dihydropyridine, phenylalkylamine and benzothiazepine derivatives. Scatchard analysis of equilibrium binding assays with ({sup 3}H)(+)-PN 200-110, ({sup 3}H)(-)-desmethoxyverapamil (( {sup 3}H)(-)-D888) and ({sup 3}H)-d-cis-dilitiazem were consistent with a single class of binding sites for the three radioligands. The pharmacological profile of SR 33557, an original compound with calcium antagonist properties, was investigated using radioligand bindingmore » studies. SR 33557 totally inhibited the specific binding of the three main classes of Ca{sup 2}{sup +} channel effectors and interacted allosterically with them. In addition, SR 33557 bound with high affinity to a homogeneous population of binding sites in baboon skeletal muscle.« less

  17. A Structure-Based Mechanism for Arf1-Dependent Recruitment of Coatomer to Membranes

    PubMed Central

    Yu, Xinchao; Breitman, Marianna; Goldberg, Jonathan

    2012-01-01

    Summary Budding of COPI-coated vesicles from Golgi membranes requires an Arf-family G protein and the coatomer complex recruited from cytosol. Arf is also required with coatomer-related clathrin adaptor complexes to bud vesicles from the trans-Golgi network and endosomal compartments. To understand the structural basis for Arf-dependent recruitment of a vesicular coat to the membrane, we determined the structure of Arf1 bound to the γζ-COP subcomplex of coatomer. Structure-guided biochemical analysis reveals that a second Arf1-GTP molecule binds to βδ-COP at a site common to the γ- and β-COP subunits. The Arf1-binding sites on coatomer are spatially related to PtdIns4,5P2-binding sites on the endocytic AP2 complex, providing evidence that the orientation of membrane binding is general for this class of vesicular coat proteins. A bivalent GTP-dependent binding mode has implications for the dynamics of coatomer interaction with the Golgi and for the selection of cargo molecules. PMID:22304919

  18. Nature and function of insulator protein binding sites in the Drosophila genome

    PubMed Central

    Schwartz, Yuri B.; Linder-Basso, Daniela; Kharchenko, Peter V.; Tolstorukov, Michael Y.; Kim, Maria; Li, Hua-Bing; Gorchakov, Andrey A.; Minoda, Aki; Shanower, Gregory; Alekseyenko, Artyom A.; Riddle, Nicole C.; Jung, Youngsook L.; Gu, Tingting; Plachetka, Annette; Elgin, Sarah C.R.; Kuroda, Mitzi I.; Park, Peter J.; Savitsky, Mikhail; Karpen, Gary H.; Pirrotta, Vincenzo

    2012-01-01

    Chromatin insulator elements and associated proteins have been proposed to partition eukaryotic genomes into sets of independently regulated domains. Here we test this hypothesis by quantitative genome-wide analysis of insulator protein binding to Drosophila chromatin. We find distinct combinatorial binding of insulator proteins to different classes of sites and uncover a novel type of insulator element that binds CP190 but not any other known insulator proteins. Functional characterization of different classes of binding sites indicates that only a small fraction act as robust insulators in standard enhancer-blocking assays. We show that insulators restrict the spreading of the H3K27me3 mark but only at a small number of Polycomb target regions and only to prevent repressive histone methylation within adjacent genes that are already transcriptionally inactive. RNAi knockdown of insulator proteins in cultured cells does not lead to major alterations in genome expression. Taken together, these observations argue against the concept of a genome partitioned by specialized boundary elements and suggest that insulators are reserved for specific regulation of selected genes. PMID:22767387

  19. Information analysis of sequences that bind the replication initiator RepA | Center for Cancer Research

    Cancer.gov

    The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.

  20. Water channel in the binding site of a high affinity anti-methotrexate antibody.

    PubMed

    Gayda, Susan; Longenecker, Kenton L; Manoj, Sharmila; Judge, Russell A; Saldana, Sylvia C; Ruan, Qiaoqiao; Swift, Kerry M; Tetin, Sergey Y

    2014-06-17

    In the present study, we report the structure of the free and drug-bound Fab fragment of a high affinity anti-methotrexate antibody and perform a thermodynamic analysis of the binding process. The anti-methotrexate Fab fragment features a remarkably rigid tunnel-like binding site that extends into a water channel serving as a specialized route to move solvent out and into the site upon ligand binding and dissociation. This new finding in antibody structure-function relationships directly relates to the fast association (1 × 10⁷ M⁻¹ s⁻¹) and slow dissociation (4 × 10⁻⁵ s⁻¹) rates determined for mAb ADD056, resulting in a very strong binding with a K(D) ~ 3.6 pM at 20 °C. As follows from the X-ray data analysis, the methotrexate-antibody complex is stabilized by an extended network of hydrogen bonds and stacking interactions. The analysis also shows structural involvement of the CDR H3 in formation of the water channel revealing another important role of this hypervariable region. This suggests a new direction in natural affinity maturation and opens a new possibility in antibody engineering. Methotrexate is a widely used therapeutic agent for many malignant diseases and inflammatory disorders. Unfortunately, it may also interfere with central aspects of metabolism and thereby cause inevitable side effects. Therefore, methotrexate therapy requires careful monitoring of drug blood levels, which is traditionally done by immunoassays. An understanding of the structure-function properties of antibodies selected for drug monitoring substantiates the performance and robustness of such tests.

  1. Role of Protein Dimeric Interface in Allosteric Inhibition of N-Acetyl-Aspartate Hydrolysis by Human Aspartoacylase.

    PubMed

    Kots, Ekaterina D; Lushchekina, Sofya V; Varfolomeev, Sergey D; Nemukhin, Alexander V

    2017-08-28

    The results of molecular modeling suggest a mechanism of allosteric inhibition upon hydrolysis of N-acetyl-aspartate (NAA), one of the most abundant amino acid derivatives in brain, by human aspartoacylase (hAsp). Details of this reaction are important to suggest the practical ways to control the enzyme activity. Search for allosteric sites using the Allosite web server and SiteMap analysis allowed us to identify substrate binding pockets located at the interface between the subunits of the hAsp dimer molecule. Molecular docking of NAA to the pointed areas at the dimer interface predicted a specific site, in which the substrate molecule interacts with the Gly237, Arg233, Glu290, and Lys292 residues. Analysis of multiple long-scaled molecular dynamics trajectories (the total simulation time exceeded 1.5 μs) showed that binding of NAA to the identified allosteric site induced significant rigidity to the protein loops with the amino acid side chains forming gates to the enzyme active site. Application of the protein dynamical network algorithms showed that substantial reorganization of the signal propagation pathways of intersubunit communication in the dimer occurred upon allosteric NAA binding to the remote site. The modeling approaches provide an explanation to the observed decrease of the reaction rate of NAA hydrolysis by hAsp at high substrate concentrations.

  2. Cluster analysis of S. Cerevisiae nucleosome binding sites

    NASA Astrophysics Data System (ADS)

    Suvorova, Y.; Korotkov, E.

    2017-12-01

    It is well known that major part of a eukaryotic genome is wrapped around histone proteins forming nucleosomes. It was also demonstrated that the DNA sequence itself is playing an important role in the nucleosome positioning process. In this work, a cluster analysis of 67 517 nucleosome binding sites from the S. Cerevisiae genome was carried out. The classification method is based on the self-adjusting dinucleotides position weight matrix. As a result, 135 significant clusters were discovered that contain 43225 sequences (which constitutes 64% of the initial set). The meaning of the found classes is discussed, as well as the possibility of the further usage.

  3. Identification of the Catalytic Ubiquinone-binding Site of Vibrio cholerae Sodium-dependent NADH Dehydrogenase

    PubMed Central

    Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar

    2017-01-01

    The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088

  4. Alternate SlyA and H-NS nucleoprotein complexes control hlyE expression in Escherichia coli K-12

    PubMed Central

    Lithgow, James K; Haider, Fouzia; Roberts, Ian S; Green, Jeffrey

    2007-01-01

    Haemolysin E is a cytolytic pore-forming toxin found in several Escherichia coli and Salmonella enterica strains. Expression of hlyE is repressed by the global regulator H-NS (histone-like nucleoid structuring protein), but can be activated by the regulator SlyA. Expression of a chromosomal hlyE–lacZ fusion in an E. coli slyA mutant was reduced to 60% of the wild-type level confirming a positive role for SlyA. DNase I footprint analysis revealed the presence of two separate SlyA binding sites, one located upstream, the other downstream of the hlyE transcriptional start site. These sites overlap AT-rich H-NS binding sites. Footprint and gel shift data showed that whereas H-NS prevented binding of RNA polymerase (RNAP) at the hlyE promoter (PhlyE), SlyA allowed binding of RNAP, but inhibited binding of H-NS. Accordingly, in vitro transcription analyses showed that addition of SlyA protein relieved H-NS-mediated repression of hlyE. Based on these observations a model for SlyA/H-NS regulation of hlyE expression is proposed in which the relative concentrations of SlyA and H-NS govern the nature of the nucleoprotein complexes formed at PhlyE. When H-NS is dominant RNAP binding is inhibited and hlyE expression is silenced; when SlyA is dominant H-NS binding is inhibited allowing RNAP access to the promoter facilitating hlyE transcription. PMID:17892462

  5. Pathogenesis of Shigella diarrhea: rabbit intestinal cell microvillus membrane binding site for Shigella toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fuchs, G.; Mobassaleh, M.; Donohue-Rolfe, A.

    This study examined the binding of purified /sup 125/I-labeled shigella toxin to rabbit jejunal microvillus membranes (MVMs). Toxin binding was concentration dependent, saturable, reversible, and specifically inhibited by unlabeled toxin. The calculated number of toxin molecules bound at 4/sup 0/C was 7.9 X 10(10) (3 X 10(10) to 2 X 10(11))/micrograms of MVM protein or 1.2 X 10(6) per enterocyte. Scatchard analysis showed the binding site to be of a single class with an equilibrium association constant, K, of 4.7 X 10(9) M-1 at 4/sup 0/C. Binding was inversely related to the temperature of incubation. A total of 80% ofmore » the labeled toxin binding at 4/sup 0/C dissociated from MVM when the temperature was raised to 37/sup 0/C, but reassociated when the temperature was again brought to 4/sup 0/C. There was no structural or functional change of MVM due to toxin as monitored by electron microscopy or assay of MVM sucrase activity. These studies demonstrate a specific binding site for shigella toxin on rabbit MVMs. The physiological relevance of this receptor remains to be determined.« less

  6. Structural characterization of metal binding to a cold-adapted frataxin.

    PubMed

    Noguera, Martín E; Roman, Ernesto A; Rigal, Juan B; Cousido-Siah, Alexandra; Mitschler, André; Podjarny, Alberto; Santos, Javier

    2015-06-01

    Frataxin is an evolutionary conserved protein that participates in iron metabolism. Deficiency of this small protein in humans causes a severe neurodegenerative disease known as Friedreich's ataxia. A number of studies indicate that frataxin binds iron and regulates Fe-S cluster biosynthesis. Previous structural studies showed that metal binding occurs mainly in a region of high density of negative charge. However, a comprehensive characterization of the binding sites is required to gain further insights into the mechanistic details of frataxin function. In this work, we have solved the X-ray crystal structures of a cold-adapted frataxin from a psychrophilic bacterium in the presence of cobalt or europium ions. We have identified a number of metal-binding sites, mainly solvent exposed, several of which had not been observed in previous studies on mesophilic homologues. No major structural changes were detected upon metal binding, although the structures exhibit significant changes in crystallographic B-factors. The analysis of these B-factors, in combination with crystal packing and RMSD among structures, suggests the existence of localized changes in the internal motions. Based on these results, we propose that bacterial frataxins possess binding sites of moderate affinity for a quick capture and transfer of iron to other proteins and for the regulation of Fe-S cluster biosynthesis, modulating interactions with partner proteins.

  7. A rigorous multiple independent binding site model for determining cell-based equilibrium dissociation constants.

    PubMed

    Drake, Andrew W; Klakamp, Scott L

    2007-01-10

    A new 4-parameter nonlinear equation based on the standard multiple independent binding site model (MIBS) is presented for fitting cell-based ligand titration data in order to calculate the ligand/cell receptor equilibrium dissociation constant and the number of receptors/cell. The most commonly used linear (Scatchard Plot) or nonlinear 2-parameter model (a single binding site model found in commercial programs like Prism(R)) used for analysis of ligand/receptor binding data assumes only the K(D) influences the shape of the titration curve. We demonstrate using simulated data sets that, depending upon the cell surface receptor expression level, the number of cells titrated, and the magnitude of the K(D) being measured, this assumption of always being under K(D)-controlled conditions can be erroneous and can lead to unreliable estimates for the binding parameters. We also compare and contrast the fitting of simulated data sets to the commonly used cell-based binding equation versus our more rigorous 4-parameter nonlinear MIBS model. It is shown through these simulations that the new 4-parameter MIBS model, when used for cell-based titrations under optimal conditions, yields highly accurate estimates of all binding parameters and hence should be the preferred model to fit cell-based experimental nonlinear titration data.

  8. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  9. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Engineering Factor Xa Inhibitor with Multiple Platelet-Binding Sites Facilitates its Platelet Targeting

    NASA Astrophysics Data System (ADS)

    Zhu, Yuanjun; Li, Ruyi; Lin, Yuan; Shui, Mengyang; Liu, Xiaoyan; Chen, Huan; Wang, Yinye

    2016-07-01

    Targeted delivery of antithrombotic drugs centralizes the effects in the thrombosis site and reduces the hemorrhage side effects in uninjured vessels. We have recently reported that the platelet-targeting factor Xa (FXa) inhibitors, constructed by engineering one Arg-Gly-Asp (RGD) motif into Ancylostoma caninum anticoagulant peptide 5 (AcAP5), can reduce the risk of systemic bleeding than non-targeted AcAP5 in mouse arterial injury model. Increasing the number of platelet-binding sites of FXa inhibitors may facilitate their adhesion to activated platelets, and further lower the bleeding risks. For this purpose, we introduced three RGD motifs into AcAP5 to generate a variant NR4 containing three platelet-binding sites. NR4 reserved its inherent anti-FXa activity. Protein-protein docking showed that all three RGD motifs were capable of binding to platelet receptor αIIbβ3. Molecular dynamics simulation demonstrated that NR4 has more opportunities to interact with αIIbβ3 than single-RGD-containing NR3. Flow cytometry analysis and rat arterial thrombosis model further confirmed that NR4 possesses enhanced platelet targeting activity. Moreover, NR4-treated mice showed a trend toward less tail bleeding time than NR3-treated mice in carotid artery endothelium injury model. Therefore, our data suggest that engineering multiple binding sites in one recombinant protein is a useful tool to improve its platelet-targeting efficiency.

  11. Regulation by divalent cations of /sup 3/H-baclofen binding to GABA/sub B/ sites in rat cerebellar membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kato, K.; Goto, M.; Fukuda, H.

    1983-02-21

    When investigating the effects of divalent cations (Mg/sup 2 +/, Ca/sup 2 +/, Sr/sup 2 +/, Ba/sup 2 +/, Mn/sup 2 +/ and Ni/sup 2 +/) on /sup 3/H-baclofen binding to rat cerebellar synaptic membranes, we found that the specific binding of /sup 3/H-baclofen was not only dependent on divalent cations, but was increased dose-dependently in the presence of these cations. The effects were in the following order of potency: Mn/sup 2 +/ approx. = Ni/sup 2 +/ > Mg/sup 2 +/ > Ca/sup 2 +/ > Sr/sup 2 +/ > Ba/sup 2 +/. Scatchard analysis of the binding datamore » revealed a single component of the binding sites in the presence of 2.5 mM MgCl/sub 2/, 2.5 mM CaCl/sub 2/ or 0.3 mM MnCl/sub 2/ whereas two components appeared in the presence of 2.5 mM MnCl/sub 2/ or 1 mM NiCl/sub 2/. In the former, divalent cations altered the apparent affinity (K/sub d/) without affecting density of the binding sites (B/sub max/). In the latter, the high-affinity sites showed a higher affinity and lower density of the binding sites than did the single component of the former. As the maximal effects of four cations (Mg/sup 2 +/, Ca/sup 2 +/, Mn/sup 2 +/, and Ni/sup 2 +/) were not additive, there are probably common sites of action of these divalent cations. Among the ligands for GABA/sub B/ sites, the affinity for (-), (+) and (+/-)baclofen, GABA and ..beta..-phenyl GABA increased 2 - 6 fold in the presence of 2.5 mM MnCl/sub 2/, in comparison with that in HEPES-buffered Krebs solution (containing 2.5 mM CaCl/sub 2/ and 1.2 mM MgSO/sub 4/), whereas that for muscimol was decreased to one-fifth. Thus, the affinity of GABA/sub B/ sites for its ligands is probably regulated by divalent cations, through common sites of action.« less

  12. Massive GGAAs in genomic repetitive sequences serve as a nuclear reservoir of NF-κB.

    PubMed

    Wu, Jian; Wang, Qiao; Dai, Wei; Wang, Wei; Yue, Ming; Wang, Jinke

    2018-04-13

    Nuclear factor κB (NF-κB) is a DNA-binding transcription factor. Characterizing its genomic binding sites is crucial for understanding its gene regulatory function and mechanism in cells. This study characterized the binding sites of NF-κB RelA/p65 in the tumor neurosis factor-α (TNFα) stimulated HeLa cells by a precise chromatin immunoprecipitation-sequencing (ChIP-seq). The results revealed that NF-κB binds nontraditional motifs (nt-motifs) containing conserved GGAA quadruplet. Moreover, nt-motifs mainly distribute in the peaks nearby centromeres that contain a larger number of repetitive elements such as satellite, simple repeats and short interspersed nuclear elements (SINEs). This intracellular binding pattern was then confirmed by the in vitro detection, indicating that NF-κB dimers can bind the nontraditional κB (nt-κB) sites with low affinity. However, this binding hardly activates transcription. This study thus deduced that NF-κB binding nt-motifs may realize functions other than gene regulation as NF-κB binding traditional motifs (t-motifs). To testify the deduction, many ChIP-seq data of other cell lines were then analyzed. The results indicate that NF-κB binding nt-motifs is also widely present in other cells. The ChIP-seq data analysis also revealed that nt-motifs more widely distribute in the peaks with low-fold enrichment. Importantly, it was also found that NF-κB binding nt-motifs is mainly present in the resting cells, whereas NF-κB binding t-motifs is mainly present in the stimulated cells. Astonishingly, no known function was enriched by the gene annotation of nt-motif peaks. Based on these results, this study proposed that the nt-κB sites that extensively distribute in larger numbers of repeat elements function as a nuclear reservoir of NF-κB. The nuclear NF-κB proteins stored at nt-κB sites in the resting cells may be recruited to the t-κB sites for regulating its target genes upon stimulation. Copyright © 2018 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  13. Computational analysis of EBNA1 ``druggability'' suggests novel insights for Epstein-Barr virus inhibitor design

    NASA Astrophysics Data System (ADS)

    Gianti, Eleonora; Messick, Troy E.; Lieberman, Paul M.; Zauhar, Randy J.

    2016-04-01

    The Epstein-Barr Nuclear Antigen 1 (EBNA1) is a critical protein encoded by the Epstein-Barr Virus (EBV). During latent infection, EBNA1 is essential for DNA replication and transcription initiation of viral and cellular genes and is necessary to immortalize primary B-lymphocytes. Nonetheless, the concept of EBNA1 as drug target is novel. Two EBNA1 crystal structures are publicly available and the first small-molecule EBNA1 inhibitors were recently discovered. However, no systematic studies have been reported on the structural details of EBNA1 "druggable" binding sites. We conducted computational identification and structural characterization of EBNA1 binding pockets, likely to accommodate ligand molecules (i.e. "druggable" binding sites). Then, we validated our predictions by docking against a set of compounds previously tested in vitro for EBNA1 inhibition (PubChem AID-2381). Finally, we supported assessments of pocket druggability by performing induced fit docking and molecular dynamics simulations paired with binding affinity predictions by Molecular Mechanics Generalized Born Surface Area calculations for a number of hits belonging to druggable binding sites. Our results establish EBNA1 as a target for drug discovery, and provide the computational evidence that active AID-2381 hits disrupt EBNA1:DNA binding upon interacting at individual sites. Lastly, structural properties of top scoring hits are proposed to support the rational design of the next generation of EBNA1 inhibitors.

  14. An Iron Reservoir to the Catalytic Metal

    PubMed Central

    Liu, Fange; Geng, Jiafeng; Gumpper, Ryan H.; Barman, Arghya; Davis, Ian; Ozarowski, Andrew; Hamelberg, Donald; Liu, Aimin

    2015-01-01

    The rubredoxin motif is present in over 74,000 protein sequences and 2,000 structures, but few have known functions. A secondary, non-catalytic, rubredoxin-like iron site is conserved in 3-hydroxyanthranilate 3,4-dioxygenase (HAO), from single cellular sources but not multicellular sources. Through the population of the two metal binding sites with various metals in bacterial HAO, the structural and functional relationship of the rubredoxin-like site was investigated using kinetic, spectroscopic, crystallographic, and computational approaches. It is shown that the first metal presented preferentially binds to the catalytic site rather than the rubredoxin-like site, which selectively binds iron when the catalytic site is occupied. Furthermore, an iron ion bound to the rubredoxin-like site is readily delivered to an empty catalytic site of metal-free HAO via an intermolecular transfer mechanism. Through the use of metal analysis and catalytic activity measurements, we show that a downstream metabolic intermediate can selectively remove the catalytic iron. As the prokaryotic HAO is often crucial for cell survival, there is a need for ensuring its activity. These results suggest that the rubredoxin-like site is a possible auxiliary iron source to the catalytic center when it is lost during catalysis in a pathway with metabolic intermediates of metal-chelating properties. A spare tire concept is proposed based on this biochemical study, and this concept opens up a potentially new functional paradigm for iron-sulfur centers in iron-dependent enzymes as transient iron binding and shuttling sites to ensure full metal loading of the catalytic site. PMID:25918158

  15. Binding modes of environmental endocrine disruptors to human serum albumin: insights from STD-NMR, ITC, spectroscopic and molecular docking studies.

    PubMed

    Yang, Hongqin; Huang, Yanmei; Liu, Jiuyang; Tang, Peixiao; Sun, Qiaomei; Xiong, Xinnuo; Tang, Bin; He, Jiawei; Li, Hui

    2017-09-11

    Given that bisphenols have an endocrine-disrupting effect on human bodies, thoroughly exposing their potential effects at the molecular level is important. Saturation transfer difference (STD) NMR-based binding studies were performed to investigate the binding potential of two bisphenol representatives, namely, bisphenol B (BPB) and bisphenol E (BPE), toward human serum albumin (HSA). The relative STD (%) suggested that BPB and BPE show similar binding modes and orientations, in which the phenolic rings were spatially close to HSA binding site. ITC analysis results showed that BPB and BPE were bound to HSA with moderately strong binding affinity through electrostatic interactions and hydrogen bonds. The order of binding affinity of HSA for two test bisphenols is as follows: BPE > BPB. The results of fluorescence competitive experiments using 5-dimethylaminonaphthalene-1-sulfonamide and dansylsarcosine as competitors, combined with molecular docking indicated that both bisphenols are prone to attach to the binding site II in HSA. Spectroscopic results (FT-IR, CD, synchronous and 3D fluorescence spectra) showed that BPB/BPE induces different degrees of microenvironmental and conformational changes to HSA.

  16. Characterization of insulin-like growth factor I receptor on human erythrocytes.

    PubMed

    Hizuka, N; Takano, K; Tanaka, I; Honda, N; Tsushima, T; Shizume, K

    1985-12-01

    [125I]Insulin-like growth factor I (IGF-I) specifically bound to erythrocytes; the binding was saturable, and time and temperature dependent. Steady state binding was reached at 16 h at 4 C, and specific binding averaged 14.3 +/- 0.7% (+/- SEM) at a concentration of 3.6 X 10(9) cells/ml in seven normal subjects. [125I]IGF-I binding to the cells was displaced by unlabeled IGF-I in a dose-dependent manner. Scatchard analysis indicated a linear plot, and Ka and number of binding sites/cell were 1.43 +/- 0.07 X 10(9) M-1 and 20.7 +/- 2.2, respectively. Compared to IGF-I, the relative potencies of multiplication-stimulating activity and insulin for displacing [125I]IGF-I binding were 20% and 1%, respectively. [125I]IGF-I binding to erythrocytes from patients with acromegaly was lower than binding to cells from pituitary dwarfs. An inverse correlation between plasma IGF-I level and the number of IGF-I-binding sites per cell was found (r = -0.75; P less than 0.005). These results demonstrate that [125I]IGF-I binding to erythrocytes can be used for clinical measurement of the IGF-I receptor.

  17. Molecular Control of Polyene Macrolide Biosynthesis

    PubMed Central

    Santos-Aberturas, Javier; Vicente, Cláudia M.; Guerra, Susana M.; Payero, Tamara D.; Martín, Juan F.; Aparicio, Jesús F.

    2011-01-01

    Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimM. This regulator, which combines an N-terminal PAS domain with a C-terminal helix-turn-helix motif, is highly conserved among polyene biosynthetic gene clusters. PimM, truncated forms of the protein without the PAS domain (PimMΔPAS), and forms containing just the DNA-binding domain (DBD) (PimMDBD) were overexpressed in Escherichia coli as GST-fused proteins. GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic mobility shift assays. Assays with truncated forms of the protein revealed that the PAS domain does not mediate specificity or the distinct recognition of target genes, which rely on the DBD domain, but significantly reduces binding affinity up to 500-fold. Transcription start points were identified by 5′-rapid amplification of cDNA ends, and the binding regions of PimMDBD were investigated by DNase I protection studies. In all cases, binding took place covering the −35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. Experimental validation of this binding site was performed by using synthetic DNA duplexes. Binding of PimM to the promoter region of one of the polyketide synthase genes from the Streptomyces nodosus amphotericin cluster containing the consensus binding site was also observed, thus proving the applicability of the findings reported here to other antifungal polyketides. PMID:21187288

  18. CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

    PubMed Central

    Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

    2011-01-01

    The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

  19. [Radiolabelling and assay of Chinese agkistrodon acutus venom with carrier-free Na 125I].

    PubMed

    Gong, Y; Deng, C; Li, S; Li, L; Guan, J

    1995-03-01

    Chinese agkistroden acutus venom (CAAV) was radiolabelled with carrier-free Na 125I by the method of Iodogen. The specific activity and radiochemical purity for radiolabelled products were 4236.5 x 10(10) Bq/mmol and 98%, respectively. Each CAAV molecule carried 0.52 125I atom. Physical and chemical characterization of radiolabelled CAAV was similar to unradiolabelled CAAV. Binding analysis showed that 125I-CAAV was bound to platelet in a saturable manner. Binding sites per platelet were 13,255 +/- 6292/platelet. The dissociation constant (Kd) was 3.2 +/- 0.69 x 10(-10) mol/L. These results are similar to binding sites of other snake venom on platelet. The investigation showed that radiolabelled CAAV made by our laboratory was useful for radioligand binding assay.

  20. TF1, the bacteriophage SPO1-encoded type II DNA-binding protein, is essential for viral multiplication.

    PubMed

    Sayre, M H; Geiduschek, E P

    1988-09-01

    The lytic Bacillus subtilis bacteriophage SPO1 encodes an abundant, 99-amino-acid type II DNA-binding protein, transcription factor 1 (TF1). TF1 is special in this family of procaryotic chromatin-forming proteins in its preference for hydroxymethyluracil-containing DNA, such as SPO1 DNA, and in binding with high affinity to specific sites in the SPO1 chromosome. We constructed recessive null alleles of the TF1 gene and introduced them into SPO1 chromosomes. Segregation analysis with partially diploid phage heterozygous for TF1 showed that phage bearing only these null alleles was inviable. Deletion of the nine C-proximal amino acids of TF1 prohibited phage multiplication in vivo and abolished its site-specific DNA-binding activity in vitro.

  1. Putative melatonin receptors in a human biological clock

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reppert, S.M.; Weaver, D.R.; Rivkees, S.A.

    In vitro autoradiography with /sup 125/I-labeled melatonin was used to examine melatonin binding sites in human hypothalamus. Specific /sup 125/I-labeled melatonin binding was localized to the suprachiasmatic nuclei, the site of a putative biological clock, and was not apparent in other hypothalamic regions. Specific /sup 125/I-labeled melatonin binding was consistently found in the suprachiasmatic nuclei of hypothalami from adults and fetuses. Densitometric analysis of competition experiments with varying concentrations of melatonin showed monophasic competition curves, with comparable half-maximal inhibition values for the suprachiasmatic nuclei of adults (150 picomolar) and fetuses (110 picomolar). Micromolar concentrations of the melatonin agonist 6-chloromelatonin completelymore » inhibited specific /sup 125/I-labeled melatonin binding, whereas the same concentrations of serotonin and norepinephrine caused only a partial reduction in specific binding. The results suggest that putative melatonin receptors are located in a human biological clock.« less

  2. Rhodobase, a meta-analytical tool for reconstructing gene regulatory networks in a model photosynthetic bacterium.

    PubMed

    Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark

    2011-02-01

    We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  3. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  4. Analysis of the Binding Sites of Porcine Sialoadhesin Receptor with PRRSV

    PubMed Central

    Jiang, Yibo; Khan, Faheem Ahmed; Pandupuspitasari, Nuruliarizki Shinta; Kadariya, Ishwari; Cheng, Zhangrui; Ren, Yuwei; Chen, Xing; Zhou, Ao; Yang, Liguo; Kong, Dexin; Zhang, Shujun

    2013-01-01

    Porcine reproductive and respiratory syndrome virus (PRRSV) can infect pigs and cause enormous economic losses to the pig industry worldwide. Porcine sialoadhesin (pSN) and CD163 have been identified as key viral receptors on porcine alveolar macrophages (PAM), a main target cell infected by PRRSV. In this study, the protein structures of amino acids 1–119 from the pSN and cSN (cattle sialoadhesin) N-termini (excluding the 19-amino acid signal peptide) were modeled via homology modeling based on mSN (mouse sialoadhesin) template structures using bioinformatics tools. Subsequently, pSN and cSN homology structures were superposed onto the mSN protein structure to predict the binding sites of pSN. As a validation experiment, the SN N-terminus (including the wild-type and site-directed-mutant-types of pSN and cSN) was cloned and expressed as a SN-GFP chimera protein. The binding activity between SN and PRRSV was confirmed by WB (Western blotting), FAR-WB (far Western blotting), ELISA (enzyme-linked immunosorbent assay) and immunofluorescence assay. We found that the S107 amino acid residue in the pSN N-terminal played a crucial role in forming a special cavity, as well as a hydrogen bond for enhancing PRRSV binding during PRRSV infection. S107 may be glycosylated during PRRSV infection and may also be involved in forming the cavity for binding PRRSV along with other sites, including W2, Y44, S45, R97, R105, W106 and V109. Additionally, S107 might also be important for pSN binding with PRRSV. However, the function of these binding sites must be confirmed by further studies. PMID:24351868

  5. Allosteric site-mediated active site inhibition of PBP2a using Quercetin 3-O-rutinoside and its combination.

    PubMed

    Rani, Nidhi; Vijayakumar, Saravanan; P T V, Lakshmi; Arunachalam, Annamalai

    2016-08-01

    Recent crystallographic study revealed the involvement of allosteric site in active site inhibition of penicillin binding protein (PBP2a), where one molecule of Ceftaroline (Cef) binds to the allosteric site of PBP2a and paved way for the other molecule (Cef) to bind at the active site. Though Cef has the potency to inhibit the PBP2a, its adverse side effects are of major concern. Previous studies have reported the antibacterial property of Quercetin derivatives, a group of natural compounds. Hence, the present study aims to evaluate the effect of Quercetin 3-o-rutinoside (Rut) in allosteric site-mediated active site inhibition of PBP2a. The molecular docking studies between allosteric site and ligands (Rut, Que, and Cef) revealed a better binding efficiency (G-score) of Rut (-7.790318) and Cef (-6.194946) with respect to Que (-5.079284). Molecular dynamic (MD) simulation studies showed significant changes at the active site in the presence of ligands (Rut and Cef) at allosteric site. Four different combinations of Rut and Cef were docked and their G-scores ranged between -6.320 and -8.623. MD studies revealed the stability of the key residue (Ser403) with Rut being at both sites, compared to other complexes. Morphological analysis through electron microscopy confirmed that combination of Rut and Cefixime was able to disturb the bacterial cell membrane in a similar fashion to that of Rut and Cefixime alone. The results of this study indicate that the affinity of Rut at both sites were equally good, with further validations Rut could be considered as an alternative for inhibiting MRSA growth.

  6. Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vivian, J. P.; Porter, C.; Wilce, J. A.

    2006-11-01

    A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

  7. Interaction of Flavonoids from Woodwardia unigemmata with Bovine Serum Albumin (BSA): Application of Spectroscopic Techniques and Molecular Modeling Methods.

    PubMed

    Ma, Rui; Pan, Hong; Shen, Tao; Li, Peng; Chen, Yanan; Li, Zhenyu; Di, Xiaxia; Wang, Shuqi

    2017-08-09

    Phytochemical investigation on the methanol extract of Woodwardia unigemmata resulted in the isolation of seven flavonoids, including one new flavonol acylglycoside ( 1 ). The structures of these compounds were elucidated on the basis of extensive spectroscopic analysis and comparison of literature data. The multidrug resistance (MDR) reversing activity was evaluated for the isolated compounds using doxorubicin-resistant K562/A02 cells model. Compound 6 showed comparable MDR reversing effect to verapamil. Furthermore, the interaction between compounds and bovine serum albumin (BSA) was investigated by spectroscopic methods, including steady-state fluorescence, synchronous fluorescence, circular dichroism (CD) spectroscopies, and molecular docking approach. The experimental results indicated that the seven flavonoids bind to BSA by static quenching mechanisms. The negative ΔH and ΔS values indicated that van der Waals interactions and hydrogen bonds contributed in the binding of compounds 2 - 6 to BSA. In the case of compounds 1 and 7 systems, the hydrophobic interactions play a major role. The binding of compounds to BSA causes slight changes in the secondary structure of BSA. There are two binding sites of compound 6 on BSA and site I is the main site according to the molecular docking studies and the site marker competitive binding assay.

  8. Cations Stiffen Actin Filaments by Adhering a Key Structural Element to Adjacent Subunits

    PubMed Central

    2016-01-01

    Ions regulate the assembly and mechanical properties of actin filaments. Recent work using structural bioinformatics and site-specific mutagenesis favors the existence of two discrete and specific divalent cation binding sites on actin filaments, positioned in the long axis between actin subunits. Cation binding at one site drives polymerization, while the other modulates filament stiffness and plays a role in filament severing by the regulatory protein, cofilin. Existing structural methods have not been able to resolve filament-associated cations, and so in this work we turn to molecular dynamics simulations to suggest a candidate binding pocket geometry for each site and to elucidate the mechanism by which occupancy of the “stiffness site” affects filament mechanical properties. Incorporating a magnesium ion in the “polymerization site” does not seem to require any large-scale change to an actin subunit’s conformation. Binding of a magnesium ion in the “stiffness site” adheres the actin DNase-binding loop (D-loop) to its long-axis neighbor, which increases the filament torsional stiffness and bending persistence length. Our analysis shows that bound D-loops occupy a smaller region of accessible conformational space. Cation occupancy buries key conserved residues of the D-loop, restricting accessibility to regulatory proteins and enzymes that target these amino acids. PMID:27146246

  9. Identification of amino acids in the nicotinic acetylcholine receptor agonist binding site and ion channel photolabeled by 4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine, a novel photoaffinity antagonist.

    PubMed

    Chiara, David C; Trinidad, Jonathan C; Wang, Dong; Ziebell, Michael R; Sullivan, Deirdre; Cohen, Jonathan B

    2003-01-21

    [(3)H]4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine (TDBzcholine) was synthesized and used as a photoaffinity probe to map the orientation of an aromatic choline ester within the agonist binding sites of the Torpedo nicotinic acetylcholine receptor (nAChR). TDBzcholine acts as a nAChR competitive antagonist that binds at equilibrium with equal affinity to both agonist sites (K(D) approximately 10 microM). Upon UV irradiation (350 nm), nAChR-rich membranes equilibrated with [(3)H]TDBzcholine incorporate (3)H into the alpha, gamma, and delta subunits in an agonist-inhibitable manner. The specific residues labeled by [(3)H]TDBzcholine were determined by N-terminal sequence analysis of subunit fragments produced by enzymatic cleavage and purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and/or reversed-phase high-performance liquid chromatography. For the alpha subunit, [(3)H]TDBzcholine photoincorporated into alphaCys-192, alphaCys-193, and alphaPro-194. For the gamma and delta subunits, [(3)H]TDBzcholine incorporated into homologous leucine residues, gammaLeu-109 and deltaLeu-111. The photolabeling of these amino acids suggests that when the antagonist TDBzcholine occupies the agonist binding sites, the Cys-192-193 disulfide and Pro-194 from the alpha subunit Segment C are oriented toward the agonist site and are in proximity to gammaLeu-109/deltaLeu-111 in Segment E, a conclusion consistent with the structure of the binding site in the molluscan acetylcholine binding protein, a soluble protein that is homologous to the nAChR extracellular domain.

  10. Structural Analysis of Charge Discrimination in the Binding of Inhibitors to Human Carbonic Anhydrases I and II

    PubMed Central

    Srivastava, D. K.; Jude, Kevin M.; Banerjee, Abir L.; Haldar, Manas; Manokaran, Sumathra; Kooren, Joel; Mallik, Sanku; Christianson, David W.

    2008-01-01

    Despite the similarity in the active site pockets of carbonic anhydrase (CA) isozymes I and II, the binding affinities of benzenesulfonamide inhibitors are invariably higher with CA II as compared to CA I. To explore the structural basis of this molecular recognition phenomenon, we have designed and synthesized simple benzenesulfonamide inhibitors substituted at the para position with positively-charged, negatively-charged, and neutral functional groups, and we have determined the affinities and X-ray crystal structures of their enzyme complexes. The para-substituents are designed to bind in the midsection of the 15 Å deep active site cleft, where interactions with enzyme residues and solvent molecules are possible. We find that a para-substituted positively-charged amino group is more poorly tolerated in the active site of CA I compared with CA II. In contrast, a para-substituted negatively-charged carboxylate substituent is tolerated equally well in the active sites of both CA isozymes. Notably, enzyme-inhibitor affinity increases upon neutralization of inhibitor charged groups by amidation or esterification. These results inform the design of short molecular linkers connecting the benzenesulfonamide group and a para-substituted tail group in “two-prong” CA inhibitors: an optimal linker segment will be electronically neutral, yet capable of engaging in at least some hydrogen bond interactions with protein residues and/or solvent. Microcalorimetric data reveal that inhibitor binding to CA I is enthalpically less favorable and entropically more favorable than inhibitor binding to CA II. This contrasting behavior may arise in part from differences in active site desolvation and the conformational entropy of inhibitor binding to each isozyme active site. PMID:17407288

  11. Protein pharmacophore selection using hydration-site analysis

    PubMed Central

    Hu, Bingjie; Lill, Markus A.

    2012-01-01

    Virtual screening using pharmacophore models is an efficient method to identify potential lead compounds for target proteins. Pharmacophore models based on protein structures are advantageous because a priori knowledge of active ligands is not required and the models are not biased by the chemical space of previously identified actives. However, in order to capture most potential interactions between all potentially binding ligands and the protein, the size of the pharmacophore model, i.e. number of pharmacophore elements, is typically quite large and therefore reduces the efficiency of pharmacophore based screening. We have developed a new method to select important pharmacophore elements using hydration-site information. The basic premise is that ligand functional groups that replace water molecules in the apo protein contribute strongly to the overall binding affinity of the ligand, due to the additional free energy gained from releasing the water molecule into the bulk solvent. We computed the free energy of water released from the binding site for each hydration site using thermodynamic analysis of molecular dynamics (MD) simulations. Pharmacophores which are co-localized with hydration sites with estimated favorable contributions to the free energy of binding are selected to generate a reduced pharmacophore model. We constructed reduced pharmacophore models for three protein systems and demonstrated good enrichment quality combined with high efficiency. The reduction in pharmacophore model size reduces the required screening time by a factor of 200–500 compared to using all protein pharmacophore elements. We also describe a training process using a small set of known actives to reliably select the optimal set of criteria for pharmacophore selection for each protein system. PMID:22397751

  12. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    PubMed

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  13. Pharmacological lineage analysis revealed the binding affinity of broad-spectrum substance P antagonists to receptors for gonadotropin-releasing peptide.

    PubMed

    Arai, Kazune; Kashiwazaki, Aki; Fujiwara, Yoko; Tsuchiya, Hiroyoshi; Sakai, Nobuya; Shibata, Katsushi; Koshimizu, Taka-aki

    2015-02-15

    A group of synthetic substance P (SP) antagonists, such as [Arg(6),D-Trp(7,9),N(Me)Phe(8)]-substance P(6-11) and [D-Arg(1),D-Phe(5),D-Trp(7,9),Leu(11)]-substance P, bind to a range of distinct G-protein-coupled receptor (GPCR) family members, including V1a vasopressin receptors, and they competitively inhibit agonist binding. This extended accessibility enabled us to identify a GPCR subset with a partially conserved binding site structure. By combining pharmacological data and amino acid sequence homology matrices, a pharmacological lineage of GPCRs that are sensitive to these two SP antagonists was constructed. We found that sensitivity to the SP antagonists was not limited to the Gq-protein-coupled V1a and V1b receptors; Gs-coupled V2 receptors and oxytocin receptors, which couple with both Gq and Gi, also demonstrated sensitivity. Unexpectedly, a dendrogram based on the amino acid sequences of 222 known GPCRs showed that a group of receptors sensitive to the SP antagonists are located in close proximity to vasopressin/oxytocin receptors. Gonadotropin-releasing peptide receptors, located near the vasopressin receptors in the dendrogram, were also sensitive to the SP analogs, whereas α1B adrenergic receptors, located more distantly from the vasopressin receptors, were not sensitive. Our finding suggests that pharmacological lineage analysis is useful in selecting subsets of candidate receptors that contain a conserved binding site for a ligand with broad-spectrum binding abilities. The knowledge that the binding site of the two broad-spectrum SP analogs partially overlaps with that of distinct peptide agonists is valuable for understanding the specificity/broadness of peptide ligands. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Analysis of molecular determinants of affinity and relative efficacy of a series of R- and S-2-(dipropylamino)tetralins at the 5-HT1A serotonin receptor

    PubMed Central

    Alder, J Tracy; Hacksell, Uli; Strange, Philip G

    2003-01-01

    Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269

  15. Diversity of Cyclic Di-GMP-Binding Proteins and Mechanisms

    PubMed Central

    2015-01-01

    ABSTRACT Cyclic di-GMP (c-di-GMP) synthetases and hydrolases (GGDEF, EAL, and HD-GYP domains) can be readily identified in bacterial genome sequences by using standard bioinformatic tools. In contrast, identification of c-di-GMP receptors remains a difficult task, and the current list of experimentally characterized c-di-GMP-binding proteins is likely incomplete. Several classes of c-di-GMP-binding proteins have been structurally characterized; for some others, the binding sites have been identified; and for several potential c-di-GMP receptors, the binding sites remain to be determined. We present here a comparative structural analysis of c-di-GMP-protein complexes that aims to discern the common themes in the binding mechanisms that allow c-di-GMP receptors to bind it with (sub)micromolar affinities despite the 1,000-fold excess of GTP. The available structures show that most receptors use their Arg and Asp/Glu residues to bind c-di-GMP monomers, dimers, or tetramers with stacked guanine bases. The only exception is the EAL domains that bind c-di-GMP monomers in an extended conformation. We show that in c-di-GMP-binding signature motifs, Arg residues bind to the O-6 and N-7 atoms at the Hoogsteen edge of the guanine base, while Asp/Glu residues bind the N-1 and N-2 atoms at its Watson-Crick edge. In addition, Arg residues participate in stacking interactions with the guanine bases of c-di-GMP and the aromatic rings of Tyr and Phe residues. This may account for the presence of Arg residues in the active sites of every receptor protein that binds stacked c-di-GMP. We also discuss the implications of these structural data for the improved understanding of the c-di-GMP signaling mechanisms. PMID:26055114

  16. Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

    PubMed Central

    Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2016-01-01

    Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

  17. A novel site contributing to growth-arrest-specific gene 6 binding to its receptors as revealed by a human monoclonal antibody

    PubMed Central

    2004-01-01

    Gas6 (growth-arrest-specific gene 6) is a vitamin K-dependent protein known to activate the Axl family of receptor tyrosine kinases. It is an important regulator of thrombosis and many other biological functions. The C-terminus of Gas6 binds to receptors and consists of two laminin-like globular domains LG1 and LG2. It has been reported that a Ca2+-binding site at the junction of LG1 and LG2 domains and a hydrophobic patch at the LG2 domain are important for receptor binding [Sasaki, Knyazev, Cheburkin, Gohring, Tisi, Ullrich, Timpl and Hohenester (2002) J. Biol. Chem. 277, 44164–44170]. In the present study, we developed a neutralizing human monoclonal antibody, named CNTO300, for Gas6. The antibody was generated by immunization of human IgG-expressing transgenic mice with recombinant human Gas6 protein and the anti-Gas6 IgG sequences were rescued from an unstable hybridoma clone. Binding of Gas6 to its receptors was partially inhibited by the CNTO300 antibody in a dose-dependent manner. To characterize further the interaction between Gas6 and this antibody, the binding kinetics of CNTO300 for recombinant Gas6 were compared with independently expressed LG1 and LG2. The CNTO300 antibody showed comparable binding affinity, yet different dependence on Ca2+, to Gas6 and LG1. No binding to LG2 was detected. In the presence of EDTA, binding of the antibody to Gas6 was disrupted, but no significant effect of EDTA on LG1 binding was evident. Further epitope mapping identified a Gas6 peptide sequence recognized by the CNTO300 antibody. This peptide sequence was found to be located at the LG1 domain distant from the Ca2+-binding site and the hydrophobic patch. Co-interaction of Gas6 with its receptor and CNTO300 antibody was detected by BIAcore analysis, suggesting a second receptor-binding site on the LG1 domain. This hypothesis was further supported by direct binding of Gas6 receptors to an independently expressed LG1 domain. Our results revealed, for the first time, a second binding site for Gas6–receptor interaction. PMID:15579134

  18. Analysis of Binding Site Hot Spots on the Surface of Ras GTPase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buhrman, Greg; O; #8242

    2012-09-17

    We have recently discovered an allosteric switch in Ras, bringing an additional level of complexity to this GTPase whose mutants are involved in nearly 30% of cancers. Upon activation of the allosteric switch, there is a shift in helix 3/loop 7 associated with a disorder to order transition in the active site. Here, we use a combination of multiple solvent crystal structures and computational solvent mapping (FTMap) to determine binding site hot spots in the 'off' and 'on' allosteric states of the GTP-bound form of H-Ras. Thirteen sites are revealed, expanding possible target sites for ligand binding well beyond themore » active site. Comparison of FTMaps for the H and K isoforms reveals essentially identical hot spots. Furthermore, using NMR measurements of spin relaxation, we determined that K-Ras exhibits global conformational dynamics very similar to those we previously reported for H-Ras. We thus hypothesize that the global conformational rearrangement serves as a mechanism for allosteric coupling between the effector interface and remote hot spots in all Ras isoforms. At least with respect to the binding sites involving the G domain, H-Ras is an excellent model for K-Ras and probably N-Ras as well. Ras has so far been elusive as a target for drug design. The present work identifies various unexplored hot spots throughout the entire surface of Ras, extending the focus from the disordered active site to well-ordered locations that should be easier to target.« less

  19. Analysis of expression and chitin-binding activity of the wing disc cuticle protein BmWCP4 in the silkworm, Bombyx mori.

    PubMed

    Deng, Hui-Min; Li, Yong; Zhang, Jia-Ling; Liu, Lin; Feng, Qi-Li

    2016-12-01

    The insect exoskeleton is mainly composed of chitin filaments linked by cuticle proteins. When insects molt, the cuticle of the exoskeleton is renewed by degrading the old chitin and cuticle proteins and synthesizing new ones. In this study, chitin-binding activity of the wing disc cuticle protein BmWCP4 in Bombyx mori was studied. Sequence analysis showed that the protein had a conservative hydrophilic "R&R" chitin-binding domain (CBD). Western blotting showed that BmWCP4 was predominately expressed in the wing disc-containing epidermis during the late wandering and early pupal stages. The immunohistochemistry result showed that the BmWCP4 was mainly present in the wing disc tissues containing wing bud and trachea blast during day 2 of wandering stage. Recombinant full-length BmWCP4 protein, "R&R" CBD peptide (CBD), non-CBD peptide (BmWCP4-CBD - ), four single site-directed mutated peptides (M 1 , M 2 , M 3 and M 4 ) and four-sites-mutated peptide (M F ) were generated and purified, respectively, for in vitro chitin-binding assay. The results indicated that both the full-length protein and the "R&R" CBD peptide could bind with chitin, whereas the BmWCP4-CBD - could not bind with chitin. The single residue mutants M 1 , M 2 , M 3 and M 4 reduced but did not completely abolish the chitin-binding activity, while four-sites-mutated protein M F completely lost the chitin-binding activity. These data indicate that BmWCP4 protein plays a critical role by binding to the chitin filaments in the wing during larva-to-pupa transformation. The conserved aromatic amino acids are critical in the interaction between chitin and the cuticle protein. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  20. The juxtamembrane domain of the E-cadherin cytoplasmic tail contributes to its interaction with Myosin VI

    PubMed Central

    Mangold, Sabine; Norwood, Suzanne J.; Yap, Alpha S.; Collins, Brett M.

    2012-01-01

    We recently identified the atypical myosin, Myosin VI, as a component of epithelial cell-cell junctions that interacts with E-cadherin. Recombinant proteins bearing the cargo-binding domain of Myosin VI (Myo VI-CBD) or the cytoplasmic tail of E-cadherin can interact directly with one another. In this report we further investigate the molecular requirements of the interaction between Myo VI-CBD and E-cadherin combining truncation mutation analysis with in vitro binding assays. We report that a short (28 amino acid) juxtamembrane region of the cadherin cytoplasmic tail is sufficient to bind Myo VI-CBD. However, central regions of the cadherin tail adjacent to the juxtamembrane sequence also display binding activity for Myo VI-CBD. It is therefore possible that the cadherin tail bears two binding sites for Myosin VI, or an extended binding site that includes the juxtamembrane region. Nevertheless, our biochemical data highlight the capacity for the juxtamembrane region to interact with functionally-significant cytoplasmic proteins. PMID:23007415

  1. Comparative Bioinformatic Analysis of Active Site Structures in Evolutionarily Remote Homologues of α,β-Hydrolase Superfamily Enzymes.

    PubMed

    Suplatov, D A; Arzhanik, V K; Svedas, V K

    2011-01-01

    Comparative bioinformatic analysis is the cornerstone of the study of enzymes' structure-function relationship. However, numerous enzymes that derive from a common ancestor and have undergone substantial functional alterations during natural selection appear not to have a sequence similarity acceptable for a statistically reliable comparative analysis. At the same time, their active site structures, in general, can be conserved, while other parts may largely differ. Therefore, it sounds both plausible and appealing to implement a comparative analysis of the most functionally important structural elements - the active site structures; that is, the amino acid residues involved in substrate binding and the catalytic mechanism. A computer algorithm has been developed to create a library of enzyme active site structures based on the use of the PDB database, together with programs of structural analysis and identification of functionally important amino acid residues and cavities in the enzyme structure. The proposed methodology has been used to compare some α,β-hydrolase superfamily enzymes. The insight has revealed a high structural similarity of catalytic site areas, including the conservative organization of a catalytic triad and oxyanion hole residues, despite the wide functional diversity among the remote homologues compared. The methodology can be used to compare the structural organization of the catalytic and substrate binding sites of various classes of enzymes, as well as study enzymes' evolution and to create of a databank of enzyme active site structures.

  2. On the molecular interaction between lactoferrin and the dye Red HE-3B. A novel approach for docking a charged and highly flexible molecule to protein surfaces

    NASA Astrophysics Data System (ADS)

    Grasselli, Mariano; Cascone, Osvaldo; Anspach, F. Birger; Delfino, Jose M.

    2002-12-01

    Lactoferrin (Lf) is a non-heme, iron binding protein present in many physiological fluids of vertebrates where its main role is the microbicidal activity. It has been isolated by different methods, including dye-affinity chromatography. Red HE-3B is one of the most common triazinic dyes applied in protein purification, but scant knowledge is available on structural details and on the energetics of its interaction with proteins. In this work we present a computational approach useful for identifying possible binding sites for Red HE-3B in apo and holo forms of Lfs from human and bovine source. A new geometrical description of Red HE-3B is introduced which greatly simplifies the conformational analysis. This approach proved to be of particular advantage for addressing conformational ensembles of highly flexible molecules. Predictions from this analysis were correlated with experimentally observed dye-binding sites, as mapped by protection from proteolysis in Red HE-3B/Lf complexes. This method could bear relevance for the screening of possible dye-binding sites in proteins whose structure is known and as a potential tool for the design of engineered protein variants which could be purified by dye-affinity chromatography.

  3. On the molecular interaction between lactoferrin and the dye Red HE-3b. A novel approach for docking a charged and highly flexible molecule to protein surfaces.

    PubMed

    Grasselli, Mariano; Cascone, Osvaldo; Birger Anspach, F; Delfino, Jose M

    2002-12-01

    Lactoferrin (Lf) is a non-heme, iron binding protein present in many physiological fluids of vertebrates where its main role is the microbicidal activity. It has been isolated by different methods, including dye-affinity chromatography. Red HE-3B is one of the most common triazinic dyes applied in protein purification, but scant knowledge is available on structural details and on the energetics of its interaction with proteins. In this work we present a computational approach useful for identifying possible binding sites for Red HE-3B in apo and holo forms of Lfs from human and bovine source. A new geometrical description of Red HE-3B is introduced which greatly simplifies the conformational analysis. This approach proved to be of particular advantage for addressing conformational ensembles of highly flexible molecules. Predictions from this analysis were correlated with experimentally observed dye-binding sites, as mapped by protection from proteolysis in Red HE-3B/Lf complexes. This method could bear relevance for the screening of possible dye-binding sites in proteins whose structure is known and as a potential tool for the design of engineered protein variants which could be purified by dye-affinity chromatography.

  4. Tolerance to LSD and DOB induced shaking behaviour: differential adaptations of frontocortical 5-HT(2A) and glutamate receptor binding sites.

    PubMed

    Buchborn, Tobias; Schröder, Helmut; Dieterich, Daniela C; Grecksch, Gisela; Höllt, Volker

    2015-03-15

    Serotonergic hallucinogens, such as lysergic acid diethylamide (LSD) and dimethoxy-bromoamphetamine (DOB), provoke stereotype-like shaking behaviour in rodents, which is hypothesised to engage frontocortical glutamate receptor activation secondary to serotonin2A (5-HT2A) related glutamate release. Challenging this hypothesis, we here investigate whether tolerance to LSD and DOB correlates with frontocortical adaptations of 5-HT2A and/or overall-glutamate binding sites. LSD and DOB (0.025 and 0.25 mg/kg, i.p.) induce a ketanserin-sensitive (0.5 mg/kg, i.p., 30-min pretreatment) increase in shaking behaviour (including head twitches and wet dog shakes), which with repeated application (7× in 4 ds) is undermined by tolerance. Tolerance to DOB, as indexed by DOB-sensitive [(3)H]spiroperidol and DOB induced [(35)S]GTP-gamma-S binding, is accompanied by a frontocortical decrease in 5-HT2A binding sites and 5-HT2 signalling, respectively; glutamate-sensitive [(3)H]glutamate binding sites, in contrast, remain unchanged. As to LSD, 5-HT2 signalling and 5-HT2A binding, respectively, are not or only marginally affected, yet [(3)H]glutamate binding is significantly decreased. Correlation analysis interrelates tolerance to DOB to the reduced 5-HT2A (r=.80) as well as the unchanged [(3)H]glutamate binding sites (r=.84); tolerance to LSD, as opposed, shares variance with the reduction in [(3)H]glutamate binding sites only (r=.86). Given that DOB and LSD both induce tolerance, one correlating with 5-HT2A, the other with glutamate receptor adaptations, it might be inferred that tolerance can arise at either level. That is, if a hallucinogen (like LSD in our study) fails to induce 5-HT2A (down-)regulation, glutamate receptors (activated postsynaptic to 5-HT2A related glutamate release) might instead adapt and thus prevent further overstimulation of the cortex. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Evidence for specific annexin I-binding proteins on human monocytes.

    PubMed Central

    Goulding, N J; Pan, L; Wardwell, K; Guyre, V C; Guyre, P M

    1996-01-01

    Recombinant human annexin I and a monoclonal antibody specific for this protein (mAb 1B) were used to investigate surface binding of this member of the annexin family of proteins to peripheral blood monocytes. Flow cytometric analysis demonstrated trypsin-sensitive, saturable binding of annexin I to human peripheral blood monocytes but not to admixed lymphocytes. A monoclonal antibody that blocks the anti-phospholipase activity of annexin I also blocked its binding to monocytes. These findings suggest the presence of specific binding sites on monocytes. Furthermore, surface iodination, immunoprecipitation and SDS/PAGE analysis were used to identify two annexin I-binding proteins on the surface of monocytes with molecular masses of 15 kDa and 18 kDa respectively. The identification and characterization of these annexin I-binding molecules should help us to better understand the specific interactions of annexin I with monocytes that lead to down-regulation of pro-inflammatory cell functions. PMID:8687405

  6. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  7. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  8. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Combining modelling and mutagenesis studies of synaptic vesicle protein 2A to identify a series of residues involved in racetam binding.

    PubMed

    Shi, Jiye; Anderson, Dina; Lynch, Berkley A; Castaigne, Jean-Gabriel; Foerch, Patrik; Lebon, Florence

    2011-10-01

    LEV (levetiracetam), an antiepileptic drug which possesses a unique profile in animal models of seizure and epilepsy, has as its unique binding site in brain, SV2A (synaptic vesicle protein 2A). Previous studies have used a chimaeric and site-specific mutagenesis approach to identify three residues in the putative tenth transmembrane helix of SV2A that, when mutated, alter binding of LEV and related racetam derivatives to SV2A. In the present paper, we report a combined modelling and mutagenesis study that successfully identifies another 11 residues in SV2A that appear to be involved in ligand binding. Sequence analysis and modelling of SV2A suggested residues equivalent to critical functional residues of other MFS (major facilitator superfamily) transporters. Alanine scanning of these and other SV2A residues resulted in the identification of residues affecting racetam binding, including Ile273 which differentiated between racetam analogues, when mutated to alanine. Integrating mutagenesis results with docking analysis led to the construction of a mutant in which six SV2A residues were replaced with corresponding SV2B residues. This mutant showed racetam ligand-binding affinity intermediate to the affinities observed for SV2A and SV2B.

  10. DNA mimic proteins: functions, structures, and bioinformatic analysis.

    PubMed

    Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J

    2014-05-13

    DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.

  11. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  12. Comparative molecular field analysis of the binding of the stereoisomers of fenoterol and fenoterol derivatives to the beta2 adrenergic receptor.

    PubMed

    Jozwiak, Krzysztof; Khalid, Chakir; Tanga, Mary J; Berzetei-Gurske, Ilona; Jimenez, Lucita; Kozocas, Joseph A; Woo, Anthony; Zhu, Weizhong; Xiao, Rui-Ping; Abernethy, Darrell R; Wainer, Irving W

    2007-06-14

    Stereoisomers of fenoterol and six fenoterol derivatives have been synthesized and their binding affinities for the beta2 adrenergic receptor (Kibeta2-AR), the subtype selectivity relative to the beta1-AR (Kibeta1-AR/Kibeta2-AR) and their functional activities were determined. Of the 26 compounds synthesized in the study, submicromolar binding affinities were observed for (R,R)-fenoterol, the (R,R)-isomer of the p-methoxy, and (R,R)- and (R,S)-isomers of 1-naphthyl derivatives and all of these compounds were active at submicromolar concentrations in cardiomyocyte contractility tests. The Kibeta1-AR/Kibeta2-AR ratios were >40 for (R,R)-fenoterol and the (R,R)-p-methoxy and (R,S)-1-naphthyl derivatives and 14 for the (R,R)-1-napthyl derivative. The binding data was analyzed using comparative molecular field analysis (CoMFA), and the resulting model indicated that the fenoterol derivatives interacted with two separate binding sites and one steric restricted site on the pseudo-receptor and that the chirality of the second stereogenic center affected Kibeta2 and subtype selectivity.

  13. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  14. Heterogeneity of binding of muscarinic receptor antagonists in rat brain homogenates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, J.H.; el-Fakahany, E.E.

    1985-06-01

    The binding properties of (-)-(/sup 3/H)quinuclidinyl benzilate and (/sup 3/H) N-methylscopolamine to muscarinic acetylcholine receptors have been investigated in rat brain homogenates. The binding of both antagonists demonstrated high affinity and saturability. Analysis of the binding data resulted in linear Scatchard plots. However, (-)-(/sup 3/H)quinuclidinyl benzilate showed a significantly higher maximal binding capacity than that of (/sup 3/H)N-methylscopolamine. Displacement of both ligands with several muscarinic receptor antagonists resulted in competition curves in accordance with the law of mass-action for quinuclidinyl benzilate, atropine and scopolamine. A similar profile was found for the quaternary ammonium analogs of atropine and scopolamine when (/supmore » 3/H)N-methylscopolamine was used to label the receptors. However, when these hydrophilic antagonists were used to displace (-)-(/sup 3/H) quinuclidinyl benzilate binding, they showed interaction with high- and low-affinity binding sites. On the other hand, the nonclassical muscarinic receptor antagonist, pirenzepine, was able to displace both ligands from two binding sites. The present data are discussed in terms of the relationship of this anomalous heterogenity of binding of these hydrophilic muscarinic receptor antagonists and the proposed M1 and M2 receptor subtypes.« less

  15. ChIP-seq analysis of the σ E regulon of Salmonella enterica serovar typhimurium reveals new genes implicated in heat shock and oxidative stress response

    DOE PAGES

    Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...

    2015-09-21

    The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less

  16. ChIP-seq analysis of the σ E regulon of Salmonella enterica serovar typhimurium reveals new genes implicated in heat shock and oxidative stress response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Jie; Overall, Christopher C.; Johnson, Rudd C.

    The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less

  17. Deciphering the complexation process of a fluoroquinolone antibiotic, levofloxacin, with bovine serum albumin in the presence of additives

    NASA Astrophysics Data System (ADS)

    Kaur, Amandeep; Khan, Imran Ahmd; Banipal, Parampaul Kaur; Banipal, Tarlok Singh

    2018-02-01

    The current work aims to explore the thermodynamic and conformational aspects for the binding of fluoroquinolone antibacterial drug, levofloxacin (LFC), with bovine serum albumin (BSA) using calorimetric, spectroscopic (UV-visible, fluorescence, circular dichroism, and 1H NMR), dynamic light scattering (DLS) and computational methods (molecular docking). The binding of LFC with BSA at two sequential sites with higher affinity ( 103 M- 1) at the first site has been explored by calorimetry whereas the binding at a single site with affinity of the order of 104 M- 1 has been observed from fluorescence spectroscopy. The calorimetric study in the presence of additives along with docking analysis reveals the significant role of electrostatic, hydrogen bonding, and hydrophobic interactions in the association process. The slight conformational changes in protein as well as the changes in the water network structure around the binding cavity of protein have been observed from spectroscopic and DLS measurements. The LFC induced quenching of BSA fluorescence was observed to be initiated mainly through the static quenching process and this suggests the formation of ground state LFC-BSA association complex. The stronger interactions of LFC in the cavity of Sudlow site I (subdomain IIA) of protein have been explored from site marker calorimetric and molecular docking study.

  18. Insight into microtubule destabilization mechanism of 3,4,5-trimethoxyphenyl indanone derivatives using molecular dynamics simulation and conformational modes analysis

    NASA Astrophysics Data System (ADS)

    Tripathi, Shubhandra; Srivastava, Gaurava; Singh, Aastha; Prakasham, A. P.; Negi, Arvind S.; Sharma, Ashok

    2018-03-01

    Colchicine site inhibitors are microtubule destabilizers having promising role in cancer therapeutics. In the current study, four such indanone derivatives (t1, t9, t14 and t17) with 3,4,5-trimethoxyphenyl fragment (ring A) and showing significant microtubule destabilization property have been explored. The interaction mechanism and conformational modes triggered by binding of these indanone derivatives and combretastatin at colchicine binding site (CBS) of αβ-tubulin dimer were studied using molecular dynamics (MD) simulation, principle component analysis and free energy landscape analysis. In the MD results, t1 showed binding similar to colchicine interacting in the deep hydrophobic core at the CBS. While t9, t14 and t17 showed binding conformation similar to combretastatin, with ring A superficially binding at the CBS. Results demonstrated that ring A played a vital role in binding via hydrophobic interactions and got anchored between the S8 and S9 sheets, H8 helix and T7 loop at the CBS. Conformational modes study revealed that twisting and bending conformational motions (as found in the apo system) were nearly absent in the ligand bound systems. Absence of twisting motion might causes loss of lateral contacts in microtubule, thus promoting microtubule destabilization. This study provides detailed account of microtubule destabilization mechanism by indanone ligands and combretastatin, and would be helpful for designing microtubule destabilizers with higher activity.

  19. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  20. Crystallographic Analysis Reveals a Novel Second Binding Site for Trimethoprim in Active Site Double Mutants of Human Dihydrofolate Reductase†,‡

    PubMed Central

    Cody, Vivian; Pace, Jim; Piraino, Jennifer; Queener, Sherry F.

    2011-01-01

    In order to produce a more potent replacement for trimethoprim (TMP) used as a therapy for Pneumocystis pneumonia and targets dihydrofolate reductase from Pneumocystis jirovecii (pjDHFR), it is necessary to understand the determinants of potency and selectivity against DHFR from the mammalian host and fungal pathogen cells. To this end, active site residues in human (h)DHFR were replaced with those from pjDHFR. Structural data are reported for two complexes of TMP with the double mutants Gln35Ser/Asn64Phe (Q35S/N64F) and Gln35Lys/Asn64Phe (Q35K/N64F) of hDHFR that unexpectedly show evidence for the binding of two molecules of TMP: one molecule that binds in the normal folate binding site and the second molecule that binds in a novel subpocket site such that the mutated residue Phe64 is involved in van der Waals contacts to the trimethoxyphenyl ring of the second TMP molecule. Kinetic data for the binding of TMP to hDHFR and pjDHFR reveal an 84-fold selectivity of TMP against pjDHFR (Ki 49 nM) compared to hDHFR (Ki 4093 nM). Two mutants that contain one substitution from pj- and one from the closely related Pneumocystis carinii DHFR (pcDHFR) (Q35K/N64F and Q35S/N64F) show Ki values of 593 and 617 nM, respectively; these Ki values are well above both the Ki for pjDHFR and are similar to pcDHFR (Q35K/N64F) and Q35S/N64F) (305 nM). These results suggest that active site residues 35 and 64 play key roles in determining selectivity for pneumocystis DHFR, but that other residues contribute to the unique binding of inhibitors to these enzymes. PMID:21684339

  1. Host-Primed Ebola Virus GP Exposes a Hydrophobic NPC1 Receptor-Binding Pocket, Revealing a Target for Broadly Neutralizing Antibodies.

    PubMed

    Bornholdt, Zachary A; Ndungo, Esther; Fusco, Marnie L; Bale, Shridhar; Flyak, Andrew I; Crowe, James E; Chandran, Kartik; Saphire, Erica Ollmann

    2016-02-23

    The filovirus surface glycoprotein (GP) mediates viral entry into host cells. Following viral internalization into endosomes, GP is cleaved by host cysteine proteases to expose a receptor-binding site (RBS) that is otherwise hidden from immune surveillance. Here, we present the crystal structure of proteolytically cleaved Ebola virus GP to a resolution of 3.3 Å. We use this structure in conjunction with functional analysis of a large panel of pseudotyped viruses bearing mutant GP proteins to map the Ebola virus GP endosomal RBS at molecular resolution. Our studies indicate that binding of GP to its endosomal receptor Niemann-Pick C1 occurs in two distinct stages: the initial electrostatic interactions are followed by specific interactions with a hydrophobic trough that is exposed on the endosomally cleaved GP1 subunit. Finally, we demonstrate that monoclonal antibodies targeting the filovirus RBS neutralize all known filovirus GPs, making this conserved pocket a promising target for the development of panfilovirus therapeutics. Ebola virus uses its glycoprotein (GP) to enter new host cells. During entry, GP must be cleaved by human enzymes in order for receptor binding to occur. Here, we provide the crystal structure of the cleaved form of Ebola virus GP. We demonstrate that cleavage exposes a site at the top of GP and that this site binds the critical domain C of the receptor, termed Niemann-Pick C1 (NPC1). We perform mutagenesis to find parts of the site essential for binding NPC1 and map distinct roles for an upper, charged crest and lower, hydrophobic trough in cleaved GP. We find that this 3-dimensional site is conserved across the filovirus family and that antibody directed against this site is able to bind cleaved GP from every filovirus tested and neutralize viruses bearing those GPs. Copyright © 2016 Bornholdt et al.

  2. Structural changes at the metal ion binding site during the phosphoglucomutase reaction.

    PubMed

    Ray, W J; Post, C B; Liu, Y; Rhyu, G I

    1993-01-12

    An electron density map of the reactive, Cd2+ form of crystalline phosphoglucomutase from X-ray diffraction studies shows that the enzymic phosphate donates a nonbridging oxygen to the ligand sphere of the bound metal ion, which appears to be tetracoordinate. 31P and 113Cd NMR spectroscopy are used to assess changes in the properties of bound Cd2+ produced by substrate/product and by substrate/product analog inhibitors. The approximately 50 ppm downfield shift of the 113Cd resonance on formation of the complex of dephosphoenzyme and glucose 1,6-bisphosphate is associated with the initial sugar-phosphate binding step and likely involves a change in the geometry of the coordinating ligands. This interpretation is supported by spectral studies involving various complexes of the active Co2+ and Ni(2+)-enzyme. In addition, there is a loss of the 31P-113Cd J coupling that characterizes the monophosphate complexes of the Cd2+ enzyme either during or immediately after the PO3- transfer step that produces the bisphosphate complex, indicating a further change at the metal binding site. The implications of these observations with respect to the PO3- transfer process in the phosphoglucomutase reaction are considered. The apparent plasticity of the ligand sphere of the active site metal ion in this system may allow a single metal ion to act as a chaperone for a nonbridging oxygen during PO3- transfer or to allow a change in metal ion coordination during catalysis. A general NMR line shape/chemical-exchange analysis for evaluating binding in protein-ligand systems when exchange is intermediate to fast on the NMR time scale is described. Its application to the present system involves multiple exchange sites that depend on a single binding rate, thereby adding further constraints to the analysis.

  3. How allosteric control of Staphylococcus aureus penicillin binding protein 2a enables methicillin resistance and physiological function

    PubMed Central

    Otero, Lisandro H.; Rojas-Altuve, Alzoray; Llarrull, Leticia I.; Carrasco-López, Cesar; Kumarasiri, Malika; Lastochkin, Elena; Fishovitz, Jennifer; Dawley, Matthew; Hesek, Dusan; Lee, Mijoon; Johnson, Jarrod W.; Fisher, Jed F.; Chang, Mayland; Mobashery, Shahriar; Hermoso, Juan A.

    2013-01-01

    The expression of penicillin binding protein 2a (PBP2a) is the basis for the broad clinical resistance to the β-lactam antibiotics by methicillin-resistant Staphylococcus aureus (MRSA). The high-molecular mass penicillin binding proteins of bacteria catalyze in separate domains the transglycosylase and transpeptidase activities required for the biosynthesis of the peptidoglycan polymer that comprises the bacterial cell wall. In bacteria susceptible to β-lactam antibiotics, the transpeptidase activity of their penicillin binding proteins (PBPs) is lost as a result of irreversible acylation of an active site serine by the β-lactam antibiotics. In contrast, the PBP2a of MRSA is resistant to β-lactam acylation and successfully catalyzes the dd-transpeptidation reaction necessary to complete the cell wall. The inability to contain MRSA infection with β-lactam antibiotics is a continuing public health concern. We report herein the identification of an allosteric binding domain—a remarkable 60 Å distant from the dd-transpeptidase active site—discovered by crystallographic analysis of a soluble construct of PBP2a. When this allosteric site is occupied, a multiresidue conformational change culminates in the opening of the active site to permit substrate entry. This same crystallographic analysis also reveals the identity of three allosteric ligands: muramic acid (a saccharide component of the peptidoglycan), the cell wall peptidoglycan, and ceftaroline, a recently approved anti-MRSA β-lactam antibiotic. The ability of an anti-MRSA β-lactam antibiotic to stimulate allosteric opening of the active site, thus predisposing PBP2a to inactivation by a second β-lactam molecule, opens an unprecedented realm for β-lactam antibiotic structure-based design. PMID:24085846

  4. Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.

    2015-02-01

    The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less

  5. Autoradiographic analysis of binding sites for sup 125 I-Bolton-Hunter-substance P in the human eye

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kieselbach, G.F.; Ragaut, R.; Knaus, H.G.

    1990-07-01

    Substance P is known to exert potent effects in peripheral tissues, and is thought to be important for ocular function. The mechanism of action of substance P in the human eye is not known. As a basis for biochemical characterization specific binding of {sup 125}I-Bolton-Hunter-substance P was demonstrated in the human eye using autoradiographic methods. Biochemical characterization on slide-mounted tissue preparations showed that binding was saturable with a KD of 0.27 +/- 0.1 nmol/l. Specific binding occurred at comparable autoradiographic densities to both human retina and choroid. Substance P and its carboxyterminal fragment, substance P(3-11), were shown to be highlymore » potent in binding competition experiments against {sup 125}I-Bolton-Hunter-substance P. Similar concentrations of substance P(1-9), neurokinin A and neurokinin B failed to significantly alter specific binding of {sup 125}I-Bolton-Hunter-substance P. The results indicate expression of high affinity substance P binding sites in human retina and choroid.« less

  6. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases.

    PubMed

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-04-12

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding.

  7. Endothelial stress induces the release of vitamin D-binding protein, a novel growth factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raymond, Marc-Andre; Desormeaux, Anik; Labelle, Andree

    2005-12-23

    Endothelial cells (EC) under stress release paracrine mediators that facilitate accumulation of vascular smooth muscle cells (VSCM) at sites of vascular injury. We found that medium conditioned by serum-starved EC increase proliferation and migration of VSCM in vitro. Fractionation of the conditioned medium followed by mass spectral analysis identified one bioactive component as vitamin D-binding protein (DBP). DBP induced both proliferation and migration of VSMC in vitro in association with increased phosphorylation of ERK 1/2. PD 98059, a biochemical inhibitor of ERK 1/2, abrogated these proliferative and migratory responses in VSMC. DBP is an important carrier for the vitamin-D sterols,more » 25-hydroxyvitamin-D, and 1{alpha},25-dihydroxyvitamin-D. Both sterols inhibited the activity of DBP on VSMC, suggesting that vitamin D binding sites are important for initiating the activities of DBP on VSMC. Release of DBP at sites of endothelial injury represents a novel pathway favoring accumulation of VSMC at sites of vascular injury.« less

  8. Novel bis-(−)-nor-meptazinol derivatives act as dual binding site AChE inhibitors with metal-complexing property

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Wei; NPFPC Key Laboratory of Contraceptives and Devices, Shanghai Institute of Planned Parenthood Research, 2140 Xietu Road, Shanghai 200032; Li, Juan

    The strategy of dual binding site acetylcholinesterase (AChE) inhibition along with metal chelation may represent a promising direction for multi-targeted interventions in the pathophysiological processes of Alzheimer's disease (AD). In the present study, two derivatives (ZLA and ZLB) of a potent dual binding site AChE inhibitor bis-(−)-nor-meptazinol (bis-MEP) were designed and synthesized by introducing metal chelating pharmacophores into the middle chain of bis-MEP. They could inhibit human AChE activity with IC{sub 50} values of 9.63 μM (for ZLA) and 8.64 μM (for ZLB), and prevent AChE-induced amyloid-β (Aβ) aggregation with IC{sub 50} values of 49.1 μM (for ZLA) and 55.3more » μM (for ZLB). In parallel, molecular docking analysis showed that they are capable of interacting with both the catalytic and peripheral anionic sites of AChE. Furthermore, they exhibited abilities to complex metal ions such as Cu(II) and Zn(II), and inhibit Aβ aggregation triggered by these metals. Collectively, these results suggest that ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency, and may be potential leads of value for further study on disease-modifying treatment of AD. -- Highlights: ► Two novel bis-(−)-nor-meptazinol derivatives are designed and synthesized. ► ZLA and ZLB may act as dual binding site AChEIs with metal-chelating potency. ► They are potential leads for disease-modifying treatment of Alzheimer's disease.« less

  9. sc-PDB: an annotated database of druggable binding sites from the Protein Data Bank.

    PubMed

    Kellenberger, Esther; Muller, Pascal; Schalon, Claire; Bret, Guillaume; Foata, Nicolas; Rognan, Didier

    2006-01-01

    The sc-PDB is a collection of 6 415 three-dimensional structures of binding sites found in the Protein Data Bank (PDB). Binding sites were extracted from all high-resolution crystal structures in which a complex between a protein cavity and a small-molecular-weight ligand could be identified. Importantly, ligands are considered from a pharmacological and not a structural point of view. Therefore, solvents, detergents, and most metal ions are not stored in the sc-PDB. Ligands are classified into four main categories: nucleotides (< 4-mer), peptides (< 9-mer), cofactors, and organic compounds. The corresponding binding site is formed by all protein residues (including amino acids, cofactors, and important metal ions) with at least one atom within 6.5 angstroms of any ligand atom. The database was carefully annotated by browsing several protein databases (PDB, UniProt, and GO) and storing, for every sc-PDB entry, the following features: protein name, function, source, domain and mutations, ligand name, and structure. The repository of ligands has also been archived by diversity analysis of molecular scaffolds, and several chemoinformatics descriptors were computed to better understand the chemical space covered by stored ligands. The sc-PDB may be used for several purposes: (i) screening a collection of binding sites for predicting the most likely target(s) of any ligand, (ii) analyzing the molecular similarity between different cavities, and (iii) deriving rules that describe the relationship between ligand pharmacophoric points and active-site properties. The database is periodically updated and accessible on the web at http://bioinfo-pharma.u-strasbg.fr/scPDB/.

  10. Searching for protein binding sites from Molecular Dynamics simulations and paramagnetic fragment-based NMR studies.

    PubMed

    Bernini, Andrea; Henrici De Angelis, Lucia; Morandi, Edoardo; Spiga, Ottavia; Santucci, Annalisa; Assfalg, Michael; Molinari, Henriette; Pillozzi, Serena; Arcangeli, Annarosa; Niccolai, Neri

    2014-03-01

    Hotspot delineation on protein surfaces represents a fundamental step for targeting protein-protein interfaces. Disruptors of protein-protein interactions can be designed provided that the sterical features of binding pockets, including the transient ones, can be defined. Molecular Dynamics, MD, simulations have been used as a reliable framework for identifying transient pocket openings on the protein surface. Accessible surface area and intramolecular H-bond involvement of protein backbone amides are proposed as descriptors for characterizing binding pocket occurrence and evolution along MD trajectories. TEMPOL induced paramagnetic perturbations on (1)H-(15)N HSQC signals of protein backbone amides have been analyzed as a fragment-based search for surface hotspots, in order to validate MD predicted pockets. This procedure has been applied to CXCL12, a small chemokine responsible for tumor progression and proliferation. From combined analysis of MD data and paramagnetic profiles, two CXCL12 sites suitable for the binding of small molecules were identified. One of these sites is the already well characterized CXCL12 region involved in the binding to CXCR4 receptor. The other one is a transient pocket predicted by Molecular Dynamics simulations, which could not be observed from static analysis of CXCL12 PDB structures. The present results indicate how TEMPOL, instrumental in identifying this transient pocket, can be a powerful tool to delineate minor conformations which can be highly relevant in dynamic discovery of antitumoral drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Thermodynamic Linkage Between Calmodulin Domains Binding Calcium and Contiguous Sites in the C-Terminal Tail of CaV1.2

    PubMed Central

    Evans, T. Idil Apak; Hell, Johannes; Shea, Madeline A.

    2011-01-01

    Calmodulin (CaM) binding to the intracellular C-terminal tail (CTT) of the cardiac L-type Ca2+ channel (CaV1.2) regulates Ca2+ entry by recognizing sites that contribute to negative feedback mechanisms for channel closing. CaM associates with CaV1.2 under low resting [Ca2+], but is poised to change conformation and position when intracellular [Ca2+] rises. CaM binding Ca2+, and the domains of CaM binding the CTT are linked thermodynamic functions. To better understand regulation, we determined the energetics of CaM domains binding to peptides representing pre-IQ sites A1588, and C1614 and the IQ motif studied as overlapping peptides IQ1644 and IQ′1650 as well as their effect on calcium binding. (Ca2+)4-CaM bound to all four peptides very favorably (Kd ≤ 2 nM). Linkage analysis showed that IQ1644–1670 bound with a Kd ~1 pM. In the pre-IQ region, (Ca2+)2-N-domain bound preferentially to A1588, while (Ca2+)2-C-domain preferred C1614. When bound to C1614, calcium binding in the N-domain affected the tertiary conformation of the C-domain. Based on the thermodynamics, we propose a structural mechanism for calcium-dependent conformational change in which the linker between CTT sites A and C buckles to form an A-C hairpin that is bridged by calcium-saturated CaM. PMID:21757287

  12. Magnesium-adenosine diphosphate binding sites in wild-type creatine kinase and in mutants: role of aromatic residues probed by Raman and infrared spectroscopies.

    PubMed

    Hagemann, H; Marcillat, O; Buchet, R; Vial, C

    2000-08-08

    Two distinct methods were used to investigate the role of Trp residues during Mg-ADP binding to cytosolic creatine kinase (CK) from rabbit muscle: (1) Raman spectroscopy, which is very sensitive to the environment of aromatic side-chain residues, and (2) reaction-induced infrared difference spectroscopy (RIDS) and photolabile substrate (ADP[Et(PhNO(2))]), combined with site-directed mutagenesis on the four Trp residues of CK. Our Raman results indicated that the environment of Trp and of Tyr were not affected during Mg-ADP binding to CK. Analysis of RIDS of wild-type CK, inactive W227Y, and active W210,217,272Y mutants suggested that Trp227 was not involved in the stacking interactions. Results are consistent with Trp227 being essential to prevent water molecules from entering in the active site [as suggested by Gross, M., Furter-Graves, E. M., Wallimann, T., Eppenberger, H. M., and Furter, R. (1994) Protein Sci. 3, 1058-1068] and that another Trp could in addition help to steer the nucleotide in the binding site, although it is not essential for the activity of CK. Raman and infrared spectra indicated that Mg-ADP binding does not involve large secondary structure changes. Only 3-4 residues absorbing in the amide I region are directly implicated in the Mg-ADP binding (corresponding to secondary structure changes less than 1%), suggesting that movement of protein domains due to Mg-nucleotide binding do not promote large secondary structure changes.

  13. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  14. A comparative analysis on the binding characteristics of various mammalian albumins towards a multitherapeutic agent, pinostrobin

    PubMed Central

    FEROZ, Shevin R.; SUMI, Rumana A.; MALEK, Sri N.A.; TAYYAB, Saad

    2014-01-01

    The interaction of pinostrobin (PS), a multitherapeutic agent with serum albumins of various mammalian species namely, goat, bovine, human, porcine, rabbit, sheep and dog was investigated using fluorescence quench titration and competitive drug displacement experiments. Analysis of the intrinsic fluorescence quenching data revealed values of the association constant, Ka in the range of 1.49 – 6.12 × 104 M−1, with 1:1 binding stoichiometry. Based on the PS–albumin binding characteristics, these albumins were grouped into two classes. Ligand displacement studies using warfarin as the site I marker ligand correlated well with the binding data. Albumins from goat and bovine were found to be closely similar to human albumin on the basis of PS binding characteristics. PMID:25519455

  15. Kinetic analysis of cooperative interactions induced by Mn2+ binding to the chloroplast H(+)-ATPase.

    PubMed

    Hiller, R; Carmeli, C

    1990-07-03

    The kinetics of Mn2+ binding to three cooperatively interacting sites in chloroplast H(+)-ATPase (CF1) were measured by EPR following rapid mixing of the enzyme with MnCl2 with a time resolution of 8 ms. Mixing of the enzyme-bound Mn2+ with MgCl2 gave a measure of the rate of exchange. The data could be best fitted to a kinetic model assuming three sequential, positively cooperative binding sites. (1) In the latent CF1, the binding to all three sites had a similar on-rate constants of (1.1 +/- 0.04) X 10(4) M-1s-1. (2) Site segregation was found in the release of ions with off-rate constants of 0.69 +/- 0.04 s-1 for the first two and 0.055 +/- 0.003 s-1 for the third. (3) Addition of one ADP per CF1 caused a decrease in the off-rate constants to 0.31 +/- 0.02 and 0.033 +/- 0.008 s-1 for the first two and the third sites, respectively. (4) Heat activation of CF1 increased the on-rate constant to (4.2 +/- 0.92) X 10(4) M-1s-1 and the off-rate constants of the first two and the third site to 1.34 +/- 0.08 and 0.16 +/- 0.07 s-1, respectively. (5) The calculated thermodynamic dissociation constants were similar to those previously obtained from equilibrium binding studies. These findings were correlated to the rate constants obtained from studies of the catalysis and regulation of the H(+)-ATPase. The data support the suggestion that regulation induces sequential progress of catalysis through the three active sites of the enzyme.

  16. Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

    PubMed Central

    Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

    2016-01-01

    Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114

  17. A Systematic Analysis of Factors Localized to Damaged Chromatin Reveals PARP-Dependent Recruitment of Transcription Factors.

    PubMed

    Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J

    2015-06-09

    Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Dynamics of TBP binding to the TATA box

    NASA Astrophysics Data System (ADS)

    Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

    2008-02-01

    Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

  19. Molecular insights into the mechanism of thermal stability of actinomycete mannanase.

    PubMed

    Kumagai, Yuya; Uraji, Misugi; Wan, Kun; Okuyama, Masayuki; Kimura, Atsuo; Hatanaka, Tadashi

    2016-09-01

    Streptomyces thermolilacinus mannanase (StMan), which requires Ca(2+) for its enhanced thermal stability and hydrolysis activity, possesses two Ca(2+) -binding sites in loop6 and loop7. We evaluated the function of the Ca(2+) -binding site in loop7 and the hydrogen bond between residues Ser247 in loop6 and Asp279 in loop7. The Ca(2+) -binding in loop7 was involved only in thermal stability. Mutations of Ser247 or Asp279 retained the Ca(2+) -binding ability; however, mutants showed less thermal stability than StMan. Phylogenetic analysis indicated that most glycoside hydrolase family 5 subfamily 8 mannanases could be stabilized by Ca(2+) ; however, the mechanism of StMan thermal stability was found to be quite specific in some actinomycete mannanases. © 2016 Federation of European Biochemical Societies.

  20. An A257V Mutation in the Bacillus subtilis Response Regulator Spo0A Prevents Regulated Expression of Promoters with Low-Consensus Binding Sites▿

    PubMed Central

    Seredick, Steve D.; Seredick, Barbara M.; Baker, David; Spiegelman, George B.

    2009-01-01

    In Bacillus species, the master regulator of sporulation is Spo0A. Spo0A functions by both activating and repressing transcription initiation from target promoters that contain 0A boxes, the binding sites for Spo0A. Several classes of spo0A mutants have been isolated, and the molecular basis for their phenotypes has been determined. However, the molecular basis of the Spo0A(A257V) substitution, representative of an unusual phenotypic class, is not understood. Spo0A(A257V) is unusual in that it abolishes sporulation; in vivo, it fails to activate transcription from key stage II promoters yet retains the ability to repress the abrB promoter. To determine how Spo0A(A257V) retains the ability to repress but not stimulate transcription, we performed a series of in vitro and in vivo assays. We found unexpectedly that the mutant protein both stimulated transcription from the spoIIG promoter and repressed transcription from the abrB promoter, albeit twofold less than the wild type. A DNA binding analysis of Spo0A(A257V) showed that the mutant protein was less able to tolerate alterations in the sequence and arrangement of its DNA binding sites than the wild-type protein. In addition, we found that Spo0A(A257V) could stimulate transcription of a mutant spoIIG promoter in vivo in which low-consensus binding sites were replaced by high-consensus binding sites. We conclude that Spo0A(A257V) is able to bind to and regulate the expression of only genes whose promoters contain high-consensus binding sites and that this effect is sufficient to explain the observed sporulation defect. PMID:19581368

  1. Binding of vitamin A with milk α- and β-caseins.

    PubMed

    Bourassa, P; N'soukpoé-Kossi, C N; Tajmir-Riahi, H A

    2013-05-01

    The binding sites of retinol and retinoic acid with milk α- and β-caseins were determined, using constant protein concentration and various retinoid contents. FTIR, UV-visible and fluorescence spectroscopic methods as well as molecular modelling were used to analyse retinol and retinoic acid binding sites, the binding constant and the effect of retinoid complexation on the stability and conformation of caseins. Structural analysis showed that retinoids bind caseins via both hydrophilic and hydrophobic contacts with overall binding constants of K(retinol-)(α)(-caseins)=1.21 (±0.4)×10(5) M(-1) and K(retinol-)(β)(-caseins)=1.11 (±0.5)×10(5) M(-1) and K(retinoic acid-)(α)(-caseins)=6.2 (±0.6)×10(4) M(-1) and K(retinoic acid-)(β)(-caseins)=6.3 (±0.6)×10(4) M(-1). The number of bound retinol molecules per protein (n) was 1.5 (±0.1) for α-casein and 1.0 (±0.1) for β-casein, while 1 molecule of retinoic acid was bound in the α- and β-casein complexes. Molecular modelling showed different binding sites for retinol and retinoic acid on α- and β-caseins with more stable complexes formed with α-casein. Retinoid-casein complexation induced minor alterations of protein conformation. Caseins might act as carriers for transportation of retinoids to target molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Kinetics of phloretin binding to phosphatidylcholine vesicle membranes

    PubMed Central

    1980-01-01

    The submillisecond kinetics for phloretin binding to unilamellar phosphatidylcholine (PC) vesicles was investigated using the temperature-jump technique. Spectrophotometric studies of the equilibrium binding performed at 328 nm demonstrated that phloretin binds to a single set of independent, equivalent sites on the vesicle with a dissociation constant of 8.0 microM and a lipid/site ratio of 4.0. The temperature of the phloretin-vesicle solution was jumped by 4 degrees C within 4 microseconds producing a monoexponential, concentration-dependent relaxation process with time constants in the 30--200-microseconds time range. An analysis of the concentration dependence of relaxation time constants at pH 7.30 and 24 degrees C yielded a binding rate constant of 2.7 X 10(8) M-1 s-1 and an unbinding constant of 2,900 s-1; approximately 66 percent of total binding sites are exposed at the outer vesicle surface. The value of the binding rate constant and three additional observations suggest that the binding kinetics are diffusion limited. The phloretin analogue, naringenin, which has a diffusion coefficient similar to phloretin yet a dissociation constant equal to 24 microM, bound to PC vesicle with the same rate constant as phloretin did. In addition, the phloretin-PC system was studied in buffers made one to six times more viscous than water by addition of sucrose or glycerol to the differ. The equilibrium affinity for phloretin binding to PC vesicles is independent of viscosity, yet the binding rate constant decreases with the expected dependence (kappa binding alpha 1/viscosity) for diffusion-limited processes. Thus, the binding rate constant is not altered by differences in binding affinity, yet depends upon the diffusion coefficient in buffer. Finally, studies of the pH dependence of the binding rate constant showed a dependence (kappa binding alpha [1 + 10pH-pK]) consistent with the diffusion-limited binding of a weak acid. PMID:7391812

  3. Identification of Human Lineage-Specific Transcriptional Coregulators Enabled by a Glossary of Binding Modules and Tunable Genomic Backgrounds.

    PubMed

    Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L

    2017-09-27

    Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Benzodiazepines: rat pinealocyte binding sites and augmentation of norepinephrine-stimulated N-acetyltransferase activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matthew, E.; Parfitt, A.G.; Sugden, D.

    1984-02-01

    Studies of (/sup 3/H)diazepam binding to intact rat pineal cells were carried out in tissue culture preparations. The binding was saturable, reversible and proportional to the number of cells used. Scatchard analysis resulted in a linear plot (Kd . 23 nM, maximum binding sites (Bmax) . 1.56 pmol/mg of protein for cells in monolayer culture; Kd . 7 nM, Bmax . 1.3 pmol/mg of protein for cells in suspension culture). Inhibition constants (Ki) for clonazepam (500 nM), flunitrazepam (38 nM) and Ro-5-4864 (5 nM) indicated that the binding sites were probably of the ''peripheral'' type. In addition, the effects ofmore » diazepam on norepinephrine-stimulated N-acetyltransferase (NAT) activity were studied in organ culture and dissociated cell culture. Diazepam (10-50 microM) both prolonged and increased the magnitude of the norepinephrine-induced increase in NAT activity but did not affect the initial rate of rise of enzyme activity. The effect was dose-dependent and was also seen with clonazepam, flunitrazepam and Ro-5-4864, but not with Ro-15-1788. Diazepam, by itself, at these concentrations, had no effect on NAT, but enzyme activity was increased by higher concentrations (0.1-1 mM). Although a relationship between the (/sup 3/H)diazepam binding sites described here and the effect of benzodiazepines on NAT cannot be established from these studies, the data suggest that the benzodiazepines may alter melatonin levels through their action on NAT.« less

  5. Structures of Receptor Complexes of a North American H7N2 Influenza Hemagglutinin with a Loop Deletion in the Receptor Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Hua; Chen, Li-Mei; Carney, Paul J.

    2012-02-21

    Human infections with subtype H7 avian influenza viruses have been reported as early as 1979. In 1996, a genetically stable 24-nucleotide deletion emerged in North American H7 influenza virus hemagglutinins, resulting in an eight amino acid deletion in the receptor-binding site. The continuous circulation of these viruses in live bird markets, as well as its documented ability to infect humans, raises the question of how these viruses achieve structural stability and functionality. Here we report a detailed molecular analysis of the receptor binding site of the North American lineage subtype H7N2 virus A/New York/107/2003 (NY107), including complexes with an avianmore » receptor analog (3'-sialyl-N-acetyllactosamine, 3'SLN) and two human receptor analogs (6'-sialyl-N-acetyllactosamine, 6'SLN; sialyllacto-N-tetraose b, LSTb). Structural results suggest a novel mechanism by which residues Arg220 and Arg229 (H3 numbering) are used to compensate for the deletion of the 220-loop and form interactions with the receptor analogs. Glycan microarray results reveal that NY107 maintains an avian-type ({alpha}2-3) receptor binding profile, with only moderate binding to human-type ({alpha}2-6) receptor. Thus despite its dramatically altered receptor binding site, this HA maintains functionality and confirms a need for continued influenza virus surveillance of avian and other animal reservoirs to define their zoonotic potential.« less

  6. Iron depletion strategy for targeted cancer therapy: utilizing the dual roles of neutrophil gelatinase-associated lipocalin protein.

    PubMed

    Tang, Hsin-Chieh; Chang, Pei-Chun; Chen, Yu-Chian

    2016-01-01

    Decreasing iron uptake and increasing iron efflux may result in cell death by oxidative inactivation of vital enzymes. Applying the dual function of neutrophil gelatinase-associated lipocalin (NGAL) could achieve the goal of iron depletion in the cancer cells. Tyr106, Lys125 or Lys134 was the key binding site for NGAL protein to sequester iron-chelating siderophores. In this study, we employed all bioactive peptides in peptide databank to dock with the siderophore-binding sites of NGAL protein by virtual screening. In addition, we performed molecular dynamics (MD) simulation to observe the molecular character and structural variation of ligand-protein interaction. Glu-Glu-Lys-Glu (EEKE), Glu-Glu-Asp-Cys-Lys (EEDCK), and Gly-Glu-Glu-Cys-Asp (GEECD) were selected preliminarily by rigorous scoring functions for further investigation. GEECD was excluded due to higher binding total energy than the others. Moreover, we also excluded EEKE due to larger influence to the stability of binding residues by the information of root mean square fluctuation (RMSF) and principal component analysis (PCA). Thus, we suggested that EEDCK was the potential bioactive peptide which had been proved to inhibit malignant cells for targeted cancer therapy. Graphical Abstract Perspective drug design of occupying the siderophore-binding sites of NGAL outside the cell temporarily by a potential short peptide until NGAL enters into the cell, and releasing the siderophore-binding sites inside the cell.

  7. Photoaffinity labeling of the TF1-ATPase from the thermophilic bacterium PS3 with 3'-O-(4-benzoyl)benzoyl ADP.

    PubMed

    Bar-Zvi, D; Yoshida, M; Shavit, N

    1985-05-31

    3'-O-(4-Benzoyl)benzoyl ADP (BzADP) was used as a photoaffinity label for covalent binding of adenine nucleotide analogs to the nucleotide binding site(s) of the thermophilic bacterium PS3 ATPase (TF1). As with the CF1-ATPase (Bar-Zvi, D. and Shavit, N. (1984) Biochim. Biophys. Acta 765, 340-356) noncovalently bound BzADP is a reversible inhibitor of the TF1-ATPase. BzADP changes the kinetics of ATP hydrolysis from noncooperative to cooperative in the same way as ADP does, but, in contrast to the effect on the CF1-ATPase, it has no effect on the Vmax. In the absence of Mg2+ 1 mol BzADP binds noncovalently to TF1, while with Mg2+ 3 mol are bound. Photoactivation of BzADP results in the covalent binding of the analog to the nucleotide binding site(s) on TF1 and correlates with the inactivation of the ATPase. Complete inactivation of the TF1-ATPase occurs after covalent binding of 2 mol BzADP/mol TF1. Photoinactivation of TF1 by BzADP is prevented if excess of either ADP or ATP is present during irradiation. Analysis by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate of the Bz[3H]ADP-labeled TF1-ATPase shows that all the radioactivity is incorporated into the beta subunit.

  8. Identifying potential selective fluorescent probes for cancer-associated protein carbonic anhydrase IX using a computational approach.

    PubMed

    Kamstra, Rhiannon L; Floriano, Wely B

    2014-11-01

    Carbonic anhydrase IX (CAIX) is a biomarker for tumor hypoxia. Fluorescent inhibitors of CAIX have been used to study hypoxic tumor cell lines. However, these inhibitor-based fluorescent probes may have a therapeutic effect that is not appropriate for monitoring treatment efficacy. In the search for novel fluorescent probes that are not based on known inhibitors, a database of 20,860 fluorescent compounds was virtually screened against CAIX using hierarchical virtual ligand screening (HierVLS). The screening database contained 14,862 compounds tagged with the ATTO680 fluorophore plus an additional 5998 intrinsically fluorescent compounds. Overall ranking of compounds to identify hit molecular probe candidates utilized a principal component analysis (PCA) approach. Four potential binding sites, including the catalytic site, were identified within the structure of the protein and targeted for virtual screening. Available sequence information for 23 carbonic anhydrase isoforms was used to prioritize the four sites based on the estimated "uniqueness" of each site in CAIX relative to the other isoforms. A database of 32 known inhibitors and 478 decoy compounds was used to validate the methodology. A receiver-operating characteristic (ROC) analysis using the first principal component (PC1) as predictive score for the validation database yielded an area under the curve (AUC) of 0.92. AUC is interpreted as the probability that a binder will have a better score than a non-binder. The use of first component analysis of binding energies for multiple sites is a novel approach for hit selection. The very high prediction power for this approach increases confidence in the outcome from the fluorescent library screening. Ten of the top scoring candidates for isoform-selective putative binding sites are suggested for future testing as fluorescent molecular probe candidates. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Comprehensive insight into the binding of sunitinib, a multi-targeted anticancer drug to human serum albumin

    NASA Astrophysics Data System (ADS)

    Kabir, Md. Zahirul; Tee, Wei-Ven; Mohamad, Saharuddin B.; Alias, Zazali; Tayyab, Saad

    2017-06-01

    Binding studies between a multi-targeted anticancer drug, sunitinib (SU) and human serum albumin (HSA) were made using fluorescence, UV-vis absorption, circular dichroism (CD) and molecular docking analysis. Both fluorescence quenching data and UV-vis absorption results suggested formation of SU-HSA complex. Moderate binding affinity between SU and HSA was evident from the value of the binding constant (3.04 × 104 M-1), obtained at 298 K. Involvement of hydrophobic interactions and hydrogen bonds as the leading intermolecular forces in the formation of SU-HSA complex was predicted from the thermodynamic data of the binding reaction. These results were in good agreement with the molecular docking analysis. Microenvironmental perturbations around Tyr and Trp residues as well as secondary and tertiary structural changes in HSA upon SU binding were evident from the three-dimensional fluorescence and circular dichroism results. SU binding to HSA also improved the thermal stability of the protein. Competitive displacement results and molecular docking analysis revealed the binding locus of SU to HSA in subdomain IIA (Sudlow's site I). The influence of a few common ions on the binding constant of SU-HSA complex was also noticed.

  10. Thermodynamic Characterization of Hydration Sites from Integral Equation-Derived Free Energy Densities: Application to Protein Binding Sites and Ligand Series.

    PubMed

    Güssregen, Stefan; Matter, Hans; Hessler, Gerhard; Lionta, Evanthia; Heil, Jochen; Kast, Stefan M

    2017-07-24

    Water molecules play an essential role for mediating interactions between ligands and protein binding sites. Displacement of specific water molecules can favorably modulate the free energy of binding of protein-ligand complexes. Here, the nature of water interactions in protein binding sites is investigated by 3D RISM (three-dimensional reference interaction site model) integral equation theory to understand and exploit local thermodynamic features of water molecules by ranking their possible displacement in structure-based design. Unlike molecular dynamics-based approaches, 3D RISM theory allows for fast and noise-free calculations using the same detailed level of solute-solvent interaction description. Here we correlate molecular water entities instead of mere site density maxima with local contributions to the solvation free energy using novel algorithms. Distinct water molecules and hydration sites are investigated in multiple protein-ligand X-ray structures, namely streptavidin, factor Xa, and factor VIIa, based on 3D RISM-derived free energy density fields. Our approach allows the semiquantitative assessment of whether a given structural water molecule can potentially be targeted for replacement in structure-based design. Finally, PLS-based regression models from free energy density fields used within a 3D-QSAR approach (CARMa - comparative analysis of 3D RISM Maps) are shown to be able to extract relevant information for the interpretation of structure-activity relationship (SAR) trends, as demonstrated for a series of serine protease inhibitors.

  11. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  12. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  13. Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale

    PubMed Central

    Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li

    2015-01-01

    The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143

  14. Molecular modeling and structural analysis of nAChR variants uncovers the mechanism of resistance to snake toxins.

    PubMed

    Gunasekaran, D; Sridhar, J; Suryanarayanan, V; Manimaran, N C; Singh, Sanjeev Kumar

    2017-06-01

    Nicotinic acetylcholine receptors (nAChRs) are neuromuscular proteins responsible for muscle contraction upon binding with chemical stimulant acetylcholine (ACh). The α-neurotoxins of snake mimic the structure of ACh and attacks nAChRs, which block the flow of ACh and leads to numbness and paralysis. The toxin-binding site of alpha subunit in the nAChRs is highly conserved throughout chordate lineages with few exceptions in resistance organisms. In this study, we have analyzed the sequence and structures of toxin-binding/resistant nAChRs and their interaction stability with toxins through molecular docking and molecular dynamics simulation (MDS). We have reported the potential glycosylation residues within the toxin-binding cleft adding sugar moieties through N-linked glycosylation in resistant organisms. Residue variations at key positions alter the secondary structure of binding cleft, which might interfere with toxin binding and it could be one of the possible explanations for the resistance to snake venoms. Analysis of nAChR-α-neurotoxin complexes has confirmed the key interacting residues. In addition, drastic variation in the binding stability of Mongoose nAChR-α-Bungarotoxin (α-BTX) and human nAChR-α-BTX complexes were found at specific phase of MDS. Our findings suggest that specific mutations in the binding site of toxin are potentially preventing the formation of stable complex of receptor-toxin, which might lead to mechanism of resistance. This in silico study on the binding cleft of nAChR and the findings of interacting residues will assist in designing potential inhibitors as therapeutic targets.

  15. Generation of tumour-necrosis-factor-alpha-specific affibody molecules capable of blocking receptor binding in vitro.

    PubMed

    Jonsson, Andreas; Wållberg, Helena; Herne, Nina; Ståhl, Stefan; Frejd, Fredrik Y

    2009-08-17

    Affibody molecules specific for human TNF-alpha (tumour necrosis factor-alpha) were selected by phage-display technology from a library based on the 58-residue Protein A-derived Z domain. TNF-alpha is a proinflammatory cytokine involved in several inflammatory diseases and, to this day, four TNF-alpha-blocking protein pharmaceuticals have been approved for clinical use. The phage selection generated 18 unique cysteine-free affibody sequences of which 12 were chosen, after sequence cluster analysis, for characterization as proteins. Biosensor binding studies of the 12 Escherichia coli-produced and IMAC (immobilized-metal-ion affinity chromatography)-purified affibody molecules revealed three variants that demonstrated the strongest binding to human TNF-alpha. These three affibody molecules were subjected to kinetic binding analysis and also tested for their binding to mouse, rat and pig TNF-alpha. For ZTNF-alpha:185, subnanomolar affinity (KD=0.1-0.5 nM) for human TNF-alpha was demonstrated, as well as significant binding to TNF-alpha from the other species. Furthermore, the binding site was found to overlap with the binding site for the TNF-alpha receptor, since this interaction could be efficiently blocked by the ZTNF-alpha:185 affibody. When investigating six dimeric affibody constructs with different linker lengths, and one trimeric construct, it was found that the inhibition of the TNF-alpha binding to its receptor could be further improved by using dimers with extended linkers and/or a trimeric affibody construct. The potential implication of the results for the future design of affibody-based reagents for the diagnosis of inflammation is discussed.

  16. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  17. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  18. Denosumab mimics the natural decoy receptor osteoprotegerin by interacting with its major binding site on RANKL.

    PubMed

    Schieferdecker, Aneta; Voigt, Mareike; Riecken, Kristoffer; Braig, Friederike; Schinke, Thorsten; Loges, Sonja; Bokemeyer, Carsten; Fehse, Boris; Binder, Mascha

    2014-08-30

    Bone homeostasis critically relies on the RANKL-RANK-OPG axis which can be targeted by the fully human monoclonal antibody denosumab in conditions with increased bone resporption such as bone metastases. The binding site and therefore the molecular mechanism by which this antibody inhibits RANKL has not been characterized so far. Here, we used random peptide phage display library screenings to identify the denosumab epitope on RANKL. Alignments of phage derived peptide sequences with RANKL suggested that this antibody recognized a linear epitope between position T233 and Y241. Mutational analysis confirmed the core residues as critical for this interaction. The spatial localization of this epitope on a 3-dimensional model of RANKL showed that it overlapped with the major binding sites of OPG and RANK on RANKL. We conclude that denosumab inhibits RANKL by both functional and molecular mimicry of the natural decoy receptor OPG.

  19. Identification and grafting of a unique peptide-binding site in the Fab framework of monoclonal antibodies

    DOE PAGES

    Donaldson, Joshua M.; Zer, Cindy; Avery, Kendra N.; ...

    2013-10-07

    Capitalizing on their extraordinary specificity, monoclonal antibodies (mAbs) have become one of the most reengineered classes of biological molecules. A major goal in many of these engineering efforts is to add new functionality to the parental mAb, including the addition of cytotoxins and imaging agents for medical applications. Herein, we present a unique peptide-binding site within the central cavity of the fragment antigen binding framework region of the chimeric, anti-epidermal growth factor receptor mAb cetuximab. We demonstrate through diffraction methods, biophysical studies, and sequence analysis that this peptide, a meditope, has moderate affinity for the Fab, is specific to cetuximabmore » (i.e., does not bind to human IgGs), and has no significant effect on antigen binding. We further demonstrate by diffraction studies and biophysical methods that the meditope binding site can be grafted onto the anti-human epidermal growth factor receptor 2 mAb trastuzumab, and that the antigen binding affinity of the grafted trastuzumab is indistinguishable from the parental mAb. Lastly, we demonstrate a bivalent meditope variant binds specifically and stably to antigen-bearing cells only in the presence of the meditope-enabled mAbs. Collectively, this finding and the subsequent characterization and engineering efforts indicate that this unique interface could serve as a noncovalent “linker” for any meditope-enabled mAb with applications in multiple mAb-based technologies including diagnostics, imaging, and therapeutic delivery.« less

  20. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  1. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  2. The transformed glucocorticoid receptor has a lower steroid-binding affinity than the nontransformed receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemoto, Takayuki; Ohara-Nemoto, Yuko; Denis, M.

    1990-02-20

    High-salt treatment of cytosolic glucocorticoid receptor (GR) preparations reduces the steroid-binding ability of the receptor and induces the conversion of the receptor from a nontransformed (non-DNA-binding) 9S form to a transformed (DNA-binding) 4S entity. Therefore, the authors decided to investigate the possible relationship between these two phenomena. The binding of ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) to the 9S form was almost saturated at a concentration of 20 nM, whereas ({sup 3}H)TA was hardly bound to the 4S form at this concentration. The 4S form was efficiently labeled at 200 nM. Scatchard analysis of the GR showed the presence of twomore » types of binding sites. In the absence of molybdate, the ratio of the lower affinity site was increased, but the total number of binding sites was not modified. The GR with the low ({sup 3}H)TA-binding affinity bound to DNA-cellulose even in its unliganded state, whereas the form with the high affinity did not. These results indicate that the transformed GR has a reduced ({sup 3}H)TA-binding affinity as compared to the nontransformed GR. The steroid-binding domain (amino acids 477-777) and the DNA- and steroid-binding domains (amino acids 415-777) of the human GR were expressed in Escherichia coli as protein A fused proteins. Taken together, these results suggest that the component(s) associating with the nontransformed GR, possibly the heat shock protein hsp 90, play(s) an important role in stabilizing the GR in a high-affinity state for steroids.« less

  3. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  4. Inhibition of tyrosinase by 4H-chromene analogs: Synthesis, kinetic studies, and computational analysis.

    PubMed

    Brasil, Edikarlos M; Canavieira, Luciana M; Cardoso, Érica T C; Silva, Edilene O; Lameira, Jerônimo; Nascimento, José L M; Eifler-Lima, Vera L; Macchi, Barbarella M; Sriram, Dharmarajan; Bernhardt, Paul V; Silva, José Rogério Araújo; Williams, Craig M; Alves, Cláudio N

    2017-11-01

    Inhibition of mushroom tyrosinase was observed with synthetic dihydropyrano[3,2-b]chromenediones. Among them, DHPC04 displayed the most potent tyrosinase inhibitory activity with a K i value of 4 μm, comparable to the reference standard inhibitor kojic acid. A kinetic study suggested that these synthetic heterocyclic compounds behave as competitive inhibitors for the L-DOPA binding site of the enzyme. Furthermore, molecular modeling provided important insight into the mechanism of binding interactions with the tyrosinase copper active site. © 2017 John Wiley & Sons A/S.

  5. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  6. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  7. Evaluation of Cu(i) binding to the E2 domain of the amyloid precursor protein - a lesson in quantification of metal binding to proteins via ligand competition.

    PubMed

    Young, Tessa R; Wedd, Anthony G; Xiao, Zhiguang

    2018-01-24

    The extracellular domain E2 of the amyloid precursor protein (APP) features a His-rich metal-binding site (denoted as the M1 site). In conjunction with surrounding basic residues, the site participates in interactions with components of the extracellular matrix including heparins, a class of negatively charged polysaccharide molecules of varying length. This work studied the chemistry of Cu(i) binding to APP E2 with the probe ligands Bcs, Bca, Fz and Fs. APP E2 forms a stable Cu(i)-mediated ternary complex with each of these anionic ligands. The complex with Bca was selected for isolation and characterization and was demonstrated, by native ESI-MS analysis, to have the stoichiometry E2 : Cu(i) : Bca = 1 : 1 : 1. Formation of these ternary complexes is specific for the APP E2 domain and requires Cu(i) coordination to the M1 site. Mutation of the M1 site was consistent with the His ligands being part of the E2 ligand set. It is likely that interactions between the negatively charged probe ligands and a positively charged patch on the surface of APP E2 are one aspect of the generation of the stable ternary complexes. Their formation prevented meaningful quantification of the affinity of Cu(i) binding to the M1 site with these probe ligands. However, the ternary complexes are disrupted by heparin, allowing reliable determination of a picomolar Cu(i) affinity for the E2/heparin complex with the Fz or Bca probe ligands. This is the first documented example of the formation of stable ternary complexes between a Cu(i) binding protein and a probe ligand. The ready disruption of the complexes by heparin identified clear 'tell-tale' signs for diagnosis of ternary complex formation and allowed a systematic review of conditions and criteria for reliable determination of affinities for metal binding via ligand competition. This study also provides new insights into a potential correlation of APP functions regulated by copper binding and heparin interaction.

  8. Structure- and Modeling-based Identification of the Adenovirus E4orf4 Binding Site in the Protein Phosphatase 2A B55α Subunit*

    PubMed Central

    Horowitz, Ben; Sharf, Rakefet; Avital-Shacham, Meirav; Pechkovsky, Antonina; Kleinberger, Tamar

    2013-01-01

    The adenovirus E4orf4 protein regulates the progression of viral infection and when expressed outside the context of the virus it induces nonclassical, cancer cell-specific apoptosis. All E4orf4 functions known to date require an interaction between E4orf4 and protein phosphatase 2A (PP2A), which is mediated through PP2A regulatory B subunits. Specifically, an interaction with the B55α subunit is required for induction of cell death by E4orf4. To gain a better insight into the E4orf4-PP2A interaction, mapping of the E4orf4 interaction site in PP2A-B55α has been undertaken. To this end we used a combination of bioinformatics analyses of PP2A-B55α and of E4orf4, which led to the prediction of E4orf4 binding sites on the surface of PP2A-B55α. Mutation analysis, immunoprecipitation, and GST pulldown assays based on the theoretical predictions revealed that the E4orf4 binding site included the α1 and α2 helices described in the B55α structure and involved at least three residues located in these helices facing each other. Loss of E4orf4 binding was accompanied by reduced contribution of the B55α mutants to E4orf4-induced cell death. The identified E4orf4 binding domain lies above the previously described substrate binding site and does not overlap it, although its location could be consistent with direct or indirect effects on substrate binding. This work assigns for the first time a functional significance to the α1,α2 helices of B55α, and we suggest that the binding site defined by these helices could also contribute to interactions between PP2A and some of its cellular regulators. PMID:23530045

  9. Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun

    Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt −85 to −11 in eBHBV1 Cp was critical formore » the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt −64 to −50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt −58 to −54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt −21 to −17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. - Highlights: • Endogenous budgerigar hepadnavirus (eBHBV) core promoters (Cps) are active in cells. • NF-Y binding site exists in the Cps of eBHBVs and all the extant avihepadnaviruses. • NF-Y binding and mediated upregulation is critical for eBHBV Cp activity.« less

  10. Role of hydrogen bonding in ligand interaction with the N-methyl-D-aspartate receptor ion channel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leeson, P.D.; Carling, R.W.; James, K.

    1990-05-01

    Displacement of (3H)MK-801 (dizocilpine, 1) binding to rat brain membranes has been used to evaluate the affinities of novel dibenzocycloalkenimines related to 1 for the ion channel binding site (also known as the phencyclidine or PCP receptor) on the N-methyl-D-aspartate (NMDA) subtype of excitory amino acid receptor. In common with many other agents having actions in the central nervous system, these compounds contain a hydrophobic aromatic moiety and a basic nitrogen atom. The conformational rigidity of these ligands provides a unique opportunity to evaluate the importance of specific geometrical properties that influence active-site recognition, in particular the role of themore » nitrogen atom in hydrogen-bonding interactions. The relative affinities (IC50s) of hydrocarbon-substituted analogues of 1 and ring homologated cyclooctenimines illustrate the importance of size-limited hydrophobic binding of both aryl rings and of the quaternary C-5 methyl group. Analysis of the binding of a series of the 10 available structurally rigid dibenzoazabicyclo(x.y.z)alkanes, by using molecular modeling techniques, uncovered a highly significant correlation between affinity and a proposed ligand-active site hydrogen bonding vector (r = 0.950, p less than 0.001). These results are used to generate a pharmacophore of the MK-801 recognition site/PCP receptor, which accounts for the binding of all of the known ligands.« less

  11. SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

    PubMed

    Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

    2018-05-22

    Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

  12. Fusicoccin-Binding Proteins in Arabidopsis thaliana (L.) Heynh. 1

    PubMed Central

    Meyer, Christiane; Feyerabend, Martin; Weiler, Elmar W.

    1989-01-01

    Using the novel radioligand, [3H]-9′-nor-fusicoccin-8′-alcohol, high affinity binding sites for fusicoccin were characterized in preparations from leaves of Arabidopsis thaliana (L.) Heynh. The binding site copartitioned with the plasmalemma marker, vanadate-sensitive K+, Mg2+-ATPase, when microsomal fractions were further purified by aqueous two-phase partitioning in polyethylene glycol-dextran phase systems and sedimented at an equilibrium density of 1.17 grams per cubic centimeter in continuous sucrose density gradients, as did the ATPase marker. The binding of [3H]-9′-nor-fusicoccin-8′-alcohol was saturable and Scatchard analysis revealed a biphasic plot with two apparent dissociation constants (KD), KD1 = 1.5 nanomolar and KD2 = 42 nanomolar, for the radioligand. Binding was optimal at pH 6, thermolabile, and was reduced by 70% when the membrane vesicles were pretreated with trypsin. The data are consistent with the presence of one or several binding proteins for fusicoccin at the plasma membrane of A. thaliana. Binding of the radioligand was unaffected by pretreatment of the sites with various alkylating and reducing agents, but was reduced by 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, diethylpyrocarbonate, chloramine T, and periodate. A number of detergents were tested to find optimum conditions for solubilization. Nonanoyl-N-methylglucamide (50 millimolar) solubilized 70% of the radioligand-binding protein complex in undissociated form. Photoaffinity labeling of membrane preparations with a tritiated azido analog of fusicoccin resulted in the labeling of a 34 ± 1 kilodalton polypeptide. Labeling of this polypeptide, presumably the fusicoccin-binding protein, was severely reduced in the presence of unlabeled fusicoccin. PMID:16666603

  13. Confirming therapeutic target of protopine using immobilized β2 -adrenoceptor coupled with site-directed molecular docking and the target-drug interaction by frontal analysis and injection amount-dependent method.

    PubMed

    Liu, Guangxin; Wang, Pei; Li, Chan; Wang, Jing; Sun, Zhenyu; Zhao, Xinfeng; Zheng, Xiaohui

    2017-07-01

    Drug-protein interaction analysis is pregnant in designing new leads during drug discovery. We prepared the stationary phase containing immobilized β 2 -adrenoceptor (β 2 -AR) by linkage of the receptor on macroporous silica gel surface through N,N'-carbonyldiimidazole method. The stationary phase was applied in identifying antiasthmatic target of protopine guided by the prediction of site-directed molecular docking. Subsequent application of immobilized β 2 -AR in exploring the binding of protopine to the receptor was realized by frontal analysis and injection amount-dependent method. The association constants of protopine to β 2 -AR by the 2 methods were (1.00 ± 0.06) × 10 5 M -1 and (1.52 ± 0.14) × 10 4 M -1 . The numbers of binding sites were (1.23 ± 0.07) × 10 -7 M and (9.09 ± 0.06) × 10 -7 M, respectively. These results indicated that β 2 -AR is the specific target for therapeutic action of protopine in vivo. The target-drug binding occurred on Ser 169 in crystal structure of the receptor. Compared with frontal analysis, injection amount-dependent method is advantageous to drug saving, improvement of sampling efficiency, and performing speed. It has grave potential in high-throughput drug-receptor interaction analysis. Copyright © 2017 John Wiley & Sons, Ltd.

  14. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  15. Distinguishing Binders from False Positives by Free Energy Calculations: Fragment Screening Against the Flap Site of HIV Protease

    PubMed Central

    2015-01-01

    Molecular docking is a powerful tool used in drug discovery and structural biology for predicting the structures of ligand–receptor complexes. However, the accuracy of docking calculations can be limited by factors such as the neglect of protein reorganization in the scoring function; as a result, ligand screening can produce a high rate of false positive hits. Although absolute binding free energy methods still have difficulty in accurately rank-ordering binders, we believe that they can be fruitfully employed to distinguish binders from nonbinders and reduce the false positive rate. Here we study a set of ligands that dock favorably to a newly discovered, potentially allosteric site on the flap of HIV-1 protease. Fragment binding to this site stabilizes a closed form of protease, which could be exploited for the design of allosteric inhibitors. Twenty-three top-ranked protein–ligand complexes from AutoDock were subject to the free energy screening using two methods, the recently developed binding energy analysis method (BEDAM) and the standard double decoupling method (DDM). Free energy calculations correctly identified most of the false positives (≥83%) and recovered all the confirmed binders. The results show a gap averaging ≥3.7 kcal/mol, separating the binders and the false positives. We present a formula that decomposes the binding free energy into contributions from the receptor conformational macrostates, which provides insights into the roles of different binding modes. Our binding free energy component analysis further suggests that improving the treatment for the desolvation penalty associated with the unfulfilled polar groups could reduce the rate of false positive hits in docking. The current study demonstrates that the combination of docking with free energy methods can be very useful for more accurate ligand screening against valuable drug targets. PMID:25189630

  16. A stepwise mechanism for the permeation of phloretin through a lipid bilayer

    PubMed Central

    1982-01-01

    The thermodynamics of interactions between phloretin and a phosphatidylcholine (PC) vesicle membrane are characterized using equilibrium spectrophotometric titration, stopped-flow, and temperature- jump techniques. Binding of phloretin to a PC vesicle membrane is diffusion limited, with an association rate constant greater than 10(8) M-1s-1, and an interfacial activation free energy of less than 2 kcal/mol. Equilibrium binding of phloretin to a vesicle membrane is characterized by a single class of high-affinity (8 micro M), noninteracting sites. Binding is enthalpy driven (delta H = -4.9 kcal/mol) at 23 degrees C. Analysis of amplitudes of kinetic processes shows that 66 +/- 3% of total phloretin binding sites are exposed at the external vesicle surface. The rate of phloretin movement between binding sites located near the external and internal interfaces is proportional to the concentration of un-ionized phloretin, with a rate constant of 5.7 X 10(4) M-1s-1 at 23 degrees C. The rate of this process is limited by a large enthalpic (9 kcal/mol) and entropic (-31 entropy units) barrier. An analysis of the concentration dependence of the rate of transmembrane movement suggests the presence of multiple intramembrane potential barriers. Permeation of phloretin through a lipid bilayer is modeled quantitatively in terms of discrete steps: binding to a membrane surface, translocation across a series of intramembrane barriers, and dissociation from the opposite membrane surface. The permeability coefficient for phloretin is calculated as 1.9 X 10(-3) cm/s on the basis of the model presented. Structure- function relationships are examined for a number of phloretin analogues. PMID:7142954

  17. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  18. Docking analysis targeted to the whole enzyme: an application to the prediction of inhibition of PTP1B by thiomorpholine and thiazolyl derivatives.

    PubMed

    Ganou, C A; Eleftheriou, P Th; Theodosis-Nobelos, P; Fesatidou, M; Geronikaki, A A; Lialiaris, T; Rekka, E A

    2018-02-01

    PTP1b is a protein tyrosine phosphatase involved in the inactivation of insulin receptor. Since inhibition of PTP1b may prolong the action of the receptor, PTP1b has become a drug target for the treatment of type II diabetes. In the present study, prediction of inhibition using docking analysis targeted specifically to the active or allosteric site was performed on 87 compounds structurally belonging to 10 different groups. Two groups, consisting of 15 thiomorpholine and 10 thiazolyl derivatives exhibiting the best prediction results, were selected for in vitro evaluation. All thiomorpholines showed inhibitory action (with IC 50 = 4-45 μΜ, Ki = 2-23 μM), while only three thiazolyl derivatives showed low inhibition (best IC 50 = 18 μΜ, Ki = 9 μΜ). However, free binding energy (E) was in accordance with the IC 50 values only for some compounds. Docking analysis targeted to the whole enzyme revealed that the compounds exhibiting IC 50 values higher than expected could bind to other peripheral sites with lower free energy, E o , than when bound to the active/allosteric site. A prediction factor, E- (Σ Eo × 0.16), which takes into account lower energy binding to peripheral sites, was proposed and was found to correlate well with the IC 50 values following an asymmetrical sigmoidal equation with r 2 = 0.9692.

  19. Differential Sox10 Genomic Occupancy in Myelinating Glia

    PubMed Central

    Lopez-Anido, Camila; Sun, Guannan; Koenning, Matthias; Srinivasan, Rajini; Hung, Holly A.; Emery, Ben; Keles, Sunduz; Svaren, John

    2015-01-01

    Myelin is formed by specialized myelinating glia: oligodendrocytes and Schwann cells in the central and peripheral nervous systems, respectively. While there are distinct developmental aspects and regulatory pathways in these two cell types, myelination in both systems requires the transcriptional activator Sox10. Sox10 interacts with cell type-specific transcription factors at some loci to induce myelin gene expression, but it is largely unknown how Sox10 transcriptional networks globally compare between oligodendrocytes and Schwann cells. We used in vivo ChIP-Seq analysis of spinal cord and peripheral nerve (sciatic nerve) to identify unique and shared Sox10 binding sites and assess their correlation with active enhancers and transcriptional profiles in oligodendrocytes and Schwann cells. Sox10 binding sites overlap with active enhancers and critical cell type-specific regulators of myelination, such as Olig2 and Myrf in oligodendrocytes, and Egr2/Krox20 in Schwann cells. Sox10 sites also associate with genes critical for myelination in both oligodendrocytes and Schwann cells, and are found within super-enhancers previously defined in brain. In Schwann cells, Sox10 sites contain binding motifs of putative partners in the Sp/Klf, Tead, and nuclear receptor protein families. Specifically, siRNA analysis of nuclear receptors Nr2f1 and Nr2f2 revealed downregulation of myelin genes Mbp and Ndrg1 in primary Schwann cells. Our analysis highlights different mechanisms that establish cell type-specific genomic occupancy of Sox10, which reflects the unique characteristics of oligodendrocyte and Schwann cell differentiation. PMID:25974668

  20. Computer-aided active-site-directed modeling of the Herpes Simplex Virus 1 and human thymidine kinase

    NASA Astrophysics Data System (ADS)

    Folkers, Gerd; Trumpp-Kallmeyer, Susanne; Gutbrod, Oliver; Krickl, Sabine; Fetzer, Jürgen; Keil, Günther M.

    1991-10-01

    Thymidine kinase (TK), which is induced by Herpes Simplex Virus 1 (HSV1), plays a key role in the antiviral activity of guanine derivatives such as aciclovir (ACV). In contrast, ACV shows only low affinity to the corresponding host cell enzyme. In order to define the differences in substrate binding of the two enzymes on molecular level, models for the three-dimensional (3-D) structures of the active sites of HSV1-TK and human TK were developed. The reconstruction of the active sites started from primary and secondary structure analysis of various kinases. The results were validated to homologous enzymes with known 3-D structures. The models predict that both enzymes consist of a central core β-sheet structure, connected by loops and α-helices very similar to the overall structure of other nucleotide binding enzymes. The phosphate binding is made up of a highly conserved glycine-rich loop at the N-terminus of the proteins and a conserved region at the C-terminus. The thymidine recognition site was found about 100 amino acids downstream from the phosphate binding loop. The differing substrate specificity of human and HSV1-TK can be explained by amino-acid substitutions in the homologous regions. To achieve a better understanding of the structure of the active site and how the thymidine kinase proteins interact with their substrates, the corresponding complexes of thymidine and dihydroxypropoxyguanine (DHPG) with HSV1 and human TK were built. For the docking of the guanine derivative, the X-ray structure of Elongation Factor Tu (EF-Tu), co-crystallized with guanosine diphosphate, was taken as reference. Fitting of thymidine into the active sites was done with respect to similar interactions found in thymidylate kinase. To complement the analysis of the 3-D structures of the two kinases and the substrate enzyme interactions, site-directed mutagenesis of the thymidine recognition site of HSV1-TK has been undertaken, changing Asp162 in the thymidine recognition site into Asn. First investigations reveal that the enzymatic activity of the mutant protein is destroyed.

  1. Structural studies on the co-chaperone Hop and its complexes with Hsp90.

    PubMed

    Onuoha, S C; Coulstock, E T; Grossmann, J G; Jackson, S E

    2008-06-13

    The tetratricopeptide repeat domain (TPR)-containing co-chaperone Hsp-organising protein (Hop) plays a critical role in mediating interactions between Heat Shock Protein (Hsp)70 and Hsp90 as part of the cellular assembly machine. It also modulates the ATPase activity of both Hsp70 and Hsp90, thus facilitating client protein transfer between the two. Despite structural work on the individual domains of Hop, no structure for the full-length protein exists, nor is it clear exactly how Hop interacts with Hsp90, although it is known that its primary binding site is the C-terminal MEEVD motif. Here, we have undertaken a biophysical analysis of the structure and binding of Hop to Hsp90 using a variety of truncation mutants of both Hop and Hsp90, in addition to mutants of Hsp90 that are thought to modulate the conformation, in particular the N-terminal dimerisation of the chaperone. The results establish that whilst the primary binding site of Hop is the C-terminal MEEVD peptide of Hsp90, binding also occurs at additional sites in the C-terminal and middle domain. In contrast, we show that another TPR-containing co-chaperone, CyP40, binds solely to the C-terminus of Hsp90. Truncation mutants of Hop were generated and used to investigate the dimerisation interface of the protein. In good agreement with recently published data, we find that the TPR2a domain that contains the Hsp90-binding site is also the primary site for dimerisation. However, our results suggest that residues within the TPR2b may play a role. Together, these data along with shape reconstruction analysis from small-angle X-ray scattering measurements are used to generate a solution structure for full-length Hop, which we show has an overall butterfly-like quaternary structure. Studies on the nucleotide dependence of Hop binding to Hsp90 establish that Hop binds to the nucleotide-free, 'open' state of Hsp90. However, the Hsp90-Hop complex is weakened by the conformational changes that occur in Hsp90 upon ATP binding. Together, the data are used to propose a detailed model of how Hop may help present the client protein to Hsp90 by aligning the bound client on Hsp70 with the middle domain of Hsp90. It is likely that Hop binds to both monomers of Hsp90 in the form of a clamp, interacting with residues in the middle domain of Hsp90, thus preventing ATP hydrolysis, possibly by the prevention of association of N-terminal and middle domains in individual Hsp90 monomers.

  2. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  3. Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

    PubMed Central

    Naz, Sadia; Ngo, Tony; Farooq, Umar

    2017-01-01

    Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099

  4. Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

    PubMed

    Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

    2017-01-01

    The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.

  5. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  6. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  7. Structure and DNA-binding of meiosis-specific protein Hop2

    NASA Astrophysics Data System (ADS)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  8. Molecular modeling and spectroscopic studies on the interaction of the chiral drug venlafaxine hydrochloride with bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Shahabadi, Nahid; Hadidi, Saba

    2014-03-01

    This study was designed to examine the interaction of racemic antidepressant drug "S,R-venlafaxine hydrochloride (VEN)" with bovine serum albumin (BSA) under physiological conditions. The mechanism of interaction was studied by spectroscopic techniques combination with molecular modeling. Stern-Volmer analysis of fluorescence quenching data shows the presence of the static quenching mechanism. The thermodynamic parameters indicated that the hydrogen bonding and weak van der Waals interactions are the predominant intermolecular forces stabilizing the complex. The number of binding sites (n) was calculated. Through the site marker competitive experiment, VEN was confirmed to be located in subdomain IIIA of BSA. The binding distance (r = 4.93 nm) between the donor BSA and acceptor VEN was obtained according to Förster's non-radiative energy transfer theory. According to UV-vis spectra and CD data binding of VEN leaded to conformational changes of BSA. Molecular docking simulations of S and R-VEN revealed that both isomers have similar interaction and the same binding sites, from this point of view S and R isomers are equal.

  9. Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

    PubMed

    Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

    2010-04-01

    The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

  10. Exploiting protein flexibility to predict the location of allosteric sites

    PubMed Central

    2012-01-01

    Background Allostery is one of the most powerful and common ways of regulation of protein activity. However, for most allosteric proteins identified to date the mechanistic details of allosteric modulation are not yet well understood. Uncovering common mechanistic patterns underlying allostery would allow not only a better academic understanding of the phenomena, but it would also streamline the design of novel therapeutic solutions. This relatively unexplored therapeutic potential and the putative advantages of allosteric drugs over classical active-site inhibitors fuel the attention allosteric-drug research is receiving at present. A first step to harness the regulatory potential and versatility of allosteric sites, in the context of drug-discovery and design, would be to detect or predict their presence and location. In this article, we describe a simple computational approach, based on the effect allosteric ligands exert on protein flexibility upon binding, to predict the existence and position of allosteric sites on a given protein structure. Results By querying the literature and a recently available database of allosteric sites, we gathered 213 allosteric proteins with structural information that we further filtered into a non-redundant set of 91 proteins. We performed normal-mode analysis and observed significant changes in protein flexibility upon allosteric-ligand binding in 70% of the cases. These results agree with the current view that allosteric mechanisms are in many cases governed by changes in protein dynamics caused by ligand binding. Furthermore, we implemented an approach that achieves 65% positive predictive value in identifying allosteric sites within the set of predicted cavities of a protein (stricter parameters set, 0.22 sensitivity), by combining the current analysis on dynamics with previous results on structural conservation of allosteric sites. We also analyzed four biological examples in detail, revealing that this simple coarse-grained methodology is able to capture the effects triggered by allosteric ligands already described in the literature. Conclusions We introduce a simple computational approach to predict the presence and position of allosteric sites in a protein based on the analysis of changes in protein normal modes upon the binding of a coarse-grained ligand at predicted cavities. Its performance has been demonstrated using a newly curated non-redundant set of 91 proteins with reported allosteric properties. The software developed in this work is available upon request from the authors. PMID:23095452

  11. Exploiting protein flexibility to predict the location of allosteric sites.

    PubMed

    Panjkovich, Alejandro; Daura, Xavier

    2012-10-25

    Allostery is one of the most powerful and common ways of regulation of protein activity. However, for most allosteric proteins identified to date the mechanistic details of allosteric modulation are not yet well understood. Uncovering common mechanistic patterns underlying allostery would allow not only a better academic understanding of the phenomena, but it would also streamline the design of novel therapeutic solutions. This relatively unexplored therapeutic potential and the putative advantages of allosteric drugs over classical active-site inhibitors fuel the attention allosteric-drug research is receiving at present. A first step to harness the regulatory potential and versatility of allosteric sites, in the context of drug-discovery and design, would be to detect or predict their presence and location. In this article, we describe a simple computational approach, based on the effect allosteric ligands exert on protein flexibility upon binding, to predict the existence and position of allosteric sites on a given protein structure. By querying the literature and a recently available database of allosteric sites, we gathered 213 allosteric proteins with structural information that we further filtered into a non-redundant set of 91 proteins. We performed normal-mode analysis and observed significant changes in protein flexibility upon allosteric-ligand binding in 70% of the cases. These results agree with the current view that allosteric mechanisms are in many cases governed by changes in protein dynamics caused by ligand binding. Furthermore, we implemented an approach that achieves 65% positive predictive value in identifying allosteric sites within the set of predicted cavities of a protein (stricter parameters set, 0.22 sensitivity), by combining the current analysis on dynamics with previous results on structural conservation of allosteric sites. We also analyzed four biological examples in detail, revealing that this simple coarse-grained methodology is able to capture the effects triggered by allosteric ligands already described in the literature. We introduce a simple computational approach to predict the presence and position of allosteric sites in a protein based on the analysis of changes in protein normal modes upon the binding of a coarse-grained ligand at predicted cavities. Its performance has been demonstrated using a newly curated non-redundant set of 91 proteins with reported allosteric properties. The software developed in this work is available upon request from the authors.

  12. iCLIP: Protein–RNA interactions at nucleotide resolution

    PubMed Central

    Huppertz, Ina; Attig, Jan; D’Ambrogio, Andrea; Easton, Laura E.; Sibley, Christopher R.; Sugimoto, Yoichiro; Tajnik, Mojca; König, Julian; Ule, Jernej

    2014-01-01

    RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein–RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA circularization step that enables analysis of cDNAs that truncated at the protein–RNA crosslink sites. Here, we describe the improved iCLIP protocol and discuss critical optimization and control experiments that are required when applying the method to new RBPs. PMID:24184352

  13. Mechanistic and conformational studies on the interaction of food dye amaranth with human serum albumin by multispectroscopic methods.

    PubMed

    Zhang, Guowen; Ma, Yadi

    2013-01-15

    The mechanism of interaction between food dye amaranth and human serum albumin (HSA) in physiological buffer (pH 7.4) was investigated by fluorescence, UV-vis absorption, circular dichroism (CD), and Fourier transform infrared (FT-IR) spectroscopy. Results obtained from analysis of fluorescence spectra indicated that amaranth had a strong ability to quench the intrinsic fluorescence of HSA through a static quenching procedure. The negative value of enthalpy change and positive value of entropy change elucidated that the binding of amaranth to HSA was driven mainly by hydrophobic and hydrogen bonding interactions. The surface hydrophobicity of HSA increased after binding with amaranth. The binding distance between HSA and amaranth was estimated to be 3.03 nm and subdomain IIA (Sudlow site I) was the primary binding site for amaranth on HSA. The results of CD and FT-IR spectra showed that binding of amaranth to HSA induced conformational changes of HSA. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Structures of human thymidylate synthase R163K with dUMP, FdUMP and glutathione show asymmetric ligand binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gibson, Lydia M.; Celeste, Lesa R.; Lovelace, Leslie L.

    Thymidylate synthase (TS) is a well validated target in cancer chemotherapy. Here, a new crystal form of the R163K variant of human TS (hTS) with five subunits per asymmetric part of the unit cell, all with loop 181-197 in the active conformation, is reported. This form allows binding studies by soaking crystals in artificial mother liquors containing ligands that bind in the active site. Using this approach, crystal structures of hTS complexes with FdUMP and dUMP were obtained, indicating that this form should facilitate high-throughput analysis of hTS complexes with drug candidates. Crystal soaking experiments using oxidized glutathione revealed thatmore » hTS binds this ligand. Interestingly, the two types of binding observed are both asymmetric. In one subunit of the physiological dimer covalent modification of the catalytic nucleophile Cys195 takes place, while in another dimer a noncovalent adduct with reduced glutathione is formed in one of the active sites.« less

  15. Methyl Transfer by Substrate Signaling from a Knotted Protein Fold

    PubMed Central

    Christian, Thomas; Sakaguchi, Reiko; Perlinska, Agata P.; Lahoud, Georges; Ito, Takuhiro; Taylor, Erika A.; Yokoyama, Shigeyuki; Sulkowska, Joanna I.; Hou, Ya-Ming

    2017-01-01

    Proteins with knotted configurations are restricted in conformational space relative to unknotted proteins. Little is known if knotted proteins have sufficient dynamics to communicate between spatially separated substrate-binding sites. In bacteria, TrmD is a methyl transferase that uses a knotted protein fold to catalyze methyl transfer from S-adenosyl methionine (AdoMet) to G37-tRNA. The product m1G37-tRNA is essential for life as a determinant to maintain protein synthesis reading-frame. Using an integrated approach of structure, kinetic, and computational analysis, we show here that the structurally constrained TrmD knot is required for its catalytic activity. Unexpectedly, the TrmD knot has complex internal movements that respond to AdoMet binding and signaling. Most of the signaling propagates the free energy of AdoMet binding to stabilize tRNA binding and to assemble the active site. This work demonstrates new principles of knots as an organized structure that captures the free energies of substrate binding to facilitate catalysis. PMID:27571175

  16. Proton and metal ion binding to natural organic polyelectrolytes-II. Preliminary investigation with a peat and a humic acid

    USGS Publications Warehouse

    Marinsky, J.A.; Reddy, M.M.

    1984-01-01

    We summarize here experimental studies of proton and metal ion binding to a peat and a humic acid. Data analysis is based on a unified physico-chemical model for reaction of simple ions with polyelectrolytes employing a modified Henderson-Hasselbalch equation. Peat exhibited an apparent intrinsic acid dissociation constant of 10-4.05, and an apparent intrinsic metal ion binding constant of: 400 for cadmium ion; 600 for zinc ion; 4000 for copper ion; 20000 for lead ion. A humic acid was found to have an apparent intrinsic proton binding constant of 10-2.6. Copper ion binding to this humic acid sample occurred at two types of sites. The first site exhibited reaction characteristics which were independent of solution pH and required the interaction of two ligands on the humic acid matrix to simultaneously complex with each copper ion. The second complex species is assumed to be a simple monodentate copper ion-carboxylate species with a stability constant of 18. ?? 1984.

  17. Identification of neuronal target genes for CCAAT/Enhancer Binding Proteins

    PubMed Central

    Kfoury, N.; Kapatos, G.

    2009-01-01

    CCAAT/Enhancer Binding Proteins (C/EBPs) play pivotal roles in development and plasticity of the nervous system. Identification of the physiological targets of C/EBPs (C/EBP target genes) should therefore provide insight into the underlying biology of these processes. We used unbiased genome-wide mapping to identify 115 C/EBPβ target genes in PC12 cells that include transcription factors, neurotransmitter receptors, ion channels, protein kinases and synaptic vesicle proteins. C/EBPβ binding sites were located primarily within introns, suggesting novel regulatory functions, and were associated with binding sites for other developmentally important transcription factors. Experiments using dominant negatives showed C/EBPβ to repress transcription of a subset of target genes. Target genes in rat brain were subsequently found to preferentially bind C/EBPα, β and δ. Analysis of the hippocampal transcriptome of C/EBPβ knockout mice revealed dysregulation of a high percentage of transcripts identified as C/EBP target genes. These results support the hypothesis that C/EBPs play non-redundant roles in the brain. PMID:19103292

  18. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  19. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  20. Computer-assisted identification of novel small molecule inhibitors targeting GLUT1

    NASA Astrophysics Data System (ADS)

    Wan, Zhining; Li, Xin; Sun, Rong; Li, Yuanyuan; Wang, Xiaoyun; Li, Xinru; Rong, Li; Shi, Zheng; Bao, Jinku

    2015-12-01

    Glucose transporters (GLUTs) are the main carriers of glucose that facilitate the diffusion of glucose in mammalian cells, especially GLUT1. Notably, GLUT1 is a rate-limiting transporter for glucose uptake, and its overexpression is a common characteristic in most cancers. Thus, the inhibition of GLUT1 by novel small compounds to lower glucose levels for cancer cells has become an emerging strategy. Herein, we employed high-throughput screening approaches to identify potential inhibitors against the sugar-binding site of GLUT1. Firstly, molecular docking screening was launched against the specs products, and three molecules (ZINC19909927, ZINC19908826, and ZINC19815451) were selected as candidate GLUT1 inhibitors for further analysis. Then, taking the initial ligand β-NG as a reference, molecular dynamic (MD) simulations and molecular mechanics/generalized born surface area (MM/GBSA) method were applied to evaluate the binding stability and affinity of the three candidates towards GLUT1. Finally, we found that ZINC19909927 might have the highest affinity to occupy the binding site of GLUT1. Meanwhile, energy decomposition analysis identified several residues located in substrate-binding site that might provide clues for future inhibitor discovery towards GLUT1. Taken together, these results in our study may provide valuable information for identifying new inhibitors targeting GLUT1-mediated glucose transport and metabolism for cancer therapeutics.

  1. Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2003-01-01

    Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osipiuk, J.; Gornicki, P.; Maj, L.

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Angstroms. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Angstroms from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer {alpha}/{beta} sandwich with the overall shape of a cylinder and shows no structural homology to proteins of knownmore » structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the {alpha}-{beta} plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.« less

  3. Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

    PubMed

    Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

    2001-11-01

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

  4. From reads to regions: a Bioconductor workflow to detect differential binding in ChIP-seq data

    PubMed Central

    Lun, Aaron T. L.; Smyth, Gordon K.

    2016-01-01

    Chromatin immunoprecipitation with massively parallel sequencing (ChIP-seq) is widely used to identify the genomic binding sites for protein of interest. Most conventional approaches to ChIP-seq data analysis involve the detection of the absolute presence (or absence) of a binding site. However, an alternative strategy is to identify changes in the binding intensity between two biological conditions, i.e., differential binding (DB). This may yield more relevant results than conventional analyses, as changes in binding can be associated with the biological difference being investigated. The aim of this article is to facilitate the implementation of DB analyses, by comprehensively describing a computational workflow for the detection of DB regions from ChIP-seq data. The workflow is based primarily on R software packages from the open-source Bioconductor project and covers all steps of the analysis pipeline, from alignment of read sequences to interpretation and visualization of putative DB regions. In particular, detection of DB regions will be conducted using the counts for sliding windows from the csaw package, with statistical modelling performed using methods in the edgeR package. Analyses will be demonstrated on real histone mark and transcription factor data sets. This will provide readers with practical usage examples that can be applied in their own studies. PMID:26834993

  5. Rational design and validation of a vanilloid-sensitive TRPV2 ion channel.

    PubMed

    Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

    2016-06-28

    Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S-S498F-L505T-Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular "glue" that bridges the S4-S5 linker to the S1-S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor.

  6. Dimeric c-di-GMP is required for post-translational regulation of alginate production in Pseudomonas aeruginosa

    DOE PAGES

    Whitney, John C.; Robinson, Howard; Whitfield, Gregory B.; ...

    2015-05-15

    Pseudomonas aeruginosa is an opportunistic human pathogen that secretes the exopolysaccharide alginate during infection of the respiratory tract of individuals afflicted with cystic fibrosis and chronic obstructive pulmonary disease. Among the proteins required for alginate production, Alg44 has been identified as an inner membrane protein whose bis-(3',5')-cyclic dimeric guanosine monophosphate (c-di-GMP) binding activity post-translationally regulates alginate secretion. In this study, we report the 1.8 Å crystal structure of the cytoplasmic region of Alg44 in complex with dimeric self-intercalated c-di-GMP and characterize its dinucleotide-binding site using mutational analysis. The structure shows that the c-di-GMP binding region of Alg44 adopts a PilZmore » domain fold with a dimerization mode not previously observed for this family of proteins. Moreover, calorimetric binding analysis of residues in the c-di-GMP binding site demonstrate that mutation of Arg-17 and Arg-95 alters the binding stoichiometry between c-di-GMP and Alg44 from 2:1 to 1:1. Introduction of these mutant alleles on the P. aeruginosa chromosome show that the residues required for binding of dimeric c-di-GMP in vitro are also required for efficient alginate production in vivo. Our results suggest that the dimeric form of c-di-GMP represents the biologically active signaling molecule needed for the secretion of an important virulence factor produced by P. aeruginosa.« less

  7. Dimeric c-di-GMP is required for post-translational regulation of alginate production in Pseudomonas aeruginosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Whitney, John C.; Robinson, Howard; Whitfield, Gregory B.

    Pseudomonas aeruginosa is an opportunistic human pathogen that secretes the exopolysaccharide alginate during infection of the respiratory tract of individuals afflicted with cystic fibrosis and chronic obstructive pulmonary disease. Among the proteins required for alginate production, Alg44 has been identified as an inner membrane protein whose bis-(3',5')-cyclic dimeric guanosine monophosphate (c-di-GMP) binding activity post-translationally regulates alginate secretion. In this study, we report the 1.8 Å crystal structure of the cytoplasmic region of Alg44 in complex with dimeric self-intercalated c-di-GMP and characterize its dinucleotide-binding site using mutational analysis. The structure shows that the c-di-GMP binding region of Alg44 adopts a PilZmore » domain fold with a dimerization mode not previously observed for this family of proteins. Moreover, calorimetric binding analysis of residues in the c-di-GMP binding site demonstrate that mutation of Arg-17 and Arg-95 alters the binding stoichiometry between c-di-GMP and Alg44 from 2:1 to 1:1. Introduction of these mutant alleles on the P. aeruginosa chromosome show that the residues required for binding of dimeric c-di-GMP in vitro are also required for efficient alginate production in vivo. Our results suggest that the dimeric form of c-di-GMP represents the biologically active signaling molecule needed for the secretion of an important virulence factor produced by P. aeruginosa.« less

  8. Analysis of sequencing data for probing RNA secondary structures and protein-RNA binding in studying posttranscriptional regulations.

    PubMed

    Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y

    2016-11-01

    High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  9. Dimeric c-di-GMP Is Required for Post-translational Regulation of Alginate Production in Pseudomonas aeruginosa*

    PubMed Central

    Whitney, John C.; Whitfield, Gregory B.; Marmont, Lindsey S.; Yip, Patrick; Neculai, A. Mirela; Lobsanov, Yuri D.; Robinson, Howard; Ohman, Dennis E.; Howell, P. Lynne

    2015-01-01

    Pseudomonas aeruginosa is an opportunistic human pathogen that secretes the exopolysaccharide alginate during infection of the respiratory tract of individuals afflicted with cystic fibrosis and chronic obstructive pulmonary disease. Among the proteins required for alginate production, Alg44 has been identified as an inner membrane protein whose bis-(3′,5′)-cyclic dimeric guanosine monophosphate (c-di-GMP) binding activity post-translationally regulates alginate secretion. In this study, we report the 1.8 Å crystal structure of the cytoplasmic region of Alg44 in complex with dimeric self-intercalated c-di-GMP and characterize its dinucleotide-binding site using mutational analysis. The structure shows that the c-di-GMP binding region of Alg44 adopts a PilZ domain fold with a dimerization mode not previously observed for this family of proteins. Calorimetric binding analysis of residues in the c-di-GMP binding site demonstrate that mutation of Arg-17 and Arg-95 alters the binding stoichiometry between c-di-GMP and Alg44 from 2:1 to 1:1. Introduction of these mutant alleles on the P. aeruginosa chromosome show that the residues required for binding of dimeric c-di-GMP in vitro are also required for efficient alginate production in vivo. These results suggest that the dimeric form of c-di-GMP represents the biologically active signaling molecule needed for the secretion of an important virulence factor produced by P. aeruginosa. PMID:25817996

  10. Adaptation of avian influenza A (H6N1) virus from avian to human receptor-binding preference

    PubMed Central

    Wang, Fei; Qi, Jianxun; Bi, Yuhai; Zhang, Wei; Wang, Min; Zhang, Baorong; Wang, Ming; Liu, Jinhua; Yan, Jinghua; Shi, Yi; Gao, George F

    2015-01-01

    The receptor-binding specificity of influenza A viruses is a major determinant for the host tropism of the virus, which enables interspecies transmission. In 2013, the first human case of infection with avian influenza A (H6N1) virus was reported in Taiwan. To gather evidence concerning the epidemic potential of H6 subtype viruses, we performed comprehensive analysis of receptor-binding properties of Taiwan-isolated H6 HAs from 1972 to 2013. We propose that the receptor-binding properties of Taiwan-isolated H6 HAs have undergone three major stages: initially avian receptor-binding preference, secondarily obtaining human receptor-binding capacity, and recently human receptor-binding preference, which has been confirmed by receptor-binding assessment of three representative virus isolates. Mutagenesis work revealed that E190V and G228S substitutions are important to acquire the human receptor-binding capacity, and the P186L substitution could reduce the binding to avian receptor. Further structural analysis revealed how the P186L substitution in the receptor-binding site of HA determines the receptor-binding preference change. We conclude that the human-infecting H6N1 evolved into a human receptor preference. PMID:25940072

  11. Leveraging cross-species transcription factor binding site patterns: from diabetes risk loci to disease mechanisms.

    PubMed

    Claussnitzer, Melina; Dankel, Simon N; Klocke, Bernward; Grallert, Harald; Glunk, Viktoria; Berulava, Tea; Lee, Heekyoung; Oskolkov, Nikolay; Fadista, Joao; Ehlers, Kerstin; Wahl, Simone; Hoffmann, Christoph; Qian, Kun; Rönn, Tina; Riess, Helene; Müller-Nurasyid, Martina; Bretschneider, Nancy; Schroeder, Timm; Skurk, Thomas; Horsthemke, Bernhard; Spieler, Derek; Klingenspor, Martin; Seifert, Martin; Kern, Michael J; Mejhert, Niklas; Dahlman, Ingrid; Hansson, Ola; Hauck, Stefanie M; Blüher, Matthias; Arner, Peter; Groop, Leif; Illig, Thomas; Suhre, Karsten; Hsu, Yi-Hsiang; Mellgren, Gunnar; Hauner, Hans; Laumen, Helmut

    2014-01-16

    Genome-wide association studies have revealed numerous risk loci associated with diverse diseases. However, identification of disease-causing variants within association loci remains a major challenge. Divergence in gene expression due to cis-regulatory variants in noncoding regions is central to disease susceptibility. We show that integrative computational analysis of phylogenetic conservation with a complexity assessment of co-occurring transcription factor binding sites (TFBS) can identify cis-regulatory variants and elucidate their mechanistic role in disease. Analysis of established type 2 diabetes risk loci revealed a striking clustering of distinct homeobox TFBS. We identified the PRRX1 homeobox factor as a repressor of PPARG2 expression in adipose cells and demonstrate its adverse effect on lipid metabolism and systemic insulin sensitivity, dependent on the rs4684847 risk allele that triggers PRRX1 binding. Thus, cross-species conservation analysis at the level of co-occurring TFBS provides a valuable contribution to the translation of genetic association signals to disease-related molecular mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. A stochastic context free grammar based framework for analysis of protein sequences

    PubMed Central

    Dyrka, Witold; Nebel, Jean-Christophe

    2009-01-01

    Background In the last decade, there have been many applications of formal language theory in bioinformatics such as RNA structure prediction and detection of patterns in DNA. However, in the field of proteomics, the size of the protein alphabet and the complexity of relationship between amino acids have mainly limited the application of formal language theory to the production of grammars whose expressive power is not higher than stochastic regular grammars. However, these grammars, like other state of the art methods, cannot cover any higher-order dependencies such as nested and crossing relationships that are common in proteins. In order to overcome some of these limitations, we propose a Stochastic Context Free Grammar based framework for the analysis of protein sequences where grammars are induced using a genetic algorithm. Results This framework was implemented in a system aiming at the production of binding site descriptors. These descriptors not only allow detection of protein regions that are involved in these sites, but also provide insight in their structure. Grammars were induced using quantitative properties of amino acids to deal with the size of the protein alphabet. Moreover, we imposed some structural constraints on grammars to reduce the extent of the rule search space. Finally, grammars based on different properties were combined to convey as much information as possible. Evaluation was performed on sites of various sizes and complexity described either by PROSITE patterns, domain profiles or a set of patterns. Results show the produced binding site descriptors are human-readable and, hence, highlight biologically meaningful features. Moreover, they achieve good accuracy in both annotation and detection. In addition, findings suggest that, unlike current state-of-the-art methods, our system may be particularly suited to deal with patterns shared by non-homologous proteins. Conclusion A new Stochastic Context Free Grammar based framework has been introduced allowing the production of binding site descriptors for analysis of protein sequences. Experiments have shown that not only is this new approach valid, but produces human-readable descriptors for binding sites which have been beyond the capability of current machine learning techniques. PMID:19814800

  13. An integrated catch-and-hold mechanism activates nicotinic acetylcholine receptors.

    PubMed

    Jadey, Snehal; Auerbach, Anthony

    2012-07-01

    In neuromuscular acetylcholine (ACh) receptor channels (AChRs), agonist molecules bind with a low affinity (LA) to two sites that can switch to high affinity (HA) and increase the probability of channel opening. We measured (by using single-channel kinetic analysis) the rate and equilibrium constants for LA binding and channel gating for several different agonists of adult-type mouse AChRs. Almost all of the variation in the equilibrium constants for LA binding was from differences in the association rate constants. These were consistently below the limit set by diffusion and were substantially different even though the agonists had similar sizes and the same charge. This suggests that binding to resting receptors is not by diffusion alone and, hence, that each binding site can undergo two conformational changes ("catch" and "hold") that connect three different structures (apo-, LA-bound, and HA-bound). Analyses of ACh-binding protein structures suggest that this binding site, too, may adopt three discrete structures having different degrees of loop C displacement ("capping"). For the agonists we tested, the logarithms of the equilibrium constants for LA binding and LA↔HA gating were correlated. Although agonist binding and channel gating have long been considered to be separate processes in the activation of ligand-gated ion channels, this correlation implies that the catch-and-hold conformational changes are energetically linked and together comprise an integrated process having a common structural basis. We propose that loop C capping mainly reflects agonist binding, with its two stages corresponding to the formation of the LA and HA complexes. The catch-and-hold reaction coordinate is discussed in terms of preopening states and thermodynamic cycles of activation.

  14. An integrated catch-and-hold mechanism activates nicotinic acetylcholine receptors

    PubMed Central

    Jadey, Snehal

    2012-01-01

    In neuromuscular acetylcholine (ACh) receptor channels (AChRs), agonist molecules bind with a low affinity (LA) to two sites that can switch to high affinity (HA) and increase the probability of channel opening. We measured (by using single-channel kinetic analysis) the rate and equilibrium constants for LA binding and channel gating for several different agonists of adult-type mouse AChRs. Almost all of the variation in the equilibrium constants for LA binding was from differences in the association rate constants. These were consistently below the limit set by diffusion and were substantially different even though the agonists had similar sizes and the same charge. This suggests that binding to resting receptors is not by diffusion alone and, hence, that each binding site can undergo two conformational changes (“catch” and “hold”) that connect three different structures (apo-, LA-bound, and HA-bound). Analyses of ACh-binding protein structures suggest that this binding site, too, may adopt three discrete structures having different degrees of loop C displacement (“capping”). For the agonists we tested, the logarithms of the equilibrium constants for LA binding and LA↔HA gating were correlated. Although agonist binding and channel gating have long been considered to be separate processes in the activation of ligand-gated ion channels, this correlation implies that the catch-and-hold conformational changes are energetically linked and together comprise an integrated process having a common structural basis. We propose that loop C capping mainly reflects agonist binding, with its two stages corresponding to the formation of the LA and HA complexes. The catch-and-hold reaction coordinate is discussed in terms of preopening states and thermodynamic cycles of activation. PMID:22732309

  15. High-affinity receptors for bombesin-like peptides in normal guinea pig lung membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lach, E.; Trifilieff, A.; Landry, Y.

    1991-01-01

    The binding of the radiolabeled bombesin analogue ({sup 125}I-Tyr{sup 4})bombesin to guinea-pig lung membranes was investigated. Binding of ({sup 125}I-Tyr{sup 4})bombesin was specific, saturable, reversible and linearly related to the protein concentration. Scatchard analysis of equilibrium binding data at 25C indicated the presence of a single class of non-interacting binding sites for bombesin (B{sub max} = 7.7 fmol/mg protein). The value of the equilibrium dissociation constant (K{sub D} = 90 pM) agrees with a high-affinity binding site. Bombesin and structurally related peptides such as ({sup 125}I-Tyr{sup 4})bombesin, neuromedin B and neuromedin C inhibited the binding of ({sup 125}I-Tyr{sup 4})bombesin inmore » an order of potencies as follows: ({sup 125}I-Tyr{sup 4})bombesin {gt} bombesin {ge} neuromedin C {much gt} neuromedin B. These results indicate that guinea-pig lung membranes possess a single class of bombesin receptors with a high affinity for bombesin and a lower one for neuromedin B.« less

  16. Fluoxetine (Prozac) Binding to Serotonin Transporter Is Modulated by Chloride and Conformational Changes

    PubMed Central

    Tavoulari, Sotiria; Forrest, Lucy R.; Rudnick, Gary

    2010-01-01

    Serotonin transporter (SERT) is the main target for widely used antidepressant agents. Several of these drugs, including imipramine, citalopram, sertraline, and fluoxetine (Prozac), bound more avidly to SERT in the presence of Cl–. In contrast, Cl– did not enhance cocaine or paroxetine binding. A Cl– binding site recently identified in SERT, and shown to be important for Cl– dependent transport, was also critical for the Cl– dependence of antidepressant affinity. Mutation of the residues contributing to this site eliminated the Cl–-mediated affinity increase for imipramine and fluoxetine. Analysis of ligand docking to a single state of SERT indicated only small differences in the energy of interaction between bound ligands and Cl–. These differences in interaction energy cannot account for the affinity differences observed for Cl– dependence. However, fluoxetine binding led to a conformational change, detected by cysteine accessibility experiments, that was qualitatively different from that induced by cocaine or other ligands. Given the known Cl– requirement for serotonin-induced conformational changes, we propose that Cl– binding facilitates conformational changes required for optimal binding of fluoxetine and other antidepressant drugs. PMID:19641126

  17. The 1.3 A resolution structure of the RNA tridecamer r(GCGUUUGAAACGC): metal ion binding correlates with base unstacking and groove contraction.

    PubMed

    Timsit, Youri; Bombard, Sophie

    2007-12-01

    Metal ions play a key role in RNA folding and activity. Elucidating the rules that govern the binding of metal ions is therefore an essential step for better understanding the RNA functions. High-resolution data are a prerequisite for a detailed structural analysis of ion binding on RNA and, in particular, the observation of monovalent cations. Here, the high-resolution crystal structures of the tridecamer duplex r(GCGUUUGAAACGC) crystallized under different conditions provides new structural insights on ion binding on GAAA/UUU sequences that exhibit both unusual structural and functional properties in RNA. The present study extends the repertory of RNA ion binding sites in showing that the two first bases of UUU triplets constitute a specific site for sodium ions. A striking asymmetric pattern of metal ion binding in the two equivalent halves of the palindromic sequence demonstrates that sequence and its environment act together to bind metal ions. A highly ionophilic half that binds six metal ions allows, for the first time, the observation of a disodium cluster in RNA. The comparison of the equivalent halves of the duplex provides experimental evidences that ion binding correlates with structural alterations and groove contraction.

  18. Crystal structure of Anoxybacillus α-amylase provides insights into maltose binding of a new glycosyl hydrolase subclass.

    PubMed

    Chai, Kian Piaw; Othman, Noor Farhan Binti; Teh, Aik-Hong; Ho, Kok Lian; Chan, Kok-Gan; Shamsir, Mohd Shahir; Goh, Kian Mau; Ng, Chyan Leong

    2016-03-15

    A new subfamily of glycosyl hydrolase family GH13 was recently proposed for α-amylases from Anoxybacillus species (ASKA and ADTA), Geobacillus thermoleovorans (GTA, Pizzo, and GtamyII), Bacillus aquimaris (BaqA), and 95 other putative protein homologues. To understand this new GH13 subfamily, we report crystal structures of truncated ASKA (TASKA). ASKA is a thermostable enzyme capable of producing high levels of maltose. Unlike GTA, biochemical analysis showed that Ca(2+) ion supplementation enhances the catalytic activities of ASKA and TASKA. The crystal structures reveal the presence of four Ca(2+) ion binding sites, with three of these binding sites are highly conserved among Anoxybacillus α-amylases. This work provides structural insights into this new GH13 subfamily both in the apo form and in complex with maltose. Furthermore, structural comparison of TASKA and GTA provides an overview of the conformational changes accompanying maltose binding at each subsite.

  19. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  20. Combinatorial multispectral, thermodynamics, docking and site-directed mutagenesis reveal the cognitive characteristics of honey bee chemosensory protein to plant semiochemical.

    PubMed

    Tan, Jing; Song, Xinmi; Fu, Xiaobin; Wu, Fan; Hu, Fuliang; Li, Hongliang

    2018-08-05

    In the chemoreceptive system of insects, there are always some soluble binding proteins, such as some antennal-specific chemosensory proteins (CSPs), which are abundantly distributed in the chemosensory sensillar lymph. The antennal-specific CSPs usually have strong capability to bind diverse semiochemicals, while the detailed interaction between CSPs and the semiochemicals remain unclear. Here, by means of the combinatorial multispectral, thermodynamics, docking and site-directed mutagenesis, we detailedly interpreted a binding interaction between a plant semiochemical β-ionone and antennal-specific CSP1 from the worker honey bee. Thermodynamic parameters (ΔH < 0, ΔS > 0) indicate that the interaction is mainly driven by hydrophobic forces and electrostatic interactions. Docking prediction results showed that there are two key amino acids, Phe44 and Gln63, may be involved in the interacting process of CSP1 to β-ionone. In order to confirm the two key amino acids, site-directed mutagenesis were performed and the binding constant (K A ) for two CSP1 mutant proteins was reduced by 60.82% and 46.80% compared to wild-type CSP1. The thermodynamic analysis of mutant proteins furtherly verified that Phe44 maintained an electrostatic interaction and Gln63 contributes hydrophobic and electrostatic forces. Our investigation initially elucidates the physicochemical mechanism of the interaction between antennal-special CSPs in insects including bees to plant semiochemicals, as well as the development of twice thermodynamic analysis (wild type and mutant proteins) combined with multispectral and site-directed mutagenesis methods. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. How does huperzine A enter and leave the binding gorge of acetylcholinesterase? Steered molecular dynamics simulations.

    PubMed

    Xu, Yechun; Shen, Jianhua; Luo, Xiaomin; Silman, Israel; Sussman, Joel L; Chen, Kaixian; Jiang, Hualiang

    2003-09-17

    The entering and leaving processes of Huperzine A (HupA) binding with the long active-site gorge of Torpedo californica acetylcholinesterase (TcAChE) have been investigated by using steered molecular dynamics simulations. The analysis of the force required along the pathway shows that it is easier for HupA to bind to the active site of AChE than to disassociate from it, which for the first time interprets at the atomic level the previous experimental result that unbinding process of HupA is much slower than its binding process to AChE. The direct hydrogen bonds, water bridges, and hydrophobic interactions were analyzed during two steered molecular dynamics (SMD) simulations. Break of the direct hydrogen bond needs a great pulling force. The steric hindrance of bottleneck might be the most important factor to produce the maximal rupture force for HupA to leave the binding site but it has a little effect on the binding process of HupA with AChE. Residue Asp72 forms a lot of water bridges with HupA leaving and entering the AChE binding gorge, acting as a clamp to take out HupA from or put HupA into the active site. The flip of the peptide bond between Gly117 and Gly118 has been detected during both the conventional MD and SMD simulations. The simulation results indicate that this flip phenomenon could be an intrinsic property of AChE and the Gly117-Gly118 peptide bond in both HupA bound and unbound AChE structures tends to adopt the native enzyme structure. At last, in a vacuum the rupture force is increased up to 1500 pN while in water solution the greatest rupture force is about 800 pN, which means water molecules in the binding gorge act as lubricant to facilitate HupA entering or leaving the binding gorge.

  2. Binding sites of resveratrol, genistein, and curcumin with milk α- and β-caseins.

    PubMed

    Bourassa, P; Bariyanga, J; Tajmir-Riahi, H A

    2013-02-07

    The binding sites of antioxidant polyphenols resveratrol, genistein, and curcumin are located with milk α- and β-caseins in aqueous solution. FTIR, CD, and fluorescence spectroscopic methods and molecular modeling were used to analyze polyphenol binding sites, the binding constant, and the effects of complexation on casein stability and conformation. Structural analysis showed that polyphenols bind casein via hydrophilic and hydrophobic interactions with the number of bound polyphenol molecules (n) 1.20 for resveratrol, 1.42 for genistein, and 1.43 for curcumin with α-casein and 1.14 for resveratrol, 1.27 for genistein, and 1.27 for curcumin with β-casein. The overall binding constants of the complexes formed are K(res-α-casein) = 1.9 (±0.6) × 10(4) M(-1), K(gen-α-casein) = 1.8 (±0.4) × 10(4) M(-1), and K(cur-α-casein) = 2.8 (±0.8) × 10(4) M(-1) with α-casein and K(res-β-casein) = 2.3 (±0.3) × 10(4) M(-1), K(gen-β-casein) = 3.0 (±0.5) × 10(4) M(-1), and K(cur-β-casein) = 3.1 (±0.5) × 10(4) M(-1) for β-casein. Molecular modeling showed the participation of several amino acids in polyphenol-protein complexes, which were stabilized by the hydrogen bonding network with the free binding energy of -11.56 (resveratrol-α-casein), -12.35 (resveratrol-β-casein), -9.68 (genistein-α-casein), -9.97 (genistein-β-casein), -8.89 (curcumin-α-casein), and -10.70 kcal/mol (curcumin-β-casein). The binding sites of polyphenols are different with α- and β-caseins. Polyphenol binding altered casein conformation with reduction of α-helix, indicating a partial protein destabilization. Caseins might act as carriers to transport polyphenol in vitro.

  3. Genome-Wide Identification of Chromatin Transitional Regions Reveals Diverse Mechanisms Defining the Boundary of Facultative Heterochromatin

    PubMed Central

    Li, Guangyao; Zhou, Lei

    2013-01-01

    Due to the self-propagating nature of the heterochromatic modification H3K27me3, chromatin barrier activities are required to demarcate the boundary and prevent it from encroaching into euchromatic regions. Studies in Drosophila and vertebrate systems have revealed several important chromatin barrier elements and their respective binding factors. However, epigenomic data indicate that the binding of these factors are not exclusive to chromatin boundaries. To gain a comprehensive understanding of facultative heterochromatin boundaries, we developed a two-tiered method to identify the Chromatin Transitional Region (CTR), i.e. the nucleosomal region that shows the greatest transition rate of the H3K27me3 modification as revealed by ChIP-Seq. This approach was applied to identify CTRs in Drosophila S2 cells and human HeLa cells. Although many insulator proteins have been characterized in Drosophila, less than half of the CTRs in S2 cells are associated with known insulator proteins, indicating unknown mechanisms remain to be characterized. Our analysis also revealed that the peak binding of insulator proteins are usually 1–2 nucleosomes away from the CTR. Comparison of CTR-associated insulator protein binding sites vs. those in heterochromatic region revealed that boundary-associated binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significant decreased nucleosome density and increased binding intensities of co-factors. Interestingly, several subgroups of boundaries have enhanced H3.3 incorporation but reduced nucleosome turnover rate. Our genome-wide study reveals that diverse mechanisms are employed to define the boundaries of facultative heterochromatin. In both Drosophila and mammalian systems, only a small fraction of insulator protein binding sites co-localize with H3K27me3 boundaries. However, boundary-associated insulator binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significantly decreased nucleosome density and increased binding of co-factors. PMID:23840609

  4. Dynamic Factors Affecting Gaseous Ligand Binding in an Artificial Oxygen Transport Protein‡

    PubMed Central

    Zhang, Lei; Andersen, Eskil M.E.; Khajo, Abdelahad; Magliozzo, Richard S.; Koder, Ronald L.

    2013-01-01

    We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7 this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime which may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when when exposed to oxygen. Compared to HP7, distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off-rate. EPR comparison of these ferric hemoproteins demonstrates that the mutation increases disorder at the heme binding site. NMR-detected deuterium exchange demonstrates that the mutation greatly increases water penetration into the protein core. The inability of the mutant protein to bind oxygen may be due to increased water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together these data underline the importance of the control of protein dynamics in the design of functional artificial proteins. PMID:23249163

  5. Dynamic factors affecting gaseous ligand binding in an artificial oxygen transport protein.

    PubMed

    Zhang, Lei; Andersen, Eskil M E; Khajo, Abdelahad; Magliozzo, Richard S; Koder, Ronald L

    2013-01-22

    We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7, this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities, and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime that may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when exposed to oxygen. Compared to that of HP7, the distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off rate. Electron paramagnetic resonance comparison of these ferric hemoproteins demonstrates that the mutation increases the level of disorder at the heme binding site. Nuclear magnetic resonance-detected deuterium exchange demonstrates that the mutation greatly increases the degree of penetration of water into the protein core. The inability of the mutant protein to bind oxygen may be due to an increased level of water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together, these data underline the importance of the control of protein dynamics in the design of functional artificial proteins.

  6. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif.

    PubMed

    Er, Tze-Kiong; Chen, Chih-Chieh; Liu, Yen-Yi; Chang, Hui-Chiu; Chien, Yin-Hsiu; Chang, Jan-Gowth; Hwang, Jenn-Kang; Jong, Yuh-Jyh

    2011-10-21

    Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.

  7. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

    PubMed Central

    2011-01-01

    Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability. PMID:22013910

  8. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  9. Direct activation of a notochord cis-regulatory module by Brachyury and FoxA in the ascidian Ciona intestinalis.

    PubMed

    Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna

    2009-11-01

    The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.

  10. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  11. Motifs for molecular recognition exploiting hydrophobic enclosure in protein-ligand binding.

    PubMed

    Young, Tom; Abel, Robert; Kim, Byungchan; Berne, Bruce J; Friesner, Richard A

    2007-01-16

    The thermodynamic properties and phase behavior of water in confined regions can vary significantly from that observed in the bulk. This is particularly true for systems in which the confinement is on the molecular-length scale. In this study, we use molecular dynamics simulations and a powerful solvent analysis technique based on inhomogenous solvation theory to investigate the properties of water molecules that solvate the confined regions of protein active sites. Our simulations and analysis indicate that the solvation of protein active sites that are characterized by hydrophobic enclosure and correlated hydrogen bonds induce atypical entropic and enthalpic penalties of hydration. These penalties apparently stabilize the protein-ligand complex with respect to the independently solvated ligand and protein, which leads to enhanced binding affinities. Our analysis elucidates several challenging cases, including the super affinity of the streptavidin-biotin system.

  12. Analysis of In Vivo Chromatin and Protein Interactions of Arabidopsis Transcript Elongation Factors.

    PubMed

    Pfab, Alexander; Antosz, Wojciech; Holzinger, Philipp; Bruckmann, Astrid; Griesenbeck, Joachim; Grasser, Klaus D

    2017-01-01

    A central step to elucidate the function of proteins commonly comprises the analysis of their molecular interactions in vivo. For nuclear regulatory proteins this involves determining protein-protein interactions as well as mapping of chromatin binding sites. Here, we present two protocols to identify protein-protein and chromatin interactions of transcript elongation factors (TEFs) in Arabidopsis. The first protocol (Subheading 3.1) describes protein affinity-purification coupled to mass spectrometry (AP-MS) that utilizes suspension cultured cells as experimental system. This approach provides an unbiased view of proteins interacting with epitope-tagged TEFs. The second protocol (Subheading 3.2) depicts details about a chromatin immunoprecipitation (ChIP) procedure to characterize genomic binding sites of TEFs. These methods should be valuable tools for the analysis of a broad variety of nuclear proteins.

  13. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  14. Chlorella virus DNA ligase: nick recognition and mutational analysis.

    PubMed

    Sriskanda, V; Shuman, S

    1998-01-15

    Chlorella virus PBCV-1 DNA ligase seals nicked DNA substrates consisting of a 5'-phosphate-terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging DNA template strand. The enzyme discriminates at the DNA binding step between substrates containing a 5'-phosphate versus a 5'-hydroxyl at the nick. Mutational analysis of the active site motif KxDGxR (residues 27-32) illuminates essential roles for the conserved Lys, Asp and Arg moieties at different steps of the ligase reaction. Mutant K27A is unable to form the covalent ligase-(Lys-straightepsilonN-P)-adenylate intermediate and hence cannot activate a nicked DNA substrate via formation of the DNA-adenylate intermediate. Nonetheless, K27A catalyzes phosphodiester bond formation at a pre-adenylated nick. This shows that the active site lysine is not required for the strand closure reaction. K27A binds to nicked DNA-adenylate, but not to a standard DNA nick. This suggests that occupancy of the AMP binding pocket of DNA ligase is important for nick recognition. Mutant D29A is active in enzyme-adenylate formation and binds readily to nicked DNA, but is inert in DNA-adenylate formation. R32A is unable to catalyze any of the three reactions of the ligation pathway and does not bind to nicked DNA.

  15. A principal component analysis of the dynamics of subdomains and binding sites in human serum albumin.

    PubMed

    Paris, Guillaume; Ramseyer, Christophe; Enescu, Mironel

    2014-05-01

    The conformational dynamics of human serum albumin (HSA) was investigated by principal component analysis (PCA) applied to three molecular dynamics trajectories of 200 ns each. The overlap of the essential subspaces spanned by the first 10 principal components (PC) of different trajectories was about 0.3 showing that the PCA based on a trajectory length of 200 ns is not completely convergent for this protein. The contributions of the relative motion of subdomains and of the subdomains (internal) distortion to the first 10 PCs were found to be comparable. Based on the distribution of the first 3 PC, 10 protein conformers are identified showing relative root mean square deviations (RMSD) between 2.3 and 4.6 Å. The main PCs are found to be delocalized over the whole protein structure indicating that the motions of different protein subdomains are coupled. This coupling is considered as being related to the allosteric effects observed upon ligand binding to HSA. On the other hand, the first PC of one of the three trajectories describes a conformational transition of the protein domain I that is close to that experimentally observed upon myristate binding. This is a theoretical support for the older hypothesis stating that changes of the protein onformation favorable to binding can precede the ligand complexation. A detailed all atoms PCA performed on the primary Sites 1 and 2 confirms the multiconformational character of the HSA binding sites as well as the significant coupling of their motions. Copyright © 2013 Wiley Periodicals, Inc.

  16. Direct interaction of the inhibitory gamma-subunit of Rod cGMP phosphodiesterase (PDE6) with the PDE6 GAFa domains.

    PubMed

    Muradov, Khakim G; Granovsky, Alexey E; Schey, Kevin L; Artemyev, Nikolai O

    2002-03-26

    Retinal rod and cone cGMP phosphodiesterases (PDE6 family) function as the effector enzyme in the vertebrate visual transduction cascade. The activity of PDE6 catalytic subunits is controlled by the Pgamma-subunits. In addition to the inhibition of cGMP hydrolysis at the catalytic sites, Pgamma is known to stimulate a noncatalytic binding of cGMP to the regulatory GAFa-GAFb domains of PDE6. The latter role of Pgamma has been attributed to its polycationic region. To elucidate the structural basis for the regulation of cGMP binding to the GAF domains of PDE6, a photoexcitable peptide probe corresponding to the polycationic region of Pgamma, Pgamma-21-45, was specifically cross-linked to rod PDE6alphabeta. The site of Pgamma-21-45 cross-linking was localized to Met138Gly139 within the PDE6alpha GAFa domain using mass spectrometric analysis. Chimeras between PDE5 and cone PDE6alpha', containing GAFa and/or GAFb domains of PDE6alpha' have been generated to probe a potential role of the GAFb domains in binding to Pgamma. Analysis of the inhibition of the PDE5/PDE6alpha' chimeras by Pgamma supported the role of PDE6 GAFa but not GAFb domains in the interaction with Pgamma. Our results suggest that a direct binding of the polycationic region of Pgamma to the GAFa domains of PDE6 may lead to a stabilization of the noncatalytic cGMP-binding sites.

  17. Harmaline competitively inhibits [3H]MK-801 binding to the NMDA receptor in rabbit brain.

    PubMed

    Du, W; Aloyo, V J; Harvey, J A

    1997-10-03

    Harmaline, a beta-carboline derivative, is known to produce tremor through a direct activation of cells in the inferior olive. However, the receptor(s) through which harmaline acts remains unknown. It was recently reported that the tremorogenic actions of harmaline could be blocked by the noncompetitive NMDA channel blocker, MK-801. This study examined whether the blockade of harmaline's action, in the rabbit, by MK-801 was due to a pharmacological antagonism at the MK-801 binding site. This was accomplished by measurement of [3H]MK-801 binding in membrane fractions derived from tissue containing the inferior olivary nucleus and from cerebral cortex. Harmaline completely displaced saturable [3H]MK-801 binding in both the inferior olive and cortex with apparent IC50 values of 60 and 170 microM, respectively. These IC50 values are consistent with the high doses of harmaline required to produce tremor, e.g., 10-30 mg/kg. Non-linear curve fitting analysis of [3H]MK-801 saturation experiments indicated that [3H]MK-801 bound to a single site and that harmaline's displacement of [3H]MK-801 binding to the NMDA receptor was competitive as indicated by a shift in Kd but not in Bmax. In addition, a Schild plot gave a slope that was not significantly different from 1 indicating that harmaline was producing a displacement of [3H]MK-801 from its binding site within the NMDA cation channel and not through an action at the glutamate or other allosteric sites on the NMDA receptor. These findings provide in vitro evidence that the competitive blockade of harmaline-induced tremor by MK-801 occurs within the calcium channel coupled to the NMDA receptor. Our hypothesis is that harmaline produces tremor by acting as an inverse agonist at the MK-801 binding site and thus opening the cation channel.

  18. Spectrophotometric and molecular modelling studies on in vitro interaction of tyrosine kinase inhibitor linifanib with bovine serum albumin.

    PubMed

    Wani, Tanveer A; Bakheit, Ahmed H; Zargar, Seema; Hamidaddin, Mohammed A; Darwish, Ibrahim A

    2017-01-01

    Linifanib (LNF) possess antitumor activity and acts by inhibiting receptor tyrosine kinase VEGF and PDGF. The interaction of BSA with the drug can provide valuable information regarding the pharmacokinetic and pharmacodynamics behavior of drug. In our study the spectrophotometric methods and molecular docking studies were executed to understand the interaction behavior of BSA and LNF. BSA has an intrinsic fluorescence and that fluorescence was quenched by LNF. This quenching process was studied at three different temperatures of 288, 300and 308 K. The interaction between LNF and BSA was due to static quenching because the Ksv (Stern-Volmer constant) at 288 K was higher than at 300 and 308 K. Kq (quenching rate constant) behaved in a similar fashion as the Ksv. Several other parameters like binding constants, number of binding sites and binding energy in addition to molecular docking studies were also used to evaluate the interaction process. A decrease in the binding constants was observed with increasing temperatures and the binding site number approximated unity. The decreasing binding constant indicates LNF-BSA complex stability. The site mark competition experiment confirmed the binding site for LNF was located on site II of BSA. UV-visible studies along with synchronous fluorescence confirm a small change in the conformation of BSA upon interaction with LNF. The thermodynamic analysis provided the values for free energy ΔG0, ΔH0 and ΔS0. The ΔG0 at the 288, 300 and 308 K ranged in between -21.5 to -23.3 kJ mol-1, whereas the calculated values of ΔH (-55.91 kJ mol-1) and ΔS0 (-111.74 J mol-1·K-1). The experimental and molecular docking results suggest that the interaction between LNF and BSA was spontaneous and they exhibited hydrogen bonding and van der Waals force between them.

  19. Monomolecular Siloxane Film as a Model of Single Site Catalysts

    DOE PAGES

    Martynowycz, Michael W.; Hu, Bo; Kuzmenko, Ivan; ...

    2016-09-06

    Achieving structurally well-defined catalytic species requires a fundamental understanding of surface chemistry. Detailed structural characterization of the catalyst binding sites in situ, such as single site catalysts on silica supports, is technically challenging or even unattainable. Octadecyltrioxysilane (OTOS) monolayers formed from octadecyltrimethoxysilane (OTMS) at the air-liquid interface after hydrolysis and condensation at low pH were chosen as a model system of surface binding sites in silica-supported Zn 2+ catalysts. We characterize the system by grazing incidence X-ray diffraction, X-ray reflectivity (XR), and X-ray fluorescence spectroscopy (XFS). Previous X-ray and infrared surface studies of OTMS/OTOS films at the airliquid interface proposedmore » the formation of polymer OTOS structures. According to our analysis, polymer formation is inconsistent with the X-ray observations and structural properties of siloxanes; it is energetically unfavorable and thus highly unlikely. We suggest an alternative mechanism of hydrolysis/condensation in OTMS leading to the formation of structurally allowed cyclic trimers with the six-membered siloxane rings, which explain well both the X-ray and infrared results. XR and XFS consistently demonstrate that tetrahedral [Zn(NH 3) 4] 2+ ions bind to hydroxyl groups of the film at a stoichiometric ratio of OTOS:Zn ~ 2:1. The high binding affinity of zinc ions to OTOS trimers suggests that the six-membered siloxane rings are binding locations for single site Zn/SiO 2 catalysts. Finally, our results show that OTOS monolayers may serve as a platform for studying silica surface chemistry or hydroxyl-mediated reactions.« less

  20. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  1. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  2. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  3. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  4. Antigen Binding and Site-Directed Labeling of Biosilica-Immobilized Fusion Proteins Expressed in Diatoms.

    PubMed

    Ford, Nicole R; Hecht, Karen A; Hu, DeHong; Orr, Galya; Xiong, Yijia; Squier, Thomas C; Rorrer, Gregory L; Roesijadi, Guritno

    2016-03-18

    The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins comprising either enhanced green fluorescent protein (EGFP) or single chain antibodies engineered with a tetracysteine tagging sequence. Of interest were the site-specific binding of (1) the fluorescent biarsenical probe AsCy3 and AsCy3e to the tetracysteine tagged fusion proteins and (2) high and low molecular mass antigens, the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT), to biosilica-immobilized single chain antibodies. Analysis of biarsenical probe binding using fluorescence and structured illumination microscopy indicated differential colocalization with EGFP in nascent and mature biosilica, supporting the use of either EGFP or bound AsCy3 and AsCy3e in studying biosilica maturation. Large increases in the lifetime of a fluorescent analogue of TNT upon binding single chain antibodies provided a robust signal capable of discriminating binding to immobilized antibodies in the transformed frustule from nonspecific binding to the biosilica matrix. In conclusion, our results demonstrate an ability to engineer diatoms to create antibody-functionalized mesoporous silica able to selectively bind chemical and biological agents for the development of sensing platforms.

  5. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

    PubMed

    Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

    2008-09-01

    WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

  6. The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

    PubMed

    Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

    2004-11-15

    Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

  7. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases

    PubMed Central

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-01-01

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding. DOI: http://dx.doi.org/10.7554/eLife.11835.001 PMID:27071344

  8. Comparison and analysis on the serum-binding characteristics of aspirin-zinc complex and aspirin.

    PubMed

    Zhang, Hua-Xin; Zhang, Qun; Wang, Hong-Lin; Li, Li-Wei

    2017-09-01

    This study was designed to compare the protein-binding characteristics of aspirin-zinc complex (AZN) with those of aspirin itself. AZN was synthesized and interacted with a model transport protein, human serum albumin (HSA). Three-dimensional fluorescence, ultraviolet-visible and circular dichroism (CD) spectra were used to characterize the interaction of AZN with HSA under physiological conditions. The interaction mechanism was explored using a fluorescence quenching method and thermodynamic calculation. The binding site and binding locality of AZN on HSA were demonstrated using a fluorescence probe technique and Förster non-radiation energy transfer theory. Synchronous fluorescence and CD spectra were employed to reveal the effect of AZN on the native conformation of the protein. The HSA-binding results for AZN were compared with those for aspirin under consistent experimental conditions, and indicated that aspirin acts as a guide in AZN when binding to Sudlow's site I, in subdomain IIA of the HSA molecule. Moreover, compared with aspirin, AZN showed greater observed binding constants with, but smaller changes in the α-helicity of, HSA, which proved that AZN might be easier to transport and have less toxicity in vivo. Copyright © 2017 John Wiley & Sons, Ltd.

  9. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  10. Mapping the signal peptide binding and oligomer contact sites of the core subunit of the pea twin arginine protein translocase.

    PubMed

    Ma, Xianyue; Cline, Kenneth

    2013-03-01

    Twin arginine translocation (Tat) systems of thylakoid and bacterial membranes transport folded proteins using the proton gradient as the sole energy source. Tat substrates have hydrophobic signal peptides with an essential twin arginine (RR) recognition motif. The multispanning cpTatC plays a central role in Tat operation: It binds the signal peptide, directs translocase assembly, and may facilitate translocation. An in vitro assay with pea (Pisum sativum) chloroplasts was developed to conduct mutagenesis and analysis of cpTatC functions. Ala scanning mutagenesis identified mutants defective in substrate binding and receptor complex assembly. Mutations in the N terminus (S1) and first stromal loop (S2) caused specific defects in signal peptide recognition. Cys matching between substrate and imported cpTatC confirmed that S1 and S2 directly and specifically bind the RR proximal region of the signal peptide. Mutations in four lumen-proximal regions of cpTatC were defective in receptor complex assembly. Copurification and Cys matching analyses suggest that several of the lumen proximal regions may be important for cpTatC-cpTatC interactions. Surprisingly, RR binding domains of adjacent cpTatCs directed strong cpTatC-cpTatC cross-linking. This suggests clustering of binding sites on the multivalent receptor complex and explains the ability of Tat to transport cross-linked multimers. Transport of substrate proteins cross-linked to the signal peptide binding site tentatively identified mutants impaired in the translocation step.

  11. Crystal Structure of the Neutralizing Llama VHH D7 and Its Mode of HIV-1 gp120 Interaction

    PubMed Central

    Hinz, Andreas; Lutje Hulsik, David; Forsman, Anna; Koh, Willie Wee-Lee; Belrhali, Hassan; Gorlani, Andrea; de Haard, Hans; Weiss, Robin A.; Verrips, Theo; Weissenhorn, Winfried

    2010-01-01

    HIV-1 entry into host cells is mediated by the sequential binding of the envelope glycoprotein gp120 to CD4 and a chemokine receptor. Antibodies binding to epitopes overlapping the CD4-binding site on gp120 are potent inhibitors of HIV entry, such as the llama heavy chain antibody fragment VHH D7, which has cross-clade neutralizing properties and competes with CD4 and mAb b12 for high affinity binding to gp120. We report the crystal structure of the D7 VHH at 1.5 Å resolution, which reveals the molecular details of the complementarity determining regions (CDR) and substantial flexibility of CDR3 that could facilitate an induced fit interaction with gp120. Structural comparison of CDRs from other CD4 binding site antibodies suggests diverse modes of interaction. Mutational analysis identified CDR3 as a key component of gp120 interaction as determined by surface plasmon resonance. A decrease in affinity is directly coupled to the neutralization efficiency since mutations that decrease gp120 interaction increase the IC50 required for HIV-1 IIIB neutralization. Thus the structural study identifies the long CDR3 of D7 as the key determinant of interaction and HIV-1 neutralization. Furthermore, our data confirm that the structural plasticity of gp120 can accommodate multiple modes of antibody binding within the CD4 binding site. PMID:20463957

  12. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  13. Simulation of electron-proton coupling with a Monte Carlo method: application to cytochrome c3 using continuum electrostatics.

    PubMed Central

    Baptista, A M; Martel, P J; Soares, C M

    1999-01-01

    A new method is presented for simulating the simultaneous binding equilibrium of electrons and protons on protein molecules, which makes it possible to study the full equilibrium thermodynamics of redox and protonation processes, including electron-proton coupling. The simulations using this method reflect directly the pH and electrostatic potential of the environment, thus providing a much closer and realistic connection with experimental parameters than do usual methods. By ignoring the full binding equilibrium, calculations usually overlook the twofold effect that binding fluctuations have on the behavior of redox proteins: first, they affect the energy of the system by creating partially occupied sites; second, they affect its entropy by introducing an additional empty/occupied site disorder (here named occupational entropy). The proposed method is applied to cytochrome c3 of Desulfovibrio vulgaris Hildenborough to study its redox properties and electron-proton coupling (redox-Bohr effect), using a continuum electrostatic method based on the linear Poisson-Boltzmann equation. Unlike previous studies using other methods, the full reduction order of the four hemes at physiological pH is successfully predicted. The sites more strongly involved in the redox-Bohr effect are identified by analysis of their titration curves/surfaces and the shifts of their midpoint redox potentials and pKa values. Site-site couplings are analyzed using statistical correlations, a method much more realistic than the usual analysis based on direct interactions. The site found to be more strongly involved in the redox-Bohr effect is propionate D of heme I, in agreement with previous studies; other likely candidates are His67, the N-terminus, and propionate D of heme IV. Even though the present study is limited to equilibrium conditions, the possible role of binding fluctuations in the concerted transfer of protons and electrons under nonequilibrium conditions is also discussed. The occupational entropy contributions to midpoint redox potentials and pKa values are computed and shown to be significant. PMID:10354425

  14. SH3 domain-mediated binding of the Drk protein to Dos is an important step in signaling of Drosophila receptor tyrosine kinases.

    PubMed

    Feller, Stephan M; Wecklein, Heike; Lewitzky, Marc; Kibler, Eike; Raabe, Thomas

    2002-08-01

    Activation of the Sevenless (Sev) receptor tyrosine kinase (RTK) in the developing Drosophila eye is required for the specification of the R7 photoreceptor cell fate. Daughter of Sevenless (Dos), a putative multi-site adaptor protein, is a substrate of the Sev kinase and is known to associate with the tyrosine phosphatase Corkscrew (Csw). Binding of Csw to Dos depends on the Csw Src homology 2 (SH2) domains and is an essential step for signaling by the Sev RTK. Dos, however, lacks a recognizable phosphotyrosine interaction domain and it was previously unclear how it is recruited to the Sev receptor. Here it is shown that the SH2/SH3 domain adaptor protein Drk can provide this link. Drk binds with its SH2 domain to the autophosphorylated Sev receptor while the C-terminal SH3 domain is able to associate with Dos. The Drk SH3 domain binding motifs on Dos were mapped to two sites which do not conform the known Drk SH3 domain binding motif (PxxPxR) but instead have the consensus PxxxRxxKP. Mutational analysis in vitro and in vivo provided evidence that both Drk binding sites fulfil an important function in the context of Sev and Drosophila epidermal growth factor receptor mediated signaling processes.

  15. Mutational analysis of human RNA polymerase II subunit 5 (RPB5): the residues critical for interactions with TFIIF subunit RAP30 and hepatitis B virus X protein.

    PubMed

    Le, Thi Thu Thuy; Zhang, Shijun; Hayashi, Naoyuki; Yasukawa, Mami; Delgermaa, Luvsanjav; Murakami, Seishi

    2005-09-01

    RNA polymerase II (RNAPII) subunit 5 (RPB5) is positioned close to DNA downstream of the initiation site and is the site of interaction with several regulators. Hepatitis B virus X protein (HBx) binds the central part of RPB5 to modulate activated transcription, and TFIIF subunit RAP30 interacts with the same part of RPB5 that is critical for the association between TFIIF and RNAPII. However the residues necessary for these interactions remain unknown. Here we report systematic mutagenesis of the central part of RPB5 using two-step alanine scanning libraries to pinpoint critical residues for its binding to RAP30 in the TFIIF complex and/or to HBx, and identified these residues in both mammalian cells and in an in vitro binding assay. Four residues, F76, I104, T111 and S113, are critical for both TFIIF- and HBx-binding, indicating the overlapping nature of the sites of interaction. In addition, V74 and N98 are required for HBx-binding, and T56 and L58 are needed for RAP30-binding. Interestingly the residues exposed to solvent, T111 and S113, are very close to the DNA, implying that two factors may modulate the interaction between DNA and RPB5.

  16. The large terminase DNA packaging motor grips DNA with its ATPase domain for cleavage by the flexible nuclease domain

    PubMed Central

    Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang

    2017-01-01

    Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398

  17. Identification of the Regulon of AphB and Its Essential Roles in LuxR and Exotoxin Asp Expression in the Pathogen Vibrio alginolyticus.

    PubMed

    Gao, Xiating; Liu, Yang; Liu, Huan; Yang, Zhen; Liu, Qin; Zhang, Yuanxing; Wang, Qiyao

    2017-10-15

    In Vibrio species, AphB is essential to activate virulence cascades by sensing low-pH and anaerobiosis signals; however, its regulon remains largely unknown. Here, AphB is found to be a key virulence regulator in Vibrio alginolyticus , a pathogen for marine animals and humans. Chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq) enabled the detection of 20 loci in the V. alginolyticus genome that contained AphB-binding peaks. An AphB-specific binding consensus was confirmed by electrophoretic mobility shift assays (EMSAs), and the regulation of genes flanking such binding sites was demonstrated using quantitative real-time PCR analysis. AphB binds directly to its own promoter and positively controls its own expression in later growth stages. AphB also activates the expression of the exotoxin Asp by binding directly to the promoter regions of asp and the master quorum-sensing (QS) regulator luxR DNase I footprinting analysis uncovered distinct AphB-binding sites (BBS) in these promoters. Furthermore, a BBS in the luxR promoter region overlaps that of LuxR-binding site I, which mediates the positive control of luxR promoter activity by AphB. This study provides new insights into the AphB regulon and reveals the mechanisms underlying AphB regulation of physiological adaptation and QS-controlled virulence in V. alginolyticus IMPORTANCE In this work, AphB is determined to play essential roles in the expression of genes associated with QS, physiology, and virulence in V. alginolyticus , a pathogen for marine animals and humans. AphB was found to bind directly to 20 genes and control their expression by a 17-bp consensus binding sequence. Among the 20 genes, the aphB gene itself was identified to be positively autoregulated, and AphB also positively controlled asp and luxR expression. Taken together, these findings improve our understanding of the roles of AphB in controlling physiological adaptation and QS-controlled virulence gene expression. Copyright © 2017 American Society for Microbiology.

  18. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  19. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  20. Structural analysis of a putative SAM-dependent methyltransferase, YtqB, from Bacillus subtilis.

    PubMed

    Park, Sun Cheol; Song, Wan Seok; Yoon, Sung-il

    2014-04-18

    S-adenosyl-L-methionine (SAM)-dependent methyltransferases (MTases) methylate diverse biological molecules using a SAM cofactor. The ytqB gene of Bacillus subtilis encodes a putative MTase and its biological function has never been characterized. To reveal the structural features and the cofactor binding mode of YtqB, we have determined the crystal structures of YtqB alone and in complex with its cofactor, SAM, at 1.9 Å and 2.2 Å resolutions, respectively. YtqB folds into a β-sheet sandwiched by two α-helical layers, and assembles into a dimeric form. Each YtqB monomer contains one SAM binding site, which shapes SAM into a slightly curved conformation and exposes the reactive methyl group of SAM potentially to a substrate. Our comparative structural analysis of YtqB and its homologues indicates that YtqB is a SAM-dependent class I MTase, and provides insights into the substrate binding site of YtqB. Copyright © 2014 Elsevier Inc. All rights reserved.

Top