Thermodynamic modeling of donor splice site recognition in pre-mRNA

NASA Astrophysics Data System (ADS)

Garland, Jeffrey A.; Aalberts, Daniel P.

2004-04-01

When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 small nuclear RNA with the donor ( 5' ) splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our “finding with binding” method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

CisMiner: Genome-Wide In-Silico Cis-Regulatory Module Prediction by Fuzzy Itemset Mining

PubMed Central

Navarro, Carmen; Lopez, Francisco J.; Cano, Carlos; Garcia-Alcalde, Fernando; Blanco, Armando

2014-01-01

Eukaryotic gene control regions are known to be spread throughout non-coding DNA sequences which may appear distant from the gene promoter. Transcription factors are proteins that coordinately bind to these regions at transcription factor binding sites to regulate gene expression. Several tools allow to detect significant co-occurrences of closely located binding sites (cis-regulatory modules, CRMs). However, these tools present at least one of the following limitations: 1) scope limited to promoter or conserved regions of the genome; 2) do not allow to identify combinations involving more than two motifs; 3) require prior information about target motifs. In this work we present CisMiner, a novel methodology to detect putative CRMs by means of a fuzzy itemset mining approach able to operate at genome-wide scale. CisMiner allows to perform a blind search of CRMs without any prior information about target CRMs nor limitation in the number of motifs. CisMiner tackles the combinatorial complexity of genome-wide cis-regulatory module extraction using a natural representation of motif combinations as itemsets and applying the Top-Down Fuzzy Frequent- Pattern Tree algorithm to identify significant itemsets. Fuzzy technology allows CisMiner to better handle the imprecision and noise inherent to regulatory processes. Results obtained for a set of well-known binding sites in the S. cerevisiae genome show that our method yields highly reliable predictions. Furthermore, CisMiner was also applied to putative in-silico predicted transcription factor binding sites to identify significant combinations in S. cerevisiae and D. melanogaster, proving that our approach can be further applied genome-wide to more complex genomes. CisMiner is freely accesible at: http://genome2.ugr.es/cisminer. CisMiner can be queried for the results presented in this work and can also perform a customized cis-regulatory module prediction on a query set of transcription factor binding sites provided by the user. PMID:25268582

Non-competitive inhibition by active site binders.

PubMed

Blat, Yuval

2010-06-01

Classical enzymology has been used for generations to understand the interactions of inhibitors with their enzyme targets. Enzymology tools enabled prediction of the biological impact of inhibitors as well as the development of novel, more potent, ones. Experiments designed to examine the competition between the tested inhibitor and the enzyme substrate(s) are the tool of choice to identify inhibitors that bind in the active site. Competition between an inhibitor and a substrate is considered a strong evidence for binding of the inhibitor in the active site, while the lack of competition suggests binding to an alternative site. Nevertheless, exceptions to this notion do exist. Active site-binding inhibitors can display non-competitive inhibition patterns. This unusual behavior has been observed with enzymes utilizing an exosite for substrate binding, isomechanism enzymes, enzymes with multiple substrates and/or products and two-step binding inhibitors. In many of these cases, the mechanisms underlying the lack of competition between the substrate and the inhibitor are well understood. Tools like alternative substrates, testing the enzyme reaction in the reverse direction and monitoring inhibition time dependence can be applied to enable distinction between 'badly behaving' active site binders and true exosite inhibitors.

Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

PubMed

Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

2018-09-01

Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

PubMed Central

Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

2017-01-01

Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

Genome-Wide Identification of Binding Sites Defines Distinct Functions for Caenorhabditis elegans PHA-4/FOXA in Development and Environmental Response

PubMed Central

Zhong, Mei; Niu, Wei; Lu, Zhi John; Sarov, Mihail; Murray, John I.; Janette, Judith; Raha, Debasish; Sheaffer, Karyn L.; Lam, Hugo Y. K.; Preston, Elicia; Slightham, Cindie; Hillier, LaDeana W.; Brock, Trisha; Agarwal, Ashish; Auerbach, Raymond; Hyman, Anthony A.; Gerstein, Mark; Mango, Susan E.; Kim, Stuart K.; Waterston, Robert H.; Reinke, Valerie; Snyder, Michael

2010-01-01

Transcription factors are key components of regulatory networks that control development, as well as the response to environmental stimuli. We have established an experimental pipeline in Caenorhabditis elegans that permits global identification of the binding sites for transcription factors using chromatin immunoprecipitation and deep sequencing. We describe and validate this strategy, and apply it to the transcription factor PHA-4, which plays critical roles in organ development and other cellular processes. We identified thousands of binding sites for PHA-4 during formation of the embryonic pharynx, and also found a role for this factor during the starvation response. Many binding sites were found to shift dramatically between embryos and starved larvae, from developmentally regulated genes to genes involved in metabolism. These results indicate distinct roles for this regulator in two different biological processes and demonstrate the versatility of transcription factors in mediating diverse biological roles. PMID:20174564

Determining the Binding Sites of β-Cyclodextrin and Peptides by Electron-Capture Dissociation High Resolution Tandem Mass Spectrometry

NASA Astrophysics Data System (ADS)

Qi, Yulin; Geib, Timon; Volmer, Dietrich A.

2015-07-01

Cyclodextrins (CDs) are a group of cyclic oligosaccharides, which readily form inclusion complexes with hydrophobic compounds to increase bioavailability, thus making CDs ideal drug excipients. Recent studies have also shown that CDs exhibit a wide range of protective effects, preventing proteins from aggregation, degradation, and folding. These effects strongly depend on the binding sites on the protein surface. CDs only exhibit weak interactions with amino acids, however; conventional analytical techniques therefore usually fail to reveal the exact location of the binding sites. Moreover, some studies even suggest that CD inclusion complexes are merely electrostatic adducts. Here, electron capture dissociation (ECD) was applied in this proof-of-concept study to examine the exact nature of the CD/peptide complexes, and CD binding sites were unambiguously located for the first time via Fourier-transform ion cyclotron resonance (FTICR) tandem mass spectrometry.

DOE Office of Scientific and Technical Information (OSTI.GOV)

B Akabayov; C Richardson

Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstratemore » that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.« less

The allosteric citalopram binding site differentially interferes with neuronal firing rate and SERT trafficking in serotonergic neurons.

PubMed

Matthäus, Friederike; Haddjeri, Nasser; Sánchez, Connie; Martí, Yasmina; Bahri, Senda; Rovera, Renaud; Schloss, Patrick; Lau, Thorsten

2016-11-01

Citalopram is a clinically applied selective serotonin re-uptake inhibitor for antidepressant pharmacotherapy. It consists of two enantiomers, S-citalopram (escitalopram) and R-citalopram, of which escitalopram exerts the antidepressant therapeutic effect and has been shown to be one of the most efficient antidepressants, while R-citalopram antagonizes escitalopram via an unknown molecular mechanism that may depend on binding to a low-affinity allosteric binding site of the serotonin transporter. However, the precise mechanism of antidepressant regulation of the serotonin transporter by citalopram enantiomers still remains elusive. Here we investigate escitalopram׳s acute effect on (1) serotonergic neuronal firing in transgenic mice that express the human serotonin transporter without and with a mutation that disables the allosteric binding site, and (2) regulation of the serotonin transporter׳s cell surface localization in stem cell-derived serotonergic neurons. Our results demonstrate that escitalopram inhibited neuronal firing less potently in the mouse line featuring a mutation that abolishes the function of the allosteric binding site and induced serotonin transporter internalization independently of the allosteric binding site mechanism. Furthermore, citalopram enantiomers dose-dependently induced serotonin transporter internalization. In conclusion, this study provides new insight into antidepressant effects exerted by citalopram enantiomers in presence and absence of a functional allosteric binding site. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.

Computational simulation of formin-mediated actin polymerization predicts homologue-dependent mechanosensitivity.

PubMed

Bryant, Derek; Clemens, Lara; Allard, Jun

2017-01-01

Many actin structures are nucleated and assembled by the barbed-end tracking polymerase formin family, including filopodia, focal adhesions, the cytokinetic ring and cell cortex. These structures respond to forces in distinct ways. Formins typically have profilin-actin binding sites embedded in highly flexible disordered FH1 domains, hypothesized to diffusively explore space to rapidly capture actin monomers for delivery to the barbed end. Recent experiments demonstrate that formin-mediated polymerization accelerates when under tension. The acceleration has been attributed to modifying the state of the FH2 domain of formin. Intriguingly, the same acceleration is reported when tension is applied to the FH1 domains, ostensibly pulling monomers away from the barbed end. Here we develop a mesoscale coarse-grain model of formin-mediated actin polymerization, including monomer capture and delivery by FH1, which sterically interacts with actin along its entire length. The binding of actin monomers to their specific sites on FH1 is entropically disfavored by the high disorder. We find that this penalty is attenuated when force is applied to the FH1 domain by revealing the binding site, increasing monomer capture efficiency. Overall polymerization rates can decrease or increase with increasing force, depending on the length of FH1 domain and location of binding site. Our results suggest that the widely varying FH1 lengths and binding site locations found in known formins could be used to differentially respond to force, depending on the actin structure being assembled. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Modeling protein-small molecule interactions: structure and thermodynamics of noble gases binding in a cavity in mutant phage T4 lysozyme L99A.

PubMed

Mann, G; Hermans, J

2000-09-29

The complexes of phage T4 lysozyme L99A with noble gases have been studied by molecular dynamics simulation. In a long simulation of the complex with one Xe atom, the structure was found to undergo global conformation change involving a reversible opening and closing of the entrance to the substrate-binding site, during which the conformations of the N and C-terminal domains varied little. The distributions of Xe positions sampled in dynamics simulations were refined in terms of anisotropic Gaussian distributions via least-squares minimization of the difference between Fourier transforms. In addition, molecular transformation simulations have been applied in order to calculate the binding free energies of Xe, Kr and Ar relative to a standard state at a pressure of 1 bar. A single bound Xe is found to assume an equilibrium distribution over three adjacent preferred sites, while in a two-Xe complex, the two Xe atoms preferentially occupy two of these. The positions of the three sites agree closely with the positions of bound Xe determined in the refined crystal structure of a complex formed at a pressure of 8 bar Xe, and the calculated affinities agree well with the observed partial occupancies. At a pressure of 8 bar, a mixture of one-Xe and two-Xe complexes is present, and similarly for complexes with Kr and Ar, with single occupancy relatively more prevalent with Kr and Ar. (Binding of a third Xe atom is found to be quite unfavorable.) A comparison with simulation results for the binding of benzene to the same site leads to the conclusion that binding of Xe within cavities in proteins is common because of several favorable factors: (1) Xe has a large atomic polarizability; (2) Xe can be applied at a relatively high pressure, i.e. high chemical potential; (3) an unfavorable entropic term related to the need to orient the ligand in the binding site is absent. Finally, it is found that the model's binding energy of a water molecule in the cavity is insufficient to overcome the unfavorable binding entropy. Copyright 2000 Academic Press.

A Large-Scale Assessment of Nucleic Acids Binding Site Prediction Programs

PubMed Central

Miao, Zhichao; Westhof, Eric

2015-01-01

Computational prediction of nucleic acid binding sites in proteins are necessary to disentangle functional mechanisms in most biological processes and to explore the binding mechanisms. Several strategies have been proposed, but the state-of-the-art approaches display a great diversity in i) the definition of nucleic acid binding sites; ii) the training and test datasets; iii) the algorithmic methods for the prediction strategies; iv) the performance measures and v) the distribution and availability of the prediction programs. Here we report a large-scale assessment of 19 web servers and 3 stand-alone programs on 41 datasets including more than 5000 proteins derived from 3D structures of protein-nucleic acid complexes. Well-defined binary assessment criteria (specificity, sensitivity, precision, accuracy…) are applied. We found that i) the tools have been greatly improved over the years; ii) some of the approaches suffer from theoretical defects and there is still room for sorting out the essential mechanisms of binding; iii) RNA binding and DNA binding appear to follow similar driving forces and iv) dataset bias may exist in some methods. PMID:26681179

CD/MCD/VTVH-MCD Studies of Escherichia coli Bacterioferritin Support a Binuclear Iron Cofactor Site.

PubMed

Kwak, Yeonju; Schwartz, Jennifer K; Huang, Victor W; Boice, Emily; Kurtz, Donald M; Solomon, Edward I

2015-12-01

Ferritins and bacterioferritins (Bfrs) utilize a binuclear non-heme iron binding site to catalyze oxidation of Fe(II), leading to formation of an iron mineral core within a protein shell. Unlike ferritins, in which the diiron site binds Fe(II) as a substrate, which then autoxidizes and migrates to the mineral core, the diiron site in Bfr has a 2-His/4-carboxylate ligand set that is commonly found in diiron cofactor enzymes. Bfrs could, therefore, utilize the diiron site as a cofactor rather than for substrate iron binding. In this study, we applied circular dichroism (CD), magnetic CD (MCD), and variable-temperature, variable-field MCD (VTVH-MCD) spectroscopies to define the geometric and electronic structures of the biferrous active site in Escherichia coli Bfr. For these studies, we used an engineered M52L variant, which is known to eliminate binding of a heme cofactor but to have very minor effects on either iron oxidation or mineral core formation. We also examined an H46A/D50A/M52L Bfr variant, which additionally disrupts a previously observed mononuclear non-heme iron binding site inside the protein shell. The spectral analyses define a binuclear and an additional mononuclear ferrous site. The biferrous site shows two different five-coordinate centers. After O2 oxidation and re-reduction, only the mononuclear ferrous signal is eliminated. The retention of the biferrous but not the mononuclear ferrous site upon O2 cycling supports a mechanism in which the binuclear site acts as a cofactor for the O2 reaction, while the mononuclear site binds the substrate Fe(II) that, after its oxidation to Fe(III), migrates to the mineral core.

Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

PubMed

Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

2018-03-28

Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Purification and sequencing of the active site tryptic peptide from penicillin-binding protein 1b of Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicholas, R.A.; Suzuki, H.; Hirota, Y.

This paper reports the sequence of the active site peptide of penicillin-binding protein 1b from Escherichia coli. Purified penicillin-binding protein 1b was labeled with (/sup 14/C)penicillin G, digested with trypsin, and partially purified by gel filtration. Upon further purification by high-pressure liquid chromatography, two radioactive peaks were observed, and the major peak, representing over 75% of the applied radioactivity, was submitted to amino acid analysis and sequencing. The sequence Ser-Ile-Gly-Ser-Leu-Ala-Lys was obtained. The active site nucleophile was identified by digesting the purified peptide with aminopeptidase M and separating the radioactive products on high-pressure liquid chromatography. Amino acid analysis confirmed thatmore » the serine residue in the middle of the sequence was covalently bonded to the (/sup 14/C)penicilloyl moiety. A comparison of this sequence to active site sequences of other penicillin-binding proteins and beta-lactamases is presented.« less

Protein-protein docking with binding site patch prediction and network-based terms enhanced combinatorial scoring.

PubMed

Gong, Xinqi; Wang, Panwen; Yang, Feng; Chang, Shan; Liu, Bin; He, Hongqiu; Cao, Libin; Xu, Xianjin; Li, Chunhua; Chen, Weizu; Wang, Cunxin

2010-11-15

Protein-protein docking has made much progress in recent years, but challenges still exist. Here we present the application of our docking approach HoDock in CAPRI. In this approach, a binding site prediction is implemented to reduce docking sampling space and filter out unreasonable docked structures, and a network-based enhanced combinatorial scoring function HPNCscore is used to evaluate the decoys. The experimental information was combined with the predicted binding site to pick out the most likely key binding site residues. We applied the HoDock method in the recent rounds of the CAPRI experiments, and got good results as predictors on targets 39, 40, and 41. We also got good results as scorers on targets 35, 37, 40, and 41. This indicates that our docking approach can contribute to the progress of protein-protein docking methods and to the understanding of the mechanism of protein-protein interactions. © 2010 Wiley-Liss, Inc.

Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

PubMed

Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

2015-02-10

Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

Energetics of Glutamate Binding to an Ionotropic Glutamate Receptor.

PubMed

Yu, Alvin; Lau, Albert Y

2017-11-22

Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that are responsible for the majority of excitatory transmission at the synaptic cleft. Mechanically speaking, agonist binding to the ligand binding domain (LBD) activates the receptor by triggering a conformational change that is transmitted to the transmembrane region, opening the ion channel pore. We use fully atomistic molecular dynamics simulations to investigate the binding process in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor, an iGluR subtype. The string method with swarms of trajectories was applied to calculate the possible pathways glutamate traverses during ligand binding. Residues peripheral to the binding cleft are found to metastably bind the ligand prior to ligand entry into the binding pocket. Umbrella sampling simulations were performed to compute the free energy barriers along the binding pathways. The calculated free energy profiles demonstrate that metastable interactions contribute substantially to the energetics of ligand binding and form local minima in the overall free energy landscape. Protein-ligand interactions at sites outside of the orthosteric agonist-binding site may serve to lower the transition barriers of the binding process.

Discrete persistent-chain model for protein binding on DNA.

PubMed

Lam, Pui-Man; Zhen, Yi

2011-04-01

We describe and solve a discrete persistent-chain model of protein binding on DNA, involving an extra σ(i) at a site i of the DNA. This variable takes the value 1 or 0, depending on whether or not the site is occupied by a protein. In addition, if the site is occupied by a protein, there is an extra energy cost ɛ. For a small force, we obtain analytic expressions for the force-extension curve and the fraction of bound protein on the DNA. For higher forces, the model can be solved numerically to obtain force-extension curves and the average fraction of bound proteins as a function of applied force. Our model can be used to analyze experimental force-extension curves of protein binding on DNA, and hence deduce the number of bound proteins in the case of nonspecific binding. ©2011 American Physical Society

Binding site stoichiometry and the effects of phosphorylation on human α1 homomeric glycine receptors

PubMed Central

Gentet, Luc J; Clements, John D

2002-01-01

The kinetic properties of the human α1 homomeric glycine receptor were investigated. Receptors were expressed in HEK 293 cells, and glycine was applied to outside-out membrane patches with sub-millisecond solution exchange. The activation time course of the glycine response was used to investigate receptor stoichiometry. The unbinding of three strychnine molecules and the cooperative binding of two glycine molecules were required to activate the channel. The effects of phosphorylation on glycine receptor kinetics were investigated by pretreating cells with phosphorylators or with phosphatases. Phosphorylation accelerated desensitisation, but slowed deactivation and recovery from desensitisation. A chemical-kinetic model was developed that reproduced the experimental observations. The model suggests that only three binding sites on the glycine channel are functional, while the remaining two binding sites are ‘silent’, possibly due to strong negative cooperativity. PMID:12356883

Genome-wide analysis of AR binding and comparison with transcript expression in primary human fetal prostate fibroblasts and cancer associated fibroblasts.

PubMed

Nash, Claire; Boufaied, Nadia; Mills, Ian G; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

2017-05-05

The androgen receptor (AR) is a transcription factor, and key regulator of prostate development and cancer, which has discrete functions in stromal versus epithelial cells. AR expressed in mesenchyme is necessary and sufficient for prostate development while loss of stromal AR is predictive of prostate cancer progression. Many studies have characterized genome-wide binding of AR in prostate tumour cells but none have used primary mesenchyme or stroma. We applied ChIPseq to identify genomic AR binding sites in primary human fetal prostate fibroblasts and patient derived cancer associated fibroblasts, as well as the WPMY1 cell line overexpressing AR. We identified AR binding sites that were specific to fetal prostate fibroblasts (7534), cancer fibroblasts (629), WPMY1-AR (2561) as well as those common among all (783). Primary fibroblasts had a distinct AR binding profile versus prostate cancer cell lines and tissue, and showed a localisation to gene promoter binding sites 1 kb upstream of the transcriptional start site, as well as non-classical AR binding sequence motifs. We used RNAseq to define transcribed genes associated with AR binding sites and derived cistromes for embryonic and cancer fibroblasts as well as a cistrome common to both. These were compared to several in vivo ChIPseq and transcript expression datasets; which identified subsets of AR targets that were expressed in vivo and regulated by androgens. This analysis enabled us to deconvolute stromal AR targets active in stroma within tumour samples. Taken together, our data suggest that the AR shows significantly different genomic binding site locations in primary prostate fibroblasts compared to that observed in tumour cells. Validation of our AR binding site data with transcript expression in vitro and in vivo suggests that the AR target genes we have identified in primary fibroblasts may contribute to clinically significant and biologically important AR-regulated changes in prostate tissue. Copyright © 2017. Published by Elsevier B.V.

Increased thyrotropin binding in hyperfunctioning thyroid nodules.

PubMed

Müller-Gärtner, H W; Schneider, C; Bay, V; Tadt, A; Rehpenning, W; de Heer, K; Jessel, M

1987-08-01

The object of this study was to investigate TSH receptors in hyperfunctioning thyroid nodules (HFN). In HFN, obtained from seven patients, 125-I-TSH binding as determined by equilibrium binding analysis on particulate membrane preparations, was found to be significantly increased as compared with normal thyroid tissues (five patients; P less than 0.001). Scatchard analysis of TSH-binding revealed two kinds of binding sites for both normal thyroid tissue and HFN, and displayed significantly increased association constants of high- and low-affinity binding sites in HFN (Ka = 11.75 +/- 6.8 10(9) M-1, P less than 0.001 and Ka = 2.1 +/- 1.0 10(7) M-1, P less than 0.025; x +/- SEM) as compared with normal thyroid tissue (Ka = 0.25 +/- 0.06 10(9) M-1, Ka = 0.14 +/- 0.03 10(7) M-1; x +/- SEM). The capacity of the high-affinity binding sites in HFN was found to be decreased (1.8 +/- 1.1 pmol/mg protein, x +/- SEM) in comparison with normal thyroid tissue (4.26 +/- 1.27 pmol/mg protein; x +/- SEM). TSH-receptor autoradiography applied to cryostatic tissue sections confirmed increased TSH binding of the follicular epithelium in HFN. These data suggest that an increased affinity of TSH-receptor sites in HFN in iodine deficient areas may be an important event in thyroid autonomy.

Determination of the affinity of drugs toward serum albumin by measurement of the quenching of the intrinsic tryptophan fluorescence of the protein.

PubMed

Epps, D E; Raub, T J; Caiolfa, V; Chiari, A; Zamai, M

1999-01-01

Binding of new chemical entities to serum proteins is an issue confronting pharmaceutical companies during development of potential therapeutic agents. Most drugs bind to the most abundant plasma protein, human serum albumin (HSA), at two major binding sites. Excepting fluorescence spectroscopy, existing methods for assaying drug binding to serum albumin are insensitive to higher-affinity compounds and can be labour-intensive, time-consuming, and usually require compound-specific assays. This led us to examine alternative ways to measure drug-albumin interaction. One method described here uses fluorescence quenching of the single tryptophan (Trp) residue in HSA excited at 295 nm to measure drug-binding affinity. Unfortunately, many compounds absorb, fluoresce, or both, in this UV wavelength region of the spectrum. Several types of binding phenomenon and spectral interference were identified by use of six structurally unrelated compounds and the equations necessary to make corrections mathematically were derived and applied to calculate binding constants accurately. The general cases were: direct quenching of Trp fluorescence by optically transparent ligands with low or high affinities; binding of optically transparent, non-fluorescent ligands to two specific sites where both sites or only one site result in Trp fluorescence quenching; and chromophores whose absorption either overlaps the Trp emission and quenches by energy transfer or absorbs light at the Trp fluorescence excitation wavelength producing absorptive screening as well as fluorescence quenching. Unless identification of the site specificity of drug binding to serum albumin is desired, quenching of the Trp fluorescence of albumin by titration with ligand is a rapid and facile method for determining the binding affinities of drugs for serum albumin.

Discovering amino acid patterns on binding sites in protein complexes

PubMed Central

Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

2011-01-01

Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

Substrate binding interferes with active site conformational dynamics in endoglucanase Cel5A from Thermobifida fusca.

PubMed

Jiang, Xukai; Wang, Yuying; Xu, Limei; Chen, Guanjun; Wang, Lushan

2017-09-09

The role of protein dynamics in enzyme catalysis is one of the most active areas in current enzymological research. Here, using endoglucanase Cel5A from Thermobifida fusca (TfCel5A) as a model, we applied molecular dynamics simulations to explore the dynamic behavior of the enzyme upon substrate binding. The collective motions of the active site revealed that the mechanism of TfCel5A substrate binding can likely be described by the conformational-selection model; however, we observed that the conformations of active site residues changed differently along with substrate binding. Although most active site residues retained their native conformational ensemble, some (Tyr163 and Glu355) generated newly induced conformations, whereas others (Phe162 and Tyr189) exhibited shifts in the equilibration of their conformational distributions. These results showed that TfCel5A substrate binding relied on a hybrid mechanism involving induced fit and conformational selection. Interestingly, we found that TfCel5A active site could only partly rebalance its conformational dynamics upon substrate dissociation within the same simulation time, which implies that the conformational rebalance upon substrate dissociation is likely more difficult than the conformational selection upon substrate binding at least in the view of the time required. Our findings offer new insight into enzyme catalysis and potential applications for future protein engineering. Copyright © 2017 Elsevier Inc. All rights reserved.

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding

PubMed Central

Gilad, Yoav; Pritchard, Jonathan K.; Stephens, Matthew

2015-01-01

Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede. PMID:26406244

msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding.

PubMed

Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew

2015-01-01

Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.

Exploring the binding pathways of the 14-3-3ζ protein: Structural and free-energy profiles revealed by Hamiltonian replica exchange molecular dynamics with distancefield distance restraints

PubMed Central

Nagy, Gabor; Oostenbrink, Chris; Hritz, Jozef

2017-01-01

The 14-3-3 protein family performs regulatory functions in eukaryotic organisms by binding to a large number of phosphorylated protein partners. Whilst the binding mode of the phosphopeptides within the primary 14-3-3 binding site is well established based on the crystal structures of their complexes, little is known about the binding process itself. We present a computational study of the process by which phosphopeptides bind to the 14-3-3ζ protein. Applying a novel scheme combining Hamiltonian replica exchange molecular dynamics and distancefield restraints allowed us to map and compare the most likely phosphopeptide-binding pathways to the 14-3-3ζ protein. The most important structural changes to the protein and peptides involved in the binding process were identified. In order to bind phosphopeptides to the primary interaction site, the 14-3-3ζ adopted a newly found wide-opened conformation. Based on our findings we additionally propose a secondary interaction site on the inner surface of the 14-3-3ζ dimer, and a direct interference on the binding process by the flexible C-terminal tail. A minimalistic model was designed to allow for the efficient calculation of absolute binding affinities. Binding affinities calculated from the potential of mean force along the binding pathway are in line with the available experimental estimates for two of the studied systems. PMID:28727767

Binding of fluoresceinated epidermal growth factor to A431 cell sub-populations studied using a model-independent analysis of flow cytometric fluorescence data.

PubMed Central

Chatelier, R C; Ashcroft, R G; Lloyd, C J; Nice, E C; Whitehead, R H; Sawyer, W H; Burgess, A W

1986-01-01

A method is developed for determining ligand-cell association parameters from a model-free analysis of data obtained with a flow cytometer. The method requires measurement of the average fluorescence per cell as a function of ligand and cell concentration. The analysis is applied to data obtained for the binding of fluoresceinated epidermal growth factor to a human epidermoid carcinoma cell line, A431. The results indicate that the growth factor binds to two classes of sites on A431 cells: 4 X 10(4) sites with a dissociation constant (KD) of less than or equal to 20 pM, and 1.5 X 10(6) sites with a KD of 3.7 nM. A derived plot of the average fluorescence per cell versus the average number of bound ligands per cell is used to construct binding isotherms for four sub-populations of A431 cells fractionated on the basis of low-angle light scatter. The four sub-populations bind the ligand with equal affinity but differ substantially in terms of the number of binding sites per cell. We also use this new analysis to critically evaluate the use of 'Fluorotrol' as a calibration standard in flow cytometry. PMID:3015587

Recognition of functional sites in protein structures.

PubMed

Shulman-Peleg, Alexandra; Nussinov, Ruth; Wolfson, Haim J

2004-06-04

Recognition of regions on the surface of one protein, that are similar to a binding site of another is crucial for the prediction of molecular interactions and for functional classifications. We first describe a novel method, SiteEngine, that assumes no sequence or fold similarities and is able to recognize proteins that have similar binding sites and may perform similar functions. We achieve high efficiency and speed by introducing a low-resolution surface representation via chemically important surface points, by hashing triangles of physico-chemical properties and by application of hierarchical scoring schemes for a thorough exploration of global and local similarities. We proceed to rigorously apply this method to functional site recognition in three possible ways: first, we search a given functional site on a large set of complete protein structures. Second, a potential functional site on a protein of interest is compared with known binding sites, to recognize similar features. Third, a complete protein structure is searched for the presence of an a priori unknown functional site, similar to known sites. Our method is robust and efficient enough to allow computationally demanding applications such as the first and the third. From the biological standpoint, the first application may identify secondary binding sites of drugs that may lead to side-effects. The third application finds new potential sites on the protein that may provide targets for drug design. Each of the three applications may aid in assigning a function and in classification of binding patterns. We highlight the advantages and disadvantages of each type of search, provide examples of large-scale searches of the entire Protein Data Base and make functional predictions.

A global optimization algorithm for protein surface alignment

PubMed Central

2010-01-01

Background A relevant problem in drug design is the comparison and recognition of protein binding sites. Binding sites recognition is generally based on geometry often combined with physico-chemical properties of the site since the conformation, size and chemical composition of the protein surface are all relevant for the interaction with a specific ligand. Several matching strategies have been designed for the recognition of protein-ligand binding sites and of protein-protein interfaces but the problem cannot be considered solved. Results In this paper we propose a new method for local structural alignment of protein surfaces based on continuous global optimization techniques. Given the three-dimensional structures of two proteins, the method finds the isometric transformation (rotation plus translation) that best superimposes active regions of two structures. We draw our inspiration from the well-known Iterative Closest Point (ICP) method for three-dimensional (3D) shapes registration. Our main contribution is in the adoption of a controlled random search as a more efficient global optimization approach along with a new dissimilarity measure. The reported computational experience and comparison show viability of the proposed approach. Conclusions Our method performs well to detect similarity in binding sites when this in fact exists. In the future we plan to do a more comprehensive evaluation of the method by considering large datasets of non-redundant proteins and applying a clustering technique to the results of all comparisons to classify binding sites. PMID:20920230

Autoradiographic Distribution and Applied Pharmacological Characteristics of Dextromethorphan and Related Antitissue/Anticonvulsant Drugs and Novel Analogs.

DTIC Science & Technology

1992-08-01

OF DEXTROMETHORPHAN AND RELATED ANTITISSUE/ANTICONVULSANT DRUGS AND NOVEL ANALOGS PRINCIPAL INVESTIGATOR: Norman G. Bowery, Ph.D., DSc CONTRACTING...Characteristics of Dextromethorphan and DAMD17-90-C-0124 Related Anti ti ssue/ Anticonvul sant Drugs and Novel 6. AUTHOR(S) Analogs 61102A...13. ABSTRACT (Maximum 200 words) Binding of dextromethorphan and its analogues to the dextromethorphan binding site and to the PCP and glycine binding

Systematic optimization model and algorithm for binding sequence selection in computational enzyme design

PubMed Central

Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan

2013-01-01

A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589

Self-assembled nanospheres with multiple endohedral binding sites pre-organize catalysts and substrates for highly efficient reactions

NASA Astrophysics Data System (ADS)

Wang, Qi-Qiang; Gonell, Sergio; Leenders, Stefan H. A. M.; Dürr, Maximilian; Ivanović-Burmazović, Ivana; Reek, Joost N. H.

2016-03-01

Tuning reagent and catalyst concentrations is crucial in the development of efficient catalytic transformations. In enzyme-catalysed reactions the substrate is bound—often by multiple non-covalent interactions—in a well-defined pocket close to the active site of the enzyme; this pre-organization facilitates highly efficient transformations. Here we report an artificial system that co-encapsulates multiple catalysts and substrates within the confined space defined by an M12L24 nanosphere that contains 24 endohedral guanidinium-binding sites. Cooperative binding means that sulfonate guests are bound much more strongly than carboxylates. This difference has been used to fix gold-based catalysts firmly, with the remaining binding sites left to pre-organize substrates. This strategy was applied to a Au(I)-catalysed cyclization of acetylenic acid to enol lactone in which the pre-organization resulted in much higher reaction rates. We also found that the encapsulated sulfonate-containing Au(I) catalysts did not convert neutral (acid) substrates, and so could have potential in the development of substrate-selective catalysis and base-triggered on/off switching of catalysis.

A novel method for the study of molecular interaction by using microscale thermophoresis.

PubMed

Mao, Yexuan; Yu, Lanlan; Yang, Ran; Qu, Ling-bo; Harrington, Perter de B

2015-01-01

The fundamental studies for the binding events of protein and its partner are crucial in drug development. In this study, a novel technology named microscale thermophoresis (MST) was applied in the investigation of molecular interaction between an organic dye fluorescein isothiocyanate (FITC) and bovine serum albumin (BSA), and the results were compared with those obtained from conventional fluorescence spectroscopy. The MST data demonstrated that with a short interaction time, FITC showed a high binding affinity for BSA by weak interaction instead of labeling the protein. By using competitive strategies in which warfarin and ibuprofen acted as the site markers of BSA, FITC was proven to mainly bind to the hydrophobic pocket of site II of BSA compared to site I of BSA. Except for the binding affinity, MST also provided additional information with respect to the aggregation of BSA and the binding of FITC to BSA aggregates, which is unobtainable by fluorescence spectroscopy. This work proves that MST as a new approach is powerful and reliable for investigation of protein-small molecule interaction. Copyright © 2014 Elsevier B.V. All rights reserved.

Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

PubMed Central

Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

2014-01-01

Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

PubMed Central

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

2017-01-01

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

Analogs of methyllycaconitine as novel noncompetitive inhibitors of nicotinic receptors: pharmacological characterization, computational modeling, and pharmacophore development.

PubMed

McKay, Dennis B; Chang, Cheng; González-Cestari, Tatiana F; McKay, Susan B; El-Hajj, Raed A; Bryant, Darrell L; Zhu, Michael X; Swaan, Peter W; Arason, Kristjan M; Pulipaka, Aravinda B; Orac, Crina M; Bergmeier, Stephen C

2007-05-01

As a novel approach to drug discovery involving neuronal nicotinic acetylcholine receptors (nAChRs), our laboratory targeted nonagonist binding sites (i.e., noncompetitive binding sites, negative allosteric binding sites) located on nAChRs. Cultured bovine adrenal cells were used as neuronal models to investigate interactions of 67 analogs of methyllycaconitine (MLA) on native alpha3beta4* nAChRs. The availability of large numbers of structurally related molecules presents a unique opportunity for the development of pharmacophore models for noncompetitive binding sites. Our MLA analogs inhibited nicotine-mediated functional activation of both native and recombinant alpha3beta4* nAChRs with a wide range of IC(50) values (0.9-115 microM). These analogs had little or no inhibitory effects on agonist binding to native or recombinant nAChRs, supporting noncompetitive inhibitory activity. Based on these data, two highly predictive 3D quantitative structure-activity relationship (comparative molecular field analysis and comparative molecular similarity index analysis) models were generated. These computational models were successfully validated and provided insights into the molecular interactions of MLA analogs with nAChRs. In addition, a pharmacophore model was constructed to analyze and visualize the binding requirements to the analog binding site. The pharmacophore model was subsequently applied to search structurally diverse molecular databases to prospectively identify novel inhibitors. The rapid identification of eight molecules from database mining and our successful demonstration of in vitro inhibitory activity support the utility of these computational models as novel tools for the efficient retrieval of inhibitors. These results demonstrate the effectiveness of computational modeling and pharmacophore development, which may lead to the identification of new therapeutic drugs that target novel sites on nAChRs.

"In situ" observation of the role of chloride ion binding to monkey green sensitive visual pigment by ATR-FTIR spectroscopy.

PubMed

Katayama, Kota; Furutani, Yuji; Iwaki, Masayo; Fukuda, Tetsuya; Imai, Hiroo; Kandori, Hideki

2018-01-31

Long-wavelength-sensitive (LWS) pigment possesses a chloride binding site in its protein moiety. The binding of chloride alters the absorption spectra of LWS; this is known as the chloride effect. Although the two amino acid substitutions of His197 and Lys200 influence the chloride effect, the molecular mechanism of chloride binding, which underlies the spectral tuning, has yet to be clarified. In this study, we applied ATR-FTIR spectroscopy to monkey green (MG) pigment to gain structural information of the chloride binding site. The results suggest that chloride binding stabilizes the β-sheet structure on the extracellular side loop with perturbation of the retinal polyene chain, promotes a hydrogen bonding exchange with the hydroxyl group of Tyr, and alters the protonation state of carboxylate. Combining with the results of the binding analyses of various anions (Br - , I - and NO 3 - ), our findings suggest that the anion binding pocket is organized for only Cl - (or Br - ) to stabilize conformation around the retinal chromophore, which is functionally relevant with absorbing long wavelength light.

Global Mapping of Transcription Factor Binding Sites by Sequencing Chromatin Surrogates: a Perspective on Experimental Design, Data Analysis, and Open Problems.

PubMed

Wei, Yingying; Wu, George; Ji, Hongkai

2013-05-01

Mapping genome-wide binding sites of all transcription factors (TFs) in all biological contexts is a critical step toward understanding gene regulation. The state-of-the-art technologies for mapping transcription factor binding sites (TFBSs) couple chromatin immunoprecipitation (ChIP) with high-throughput sequencing (ChIP-seq) or tiling array hybridization (ChIP-chip). These technologies have limitations: they are low-throughput with respect to surveying many TFs. Recent advances in genome-wide chromatin profiling, including development of technologies such as DNase-seq, FAIRE-seq and ChIP-seq for histone modifications, make it possible to predict in vivo TFBSs by analyzing chromatin features at computationally determined DNA motif sites. This promising new approach may allow researchers to monitor the genome-wide binding sites of many TFs simultaneously. In this article, we discuss various experimental design and data analysis issues that arise when applying this approach. Through a systematic analysis of the data from the Encyclopedia Of DNA Elements (ENCODE) project, we compare the predictive power of individual and combinations of chromatin marks using supervised and unsupervised learning methods, and evaluate the value of integrating information from public ChIP and gene expression data. We also highlight the challenges and opportunities for developing novel analytical methods, such as resolving the one-motif-multiple-TF ambiguity and distinguishing functional and non-functional TF binding targets from the predicted binding sites. The online version of this article (doi:10.1007/s12561-012-9066-5) contains supplementary material, which is available to authorized users.

Computational Optimization and Characterization of Molecularly Imprinted Polymers

NASA Astrophysics Data System (ADS)

Terracina, Jacob J.

Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

PubMed

Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

2011-02-10

Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.

A fragment-based approach applied to a highly flexible target: Insights and challenges towards the inhibition of HSP70 isoforms

NASA Astrophysics Data System (ADS)

Jones, Alan M.; Westwood, Isaac M.; Osborne, James D.; Matthews, Thomas P.; Cheeseman, Matthew D.; Rowlands, Martin G.; Jeganathan, Fiona; Burke, Rosemary; Lee, Diane; Kadi, Nadia; Liu, Manjuan; Richards, Meirion; McAndrew, Craig; Yahya, Norhakim; Dobson, Sarah E.; Jones, Keith; Workman, Paul; Collins, Ian; van Montfort, Rob L. M.

2016-10-01

The heat shock protein 70s (HSP70s) are molecular chaperones implicated in many cancers and of significant interest as targets for novel cancer therapies. Several HSP70 inhibitors have been reported, but because the majority have poor physicochemical properties and for many the exact mode of action is poorly understood, more detailed mechanistic and structural insight into ligand-binding to HSP70s is urgently needed. Here we describe the first comprehensive fragment-based inhibitor exploration of an HSP70 enzyme, which yielded an amino-quinazoline fragment that was elaborated to a novel ATP binding site ligand with different physicochemical properties to known adenosine-based HSP70 inhibitors. Crystal structures of amino-quinazoline ligands bound to the different conformational states of the HSP70 nucleotide binding domain highlighted the challenges of a fragment-based approach when applied to this particular flexible enzyme class with an ATP-binding site that changes shape and size during its catalytic cycle. In these studies we showed that Ser275 is a key residue in the selective binding of ATP. Additionally, the structural data revealed a potential functional role for the ATP ribose moiety in priming the protein for the formation of the ATP-bound pre-hydrolysis complex by influencing the conformation of one of the phosphate binding loops.

Thermal perturbation correlation of calcium binding Human centrin 3 and its structural changes

NASA Astrophysics Data System (ADS)

Pastrana-Rios, Belinda

2014-07-01

Perturbation-correlation moving-window two-dimensional (PCMW2D) correlation spectroscopy was applied for the determination of the individual transition temperatures of different vibrational modes located within structural components of a calcium binding protein known as Human centrin 3. This crucial information served to understand the contribution individual calcium binding sites made towards the stability of the EF-hand and therefore the protein without the use of probes. We are convinced that the general application of PCMW2D correlation spectroscopy can be applied to the study of proteins in general to ascertain the differences in the stability of structural motifs within proteins and its relationship to the actual transition temperature of unfolding.

Rapid characterization of a novel taspine derivative-HMQ1611 binding to EGFR by a cell membrane chromatography method.

PubMed

Du, Hui; Lv, Nan; Wang, Sicen; He, Langchong

2013-05-01

A new high-expression endothelial growth factor receptor (EGFR) cell membrane chromatography (CMC) method was applied to recognize the ligands acting on EGFR specifically, and investigate the affinity of gefitinib/HMQ1611 to EGFR. In the self and direct competitive assay, gefitinib/HMQ1611 was used as a competitor in the mobile phase to evaluate the effect of the competitor's concentrations on the retention of the ligands, respectively, and the competition between gefitinib and HMQ1611 binding to EGFR was also been examined. The retention behavior indicated that gefitinib had one type of binding sites on the EGFR, and the equilibrium dissociation constant (K(D)) was (9.11 ± 1.89) × 10(-6) M; HMQ1611 had two major binding regions on the EGFR, and the K(D) values obtained from the model were (2.39 ± 0.33) × 10(-7) and (3.87 ± 0.93) × 10(-5) M for HMQ1611 at the high- and low-affinity sites, respectively. The competition between gefitinib and HMQ1611 occurred at the low-affinity sites on the EGFR. The low-affinity sites were of higher concentrations and contributed to a much larger part of retention of HMQ1611. The results suggested that gefitinib and HMQ1611 competed for the common binding sites on the EGFR, no matter the ligand was used as an analyte or a competitor.

Developmental changes in the distribution of cecal lectin-binding sites of Balb-c mice.

PubMed

Doehrn, S; Breipohl, W; Lierse, W; Romaniuk, K; Young, W

1992-01-01

The existence of lectin-binding sites was investigated in the cecum of Balb-c mice at seven developmental stages ranging from 18 days post conception (p.c.) to 8 weeks after birth. Nine horseradish-peroxidase-conjugated lectins (concanavalin A, Triticum vulgaris, Dolichus biflorus, Helix pomatia, Arachis hypogaea, Glycine maximus, Lotus tetragonolobus, Ulex europaeus, Limulus polyphemus) were applied to 5- to 7-microns thin paraffin sections of Bouin-fixed tissue. After DAB staining the sections were evaluated by light microscopy. It was shown that each lectin exhibits a unique developmental pattern. The adult binding patterns were established at the age of 3-4 weeks with only minor changes occurring thereafter. Considerable differences in binding patterns occurred not only between lectins of different groups but also between lectins with the same nominal monosaccharide specificity.

Mathematical description of drug-target interactions: application to biologics that bind to targets with two binding sites.

PubMed

Gibiansky, Leonid; Gibiansky, Ekaterina

2018-02-01

The emerging discipline of mathematical pharmacology occupies the space between advanced pharmacometrics and systems biology. A characteristic feature of the approach is application of advance mathematical methods to study the behavior of biological systems as described by mathematical (most often differential) equations. One of the early application of mathematical pharmacology (that was not called this name at the time) was formulation and investigation of the target-mediated drug disposition (TMDD) model and its approximations. The model was shown to be remarkably successful, not only in describing the observed data for drug-target interactions, but also in advancing the qualitative and quantitative understanding of those interactions and their role in pharmacokinetic and pharmacodynamic properties of biologics. The TMDD model in its original formulation describes the interaction of the drug that has one binding site with the target that also has only one binding site. Following the framework developed earlier for drugs with one-to-one binding, this work aims to describe a rigorous approach for working with similar systems and to apply it to drugs that bind to targets with two binding sites. The quasi-steady-state, quasi-equilibrium, irreversible binding, and Michaelis-Menten approximations of the model are also derived. These equations can be used, in particular, to predict concentrations of the partially bound target (RC). This could be clinically important if RC remains active and has slow internalization rate. In this case, introduction of the drug aimed to suppress target activity may lead to the opposite effect due to RC accumulation.

iCLIP: Protein–RNA interactions at nucleotide resolution

PubMed Central

Huppertz, Ina; Attig, Jan; D’Ambrogio, Andrea; Easton, Laura E.; Sibley, Christopher R.; Sugimoto, Yoichiro; Tajnik, Mojca; König, Julian; Ule, Jernej

2014-01-01

RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein–RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA circularization step that enables analysis of cDNAs that truncated at the protein–RNA crosslink sites. Here, we describe the improved iCLIP protocol and discuss critical optimization and control experiments that are required when applying the method to new RBPs. PMID:24184352

Identifying the binding mode of a molecular scaffold

NASA Astrophysics Data System (ADS)

Chema, Doron; Eren, Doron; Yayon, Avner; Goldblum, Amiram; Zaliani, Andrea

2004-01-01

We describe a method for docking of a scaffold-based series and present its advantages over docking of individual ligands, for determining the binding mode of a molecular scaffold in a binding site. The method has been applied to eight different scaffolds of protein kinase inhibitors (PKI). A single analog of each of these eight scaffolds was previously crystallized with different protein kinases. We have used FlexX to dock a set of molecules that share the same scaffold, rather than docking a single molecule. The main mode of binding is determined by the mode of binding of the largest cluster among the docked molecules that share a scaffold. Clustering is based on our `nearest single neighbor' method [J. Chem. Inf. Comput. Sci., 43 (2003) 208-217]. Additional criteria are applied in those cases in which more than one significant binding mode is found. Using the proposed method, most of the crystallographic binding modes of these scaffolds were reconstructed. Alternative modes, that have not been detected yet by experiments, could also be identified. The method was applied to predict the binding mode of an additional molecular scaffold that was not yet reported and the predicted binding mode has been found to be very similar to experimental results for a closely related scaffold. We suggest that this approach be used as a virtual screening tool for scaffold-based design processes.

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction.

PubMed

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H

2017-01-09

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

How Cations Can Assist DNase I in DNA Binding and Hydrolysis

PubMed Central

Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden, Marc

2010-01-01

DNase I requires Ca2+ and Mg2+ for hydrolyzing double-stranded DNA. However, the number and the location of DNase I ion-binding sites remain unclear, as well as the role of these counter-ions. Using molecular dynamics simulations, we show that bovine pancreatic (bp) DNase I contains four ion-binding pockets. Two of them strongly bind Ca2+ while the other two sites coordinate Mg2+. These theoretical results are strongly supported by revisiting crystallographic structures that contain bpDNase I. One Ca2+ stabilizes the functional DNase I structure. The presence of Mg2+ in close vicinity to the catalytic pocket of bpDNase I reinforces the idea of a cation-assisted hydrolytic mechanism. Importantly, Poisson-Boltzmann-type electrostatic potential calculations demonstrate that the divalent cations collectively control the electrostatic fit between bpDNase I and DNA. These results improve our understanding of the essential role of cations in the biological function of bpDNase I. The high degree of conservation of the amino acids involved in the identified cation-binding sites across DNase I and DNase I-like proteins from various species suggests that our findings generally apply to all DNase I-DNA interactions. PMID:21124947

Dynamics of TBP binding to the TATA box

NASA Astrophysics Data System (ADS)

Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

2008-02-01

Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

Assessment of ligand binding at a site relevant to SOD1 oxidation and aggregation.

PubMed

Manjula, Ramu; Wright, Gareth S A; Strange, Richard W; Padmanabhan, Balasundaram

2018-05-01

Cu/Zn superoxide dismutase-1 (SOD1) mutations are causative for a subset of amyotrophic lateral sclerosis (ALS) cases. These mutations lead to structural instability, aggregation and ultimately motor neuron death. We have determined crystal structures of SOD1 in complex with a naphthalene-catechol-linked compound which binds with low micro-molar affinity to a site important for oxidative damage-induced aggregation. SOD1 Trp32 oxidation is indeed significantly inhibited by ligand binding. Our work shows how compound linking can be applied successfully to ligand interactions on the SOD1 surface to generate relatively good binding strength. The ligand, positioned in a region important for SOD1 fibrillation, offers the possibility that it, or a similar compound, could prevent the abnormal self-association that drives SOD1 toxicity in ALS. © 2018 Federation of European Biochemical Societies.

Deciphering Cryptic Binding Sites on Proteins by Mixed-Solvent Molecular Dynamics.

PubMed

Kimura, S Roy; Hu, Hai Peng; Ruvinsky, Anatoly M; Sherman, Woody; Favia, Angelo D

2017-06-26

In recent years, molecular dynamics simulations of proteins in explicit mixed solvents have been applied to various problems in protein biophysics and drug discovery, including protein folding, protein surface characterization, fragment screening, allostery, and druggability assessment. In this study, we perform a systematic study on how mixtures of organic solvent probes in water can reveal cryptic ligand binding pockets that are not evident in crystal structures of apo proteins. We examine a diverse set of eight PDB proteins that show pocket opening induced by ligand binding and investigate whether solvent MD simulations on the apo structures can induce the binding site observed in the holo structures. The cosolvent simulations were found to induce conformational changes on the protein surface, which were characterized and compared with the holo structures. Analyses of the biological systems, choice of probes and concentrations, druggability of the resulting induced pockets, and application to drug discovery are discussed here.

A Graphical Modelling Approach to the Dissection of Highly Correlated Transcription Factor Binding Site Profiles

PubMed Central

Stojnic, Robert; Fu, Audrey Qiuyan; Adryan, Boris

2012-01-01

Inferring the combinatorial regulatory code of transcription factors (TFs) from genome-wide TF binding profiles is challenging. A major reason is that TF binding profiles significantly overlap and are therefore highly correlated. Clustered occurrence of multiple TFs at genomic sites may arise from chromatin accessibility and local cooperation between TFs, or binding sites may simply appear clustered if the profiles are generated from diverse cell populations. Overlaps in TF binding profiles may also result from measurements taken at closely related time intervals. It is thus of great interest to distinguish TFs that directly regulate gene expression from those that are indirectly associated with gene expression. Graphical models, in particular Bayesian networks, provide a powerful mathematical framework to infer different types of dependencies. However, existing methods do not perform well when the features (here: TF binding profiles) are highly correlated, when their association with the biological outcome is weak, and when the sample size is small. Here, we develop a novel computational method, the Neighbourhood Consistent PC (NCPC) algorithms, which deal with these scenarios much more effectively than existing methods do. We further present a novel graphical representation, the Direct Dependence Graph (DDGraph), to better display the complex interactions among variables. NCPC and DDGraph can also be applied to other problems involving highly correlated biological features. Both methods are implemented in the R package ddgraph, available as part of Bioconductor (http://bioconductor.org/packages/2.11/bioc/html/ddgraph.html). Applied to real data, our method identified TFs that specify different classes of cis-regulatory modules (CRMs) in Drosophila mesoderm differentiation. Our analysis also found depletion of the early transcription factor Twist binding at the CRMs regulating expression in visceral and somatic muscle cells at later stages, which suggests a CRM-specific repression mechanism that so far has not been characterised for this class of mesodermal CRMs. PMID:23144600

Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

PubMed

Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

2017-05-02

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

Iron depletion strategy for targeted cancer therapy: utilizing the dual roles of neutrophil gelatinase-associated lipocalin protein.

PubMed

Tang, Hsin-Chieh; Chang, Pei-Chun; Chen, Yu-Chian

2016-01-01

Decreasing iron uptake and increasing iron efflux may result in cell death by oxidative inactivation of vital enzymes. Applying the dual function of neutrophil gelatinase-associated lipocalin (NGAL) could achieve the goal of iron depletion in the cancer cells. Tyr106, Lys125 or Lys134 was the key binding site for NGAL protein to sequester iron-chelating siderophores. In this study, we employed all bioactive peptides in peptide databank to dock with the siderophore-binding sites of NGAL protein by virtual screening. In addition, we performed molecular dynamics (MD) simulation to observe the molecular character and structural variation of ligand-protein interaction. Glu-Glu-Lys-Glu (EEKE), Glu-Glu-Asp-Cys-Lys (EEDCK), and Gly-Glu-Glu-Cys-Asp (GEECD) were selected preliminarily by rigorous scoring functions for further investigation. GEECD was excluded due to higher binding total energy than the others. Moreover, we also excluded EEKE due to larger influence to the stability of binding residues by the information of root mean square fluctuation (RMSF) and principal component analysis (PCA). Thus, we suggested that EEDCK was the potential bioactive peptide which had been proved to inhibit malignant cells for targeted cancer therapy. Graphical Abstract Perspective drug design of occupying the siderophore-binding sites of NGAL outside the cell temporarily by a potential short peptide until NGAL enters into the cell, and releasing the siderophore-binding sites inside the cell.

Prediction of Protein-Protein Interaction Sites Using Electrostatic Desolvation Profiles

PubMed Central

Fiorucci, Sébastien; Zacharias, Martin

2010-01-01

Abstract Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. PMID:20441756

iCLIP: protein-RNA interactions at nucleotide resolution.

PubMed

Huppertz, Ina; Attig, Jan; D'Ambrogio, Andrea; Easton, Laura E; Sibley, Christopher R; Sugimoto, Yoichiro; Tajnik, Mojca; König, Julian; Ule, Jernej

2014-02-01

RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein-RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA circularization step that enables analysis of cDNAs that truncated at the protein-RNA crosslink sites. Here, we describe the improved iCLIP protocol and discuss critical optimization and control experiments that are required when applying the method to new RBPs. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Identification of B. anthracis N(5)-carboxyaminoimidazole ribonucleotide mutase (PurE) active site binding compounds via fragment library screening.

PubMed

Lei, Hao; Jones, Christopher; Zhu, Tian; Patel, Kavankumar; Wolf, Nina M; Fung, Leslie W-M; Lee, Hyun; Johnson, Michael E

2016-02-15

The de novo purine biosynthesis pathway is an attractive target for antibacterial drug design, and PurE from this pathway has been identified to be crucial for Bacillus anthracis survival in serum. In this study we adopted a fragment-based hit discovery approach, using three screening methods-saturation transfer difference nucleus magnetic resonance (STD-NMR), water-ligand observed via gradient spectroscopy (WaterLOGSY) NMR, and surface plasmon resonance (SPR), against B. anthracis PurE (BaPurE) to identify active site binding fragments by initially testing 352 compounds in a Zenobia fragment library. Competition STD NMR with the BaPurE product effectively eliminated non-active site binding hits from the primary hits, selecting active site binders only. Binding affinities (dissociation constant, KD) of these compounds varied between 234 and 301μM. Based on test results from the Zenobia compounds, we subsequently developed and applied a streamlined fragment screening strategy to screen a much larger library consisting of 3000 computationally pre-selected fragments. Thirteen final fragment hits were confirmed to exhibit binding affinities varying from 14μM to 700μM, which were categorized into five different basic scaffolds. All thirteen fragment hits have ligand efficiencies higher than 0.30. We demonstrated that at least two fragments from two different scaffolds exhibit inhibitory activity against the BaPurE enzyme. Published by Elsevier Ltd.

Computational investigation of cholesterol binding sites on mitochondrial VDAC.

PubMed

Weiser, Brian P; Salari, Reza; Eckenhoff, Roderic G; Brannigan, Grace

2014-08-21

The mitochondrial voltage-dependent anion channel (VDAC) allows passage of ions and metabolites across the mitochondrial outer membrane. Cholesterol binds mammalian VDAC, and we investigated the effects of binding to human VDAC1 with atomistic molecular dynamics simulations that totaled 1.4 μs. We docked cholesterol to specific sites on VDAC that were previously identified with NMR, and we tested the reliability of multiple docking results in each site with simulations. The most favorable binding modes were used to build a VDAC model with cholesterol occupying five unique sites, and during multiple 100 ns simulations, cholesterol stably and reproducibly remained bound to the protein. For comparison, VDAC was simulated in systems with identical components but with cholesterol initially unbound. The dynamics of loops that connect adjacent β-strands were most affected by bound cholesterol, with the averaged root-mean-square fluctuation (RMSF) of multiple residues altered by 20-30%. Cholesterol binding also stabilized charged residues inside the channel and localized the surrounding electrostatic potentials. Despite this, ion diffusion through the channel was not significantly affected by bound cholesterol, as evidenced by multi-ion potential of mean force measurements. Although we observed modest effects of cholesterol on the open channel, our model will be particularly useful in experiments that investigate how cholesterol affects VDAC function under applied electrochemical forces and also how other ligands and proteins interact with the channel.

Computational Investigation of Cholesterol Binding Sites on Mitochondrial VDAC

PubMed Central

2015-01-01

The mitochondrial voltage-dependent anion channel (VDAC) allows passage of ions and metabolites across the mitochondrial outer membrane. Cholesterol binds mammalian VDAC, and we investigated the effects of binding to human VDAC1 with atomistic molecular dynamics simulations that totaled 1.4 μs. We docked cholesterol to specific sites on VDAC that were previously identified with NMR, and we tested the reliability of multiple docking results in each site with simulations. The most favorable binding modes were used to build a VDAC model with cholesterol occupying five unique sites, and during multiple 100 ns simulations, cholesterol stably and reproducibly remained bound to the protein. For comparison, VDAC was simulated in systems with identical components but with cholesterol initially unbound. The dynamics of loops that connect adjacent β-strands were most affected by bound cholesterol, with the averaged root-mean-square fluctuation (RMSF) of multiple residues altered by 20–30%. Cholesterol binding also stabilized charged residues inside the channel and localized the surrounding electrostatic potentials. Despite this, ion diffusion through the channel was not significantly affected by bound cholesterol, as evidenced by multi-ion potential of mean force measurements. Although we observed modest effects of cholesterol on the open channel, our model will be particularly useful in experiments that investigate how cholesterol affects VDAC function under applied electrochemical forces and also how other ligands and proteins interact with the channel. PMID:25080204

Revealing multi-binding sites for taspine to VEGFR-2 by cell membrane chromatography zonal elution.

PubMed

Du, Hui; Wang, Sicen; Ren, Jing; Lv, Nan; He, Langchong

2012-03-01

A new high-expression vascular endothelial growth factor receptor-2 (VEGFR-2) cell membrane chromatography (CMC) method was developed to investigate the affinity of ligands for VEGFR-2. An HEK293 VEGFR-2/CMC system was applied to specifically recognize ligands acting on VEGFR-2. Sorafenib was used as a mobile phase additive to evaluate the effect of the marker's concentration on the retention of sorafenib and taspine, respectively. The relationship among the retention, the types of binding sites and the affinity of taspine binding to VEGFR-2 has also been concerned. The retention behavior indicated that sorafenib had two major binding regions on VEGFR-2, and that taspine might act as a multi-target VEGFR-2 inhibitor with similar biological activity to sorafenib. The equilibrium dissociation constants (K(D)) obtained from the model are (5.25 ± 0.31) × 10⁻⁷ and (9.88 ± 0.54) × 10⁻⁵ mol L⁻¹ for sorafenib at the high- and low-affinity sites, respectively, and the corresponding values for taspine are (3.88 ± 0.31) × 10⁻⁶ and (7.04 ± 0.49)×10⁻⁵ mol L⁻¹. The two types of binding sites contributed about a 1:2 ratio on the retention of taspine. Copyright © 2012 Elsevier B.V. All rights reserved.

Designing Hydrolytic Zinc Metalloenzymes

PubMed Central

2015-01-01

Zinc is an essential element required for the function of more than 300 enzymes spanning all classes. Despite years of dedicated study, questions regarding the connections between primary and secondary metal ligands and protein structure and function remain unanswered, despite numerous mechanistic, structural, biochemical, and synthetic model studies. Protein design is a powerful strategy for reproducing native metal sites that may be applied to answering some of these questions and subsequently generating novel zinc enzymes. From examination of the earliest design studies introducing simple Zn(II)-binding sites into de novo and natural protein scaffolds to current studies involving the preparation of efficient hydrolytic zinc sites, it is increasingly likely that protein design will achieve reaction rates previously thought possible only for native enzymes. This Current Topic will review the design and redesign of Zn(II)-binding sites in de novo-designed proteins and native protein scaffolds toward the preparation of catalytic hydrolytic sites. After discussing the preparation of Zn(II)-binding sites in various scaffolds, we will describe relevant examples for reengineering existing zinc sites to generate new or altered catalytic activities. Then, we will describe our work on the preparation of a de novo-designed hydrolytic zinc site in detail and present comparisons to related designed zinc sites. Collectively, these studies demonstrate the significant progress being made toward building zinc metalloenzymes from the bottom up. PMID:24506795

α‐Conotoxin M1 (CTx) blocks αδ binding sites of adult nicotinic receptors while ACh binding at αε sites elicits only small and short quantal synaptic currents

PubMed Central

Dudel, Josef

2014-01-01

Abstract In ‘embryonic’ nicotinic receptors, low CTx concentrations are known to block only the αδ binding site, whereas binding of ACh at the αγ‐site elicits short single channel openings and short bursts. In adult muscles the αγ‐ is replaced by the αε‐site. Quantal EPSCs (qEPSCs) were elicited in adult muscles by depolarization pulses and recorded through a perfused macropatch electrode. One to 200 nmol L−1 CTx reduced amplitudes and decay time constants of qEPSCs, but increased their rise times. CTx block at the αδ binding sites was incomplete: The qEPSCs still contained long bursts from not yet blocked receptors, whereas their average decay time constants were reduced by a short burst component generated by ACh binding to the αε‐site. Two nanomolar CTx applied for 3 h reduced the amplitudes of qEPSCs to less than half with a constant slope. The equilibrium concentration of the block is below 1 nmol L−1 and lower than that of embryonic receptors. CTx‐block increased in proportion to CTx concentrations (average rate 2 × 104 s−1·mol−1 L). Thus, the reactions of ‘embryonic’ and of adult nicotinic receptors to block by CTx are qualitatively the same. – The study of the effects of higher CTx concentrations or of longer periods of application of CTx was limited by presynaptic effects of CTx. Even low CTx concentrations severely reduced the release of quanta by activating presynaptic M2 receptors at a maximal rate of 6 × 105 s−1·mol−1 L. When this dominant inhibition was prevented by blocking the M2 receptors with methoctramine, activation of M1 receptors was unmasked and facilitated release. PMID:25501436

Affinity capillary electrophoresis and fluorescence spectroscopy for studying enantioselective interactions between omeprazole enantiomer and human serum albumin.

PubMed

Xu, Yujing; Hong, Tingting; Chen, Xueping; Ji, Yibing

2017-05-01

Baseline separation of omeprazole (OME) enantiomers was achieved by affinity capillary electrophoresis (ACE), using human serum albumin (HSA) as the chiral selector. The influence of several experimental variables such as HSA concentration, the type and content of organic modifiers, applied voltage and running buffer concentration on the separation was evaluated. The binding of esomeprazole (S-omeprazole, S-OME) and its R-enantiomer (R-omeprazole, R-OME) to HSA under simulated physiological conditions was studied by ACE and fluorescence spectroscopy which was considered as a reference method. ACE studies demonstrated that the binding constants of the two enantiomers and HSA were 3.18 × 10 3 M -1 and 5.36 × 10 3 M -1 , respectively. The binding properties including the fluorescence quenching mechanisms, binding constants, binding sites and the number of binding sites were obtained by fluorescence spectroscopy. Though the ACE method could not get enough data when compared with the fluorescence spectrum method, the separation and binding studies of chiral drugs could be achieved simultaneously via this method. This study is of great significance for the investigation and clinical application of chiral drugs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Determining the binding affinities of phenolic compounds to proteins by quenching of the intrinsic tryptophan fluorescence.

PubMed

Rawel, Harshadrai M; Frey, Simone K; Meidtner, Karina; Kroll, Jürgen; Schweigert, Florian J

2006-08-01

The noncovalent binding of selected phenolic compounds (chlorogenic-, ferulic-, gallic acid, quercetin, rutin, and isoquercetin) to proteins (HSA, BSA, soy glycinin, and lysozyme) was studied by an indirect method applying the quenching of intrinsic tryptophan fluorescence. From the data obtained, the binding constants were calculated by nonlinear regression (one site binding; y = Bx/k + x). It has been reported that tannins inhibit human salivary amylase and that these complexes may reduce the development of cariogenic plaques. Further, amylase contains two tryptophan residues in its active site. Therefore, in a second part of the study involving 31 human subjects, evidence was sought for noncovalent interactions between the phenols of green tea and saliva proteins as measured by the fluorescence intensity. Amylase activity was determined before and after the addition of green tea to saliva of 31 subjects. Forty percent of the subjects showed an increase in amylase activity contrary to studies reporting only a decrease in activity. The interactions of tannin with amylase result in a decrease of its activity. It still remains to be elucidated why amylase does not react uniformly under conditions of applying green tea to saliva. Further, in terms of using phenols as caries inhibitors this finding should be of importance.

Arginine residues on the opposite side of the active site stimulate the catalysis of ribosome depurination by ricin A chain by interacting with the P-protein stalk.

PubMed

Li, Xiao-Ping; Kahn, Peter C; Kahn, Jennifer Nielsen; Grela, Przemyslaw; Tumer, Nilgun E

2013-10-18

Ricin inhibits protein synthesis by depurinating the α-sarcin/ricin loop (SRL). Ricin holotoxin does not inhibit translation unless the disulfide bond between the A (RTA) and B (RTB) subunits is reduced. Ricin holotoxin did not bind ribosomes or depurinate them but could depurinate free RNA. When RTA is separated from RTB, arginine residues located at the interface are exposed to the solvent. Because this positively charged region, but not the active site, is blocked by RTB, we mutated arginine residues at or near the interface of RTB to determine if they are critical for ribosome binding. These variants were structurally similar to wild type RTA but could not bind ribosomes. Their K(m) values and catalytic rates (k(cat)) for an SRL mimic RNA were similar to those of wild type, indicating that their activity was not altered. However, they showed an up to 5-fold increase in K(m) and up to 38-fold decrease in kcat toward ribosomes. These results suggest that the stalk binding stimulates the catalysis of ribosome depurination by RTA. The mutated arginines have side chains behind the active site cleft, indicating that the ribosome binding surface of RTA is on the opposite side of the surface that interacts with the SRL. We propose that stalk binding stimulates the catalysis of ribosome depurination by orienting the active site of RTA toward the SRL and thereby allows docking of the target adenine into the active site. This model may apply to the translation factors that interact with the stalk.

Ph-Dependent Inhibition of Voltage-Gated H+ Currents in Rat Alveolar Epithelial Cells by Zn2+ and Other Divalent Cations

PubMed Central

Cherny, Vladimir V.; DeCoursey, Thomas E.

1999-01-01

Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017

Predicting conformational ensembles and genome-wide transcription factor binding sites from DNA sequences.

PubMed

Andrabi, Munazah; Hutchins, Andrew Paul; Miranda-Saavedra, Diego; Kono, Hidetoshi; Nussinov, Ruth; Mizuguchi, Kenji; Ahmad, Shandar

2017-06-22

DNA shape is emerging as an important determinant of transcription factor binding beyond just the DNA sequence. The only tool for large scale DNA shape estimates, DNAshape was derived from Monte-Carlo simulations and predicts four broad and static DNA shape features, Propeller twist, Helical twist, Minor groove width and Roll. The contributions of other shape features e.g. Shift, Slide and Opening cannot be evaluated using DNAshape. Here, we report a novel method DynaSeq, which predicts molecular dynamics-derived ensembles of a more exhaustive set of DNA shape features. We compared the DNAshape and DynaSeq predictions for the common features and applied both to predict the genome-wide binding sites of 1312 TFs available from protein interaction quantification (PIQ) data. The results indicate a good agreement between the two methods for the common shape features and point to advantages in using DynaSeq. Predictive models employing ensembles from individual conformational parameters revealed that base-pair opening - known to be important in strand separation - was the best predictor of transcription factor-binding sites (TFBS) followed by features employed by DNAshape. Of note, TFBS could be predicted not only from the features at the target motif sites, but also from those as far as 200 nucleotides away from the motif.

Verifying the competition between haloperidol and biperiden in serum albumin through a model based on spectrofluorimetry

NASA Astrophysics Data System (ADS)

Muniz da Silva Fragoso, Viviane; Patrícia de Morais e Coura, Carla; Paulino, Erica Tex; Valdez, Ethel Celene Narvaez; Silva, Dilson; Cortez, Celia Martins

2017-11-01

The aim of this work was to apply mathematical-computational modeling to study the interactions of haloperidol (HLP) and biperiden (BPD) with human (HSA) and bovine (BSA) serum albumin in order to verify the competition of these drugs for binding sites in HSA, using intrinsic tryptophan fluorescence quenching data. The association constants estimated for HPD-HSA was 2.17(±0.05) × 107 M-1, BPD-HSA was 2.01(±0.03) × 108 M-1 at 37 °C. Results have shown that drugs do not compete for the same binding sites in albumin.

A Surface Energy Transfer Nanoruler for Measuring Binding Site Distances on Live Cell Surfaces

PubMed Central

Chen, Yan; O’Donoghue, Meghan B.; Huang, Yu-Fen; Kang, Huaizhi; Phillips, Joseph A.; Chen, Xiaolan; Estevez, M.-Carmen; Tan, Weihong

2010-01-01

Measuring distances at molecular length scales in living systems is a significant challenge. Methods like FRET have limitations due to short detection distances and strict orientations. Recently, surface energy transfer (SET) has been used in bulk solutions; however, it cannot be applied to living systems. Here, we have developed an SET nanoruler, using aptamer-gold-nanoparticle conjugates with different diameters, to monitor the distance between binding sites of a receptor on living cells. The nanoruler can measure separation distances well beyond the detection limit of FRET. Thus, for the first time, we have developed an effective SET nanoruler for live cells with long distance, easy construction, fast detection and low background. This is also the first time that the distance between the aptamer and antibody binding sites in the membrane protein PTK7 was measured accurately. The SET nanoruler represents the next leap forward to monitor structural components within living cell membranes. PMID:21038856

Dynamic Changes in Nucleosome Occupancy Are Not Predictive of Gene Expression Dynamics but Are Linked to Transcription and Chromatin Regulators

PubMed Central

Huebert, Dana J.; Kuan, Pei-Fen; Keleş, Sündüz

2012-01-01

The response to stressful stimuli requires rapid, precise, and dynamic gene expression changes that must be coordinated across the genome. To gain insight into the temporal ordering of genome reorganization, we investigated dynamic relationships between changing nucleosome occupancy, transcription factor binding, and gene expression in Saccharomyces cerevisiae yeast responding to oxidative stress. We applied deep sequencing to nucleosomal DNA at six time points before and after hydrogen peroxide treatment and revealed many distinct dynamic patterns of nucleosome gain and loss. The timing of nucleosome repositioning was not predictive of the dynamics of downstream gene expression change but instead was linked to nucleosome position relative to transcription start sites and specific cis-regulatory elements. We measured genome-wide binding of the stress-activated transcription factor Msn2p over time and found that Msn2p binds different loci with different dynamics. Nucleosome eviction from Msn2p binding sites was common across the genome; however, we show that, contrary to expectation, nucleosome loss occurred after Msn2p binding and in fact required Msn2p. This negates the prevailing model that nucleosomes obscuring Msn2p sites regulate DNA access and must be lost before Msn2p can bind DNA. Together, these results highlight the complexities of stress-dependent chromatin changes and their effects on gene expression. PMID:22354995

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

PubMed Central

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

PubMed

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

A Comparison Study for DNA Motif Modeling on Protein Binding Microarray.

PubMed

Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Wong, Hau-San

2016-01-01

Transcription factor binding sites (TFBSs) are relatively short (5-15 bp) and degenerate. Identifying them is a computationally challenging task. In particular, protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner; for instance, a typical PBM experiment can measure binding signal intensities of a protein to all possible DNA k-mers (k = 8∼10). Since proteins can often bind to DNA with different binding intensities, one of the major challenges is to build TFBS (also known as DNA motif) models which can fully capture the quantitative binding affinity data. To learn DNA motif models from the non-convex objective function landscape, several optimization methods are compared and applied to the PBM motif model building problem. In particular, representative methods from different optimization paradigms have been chosen for modeling performance comparison on hundreds of PBM datasets. The results suggest that the multimodal optimization methods are very effective for capturing the binding preference information from PBM data. In particular, we observe a general performance improvement if choosing di-nucleotide modeling over mono-nucleotide modeling. In addition, the models learned by the best-performing method are applied to two independent applications: PBM probe rotation testing and ChIP-Seq peak sequence prediction, demonstrating its biological applicability.

Biochemistry of the tale transcription factors PREP, MEIS, and PBX in vertebrates.

PubMed

Longobardi, E; Penkov, D; Mateos, D; De Florian, G; Torres, M; Blasi, Francesco

2014-01-01

TALE (three amino acids loop extension) homeodomain transcription factors are required in various steps of embryo development, in many adult physiological functions, and are involved in important pathologies. This review focuses on the PREP, MEIS, and PBX sub-families of TALE factors and aims at giving information on their biochemical properties, i.e., structure, interactors, and interaction surfaces. Members of the three sets of protein form dimers in which the common partner is PBX but they can also directly interact with other proteins forming higher-order complexes, in particular HOX. Finally, recent advances in determining the genome-wide DNA-binding sites of PREP1, MEIS1, and PBX1, and their partial correspondence with the binding sites of some HOX proteins, are reviewed. These studies have generated a few general rules that can be applied to all members of the three gene families. PREP and MEIS recognize slightly different consensus sequences: PREP prefers to bind to promoters and to have PBX as a DNA-binding partner; MEIS prefers HOX as partner, and both PREP and MEIS drive PBX to their own binding sites. This outlines the clear individuality of the PREP and MEIS proteins, the former mostly devoted to basic cellular functions, the latter more to developmental functions. Copyright © 2013 Wiley Periodicals, Inc.

SVM prediction of ligand-binding sites in bacterial lipoproteins employing shape and physio-chemical descriptors.

PubMed

Kadam, Kiran; Prabhakar, Prashant; Jayaraman, V K

2012-11-01

Bacterial lipoproteins play critical roles in various physiological processes including the maintenance of pathogenicity and numbers of them are being considered as potential candidates for generating novel vaccines. In this work, we put forth an algorithm to identify and predict ligand-binding sites in bacterial lipoproteins. The method uses three types of pocket descriptors, namely fpocket descriptors, 3D Zernike descriptors and shell descriptors, and combines them with Support Vector Machine (SVM) method for the classification. The three types of descriptors represent shape-based properties of the pocket as well as its local physio-chemical features. All three types of descriptors, along with their hybrid combinations are evaluated with SVM and to improve classification performance, WEKA-InfoGain feature selection is applied. Results obtained in the study show that the classifier successfully differentiates between ligand-binding and non-binding pockets. For the combination of three types of descriptors, 10 fold cross-validation accuracy of 86.83% is obtained for training while the selected model achieved test Matthews Correlation Coefficient (MCC) of 0.534. Individually or in combination with new and existing methods, our model can be a very useful tool for the prediction of potential ligand-binding sites in bacterial lipoproteins.

Theory of single-molecule controlled rotation experiments, predictions, tests, and comparison with stalling experiments in F1-ATPase.

PubMed

Volkán-Kacsó, Sándor; Marcus, Rudolph A

2016-10-25

A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.

Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases*

PubMed Central

Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit

2015-01-01

Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (PIntr) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a 14C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site −3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils. PMID:26468285

Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases.

PubMed

Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit

2015-11-27

Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (P(Intr)) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a (14)C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site -3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Informative priors based on transcription factor structural class improve de novo motif discovery.

PubMed

Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

2006-07-15

An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

Prediction of protein-protein interaction sites using electrostatic desolvation profiles.

PubMed

Fiorucci, Sébastien; Zacharias, Martin

2010-05-19

Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. Copyright (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

NASA Astrophysics Data System (ADS)

Smith, Jarrod Anson

2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

Genome-Wide Identification of Chromatin Transitional Regions Reveals Diverse Mechanisms Defining the Boundary of Facultative Heterochromatin

PubMed Central

Li, Guangyao; Zhou, Lei

2013-01-01

Due to the self-propagating nature of the heterochromatic modification H3K27me3, chromatin barrier activities are required to demarcate the boundary and prevent it from encroaching into euchromatic regions. Studies in Drosophila and vertebrate systems have revealed several important chromatin barrier elements and their respective binding factors. However, epigenomic data indicate that the binding of these factors are not exclusive to chromatin boundaries. To gain a comprehensive understanding of facultative heterochromatin boundaries, we developed a two-tiered method to identify the Chromatin Transitional Region (CTR), i.e. the nucleosomal region that shows the greatest transition rate of the H3K27me3 modification as revealed by ChIP-Seq. This approach was applied to identify CTRs in Drosophila S2 cells and human HeLa cells. Although many insulator proteins have been characterized in Drosophila, less than half of the CTRs in S2 cells are associated with known insulator proteins, indicating unknown mechanisms remain to be characterized. Our analysis also revealed that the peak binding of insulator proteins are usually 1–2 nucleosomes away from the CTR. Comparison of CTR-associated insulator protein binding sites vs. those in heterochromatic region revealed that boundary-associated binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significant decreased nucleosome density and increased binding intensities of co-factors. Interestingly, several subgroups of boundaries have enhanced H3.3 incorporation but reduced nucleosome turnover rate. Our genome-wide study reveals that diverse mechanisms are employed to define the boundaries of facultative heterochromatin. In both Drosophila and mammalian systems, only a small fraction of insulator protein binding sites co-localize with H3K27me3 boundaries. However, boundary-associated insulator binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significantly decreased nucleosome density and increased binding of co-factors. PMID:23840609

Site-specific protein backbone and side-chain NMR chemical shift and relaxation analysis of human vinexin SH3 domain using a genetically encoded {sup 15}N/{sup 19}F-labeled unnatural amino acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Pan; School of Life Science, University of Science and Technology of China, Hefei, Anhui 230026; Xi, Zhaoyong

Research highlights: {yields} Chemical synthesis of {sup 15}N/{sup 19}F-trifluomethyl phenylalanine. {yields} Site-specific incorporation of {sup 15}N/{sup 19}F-trifluomethyl phenylalanine to SH3. {yields} Site-specific backbone and side chain chemical shift and relaxation analysis. {yields} Different internal motions at different sites of SH3 domain upon ligand binding. -- Abstract: SH3 is a ubiquitous domain mediating protein-protein interactions. Recent solution NMR structural studies have shown that a proline-rich peptide is capable of binding to the human vinexin SH3 domain. Here, an orthogonal amber tRNA/tRNA synthetase pair for {sup 15}N/{sup 19}F-trifluoromethyl-phenylalanine ({sup 15}N/{sup 19}F-tfmF) has been applied to achieve site-specific labeling of SH3 at threemore » different sites. One-dimensional solution NMR spectra of backbone amide ({sup 15}N){sup 1}H and side-chain {sup 19}F were obtained for SH3 with three different site-specific labels. Site-specific backbone amide ({sup 15}N){sup 1}H and side-chain {sup 19}F chemical shift and relaxation analysis of SH3 in the absence or presence of a peptide ligand demonstrated different internal motions upon ligand binding at the three different sites. This site-specific NMR analysis might be very useful for studying large-sized proteins or protein complexes.« less

Structure-Based Design and Synthesis of Potent and Selective Matrix Metalloproteinase 13 Inhibitors.

PubMed

Choi, Jun Yong; Fuerst, Rita; Knapinska, Anna M; Taylor, Alexander B; Smith, Lyndsay; Cao, Xiaohang; Hart, P John; Fields, Gregg B; Roush, William R

2017-07-13

We describe the use of comparative structural analysis and structure-guided molecular design to develop potent and selective inhibitors (10d and (S)-17b) of matrix metalloproteinase 13 (MMP-13). We applied a three-step process, starting with a comparative analysis of the X-ray crystallographic structure of compound 5 in complex with MMP-13 with published structures of known MMP-13·inhibitor complexes followed by molecular design and synthesis of potent but nonselective zinc-chelating MMP inhibitors (e.g., 10a and 10b). After demonstrating that the pharmacophores of the chelating inhibitors (S)-10a, (R)-10a, and 10b were binding within the MMP-13 active site, the Zn 2+ chelating unit was replaced with nonchelating polar residues that bridged over the Zn 2+ binding site and reached into a solvent accessible area. After two rounds of structural optimization, these design approaches led to small molecule MMP-13 inhibitors 10d and (S)-17b, which bind within the substrate-binding site of MMP-13 and surround the catalytically active Zn 2+ ion without chelating to the metal. These compounds exhibit at least 500-fold selectivity versus other MMPs.

Prediction of TF target sites based on atomistic models of protein-DNA complexes

PubMed Central

Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno

2008-01-01

Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190

Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

PubMed

Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

2015-06-09

The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

Separating the Role of Protein Restraints and Local Metal-Site Interaction Chemistry in the Thermodynamics of a Zinc Finger Protein

PubMed Central

Dixit, Purushottam D.; Asthagiri, D.

2011-01-01

We express the effective Hamiltonian of an ion-binding site in a protein as a combination of the Hamiltonian of the ion-bound site in vacuum and the restraints of the protein on the site. The protein restraints are described by the quadratic elastic network model. The Hamiltonian of the ion-bound site in vacuum is approximated as a generalized Hessian around the minimum energy configuration. The resultant of the two quadratic Hamiltonians is cast into a pure quadratic form. In the canonical ensemble, the quadratic nature of the resultant Hamiltonian allows us to express analytically the excess free energy, enthalpy, and entropy of ion binding to the protein. The analytical expressions allow us to separate the roles of the dynamic restraints imposed by the protein on the binding site and the temperature-independent chemical effects in metal-ligand coordination. For the consensus zinc-finger peptide, relative to the aqueous phase, the calculated free energy of exchanging Zn2+ with Fe2+, Co2+, Ni2+, and Cd2+ are in agreement with experiments. The predicted excess enthalpy of ion exchange between Zn2+ and Co2+ also agrees with the available experimental estimate. The free energy of applying the protein restraints reveals that relative to Zn2+, the Co2+, and Cd2+-site clusters are more destabilized by the protein restraints. This leads to an experimentally testable hypothesis that a tetrahedral metal binding site with minimal protein restraints will be less selective for Zn2+ over Co2+ and Cd2+ compared to a zinc finger peptide. No appreciable change is expected for Fe2+ and Ni2+. The framework presented here may prove useful in protein engineering to tune metal selectivity. PMID:21943427

Quantitative in vivo receptor binding. I. Theory and application to the muscarinic cholinergic receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frey, K.A.; Ehrenkaufer, R.L.; Beaucage, S.

1985-02-01

A novel approach to in vivo receptor binding experiments is presented which allows direct quantitation of binding site densities. The method is based on an equilibrium model of tracer uptake and is designed to produce a static distribution proportional to receptor density and to minimize possible confounding influences of regional blood flow, blood-brain barrier permeability, and nonspecific binding. This technique was applied to the measurement of regional muscarinic cholinergic receptor densities in rat brain using (/sup 3/H)scopolamine. Specific in vivo binding of scopolamine demonstrated saturability, a pharmacologic profile, and regional densities which are consistent with interaction of the tracer withmore » the muscarinic receptor. Estimates of receptor density obtained with the in vivo method and in vitro measurements in homogenates were highly correlated. Furthermore, reduction in striatal muscarinic receptors following ibotenic acid lesions resulted in a significant decrease in tracer uptake in vivo, indicating that the correlation between scopolamine distribution and receptor density may be used to demonstrate pathologic conditions. We propose that the general method presented here is directly applicable to investigation of high affinity binding sites for a variety of radioligands.« less

Protein surface roughness accounts for binding free energy of Plasmepsin II-ligand complexes.

PubMed

Valdés-Tresanco, Mario E; Valdés-Tresanco, Mario S; Valiente, Pedro A; Cocho, Germinal; Mansilla, Ricardo; Nieto-Villar, J M

2018-01-01

The calculation of absolute binding affinities for protein-inhibitor complexes remains as one of the main challenges in computational structure-based ligand design. The present work explored the calculations of surface fractal dimension (as a measure of surface roughness) and the relationship with experimental binding free energies of Plasmepsin II complexes. Plasmepsin II is an attractive target for novel therapeutic compounds to treat malaria. However, the structural flexibility of this enzyme is a drawback when searching for specific inhibitors. Concerning that, we performed separate explicitly solvated molecular dynamics simulations using the available high-resolution crystal structures of different Plasmepsin II complexes. Molecular dynamics simulations allowed a better approximation to systems dynamics and, therefore, a more reliable estimation of surface roughness. This constitutes a novel approximation in order to obtain more realistic values of fractal dimension, because previous works considered only x-ray structures. Binding site fractal dimension was calculated considering the ensemble of structures generated at different simulation times. A linear relationship between binding site fractal dimension and experimental binding free energies of the complexes was observed within 20 ns. Previous studies of the subject did not uncover this relationship. Regression model, coined FD model, was built to estimate binding free energies from binding site fractal dimension values. Leave-one-out cross-validation showed that our model reproduced accurately the absolute binding free energies for our training set (R 2  = 0.76; <|error|> =0.55 kcal/mol; SD error  = 0.19 kcal/mol). The fact that such a simple model may be applied raises some questions that are addressed in the article. Copyright © 2017 John Wiley & Sons, Ltd.

An ensemble model of competitive multi-factor binding of the genome

PubMed Central

Wasson, Todd; Hartemink, Alexander J.

2009-01-01

Hundreds of different factors adorn the eukaryotic genome, binding to it in large number. These DNA binding factors (DBFs) include nucleosomes, transcription factors (TFs), and other proteins and protein complexes, such as the origin recognition complex (ORC). DBFs compete with one another for binding along the genome, yet many current models of genome binding do not consider different types of DBFs together simultaneously. Additionally, binding is a stochastic process that results in a continuum of binding probabilities at any position along the genome, but many current models tend to consider positions as being either binding sites or not. Here, we present a model that allows a multitude of DBFs, each at different concentrations, to compete with one another for binding sites along the genome. The result is an “occupancy profile,” a probabilistic description of the DNA occupancy of each factor at each position. We implement our model efficiently as the software package COMPETE. We demonstrate genome-wide and at specific loci how modeling nucleosome binding alters TF binding, and vice versa, and illustrate how factor concentration influences binding occupancy. Binding cooperativity between nearby TFs arises implicitly via mutual competition with nucleosomes. Our method applies not only to TFs, but also recapitulates known occupancy profiles of a well-studied replication origin with and without ORC binding. Importantly, the sequence preferences our model takes as input are derived from in vitro experiments. This ensures that the calculated occupancy profiles are the result of the forces of competition represented explicitly in our model and the inherent sequence affinities of the constituent DBFs. PMID:19720867

Theoretical estimates of exposure timescales of protein binding sites on DNA regulated by nucleosome kinetics.

PubMed

Parmar, Jyotsana J; Das, Dibyendu; Padinhateeri, Ranjith

2016-02-29

It is being increasingly realized that nucleosome organization on DNA crucially regulates DNA-protein interactions and the resulting gene expression. While the spatial character of the nucleosome positioning on DNA has been experimentally and theoretically studied extensively, the temporal character is poorly understood. Accounting for ATPase activity and DNA-sequence effects on nucleosome kinetics, we develop a theoretical method to estimate the time of continuous exposure of binding sites of non-histone proteins (e.g. transcription factors and TATA binding proteins) along any genome. Applying the method to Saccharomyces cerevisiae, we show that the exposure timescales are determined by cooperative dynamics of multiple nucleosomes, and their behavior is often different from expectations based on static nucleosome occupancy. Examining exposure times in the promoters of GAL1 and PHO5, we show that our theoretical predictions are consistent with known experiments. We apply our method genome-wide and discover huge gene-to-gene variability of mean exposure times of TATA boxes and patches adjacent to TSS (+1 nucleosome region); the resulting timescale distributions have non-exponential tails. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Feature-Based Approach to Modeling Protein–DNA Interactions

PubMed Central

Segal, Eran

2008-01-01

Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

Anesthetic sites and allosteric mechanisms of action on Cys-loop ligand-gated ion channels.

PubMed

Forman, Stuart A; Miller, Keith W

2011-02-01

The Cys-loop ligand-gated ion channel superfamily is a major group of neurotransmitter-activated receptors in the central and peripheral nervous system. The superfamily includes inhibitory receptors stimulated by γ-aminobutyric acid (GABA) and glycine and excitatory receptors stimulated by acetylcholine and serotonin. The first part of this review presents current evidence on the location of the anesthetic binding sites on these channels and the mechanism by which binding to these sites alters their function. The second part of the review addresses the basis for this selectivity, and the third part describes the predictive power of a quantitative allosteric model showing the actions of etomidate on γ-aminobutyric acid type A receptors (GABA(A)Rs). General anesthetics at clinical concentrations inhibit the excitatory receptors and enhance the inhibitory receptors. The location of general anesthetic binding sites on these receptors is being defined by photoactivable analogues of general anesthetics. The receptor studied most extensively is the muscle-type nicotinic acetylcholine receptor (nAChR), and progress is now being made with GABA(A)Rs. There are three categories of sites that are all in the transmembrane domain: 1) within a single subunit's four-helix bundle (intrasubunit site; halothane and etomidate on the δ subunit of AChRs); 2) between five subunits in the transmembrane conduction pore (channel lumen sites; etomidate and alcohols on nAChR); and 3) between two subunits (subunit interface sites; etomidate between the α1 and β2/3 subunits of the GABA(A)R). These binding sites function allosterically. Certain conformations of a receptor bind the anesthetic with greater affinity than others. Time-resolved photolabelling of some sites occurs within milliseconds of channel opening on the nAChR but not before. In GABA(A)Rs, electrophysiological data fit an allosteric model in which etomidate binds to and stabilizes the open state, increasing both the fraction of open channels and their lifetime. As predicted by the model, the channel-stabilizing action of etomidate is so strong that higher concentrations open the channel in the absence of agonist. The formal functional paradigm presented for etomidate may apply to other potent general anesthetic drugs. Combining photolabelling with structure-function mutational studies in the context of allosteric mechanisms should lead us to a more detailed understanding of how and where these important drugs act.

The effects of methylglyoxal-bis(guanylhydrazone) on spermine binding and transport in liver mitochondria.

PubMed

Toninello, A; Via, L D; Di Noto, V; Mancon, M

1999-12-15

This study evaluated the effect of the anticancer drug methylglyoxal-bis(guanylhydrazone) (MGBG) on the binding of the polyamine spermine to the mitochondrial membrane and its transport into the inner compartment of this organelle. Spermine binding was studied by applying a new thermodynamic treatment of ligand-receptor interactions (Di Noto et al., Macromol Theory Simul 5: 165-181, 1996). Results showed that MGBG inhibited the binding of spermine to the site competent for the first step in polyamine transport; the interaction of spermine with this site, termed S1, also mediates the inhibitory effect of the polyamine on the mitochondrial permeability transition (Dalla Via et al., Biochim Biophys Acta 1284: 247-252, 1996). In the presence of 1 mM MGBG, the binding capacity and affinity of this site were reduced by about 2.6-fold; on the contrary, the binding capacity of the S2 site, which is most likely responsible for the internalization of cytoplasmic proteins (see Dalla Via et al., reference cited above), increased by about 1.3-fold, and its binding affinity remained unaffected. MGBG also inhibited the initial rate of spermine transport in a dose-dependent manner by establishing apparently sigmoidal kinetics. Consequently, the total extent of spermine accumulation inside mitochondria was inhibited. This inhibition in transport seems to reflect a conformational change at the level of the channel protein constituting the polyamine transport system, rather than competitive inhibition at the inner active site of the channel, thereby excluding the possibility that the polyamine and drug use the same transport pathway. Furthermore, it is suggested that, in the presence of MGBG, the S2 site is able to participate in residual spermine transport. MGBG also strongly inhibits deltapH-dependent spermine efflux, resulting in a complete block in the bidirectional flux of the polyamine and its sequestration inside the matrix space. The effects of MGBG on spermine accumulation are consistent with in vivo disruption of the regulator of energy metabolism and replication of the mitochondrial genome.

Knowledge-Guided Docking of WW Domain Proteins and Flexible Ligands

NASA Astrophysics Data System (ADS)

Lu, Haiyun; Li, Hao; Banu Bte Sm Rashid, Shamima; Leow, Wee Kheng; Liou, Yih-Cherng

Studies of interactions between protein domains and ligands are important in many aspects such as cellular signaling. We present a knowledge-guided approach for docking protein domains and flexible ligands. The approach is applied to the WW domain, a small protein module mediating signaling complexes which have been implicated in diseases such as muscular dystrophy and Liddle’s syndrome. The first stage of the approach employs a substring search for two binding grooves of WW domains and possible binding motifs of peptide ligands based on known features. The second stage aligns the ligand’s peptide backbone to the two binding grooves using a quasi-Newton constrained optimization algorithm. The backbone-aligned ligands produced serve as good starting points to the third stage which uses any flexible docking algorithm to perform the docking. The experimental results demonstrate that the backbone alignment method in the second stage performs better than conventional rigid superposition given two binding constraints. It is also shown that using the backbone-aligned ligands as initial configurations improves the flexible docking in the third stage. The presented approach can also be applied to other protein domains that involve binding of flexible ligand to two or more binding sites.

JET2 Viewer: a database of predicted multiple, possibly overlapping, protein-protein interaction sites for PDB structures.

PubMed

Ripoche, Hugues; Laine, Elodie; Ceres, Nicoletta; Carbone, Alessandra

2017-01-04

The database JET2 Viewer, openly accessible at http://www.jet2viewer.upmc.fr/, reports putative protein binding sites for all three-dimensional (3D) structures available in the Protein Data Bank (PDB). This knowledge base was generated by applying the computational method JET 2 at large-scale on more than 20 000 chains. JET 2 strategy yields very precise predictions of interacting surfaces and unravels their evolutionary process and complexity. JET2 Viewer provides an online intelligent display, including interactive 3D visualization of the binding sites mapped onto PDB structures and suitable files recording JET 2 analyses. Predictions were evaluated on more than 15 000 experimentally characterized protein interfaces. This is, to our knowledge, the largest evaluation of a protein binding site prediction method. The overall performance of JET 2 on all interfaces are: Sen = 52.52, PPV = 51.24, Spe = 80.05, Acc = 75.89. The data can be used to foster new strategies for protein-protein interactions modulation and interaction surface redesign. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structural Dynamics as a Contributor to Error-prone Replication by an RNA-dependent RNA Polymerase*

PubMed Central

Moustafa, Ibrahim M.; Korboukh, Victoria K.; Arnold, Jamie J.; Smidansky, Eric D.; Marcotte, Laura L.; Gohara, David W.; Yang, Xiaorong; Sánchez-Farrán, María Antonieta; Filman, David; Maranas, Janna K.; Boehr, David D.; Hogle, James M.; Colina, Coray M.; Cameron, Craig E.

2014-01-01

RNA viruses encoding high- or low-fidelity RNA-dependent RNA polymerases (RdRp) are attenuated. The ability to predict residues of the RdRp required for faithful incorporation of nucleotides represents an essential step in any pipeline intended to exploit perturbed fidelity as the basis for rational design of vaccine candidates. We used x-ray crystallography, molecular dynamics simulations, NMR spectroscopy, and pre-steady-state kinetics to compare a mutator (H273R) RdRp from poliovirus to the wild-type (WT) enzyme. We show that the nucleotide-binding site toggles between the nucleotide binding-occluded and nucleotide binding-competent states. The conformational dynamics between these states were enhanced by binding to primed template RNA. For the WT, the occluded conformation was favored; for H273R, the competent conformation was favored. The resonance for Met-187 in our NMR spectra reported on the ability of the enzyme to check the correctness of the bound nucleotide. Kinetic experiments were consistent with the conformational dynamics contributing to the established pre-incorporation conformational change and fidelity checkpoint. For H273R, residues comprising the active site spent more time in the catalytically competent conformation and were more positively correlated than the WT. We propose that by linking the equilibrium between the binding-occluded and binding-competent conformations of the nucleotide-binding pocket and other active-site dynamics to the correctness of the bound nucleotide, faithful nucleotide incorporation is achieved. These studies underscore the need to apply multiple biophysical and biochemical approaches to the elucidation of the physical basis for polymerase fidelity. PMID:25378410

Towards novel therapeutics for HIV through fragment-based screening and drug design.

PubMed

Tiefendbrunn, Theresa; Stout, C David

2014-01-01

Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.

The Electronic Behavior of Zinc-Finger Protein Binding Sites in the Context of the DNA Extended Ladder Model

NASA Astrophysics Data System (ADS)

Oiwa, Nestor; Cordeiro, Claudette; Heermann, Dieter

2016-05-01

Instead of ATCG letter alignments, typically used in bioinformatics, we propose a new alignment method using the probability distribution function of the bottom of the occupied molecular orbital (BOMO), highest occupied molecular orbital (HOMO) and lowest unoccupied orbital (LUMO). We apply the technique to transcription factors with Cys2His2 zinc fingers. These transcription factors search for binding sites, probing for the electronic patterns at the minor and major DNA groves. The eukaryotic Cys2His2 zinc finger proteins bind to DNA ubiquitously at highly conserved domains. They are responsible for gene regulation and the spatial organization of DNA. To study and understand these zinc finger DNA-protein interactions, we use the extended ladder in the DNA model proposed by Zhu, Rasmussen, Balatsky & Bishop (2007) te{Zhu-2007}. Considering one single spinless electron in each nucleotide π-orbital along a double DNA chain (dDNA), we find a typical pattern for the bottom of BOMO, HOMO and LUMO along the binding sites. We specifically looked at two members of zinc finger protein family: specificity protein 1 (SP1) and early grown response 1 transcription factors (EGR1). When the valence band is filled, we find electrons in the purines along the nucleotide sequence, compatible with the electric charges of the binding amino acids in SP1 and EGR1 zinc finger.

Investigation of Non-Covalent Interactions of Aflatoxins (B1, B2, G1, G2, and M1) with Serum Albumin

PubMed Central

Poór, Miklós; Bálint, Mónika; Hetényi, Csaba; Gődér, Beatrix; Kunsági-Máté, Sándor; Lemli, Beáta

2017-01-01

Aflatoxins are widely spread mycotoxins produced mainly by Aspergillus species. Consumption of aflatoxin-contaminated foods and drinks causes serious health risks for people worldwide. It is well-known that the reactive epoxide metabolite of aflatoxin B1 (AFB1) forms covalent adducts with serum albumin. However, non-covalent interactions of aflatoxins with human serum albumin (HSA) are poorly characterized. Thus, in this study the complex formation of aflatoxins was examined with HSA applying spectroscopic and molecular modelling studies. Our results demonstrate that aflatoxins form stable complexes with HSA as reflected by binding constants between 2.1 × 104 and 4.5 × 104 dm3/mol. A binding free energy value of −26.90 kJ mol−1 suggests a spontaneous binding process between AFB1 and HSA at room-temperature, while the positive entropy change of 55.1 JK−1 mol−1 indicates a partial decomposition of the solvation shells of the interacting molecules. Modeling studies and investigations with site markers suggest that Sudlow’s Site I of subdomain IIA is the high affinity binding site of aflatoxins on HSA. Interaction of AFB1 with bovine, porcine, and rat serum albumins was also investigated. Similar stabilities of the examined AFB1-albumin complexes were observed suggesting the low species differences of the albumin-binding of aflatoxins. PMID:29068381

Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

1991-01-01

Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

NASA Astrophysics Data System (ADS)

Lengyel, Iván M.; Morelli, Luis G.

2017-04-01

Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

Multiple grid arrangement improves ligand docking with unknown binding sites: Application to the inverse docking problem.

PubMed

Ban, Tomohiro; Ohue, Masahito; Akiyama, Yutaka

2018-04-01

The identification of comprehensive drug-target interactions is important in drug discovery. Although numerous computational methods have been developed over the years, a gold standard technique has not been established. Computational ligand docking and structure-based drug design allow researchers to predict the binding affinity between a compound and a target protein, and thus, they are often used to virtually screen compound libraries. In addition, docking techniques have also been applied to the virtual screening of target proteins (inverse docking) to predict target proteins of a drug candidate. Nevertheless, a more accurate docking method is currently required. In this study, we proposed a method in which a predicted ligand-binding site is covered by multiple grids, termed multiple grid arrangement. Notably, multiple grid arrangement facilitates the conformational search for a grid-based ligand docking software and can be applied to the state-of-the-art commercial docking software Glide (Schrödinger, LLC). We validated the proposed method by re-docking with the Astex diverse benchmark dataset and blind binding site situations, which improved the correct prediction rate of the top scoring docking pose from 27.1% to 34.1%; however, only a slight improvement in target prediction accuracy was observed with inverse docking scenarios. These findings highlight the limitations and challenges of current scoring functions and the need for more accurate docking methods. The proposed multiple grid arrangement method was implemented in Glide by modifying a cross-docking script for Glide, xglide.py. The script of our method is freely available online at http://www.bi.cs.titech.ac.jp/mga_glide/. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

A Transmembrane Amino Acid in the GABAA Receptor β2 Subunit Critical for the Actions of Alcohols and Anesthetics

PubMed Central

McCracken, Mandy L.; Borghese, Cecilia M.; Trudell, James R.

2010-01-01

Alcohols and inhaled anesthetics enhance the function of GABAA receptors containing α, β, and γ subunits. Molecular analysis has focused on the role of the α subunits; however, there is evidence that the β subunits may also be important. The goal of our study was to determine whether Asn265, which is homologous to the site implicated in the α subunit (Ser270), contributes to an alcohol and volatile anesthetic binding site in the GABAA receptor β2 subunit. We substituted cysteine for Asn265 and exposed the mutant to the sulfhydryl-specific reagent octyl methanethiosulfonate (OMTS). We used two-electrode voltage-clamp electrophysiology in Xenopus laevis oocytes and found that, after OMTS application, GABA-induced currents were irreversibly potentiated in mutant α1β2(N265C)γ2S receptors [but not α1β2(I264C)γ2S], presumably because of the covalent linking of octanethiol to the thiol group in the substituted cysteine. It is noteworthy that this effect was blocked when OMTS was applied in the presence of octanol. We found that potentiation by butanol, octanol, or isoflurane in the N265C mutant was nearly abolished after the application of OMTS, suggesting that an alcohol and volatile anesthetic binding site at position 265 of the β2 subunit was irreversibly occupied by octanethiol and consequently prevented butanol or isoflurane from binding and producing their effects. OMTS did not affect modulation or direct activation by pentobarbital, but there was a partial reduction of allosteric modulation by flunitrazepam and alphaxalone in mutant α1β2(N265C)γ2S receptors after OMTS was applied. Our findings provide evidence that Asn265 may contribute to an alcohol and anesthetic binding site. PMID:20826568

Exploiting three kinds of interface propensities to identify protein binding sites.

PubMed

Liu, Bin; Wang, Xiaolong; Lin, Lei; Dong, Qiwen; Wang, Xuan

2009-08-01

Predicting the binding sites between two interacting proteins provides important clues to the function of a protein. In this study, we present a building block of proteins called order profiles to use the evolutionary information of the protein sequence frequency profiles and apply this building block to produce a class of propensities called order profile interface propensities. For comparisons, we revisit the usage of residue interface propensities and binary profile interface propensities for protein binding site prediction. Each kind of propensities combined with sequence profiles and accessible surface areas are inputted into SVM. When tested on four types of complexes (hetero-permanent complexes, hetero-transient complexes, homo-permanent complexes and homo-transient complexes), experimental results show that the order profile interface propensities are better than residue interface propensities and binary profile interface propensities. Therefore, order profile is a suitable profile-level building block of the protein sequences and can be widely used in many tasks of computational biology, such as the sequence alignment, the prediction of domain boundary, the designation of knowledge-based potentials and the protein remote homology detection.

TINS, target immobilized NMR screening: an efficient and sensitive method for ligand discovery.

PubMed

Vanwetswinkel, Sophie; Heetebrij, Robert J; van Duynhoven, John; Hollander, Johan G; Filippov, Dmitri V; Hajduk, Philip J; Siegal, Gregg

2005-02-01

We propose a ligand screening method, called TINS (target immobilized NMR screening), which reduces the amount of target required for the fragment-based approach to drug discovery. Binding is detected by comparing 1D NMR spectra of compound mixtures in the presence of a target immobilized on a solid support to a control sample. The method has been validated by the detection of a variety of ligands for protein and nucleic acid targets (K(D) from 60 to 5000 muM). The ligand binding capacity of a protein was undiminished after 2000 different compounds had been applied, indicating the potential to apply the assay for screening typical fragment libraries. TINS can be used in competition mode, allowing rapid characterization of the ligand binding site. TINS may allow screening of targets that are difficult to produce or that are insoluble, such as membrane proteins.

Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sloan, J.W.

1984-01-01

These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

Affinity modulation of small-molecule ligands by borrowing endogenous protein surfaces

PubMed Central

Briesewitz, Roger; Ray, Gregory T.; Wandless, Thomas J.; Crabtree, Gerald R.

1999-01-01

A general strategy is described for improving the binding properties of small-molecule ligands to protein targets. A bifunctional molecule is created by chemically linking a ligand of interest to another small molecule that binds tightly to a second protein. When the ligand of interest is presented to the target protein by the second protein, additional protein–protein interactions outside of the ligand-binding sites serve either to increase or decrease the affinity of the binding event. We have applied this approach to an intractable target, the SH2 domain, and demonstrate a 3-fold enhancement over the natural peptide. This approach provides a way to modulate the potency and specificity of biologically active compounds. PMID:10051576

On the molecular interaction between lactoferrin and the dye Red HE-3B. A novel approach for docking a charged and highly flexible molecule to protein surfaces

NASA Astrophysics Data System (ADS)

Grasselli, Mariano; Cascone, Osvaldo; Anspach, F. Birger; Delfino, Jose M.

2002-12-01

Lactoferrin (Lf) is a non-heme, iron binding protein present in many physiological fluids of vertebrates where its main role is the microbicidal activity. It has been isolated by different methods, including dye-affinity chromatography. Red HE-3B is one of the most common triazinic dyes applied in protein purification, but scant knowledge is available on structural details and on the energetics of its interaction with proteins. In this work we present a computational approach useful for identifying possible binding sites for Red HE-3B in apo and holo forms of Lfs from human and bovine source. A new geometrical description of Red HE-3B is introduced which greatly simplifies the conformational analysis. This approach proved to be of particular advantage for addressing conformational ensembles of highly flexible molecules. Predictions from this analysis were correlated with experimentally observed dye-binding sites, as mapped by protection from proteolysis in Red HE-3B/Lf complexes. This method could bear relevance for the screening of possible dye-binding sites in proteins whose structure is known and as a potential tool for the design of engineered protein variants which could be purified by dye-affinity chromatography.

On the molecular interaction between lactoferrin and the dye Red HE-3b. A novel approach for docking a charged and highly flexible molecule to protein surfaces.

PubMed

Grasselli, Mariano; Cascone, Osvaldo; Birger Anspach, F; Delfino, Jose M

2002-12-01

Lactoferrin (Lf) is a non-heme, iron binding protein present in many physiological fluids of vertebrates where its main role is the microbicidal activity. It has been isolated by different methods, including dye-affinity chromatography. Red HE-3B is one of the most common triazinic dyes applied in protein purification, but scant knowledge is available on structural details and on the energetics of its interaction with proteins. In this work we present a computational approach useful for identifying possible binding sites for Red HE-3B in apo and holo forms of Lfs from human and bovine source. A new geometrical description of Red HE-3B is introduced which greatly simplifies the conformational analysis. This approach proved to be of particular advantage for addressing conformational ensembles of highly flexible molecules. Predictions from this analysis were correlated with experimentally observed dye-binding sites, as mapped by protection from proteolysis in Red HE-3B/Lf complexes. This method could bear relevance for the screening of possible dye-binding sites in proteins whose structure is known and as a potential tool for the design of engineered protein variants which could be purified by dye-affinity chromatography.

Virtual Lead Identification of Farnesyltransferase Inhibitors Based on Ligand and Structure-Based Pharmacophore Techniques

PubMed Central

Al-Balas, Qosay A.; Amawi, Haneen A.; Hassan, Mohammad A.; Qandil, Amjad M.; Almaaytah, Ammar M.; Mhaidat, Nizar M.

2013-01-01

Farnesyltransferase enzyme (FTase) is considered an essential enzyme in the Ras signaling pathway associated with cancer. Thus, designing inhibitors for this enzyme might lead to the discovery of compounds with effective anticancer activity. In an attempt to obtain effective FTase inhibitors, pharmacophore hypotheses were generated using structure-based and ligand-based approaches built in Discovery Studio v3.1. Knowing the presence of the zinc feature is essential for inhibitor’s binding to the active site of FTase enzyme; further customization was applied to include this feature in the generated pharmacophore hypotheses. These pharmacophore hypotheses were thoroughly validated using various procedures such as ROC analysis and ligand pharmacophore mapping. The validated pharmacophore hypotheses were used to screen 3D databases to identify possible hits. Those which were both high ranked and showed sufficient ability to bind the zinc feature in active site, were further refined by applying drug-like criteria such as Lipiniski’s “rule of five” and ADMET filters. Finally, the two candidate compounds (ZINC39323901 and ZINC01034774) were allowed to dock using CDOCKER and GOLD in the active site of FTase enzyme to optimize hit selection. PMID:24276257

Virtual lead identification of farnesyltransferase inhibitors based on ligand and structure-based pharmacophore techniques.

PubMed

Al-Balas, Qosay A; Amawi, Haneen A; Hassan, Mohammad A; Qandil, Amjad M; Almaaytah, Ammar M; Mhaidat, Nizar M

2013-05-27

Farnesyltransferase enzyme (FTase) is considered an essential enzyme in the Ras signaling pathway associated with cancer. Thus, designing inhibitors for this enzyme might lead to the discovery of compounds with effective anticancer activity. In an attempt to obtain effective FTase inhibitors, pharmacophore hypotheses were generated using structure-based and ligand-based approaches built in Discovery Studio v3.1. Knowing the presence of the zinc feature is essential for inhibitor's binding to the active site of FTase enzyme; further customization was applied to include this feature in the generated pharmacophore hypotheses. These pharmacophore hypotheses were thoroughly validated using various procedures such as ROC analysis and ligand pharmacophore mapping. The validated pharmacophore hypotheses were used to screen 3D databases to identify possible hits. Those which were both high ranked and showed sufficient ability to bind the zinc feature in active site, were further refined by applying drug-like criteria such as Lipiniski's "rule of five" and ADMET filters. Finally, the two candidate compounds (ZINC39323901 and ZINC01034774) were allowed to dock using CDOCKER and GOLD in the active site of FTase enzyme to optimize hit selection.

Inhalational anaesthetics and n-alcohols share a site of action in the neuronal Shaw2 Kv channel

PubMed Central

Bhattacharji, Aditya; Klett, Nathan; Go, Ramon Christopher V; Covarrubias, Manuel

2010-01-01

Background and purpose: Neuronal ion channels are key targets of general anaesthetics and alcohol, and binding of these drugs to pre-existing and relatively specific sites is thought to alter channel gating. However, the underlying molecular mechanisms of this action are still poorly understood. Here, we investigated the neuronal Shaw2 voltage-gated K+ (Kv) channel to ask whether the inhalational anaesthetic halothane and n-alcohols share a binding site near the activation gate of the channel. Experimental approach: Focusing on activation gate mutations that affect channel modulation by n-alcohols, we investigated n-alcohol-sensitive and n-alcohol-resistant Kv channels heterologously expressed in Xenopus oocytes to probe the functional modulation by externally applied halothane using two-electrode voltage clamping and a gas-tight perfusion system. Key results: Shaw2 Kv channels are reversibly inhibited by halothane in a dose-dependent and saturable manner (K0.5= 400 µM; nH= 1.2). Also, discrete mutations in the channel's S4S5 linker are sufficient to reduce or confer inhibition by halothane (Shaw2-T330L and Kv3.4-G371I/T378A respectively). Furthermore, a point mutation in the S6 segment of Shaw2 (P410A) converted the halothane-induced inhibition into halothane-induced potentiation. Lastly, the inhibition resulting from the co-application of n-butanol and halothane is consistent with the presence of overlapping binding sites for these drugs and weak binding cooperativity. Conclusions and implications: These observations strongly support a molecular model of a general anaesthetic binding site in the Shaw2 Kv channel. This site may involve the amphiphilic interface between the S4S5 linker and the S6 segment, which plays a pivotal role in Kv channel activation. PMID:20136839

Universal Sign Control of Coupling in Tight-Binding Lattices

NASA Astrophysics Data System (ADS)

Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander

2016-05-01

We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

A method for predicting individual residue contributions to enzyme specificity and binding-site energies, and its application to MTH1.

PubMed

Stewart, James J P

2016-11-01

A new method for predicting the energy contributions to substrate binding and to specificity has been developed. Conventional global optimization methods do not permit the subtle effects responsible for these properties to be modeled with sufficient precision to allow confidence to be placed in the results, but by making simple alterations to the model, the precisions of the various energies involved can be improved from about ±2 kcal mol -1 to ±0.1 kcal mol -1 . This technique was applied to the oxidized nucleotide pyrophosphohydrolase enzyme MTH1. MTH1 is unusual in that the binding and reaction sites are well separated-an advantage from a computational chemistry perspective, as it allows the energetics involved in docking to be modeled without the need to consider any issues relating to reaction mechanisms. In this study, two types of energy terms were investigated: the noncovalent interactions between the binding site and the substrate, and those responsible for discriminating between the oxidized nucleotide 8-oxo-dGTP and the normal dGTP. Both of these were investigated using the semiempirical method PM7 in the program MOPAC. The contributions of the individual residues to both the binding energy and the specificity of MTH1 were calculated by simulating the effect of mutations. Where comparisons were possible, all calculated results were in agreement with experimental observations. This technique provides fresh insight into the binding mechanism that enzymes use for discriminating between possible substrates.

An Electrostatic Funnel in the GABA-Binding Pathway

PubMed Central

Lightstone, Felice C.

2016-01-01

The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

A flexible docking scheme to explore the binding selectivity of PDZ domains.

PubMed

Gerek, Z Nevin; Ozkan, S Banu

2010-05-01

Modeling of protein binding site flexibility in molecular docking is still a challenging problem due to the large conformational space that needs sampling. Here, we propose a flexible receptor docking scheme: A dihedral restrained replica exchange molecular dynamics (REMD), where we incorporate the normal modes obtained by the Elastic Network Model (ENM) as dihedral restraints to speed up the search towards correct binding site conformations. To our knowledge, this is the first approach that uses ENM modes to bias REMD simulations towards binding induced fluctuations in docking studies. In our docking scheme, we first obtain the deformed structures of the unbound protein as initial conformations by moving along the binding fluctuation mode, and perform REMD using the ENM modes as dihedral restraints. Then, we generate an ensemble of multiple receptor conformations (MRCs) by clustering the lowest replica trajectory. Using ROSETTALIGAND, we dock ligands to the clustered conformations to predict the binding pose and affinity. We apply this method to postsynaptic density-95/Dlg/ZO-1 (PDZ) domains; whose dynamics govern their binding specificity. Our approach produces the lowest energy bound complexes with an average ligand root mean square deviation of 0.36 A. We further test our method on (i) homologs and (ii) mutant structures of PDZ where mutations alter the binding selectivity. In both cases, our approach succeeds to predict the correct pose and the affinity of binding peptides. Overall, with this approach, we generate an ensemble of MRCs that leads to predict the binding poses and specificities of a protein complex accurately.

A flexible docking scheme to explore the binding selectivity of PDZ domains

PubMed Central

Gerek, Z Nevin; Ozkan, S Banu

2010-01-01

Modeling of protein binding site flexibility in molecular docking is still a challenging problem due to the large conformational space that needs sampling. Here, we propose a flexible receptor docking scheme: A dihedral restrained replica exchange molecular dynamics (REMD), where we incorporate the normal modes obtained by the Elastic Network Model (ENM) as dihedral restraints to speed up the search towards correct binding site conformations. To our knowledge, this is the first approach that uses ENM modes to bias REMD simulations towards binding induced fluctuations in docking studies. In our docking scheme, we first obtain the deformed structures of the unbound protein as initial conformations by moving along the binding fluctuation mode, and perform REMD using the ENM modes as dihedral restraints. Then, we generate an ensemble of multiple receptor conformations (MRCs) by clustering the lowest replica trajectory. Using RosettaLigand, we dock ligands to the clustered conformations to predict the binding pose and affinity. We apply this method to postsynaptic density-95/Dlg/ZO-1 (PDZ) domains; whose dynamics govern their binding specificity. Our approach produces the lowest energy bound complexes with an average ligand root mean square deviation of 0.36 Å. We further test our method on (i) homologs and (ii) mutant structures of PDZ where mutations alter the binding selectivity. In both cases, our approach succeeds to predict the correct pose and the affinity of binding peptides. Overall, with this approach, we generate an ensemble of MRCs that leads to predict the binding poses and specificities of a protein complex accurately. PMID:20196074

Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

PubMed Central

Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

2013-01-01

Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

Extended Graph-Based Models for Enhanced Similarity Search in Cavbase.

PubMed

Krotzky, Timo; Fober, Thomas; Hüllermeier, Eyke; Klebe, Gerhard

2014-01-01

To calculate similarities between molecular structures, measures based on the maximum common subgraph are frequently applied. For the comparison of protein binding sites, these measures are not fully appropriate since graphs representing binding sites on a detailed atomic level tend to get very large. In combination with an NP-hard problem, a large graph leads to a computationally demanding task. Therefore, for the comparison of binding sites, a less detailed coarse graph model is used building upon so-called pseudocenters. Consistently, a loss of structural data is caused since many atoms are discarded and no information about the shape of the binding site is considered. This is usually resolved by performing subsequent calculations based on additional information. These steps are usually quite expensive, making the whole approach very slow. The main drawback of a graph-based model solely based on pseudocenters, however, is the loss of information about the shape of the protein surface. In this study, we propose a novel and efficient modeling formalism that does not increase the size of the graph model compared to the original approach, but leads to graphs containing considerably more information assigned to the nodes. More specifically, additional descriptors considering surface characteristics are extracted from the local surface and attributed to the pseudocenters stored in Cavbase. These properties are evaluated as additional node labels, which lead to a gain of information and allow for much faster but still very accurate comparisons between different structures.

Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ

NASA Astrophysics Data System (ADS)

Bolla, Jani Reddy; Sauer, Joshua B.; Wu, Di; Mehmood, Shahid; Allison, Timothy M.; Robinson, Carol V.

2018-03-01

Translocation of lipid II across the cytoplasmic membrane is essential in peptidoglycan biogenesis. Although most steps are understood, identifying the lipid II flippase has yielded conflicting results, and the lipid II binding properties of two candidate flippases—MurJ and FtsW—remain largely unknown. Here we apply native mass spectrometry to both proteins and characterize lipid II binding. We observed lower levels of lipid II binding to FtsW compared to MurJ, consistent with MurJ having a higher affinity. Site-directed mutagenesis of MurJ suggests that mutations at A29 and D269 attenuate lipid II binding to MurJ, whereas chemical modification of A29 eliminates binding. The antibiotic ramoplanin dissociates lipid II from MurJ, whereas vancomycin binds to form a stable complex with MurJ:lipid II. Furthermore, we reveal cardiolipins associate with MurJ but not FtsW, and exogenous cardiolipins reduce lipid II binding to MurJ. These observations provide insights into determinants of lipid II binding to MurJ and suggest roles for endogenous lipids in regulating substrate binding.

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

PubMed

Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

2017-06-01

Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

Substrate-binding specificity of chitinase and chitosanase as revealed by active-site architecture analysis.

PubMed

Liu, Shijia; Shao, Shangjin; Li, Linlin; Cheng, Zhi; Tian, Li; Gao, Peiji; Wang, Lushan

2015-12-11

Chitinases and chitosanases, referred to as chitinolytic enzymes, are two important categories of glycoside hydrolases (GH) that play a key role in degrading chitin and chitosan, two naturally abundant polysaccharides. Here, we investigate the active site architecture of the major chitosanase (GH8, GH46) and chitinase families (GH18, GH19). Both charged (Glu, His, Arg, Asp) and aromatic amino acids (Tyr, Trp, Phe) are observed with higher frequency within chitinolytic active sites as compared to elsewhere in the enzyme structure, indicating significant roles related to enzyme function. Hydrogen bonds between chitinolytic enzymes and the substrate C2 functional groups, i.e. amino groups and N-acetyl groups, drive substrate recognition, while non-specific CH-π interactions between aromatic residues and substrate mainly contribute to tighter binding and enhanced processivity evident in GH8 and GH18 enzymes. For different families of chitinolytic enzymes, the number, type, and position of substrate atoms bound in the active site vary, resulting in different substrate-binding specificities. The data presented here explain the synergistic action of multiple enzyme families at a molecular level and provide a more reasonable method for functional annotation, which can be further applied toward the practical engineering of chitinases and chitosanases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Searching for protein binding sites from Molecular Dynamics simulations and paramagnetic fragment-based NMR studies.

PubMed

Bernini, Andrea; Henrici De Angelis, Lucia; Morandi, Edoardo; Spiga, Ottavia; Santucci, Annalisa; Assfalg, Michael; Molinari, Henriette; Pillozzi, Serena; Arcangeli, Annarosa; Niccolai, Neri

2014-03-01

Hotspot delineation on protein surfaces represents a fundamental step for targeting protein-protein interfaces. Disruptors of protein-protein interactions can be designed provided that the sterical features of binding pockets, including the transient ones, can be defined. Molecular Dynamics, MD, simulations have been used as a reliable framework for identifying transient pocket openings on the protein surface. Accessible surface area and intramolecular H-bond involvement of protein backbone amides are proposed as descriptors for characterizing binding pocket occurrence and evolution along MD trajectories. TEMPOL induced paramagnetic perturbations on (1)H-(15)N HSQC signals of protein backbone amides have been analyzed as a fragment-based search for surface hotspots, in order to validate MD predicted pockets. This procedure has been applied to CXCL12, a small chemokine responsible for tumor progression and proliferation. From combined analysis of MD data and paramagnetic profiles, two CXCL12 sites suitable for the binding of small molecules were identified. One of these sites is the already well characterized CXCL12 region involved in the binding to CXCR4 receptor. The other one is a transient pocket predicted by Molecular Dynamics simulations, which could not be observed from static analysis of CXCL12 PDB structures. The present results indicate how TEMPOL, instrumental in identifying this transient pocket, can be a powerful tool to delineate minor conformations which can be highly relevant in dynamic discovery of antitumoral drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

Differential Binding Models for Direct and Reverse Isothermal Titration Calorimetry.

PubMed

Herrera, Isaac; Winnik, Mitchell A

2016-03-10

Isothermal titration calorimetry (ITC) is a technique to measure the stoichiometry and thermodynamics from binding experiments. Identifying an appropriate mathematical model to evaluate titration curves of receptors with multiple sites is challenging, particularly when the stoichiometry or binding mechanism is not available. In a recent theoretical study, we presented a differential binding model (DBM) to study calorimetry titrations independently of the interaction among the binding sites (Herrera, I.; Winnik, M. A. J. Phys. Chem. B 2013, 117, 8659-8672). Here, we build upon our DBM and show its practical application to evaluate calorimetry titrations of receptors with multiple sites independently of the titration direction. Specifically, we present a set of ordinary differential equations (ODEs) with the general form d[S]/dV that can be integrated numerically to calculate the equilibrium concentrations of free and bound species S at every injection step and, subsequently, to evaluate the volume-normalized heat signal (δQ(V) = δq/dV) of direct and reverse calorimetry titrations. Additionally, we identify factors that influence the shape of the titration curve and can be used to optimize the initial concentrations of titrant and analyte. We demonstrate the flexibility of our updated DBM by applying these differentials and a global regression analysis to direct and reverse calorimetric titrations of gadolinium ions with multidentate ligands of increasing denticity, namely, diglycolic acid (DGA), citric acid (CIT), and nitrilotriacetic acid (NTA), and use statistical tests to validate the stoichiometries for the metal-ligand pairs studied.

Elucidating the mechanism for the reduction of nitrite by copper nitrite reductase--a contribution from quantum chemical studies.

PubMed

De Marothy, S A; Blomberg, M R A; Siegbahn, P E M

2007-01-30

Density functional methods have been applied to investigate the properties of the active site of copper-containing nitrite reductases and possible reaction mechanisms for the enzyme catalysis. The results for a model of the active site indicate that a hydroxyl intermediate is not formed during the catalytic cycle, but rather a state with a protonated nitrite bound to the reduced copper. Electron affinity calculations indicate that reduction of the T2 copper site does not occur immediately after nitrite binding. Proton affinity calculations are indicative of substantial pK(a) differences between different states of the T2 site. The calculations further suggest that the reaction does not proceed until uptake of a second proton from the bulk solution. They also indicate that Asp-92 may play both a key role as a proton donor to the substrate, and a structural role in promoting catalysis. In the D92N mutant another base, presumably a nearby histidine (His-249) may take the role as the proton donor. On the basis of these model calculations and available experimental evidence, an ordered reaction mechanism for the reduction of nitrite is suggested. An investigation of the binding modes of the nitric oxide product and the nitrite substrate to the model site has also been made, indicating that nitric oxide prefers to bind in an end-on fashion to the reduced T2 site.

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

NASA Astrophysics Data System (ADS)

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-01

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

PubMed

Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

2016-08-05

Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Allosteric binding sites in Rab11 for potential drug candidates

PubMed Central

2018-01-01

Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, A.M.; Vandesande, F.; Orban, G.A.

1991-03-08

The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

Glycoconjugate pattern of membranes in the acinar cell of the rat pancreas.

PubMed

Willemer, S; Köhler, H; Naumann, R; Kern, H F; Adler, G

1990-01-01

Lectin-binding studies were performed at the ultrastructural level to characterize glycoconjugate patterns on membrane systems in pancreatic acinar cells of the rat. Five lectins reacting with different sugar moieties were applied to ultrathin frozen sections: concanavalin A (ConA): glucose, mannose; wheat-germ agglutinin (WGA): N-acetylglucosamine, sialic acid; Ricinus communis agglutinin I (RCA I): galactose; Ulex europaeus agglutinin I (UEA I): L-fucose; soybean agglutinin (SBA): N-acetylgalactosamine). Binding sites of lectins were visualized either by direct conjugation to colloidal gold or by the use of a three-step procedure involving additional immune reactions. The rough endoplasmic reticulum and the nuclear envelope of acinar cells was selectively labelled for ConA. The membranes of the Golgi apparatus bound all lectins applied with an increasing intensity proceeding from the cis- to the trans-Golgi area for SBA, UEA I and WGA. In contrast RCA I selectively labelled the trans-Golgi cisternae. The membranes of condensing vacuoles and zymogen granules were labelled for all lectins used although the density of the label differed between the lectins. In contrast the content of zymogen granules failed to bind SBA and WGA. Lysosomal bodies (membranes and content) revealed binding sites for all lectins used. The plasma membranes were heavily labelled by all lectins except for SBA which showed only a weak binding to the lateral and the apical plasma membrane. These results are in accordance to current biochemical knowledge of the successive steps in the glycosylation of membrane proteins. It could be demonstrated, that the cryo-section technique is suitable for the fine structural localisation of surface glycoconjugates of plasma membranes and internal membranes in pancreatic acinar cells using plant lectins.

Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

PubMed Central

Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

1999-01-01

A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

PubMed

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

Use of polyclonal and monoclonal antibodies to study hCG-receptor interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milius, R.P.

1985-01-01

Although the glycoprotein hormones lutropin (LH), follitropin (FSH), and thyrotropin (TSH) bind to different receptors, each contains an identical alpha subunit. Specificity is somehow endowed by theta subunits which are distinct for each hormone. Human choriogonadotropin (hCG) is a natural LH analog that contains a beta subunit nearly identical to that of LH. The roles of these subunits in the recognition and high affinity binding of hCG to receptor was examined. Polyclonal and monoclonal antibodies specific for the individual subunits of hCG were used to probe the hormone-receptor interaction. Conformation-specific and sequence-specific antibodies were examined for their abilities to bindmore » Triton X-100-solubilized /sup 125/I-hCG-receptor complex and to inhibit hormone binding to crude rat ovarian membranes containing receptor. Even though the immunoreactive sites are not located on the receptor binding surface of the beta subunit, most, but not all, of these polyclonal and monoclonal antibodies were able to inhibit /sup 125/I-hCG binding to receptor. Although the inhibition of binding may be due to steric interference due to the size of the antibody molecules, a two-step model for hCG binding to receptor is presented that also explains these results. In this model, the beta subunit initially binds with the receptor with a highly specific but low affinity interaction. This activates a site for the high affinity binding of the alpha subunit and stabilization of the complex. This is an attractive model as it may be applied to other glycoprotein hormones sharing an alpha subunit.« less

Bioinformatics approaches to predict target genes from transcription factor binding data.

PubMed

Essebier, Alexandra; Lamprecht, Marnie; Piper, Michael; Bodén, Mikael

2017-12-01

Transcription factors regulate gene expression and play an essential role in development by maintaining proliferative states, driving cellular differentiation and determining cell fate. Transcription factors are capable of regulating multiple genes over potentially long distances making target gene identification challenging. Currently available experimental approaches to detect distal interactions have multiple weaknesses that have motivated the development of computational approaches. Although an improvement over experimental approaches, existing computational approaches are still limited in their application, with different weaknesses depending on the approach. Here, we review computational approaches with a focus on data dependency, cell type specificity and usability. With the aim of identifying transcription factor target genes, we apply available approaches to typical transcription factor experimental datasets. We show that approaches are not always capable of annotating all transcription factor binding sites; binding sites should be treated disparately; and a combination of approaches can increase the biological relevance of the set of genes identified as targets. Copyright © 2017 Elsevier Inc. All rights reserved.

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

Discovery of novel and cardioselective diltiazem-like calcium channel blockers via virtual screening.

PubMed

Carosati, Emanuele; Budriesi, Roberta; Ioan, Pierfranco; Ugenti, Maria P; Frosini, Maria; Fusi, Fabio; Corda, Gaetano; Cosimelli, Barbara; Spinelli, Domenico; Chiarini, Alberto; Cruciani, Gabriele

2008-09-25

With the effort to discover new chemotypes blocking L-type calcium channels (LTCCs), ligand-based virtual screening was applied with a specific interest toward the diltiazem binding site. Roughly 50000 commercially available compounds served as a database for screening. The filtering through predicted pharmacokinetic properties and structural requirements reduced the initial database to a few compounds for which the similarity was calculated toward two template molecules, diltiazem and 4-chloro-Ncyclopropyl- N-(4-piperidinyl)benzene-sulfonamide, the most interesting hit of a previous screening experiment. For 18 compounds, inotropic and chronotropic activity as well as the vasorelaxant effect on guinea pig were studied "in vitro", and for the most promising, binding studies to the diltiazem site were carried out. The procedure yielded several hits, confirming in silico techniques to be useful for finding new chemotypes. In particular, N-[2-(dimethylamino)ethyl]-3-hydroxy-2-naphthamide, N,Ndimethyl- N'-(2-pyridin-3-ylquinolin-4-yl)ethane-1,2-diamine, 2-[(4-chlorophenyl)(pyridin-2-yl)methoxy]- N,N-dimethylethanamine (carbinoxamine), and 7-[2-(diethylamino)ethoxy]-2H-chromen-2-one revealed interesting activity and binding to the benzothiazepine site.

The Role of Binding Site on the Mechanical Unfolding Mechanism of Ubiquitin

NASA Astrophysics Data System (ADS)

Cao, Penghui; Yoon, Gwonchan; Tao, Weiwei; Eom, Kilho; Park, Harold S.

2015-03-01

We apply novel atomistic simulations based on potential energy surface exploration to investigate the constant force-induced unfolding of ubiquitin. At the experimentally-studied force clamping level of 100 pN, we find a new unfolding mechanism starting with the detachment between β5 and β3 involving the binding site of ubiquitin, the Ile44 residue. This new unfolding pathway leads to the discovery of new intermediate configurations, which correspond to the end-to-end extensions previously seen experimentally. More importantly, it demonstrates the novel finding that the binding site of ubiquitin can be responsible not only for its biological functions, but also its unfolding dynamics. We also report in contrast to previous single molecule constant force experiments that when the clamping force becomes smaller than about 300 pN, the number of intermediate configurations increases dramatically, where almost all unfolding events at 100 pN involve an intermediate configuration. By directly calculating the life times of the intermediate configurations from the height of the barriers that were crossed on the potential energy surface, we demonstrate that these intermediate states were likely not observed experimentally due to their lifetimes typically being about two orders of magnitude smaller than the experimental temporal resolution.

Identifying Ca2+-Binding Sites in Proteins by Liquid Chromatography-Mass Spectrometry Using Ca2+-Directed Dissociations

PubMed Central

Jamalian, Azadeh; Sneekes, Evert-Jan; Wienk, Hans; Dekker, Lennard J. M.; Ruttink, Paul J. A.; Ursem, Mario; Luider, Theo M.; Burgers, Peter C.

2014-01-01

Here we describe a new method to identify calcium-binding sites in proteins using high-resolution liquid chromatography-mass spectrometry in concert with calcium-directed collision-induced dissociations. Our method does not require any modifications to the liquid chromatography-mass spectrometry apparatus, uses standard digestion protocols, and can be applied to existing high-resolution MS data files. In contrast to NMR, our method is applicable to very small amounts of complex protein mixtures (femtomole level). Calcium-bound peptides can be identified using three criteria: (1) the calculated exact mass of the calcium containing peptide; (2) specific dissociations of the calcium-containing peptide from threonine and serine residues; and (3) the very similar retention times of the calcium-containing peptide and the free peptide. PMID:25023127

Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

PubMed Central

Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

2013-01-01

Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

Improved neovascularization and wound repair by targeting human basic fibroblast growth factor (bFGF) to fibrin.

PubMed

Zhao, Wenxue; Han, Qianqian; Lin, Hang; Gao, Yuan; Sun, Wenjie; Zhao, Yannan; Wang, Bin; Chen, Bing; Xiao, Zhifeng; Dai, Jianwu

2008-10-01

Targeted therapy is a new generation of therapeutics, where two critical factors are involved. One is the particular molecular target, and the other is the specific target-binding drug. In this work, the fibrin, a main component of plasma clot at wound sites, was used as the target for human bFGF, aiming to improve therapeutic neovascularization and wound repair. To endow bFGF with fibrin-targeting ability, a fibrin-binding peptide Kringle1 (K1), derived from human plasminogen, was fused to human bFGF. The recombinant K1bFGF showed high fibrin and plasma-clot-binding ability. When applied to the wound sites with plasma clots, K1bFGF induced robust neovascularization and improved wound healing. To extend the application of K1bFGF to other cases where no plasma clots exist, we developed a fibrin-scaffold/K1bFGF system. This system could induce localized neovascularization by delivery of K1bFGF in a sustained and site-targeting manner, and provide a microenvironment promoting cell growth and tissue regeneration. In summary, we successfully used the pathologic environment fibrin clot as the target for bFGF, and based on which bFGF was designed into a targeting agent by introduction of a fibrin-binding peptide. This provides a potential approach to improve therapeutic neovascularization and wound repair.

Computer-assisted identification of novel small molecule inhibitors targeting GLUT1

NASA Astrophysics Data System (ADS)

Wan, Zhining; Li, Xin; Sun, Rong; Li, Yuanyuan; Wang, Xiaoyun; Li, Xinru; Rong, Li; Shi, Zheng; Bao, Jinku

2015-12-01

Glucose transporters (GLUTs) are the main carriers of glucose that facilitate the diffusion of glucose in mammalian cells, especially GLUT1. Notably, GLUT1 is a rate-limiting transporter for glucose uptake, and its overexpression is a common characteristic in most cancers. Thus, the inhibition of GLUT1 by novel small compounds to lower glucose levels for cancer cells has become an emerging strategy. Herein, we employed high-throughput screening approaches to identify potential inhibitors against the sugar-binding site of GLUT1. Firstly, molecular docking screening was launched against the specs products, and three molecules (ZINC19909927, ZINC19908826, and ZINC19815451) were selected as candidate GLUT1 inhibitors for further analysis. Then, taking the initial ligand β-NG as a reference, molecular dynamic (MD) simulations and molecular mechanics/generalized born surface area (MM/GBSA) method were applied to evaluate the binding stability and affinity of the three candidates towards GLUT1. Finally, we found that ZINC19909927 might have the highest affinity to occupy the binding site of GLUT1. Meanwhile, energy decomposition analysis identified several residues located in substrate-binding site that might provide clues for future inhibitor discovery towards GLUT1. Taken together, these results in our study may provide valuable information for identifying new inhibitors targeting GLUT1-mediated glucose transport and metabolism for cancer therapeutics.

Segregation of O2 and CO on the surface of dust grains determines the desorption energy of O2

NASA Astrophysics Data System (ADS)

Noble, J. A.; Diana, S.; Dulieu, F.

2015-12-01

Selective depletion towards pre-stellar cores is still not understood. The exchange between the solid and gas phases is central to this mystery. The aim of this paper is to show that the thermal desorption of O2 and CO from a submonolayer mixture is greatly affected by the composition of the initial surface population. We have performed thermally programmed desorption (TPD) experiments on various submonolayer mixtures of O2 and CO. Pure O2 and CO exhibit almost the same desorption behaviour, but their desorption differs strongly when mixed. Pure O2 is slightly less volatile than CO, while in mixtures, O2 desorbs earlier than CO. We analyse our data using a desorption law linking competition for binding sites with desorption, based on the assumption that the binding energy distribution of both molecules is the same. We apply Fermi-Dirac statistics in order to calculate the adsorption site population distribution, and derive the desorbing fluxes. Despite its simplicity, the model reproduces the observed desorption profiles, indicating that competition for adsorption sites is the reason for lower temperature O2 desorption. CO molecules push-out or `dislodge' O2 molecules from the most favourable binding sites, ultimately forcing their early desorption. It is crucial to consider the surface coverage of dust grains in any description of desorption. Competition for access to binding sites results in some important discrepancies between similar kinds of molecules, such as CO and O2. This is an important phenomenon to be investigated in order to develop a better understanding of the apparently selective depletion observed in dark molecular clouds.

A 23Na Multiple-Quantum-Filtered NMR Study of the Effect of the Cytoskeleton Conformation on the Anisotropic Motion of Sodium Ions in Red Blood Cells

NASA Astrophysics Data System (ADS)

Knubovets, Tatyana; Shinar, Hadassah; Eliav, Uzi; Navon, Gil

1996-01-01

Recently, it has been shown that23Na double-quantum-filtered NMR spectroscopy can be used to detect anisotropic motion of bound sodium ions in biological systems. The technique is based on the formation of the second-rank tensor when the quadrupolar interaction is not averaged to zero. Using this method, anisotropic motion of bound sodium in human and dog red blood cells was detected, and the effect was shown to depend on the integrity of the membrane cytoskeleton. In the present study, multiple-quantum-filtered techniques were applied in combination with a quadrupolar echo to measure the transverse-relaxation times,T2fandT2s. Line fitting was performed to obtain the values of the residual quadrupolar interaction, which was measured for sodium in a variety of mammalian erythrocytes of different size, shape, rheological properties, and sodium concentrations. Human unsealed white ghosts were used to study sodium bound at the anisotropic sites on the inner side of the RBC membrane. Modulations of the conformation of the cytoskeleton by the variation of either the ionic strength or pH of the suspending medium caused drastic changes in both the residual quadrupolar interaction andT2fdue to changes in the fraction of bound sodium ions as well as changes in the structure of the binding sites. By combining the two spectroscopic parameters, structural change can be followed. The changes in the structure of the sodium anisotropic binding sites deduced by this method were found to correlate with known conformational changes of the membrane cytoskeleton. Variations of the medium pH affected both the fraction of bound sodium ions and the structure of the anisotropic binding sites. Sodium and potassium were shown to bind to the anisotropic binding sites with the same affinity.

From reads to regions: a Bioconductor workflow to detect differential binding in ChIP-seq data

PubMed Central

Lun, Aaron T. L.; Smyth, Gordon K.

2016-01-01

Chromatin immunoprecipitation with massively parallel sequencing (ChIP-seq) is widely used to identify the genomic binding sites for protein of interest. Most conventional approaches to ChIP-seq data analysis involve the detection of the absolute presence (or absence) of a binding site. However, an alternative strategy is to identify changes in the binding intensity between two biological conditions, i.e., differential binding (DB). This may yield more relevant results than conventional analyses, as changes in binding can be associated with the biological difference being investigated. The aim of this article is to facilitate the implementation of DB analyses, by comprehensively describing a computational workflow for the detection of DB regions from ChIP-seq data. The workflow is based primarily on R software packages from the open-source Bioconductor project and covers all steps of the analysis pipeline, from alignment of read sequences to interpretation and visualization of putative DB regions. In particular, detection of DB regions will be conducted using the counts for sliding windows from the csaw package, with statistical modelling performed using methods in the edgeR package. Analyses will be demonstrated on real histone mark and transcription factor data sets. This will provide readers with practical usage examples that can be applied in their own studies. PMID:26834993

Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

PubMed

Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

2017-07-01

Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

Pattern similarity study of functional sites in protein sequences: lysozymes and cystatins

PubMed Central

Nakai, Shuryo; Li-Chan, Eunice CY; Dou, Jinglie

2005-01-01

Background Although it is generally agreed that topography is more conserved than sequences, proteins sharing the same fold can have different functions, while there are protein families with low sequence similarity. An alternative method for profile analysis of characteristic conserved positions of the motifs within the 3D structures may be needed for functional annotation of protein sequences. Using the approach of quantitative structure-activity relationships (QSAR), we have proposed a new algorithm for postulating functional mechanisms on the basis of pattern similarity and average of property values of side-chains in segments within sequences. This approach was used to search for functional sites of proteins belonging to the lysozyme and cystatin families. Results Hydrophobicity and β-turn propensity of reference segments with 3–7 residues were used for the homology similarity search (HSS) for active sites. Hydrogen bonding was used as the side-chain property for searching the binding sites of lysozymes. The profiles of similarity constants and average values of these parameters as functions of their positions in the sequences could identify both active and substrate binding sites of the lysozyme of Streptomyces coelicolor, which has been reported as a new fold enzyme (Cellosyl). The same approach was successfully applied to cystatins, especially for postulating the mechanisms of amyloidosis of human cystatin C as well as human lysozyme. Conclusion Pattern similarity and average index values of structure-related properties of side chains in short segments of three residues or longer were, for the first time, successfully applied for predicting functional sites in sequences. This new approach may be applicable to studying functional sites in un-annotated proteins, for which complete 3D structures are not yet available. PMID:15904486

Functional diversification of ROK-family transcriptional regulators of sugar catabolism in the Thermotogae phylum

PubMed Central

Kazanov, Marat D.; Li, Xiaoqing; Gelfand, Mikhail S.; Osterman, Andrei L.; Rodionov, Dmitry A.

2013-01-01

Large and functionally heterogeneous families of transcription factors have complex evolutionary histories. What shapes specificities toward effectors and DNA sites in paralogous regulators is a fundamental question in biology. Bacteria from the deep-branching lineage Thermotogae possess multiple paralogs of the repressor, open reading frame, kinase (ROK) family regulators that are characterized by carbohydrate-sensing domains shared with sugar kinases. We applied an integrated genomic approach to study functions and specificities of regulators from this family. A comparative analysis of 11 Thermotogae genomes revealed novel mechanisms of transcriptional regulation of the sugar utilization networks, DNA-binding motifs and specific functions. Reconstructed regulons for seven groups of ROK regulators were validated by DNA-binding assays using purified recombinant proteins from the model bacterium Thermotoga maritima. All tested regulators demonstrated specific binding to their predicted cognate DNA sites, and this binding was inhibited by specific effectors, mono- or disaccharides from their respective sugar catabolic pathways. By comparing ligand-binding domains of regulators with structurally characterized kinases from the ROK family, we elucidated signature amino acid residues determining sugar-ligand regulator specificity. Observed correlations between signature residues and the sugar-ligand specificities provide the framework for structure functional classification of the entire ROK family. PMID:23209028

Self-consistent field theory of polymer-ionic molecule complexation.

PubMed

Nakamura, Issei; Shi, An-Chang

2010-05-21

A self-consistent field theory is developed for polymers that are capable of binding small ionic molecules (adsorbates). The polymer-ionic molecule association is described by Ising-like binding variables, C(i) ((a))(kDelta)(=0 or 1), whose average determines the number of adsorbed molecules, n(BI). Polymer gelation can occur through polymer-ionic molecule complexation in our model. For polymer-polymer cross-links through the ionic molecules, three types of solutions for n(BI) are obtained, depending on the equilibrium constant of single-ion binding. Spinodal lines calculated from the mean-field free energy exhibit closed-loop regions where the homogeneous phase becomes unstable. This phase instability is driven by the excluded-volume interaction due to the single occupancy of ion-binding sites on the polymers. Moreover, sol-gel transitions are examined using a critical degree of conversion. A gel phase is induced when the concentration of adsorbates is increased. At a higher concentration of the adsorbates, however, a re-entrance from a gel phase into a sol phase arises from the correlation between unoccupied and occupied ion-binding sites. The theory is applied to a model system, poly(vinyl alcohol) and borate ion in aqueous solution with sodium chloride. Good agreement between theory and experiment is obtained.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

2005-01-01

The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

PubMed Central

Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

2015-01-01

The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

Differential regulation of NMDA receptors by d-serine and glycine in mammalian spinal locomotor networks

PubMed Central

Acton, David

2017-01-01

Activation of N-methyl-d-aspartate receptors (NMDARs) requires the binding of a coagonist, either d-serine or glycine, in addition to glutamate. Changes in occupancy of the coagonist binding site are proposed to modulate neural networks including those controlling swimming in frog tadpoles. Here, we characterize regulation of the NMDAR coagonist binding site in mammalian spinal locomotor networks. Blockade of NMDARs by d(−)-2-amino-5-phosphonopentanoic acid (d-APV) or 5,7-dichlorokynurenic acid reduced the frequency and amplitude of pharmacologically induced locomotor-related activity recorded from the ventral roots of spinal-cord preparations from neonatal mice. Furthermore, d-APV abolished synchronous activity induced by blockade of inhibitory transmission. These results demonstrate an important role for NMDARs in murine locomotor networks. Bath-applied d-serine enhanced the frequency of locomotor-related but not disinhibited bursting, indicating that coagonist binding sites are saturated during the latter but not the former mode of activity. Depletion of endogenous d-serine by d-amino acid oxidase or the serine-racemase inhibitor erythro-β-hydroxy-l-aspartic acid (HOAsp) increased the frequency of locomotor-related activity, whereas application of l-serine to enhance endogenous d-serine synthesis reduced burst frequency, suggesting a requirement for d-serine at a subset of synapses onto inhibitory interneurons. Consistent with this, HOAsp was ineffective during disinhibited activity. Bath-applied glycine (1–100 µM) failed to alter locomotor-related activity, whereas ALX 5407, a selective inhibitor of glycine transporter-1 (GlyT1), enhanced burst frequency, supporting a role for GlyT1 in NMDAR regulation. Together these findings indicate activity-dependent and synapse-specific regulation of the coagonist binding site within spinal locomotor networks, illustrating the importance of NMDAR regulation in shaping motor output. NEW & NOTEWORTHY We provide evidence that NMDARs within murine spinal locomotor networks determine the frequency and amplitude of ongoing locomotor-related activity in vitro and that NMDARs are regulated by d-serine and glycine in a synapse-specific and activity-dependent manner. In addition, glycine transporter-1 is shown to be an important regulator of NMDARs during locomotor-related activity. These results show how excitatory transmission can be tuned to diversify the output repertoire of spinal locomotor networks in mammals. PMID:28202572

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

PubMed

Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

2013-07-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

PubMed Central

Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

2013-01-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

2009-05-22

Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

NASA Astrophysics Data System (ADS)

Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

2013-08-01

The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

1987-11-01

Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

PubMed Central

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

PubMed

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

2013-09-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

2017-03-28

Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

Characterization of lithium coordination sites with magic-angle spinning NMR

NASA Astrophysics Data System (ADS)

Haimovich, A.; Goldbourt, A.

2015-05-01

Lithium, in the form of lithium carbonate, is one of the most common drugs for bipolar disorder. Lithium is also considered to have an effect on many other cellular processes hence it possesses additional therapeutic as well as side effects. In order to quantitatively characterize the binding mode of lithium, it is required to identify the interacting species and measure their distances from the metal center. Here we use magic-angle spinning (MAS) solid-state NMR to study the binding site of lithium in complex with glycine and water (LiGlyW). Such a compound is a good enzyme mimetic since lithium is four-coordinated to one water molecule and three carboxylic groups. Distance measurements to carbons are performed using a 2D transferred echo double resonance (TEDOR) MAS solid-state NMR experiment, and water binding is probed by heteronuclear high-resolution proton-lithium and proton-carbon correlation (wPMLG-HETCOR) experiments. Both HETCOR experiments separate the main complex from impurities and non-specifically bound lithium species, demonstrating the sensitivity of the method to probe the species in the binding site. Optimizations of the TEDOR pulse scheme in the case of a quadrupolar nucleus with a small quadrupole coupling constant show that it is most efficient when pulses are positioned on the spin-1/2 (carbon-13) nucleus. Since the intensity of the TEDOR signal is not normalized, careful data analysis that considers both intensity and dipolar oscillations has to be performed. Nevertheless we show that accurate distances can be extracted for both carbons of the bound glycine and that these distances are consistent with the X-ray data and with lithium in a tetrahedral environment. The lithium environment in the complex is very similar to the binding site in inositol monophosphatase, an enzyme associated with bipolar disorder and the putative target for lithium therapy. A 2D TEDOR experiment applied to the bacterial SuhB gene product of this enzyme was designed to probe direct correlations between lithium, the enzyme inhibitor, and the closest carboxyl carbons of the binding site. At this point, the chemical shift of the bound carboxyl groups in this 29 kDa enzyme could be determined.

An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

PubMed

Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

2014-01-01

Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances ChIP-seq data analysis and allows the identification of multiple SUMOylated TF binding sites simultaneously, which can then be utilized for other functional PTM binding site prediction in future.

Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

PubMed

Abou-Zied, Osama K

2015-01-01

Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

PubMed Central

Pikler, G M; Webster, R A; Spelsberg, T C

1976-01-01

Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

A class of selective antibacterials derived from a protein kinase inhibitor pharmacophore

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, J. Richard; Dunham, Steve; Mochalkin, Igor

2009-06-25

As the need for novel antibiotic classes to combat bacterial drug resistance increases, the paucity of leads resulting from target-based antibacterial screening of pharmaceutical compound libraries is of major concern. One explanation for this lack of success is that antibacterial screening efforts have not leveraged the eukaryotic bias resulting from more extensive chemistry efforts targeting eukaryotic gene families such as G protein-coupled receptors and protein kinases. Consistent with a focus on antibacterial target space resembling these eukaryotic targets, we used whole-cell screening to identify a series of antibacterial pyridopyrimidines derived from a protein kinase inhibitor pharmacophore. In bacteria, the pyridopyrimidinesmore » target the ATP-binding site of biotin carboxylase (BC), which catalyzes the first enzymatic step of fatty acid biosynthesis. These inhibitors are effective in vitro and in vivo against fastidious Gram-negative pathogens including Haemophilus influenzae. Although the BC active site has architectural similarity to those of eukaryotic protein kinases, inhibitor binding to the BC ATP-binding site is distinct from the protein kinase-binding mode, such that the inhibitors are selective for bacterial BC. In summary, we have discovered a promising class of potent antibacterials with a previously undescribed mechanism of action. In consideration of the eukaryotic bias of pharmaceutical libraries, our findings also suggest that pursuit of a novel inhibitor leads for antibacterial targets with active-site structural similarity to known human targets will likely be more fruitful than the traditional focus on unique bacterial target space, particularly when structure-based and computational methodologies are applied to ensure bacterial selectivity.« less

Study on the Mechanism of Interaction between Phthalate Acid Esters and Bovine Hemoglobin.

PubMed

Chi, Zhenxing; Zhao, Jing; You, Hong; Wang, Mingjing

2016-08-03

Phthalate acid esters (PAEs) are widely used in plastic products as a series of chemical softeners. However, PAEs, which now exist in many environmental media such as the atmosphere, water, and soil, have been shown to be environmental endocrine disruptors. Hemoglobin is a functional protein that carries oxygen in the red blood cells of animals. This study aims at revealing the interactions between bovine hemoglobin (BHb) and PAEs using spectroscopic and molecular modeling methods. The results indicate that the selected representative PAEs-dimethyl phthalate (DMP), diethyl phthalate (DEP), and dibutyl phthalate (DBP)-can interact with BHb to form BHb-PAE complexes with one binding site, mainly relying on hydrophobic forces, with the affinity order DMP > DEP > DBP, opposite to the order of side-chain length. The binding of PAEs can cause conformational and micro-environmental changes in BHb, which may affect the physiological functions of Hb. Furthermore, molecular docking was applied to define the specific binding sites, the results of which show that all the three PAEs can bind into the central cavity of BHb. The study contributes to expound the toxic mechanism of PAEs in vivo from the point of hematological toxicology.

The Rickettsia Surface Cell Antigen 4 Applies Mimicry to Bind to and Activate Vinculin*

PubMed Central

Park, HaJeung; Lee, Jun Hyuck; Gouin, Edith; Cossart, Pascale; Izard, Tina

2011-01-01

Pathogenic Rickettsia species cause high morbidity and mortality, especially R. prowazekii, the causative agent of typhus. Like many intracellular pathogens, Rickettsia exploit the cytoskeleton to enter and spread within the host cell. Here we report that the cell surface antigen sca4 of Rickettsia co-localizes with vinculin in cells at sites of focal adhesions in sca4-transfected cells and that sca4 binds to and activates vinculin through two vinculin binding sites (VBSs) that are conserved across all Rickettsia. Remarkably, this occurs through molecular mimicry of the vinculin-talin interaction that is also seen with the IpaA invasin of the intracellular pathogen Shigella, where binding of these VBSs to the vinculin seven-helix bundle head domain (Vh1) displaces intramolecular interactions with the vinculin tail domain that normally clamp vinculin in an inactive state. Finally, the vinculin·sca4-VBS crystal structures reveal that vinculin adopts a new conformation when bound to the C-terminal VBS of sca4. Collectively, our data define the mechanism by which sca4 activates vinculin and interacts with the actin cytoskeleton, and they suggest important roles for vinculin in Rickettsia pathogenesis. PMID:21841197

Hit identification of novel heparanase inhibitors by structure- and ligand-based approaches.

PubMed

Gozalbes, Rafael; Mosulén, Silvia; Ortí, Leticia; Rodríguez-Díaz, Jesús; Carbajo, Rodrigo J; Melnyk, Patricia; Pineda-Lucena, Antonio

2013-04-01

Heparanase is a key enzyme involved in the dissemination of metastatic cancer cells. In this study a combination of in silico techniques and experimental methods was used to identify new potential inhibitors against this target. A 3D model of heparanase was built from sequence homology and applied to the virtual screening of a library composed of 27 known heparanase inhibitors and a commercial collection of drugs and drug-like compounds. The docking results from this campaign were combined with those obtained from a pharmacophore model recently published based in the same set of chemicals. Compounds were then ranked according to their theoretical binding affinity, and the top-rated commercial drugs were selected for further experimental evaluation. Biophysical methods (NMR and SPR) were applied to assess experimentally the interaction of the selected compounds with heparanase. The binding site was evaluated via competition experiments, using a known inhibitor of heparanase. Three of the selected drugs were found to bind to the active site of the protein and their KD values were determined. Among them, the antimalarial drug amodiaquine presented affinity towards the protein in the low-micromolar range, and was singled out for a SAR study based on its chemical scaffold. A subset of fourteen 4-arylaminoquinolines from a global set of 249 analogues of amodiaquine was selected based on the application of in silico models, a QSAR solubility prediction model and a chemical diversity analysis. Some of these compounds displayed binding affinities in the micromolar range. Copyright © 2013 Elsevier Ltd. All rights reserved.

Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

NASA Astrophysics Data System (ADS)

Schwartz, Rochelle D.; Kellar, Kenneth J.

1983-04-01

Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

Substance P binding sites in the nucleus tractus solitarius of the cat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maley, B.E.; Sasek, C.A.; Seybold, V.S.

1988-11-01

Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

PubMed

Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

2018-06-16

Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

PubMed Central

Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

1991-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

A principal component analysis of the dynamics of subdomains and binding sites in human serum albumin.

PubMed

Paris, Guillaume; Ramseyer, Christophe; Enescu, Mironel

2014-05-01

The conformational dynamics of human serum albumin (HSA) was investigated by principal component analysis (PCA) applied to three molecular dynamics trajectories of 200 ns each. The overlap of the essential subspaces spanned by the first 10 principal components (PC) of different trajectories was about 0.3 showing that the PCA based on a trajectory length of 200 ns is not completely convergent for this protein. The contributions of the relative motion of subdomains and of the subdomains (internal) distortion to the first 10 PCs were found to be comparable. Based on the distribution of the first 3 PC, 10 protein conformers are identified showing relative root mean square deviations (RMSD) between 2.3 and 4.6 Å. The main PCs are found to be delocalized over the whole protein structure indicating that the motions of different protein subdomains are coupled. This coupling is considered as being related to the allosteric effects observed upon ligand binding to HSA. On the other hand, the first PC of one of the three trajectories describes a conformational transition of the protein domain I that is close to that experimentally observed upon myristate binding. This is a theoretical support for the older hypothesis stating that changes of the protein onformation favorable to binding can precede the ligand complexation. A detailed all atoms PCA performed on the primary Sites 1 and 2 confirms the multiconformational character of the HSA binding sites as well as the significant coupling of their motions. Copyright © 2013 Wiley Periodicals, Inc.

A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

PubMed Central

Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

2003-01-01

A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

PubMed

Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

2008-11-21

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

PubMed

Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

1992-05-05

Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

PubMed Central

Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

2008-01-01

Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

[The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

PubMed

Kawasaki, Kazuyoshi; Ogawa, Seturou

2003-01-01

NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

PubMed

Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

2017-09-01

Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

PubMed Central

Das, Sourav; Kokardekar, Arshad

2009-01-01

Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

Biosorption of aluminum through the use of non-viable biomass of Pseudomonas putida.

PubMed

Boeris, Paola Sabrina; Agustín, María Del Rosario; Acevedo, Diego Fernando; Lucchesi, Gloria Inés

2016-10-20

Living and non-living biomass of Pseudomonas putida A (ATCC 12633) was used as biosorbent for the removing of Al(3+) from aqueous solutions. The process was stable with time, efficient at pH 4.3 and between 15°C and 42°C. Two isotherms models were applied to describe the interaction between the biosorbent and Al(3+). Non-living biomass of P. putida A (ATCC 12633) was found to be the most efficient at adsorbing Al(3+) with a maximum sorption capacity of 0.55mg Al(3+)/gr adsorbent and with 36×10(5) binding sites of Al(3+)/microorganisms. Infrared spectroscopy analysis shows that the biosorbent present some vibrational band of functional groups that change in presence of Al(3+): hydroxyl, carboxyl and phosphate. Considering that Al(3+) binds to the phosphate group of phosphatidylcholine, non-viable biomass of P. putida PB01 (mutant lacking phosphatidylcholine) was used. Aluminum adsorption of the parental strain was 30 times higher than values registered in P. putida PB01 (36×10(5) sites/microorganism vs 1.2×10(5) sites/microorganism, respectively). This result evidenced that the absence of phosphatidylcholine significantly affected the availability of the binding sites and consequently the efficiency of the biomass to adsorb Al(3+). Copyright © 2016 Elsevier B.V. All rights reserved.

Site-Specific 64Cu Labeling of the Serine Protease, Active Site Inhibited Factor Seven Azide (FVIIai-N3), Using Copper Free Click Chemistry.

PubMed

Jeppesen, Troels E; Kristensen, Lotte K; Nielsen, Carsten H; Petersen, Lars C; Kristensen, Jesper B; Behrens, Carsten; Madsen, Jacob; Kjaer, Andreas

2018-01-17

A method for site-specific radiolabeling of the serine protease active site inhibited factor seven (FVIIai) with 64 Cu has been applied using a biorthogonal click reaction. FVIIai binds to tissue factor (TF), a trans-membrane protein involved in hemostasis, angiogenesis, proliferation, cell migration, and survival of cancer cells. First a single azide moiety was introduced in the active site of this 50 kDa protease. Then a NOTA moiety was introduced via a strain promoted azide-alkyne reaction and the corresponding conjugate was labeled with 64 Cu. Binding to TF and the stability was evaluated in vitro. TF targeting capability of the radiolabeled conjugate was tested in vivo by positron emission tomography (PET) imaging in pancreatic human xenograft cancer mouse models with various TF expressions. The conjugate showed good stability (>91% at 16 h), an immunoreactivity of 93.5%, and a mean tumor uptake of 2.1 ± 0.2%ID/g at 15 h post injection. In conclusion, FVIIai was radiolabeled with 64 Cu in single well-defined position of the protein. This method can be utilized to prepare conjugates from serine proteases with the label at a specific position.

Dynamic ion-ion and water-ion interactions in ion channels.

PubMed Central

Wu, J V

1992-01-01

The dynamic interactions among ions and water molecules in ion channels are treated based on an assumption that ions at binding sites can be knocked off by both transient entering ions and local water molecules. The theory, when applied to a single-site model K+ channel, provides solutions for super- and subsaturations, flux-ratio exponent (n') greater than 1, osmotic streaming current, activity-dependent reversal potentials, and anomalous mole-fraction behavior. The analysis predicts that: (a) the saturation may but, in general, does not follow the Michaelis-Menten relation; (b) streaming current results from imbalanced water-ion knock-off interactions; (c) n' greater than 1 even for single-site channels, but it is unlikely to exceed 1.4 unless the pore is occupied by one or more ion(s); (d) in the calculation involving two permeant ion species with similar radii, the heavier ions show higher affinity; the ion-ion knock-off dissociation from the site is more effective when two interacting ions are identical. Therefore, the "multi-ion behaviors" found in most ion channels are the consequences of dynamic ion-ion and water-ion interactions. The presence of these interactions does not require two or more binding sites in channels. PMID:1376158

Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

PubMed Central

Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

2015-01-01

Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poat, J.A.; Cripps, H.E.; Iversen, L.L.

1988-05-01

Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCann, D.J.; Su, T.P.

1991-05-01

The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

PubMed

Suzuki, N; Mihashi, K

1991-01-01

The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

On the distribution of Na+ pump sites in the frog skin

PubMed Central

Mills, JW; DiBona, DR

1977-01-01

Exposure of the outside of the isolated frog skin to a Ringer's solution, made hypertonic by the addition of mannitol, causes a rapid and sustained increase in transepithelial permeability through a structural distortion-a focal blistering-of the "tight" junctions of the outermost living cell layer. [(3)H]ouabain, used as an autoradiographic marker for the Na+-pump (Na+-K+-adenosine triphosphatase), is usually unable to penetrate the frog skin from the outside solution, but when added to a hypertonic mannitol- Ringer's solution in the outside bath it readily penetrates the epithelium, presumably through the opened shunt pathway. Radioautographic analysis of [(3)H]ouabain binding sites revealed that most of ouabain enters from the outside solution binds to the sites on the cell membranes of the stratum spinosum, as was the case when it was applied from the inside bath in an earlier study. The outer living cell layer, the first to be exposed to ouabain, does not appear to be the major site for the Na+-pump, and therefore, is not likely to be responsible for most of the active pumping of Na+. This result demonstrates that previous failure to show a high density of Na+-pump sites on the cells of the outermost layer, when [(3)H]ouabain was applied from the inside solution, was not due to the inability of the marker to reach these cells at a sufficient concentration to reveal all pump sites. These results provide further support for a model of Na+-transport across the frog skin which distributes the active pump step on the inward facing membranes of all living cells. PMID:144738

Antibody-ribosome-mRNA (ARM) complexes as efficient selection particles for in vitro display and evolution of antibody combining sites.

PubMed Central

He, M; Taussig, M J

1997-01-01

We describe a rapid, eukaryotic, in vitro method for selection and evolution of antibody combining sites using antibody-ribosome-mRNA (ARM) complexes as selection particles. ARMs carrying single-chain (VH/K) binding fragments specific for progesterone were selected using antigen-coupled magnetic beads; selection simultaneously captured the genetic information as mRNA, making it possible to generate and amplify cDNA by single-step RT-PCR on the ribosome-bound mRNA for further manipulation. Using mutant libraries, antigen-binding ARMs were enriched by a factor of 10(4)-10(5)-fold in a single cycle, with further enrichment in repeated cycles. While demonstrated here for antibodies, the method has the potential to be applied equally for selection of receptors or peptides from libraries. PMID:9396828

Antibody-ribosome-mRNA (ARM) complexes as efficient selection particles for in vitro display and evolution of antibody combining sites.

PubMed

He, M; Taussig, M J

1997-12-15

We describe a rapid, eukaryotic, in vitro method for selection and evolution of antibody combining sites using antibody-ribosome-mRNA (ARM) complexes as selection particles. ARMs carrying single-chain (VH/K) binding fragments specific for progesterone were selected using antigen-coupled magnetic beads; selection simultaneously captured the genetic information as mRNA, making it possible to generate and amplify cDNA by single-step RT-PCR on the ribosome-bound mRNA for further manipulation. Using mutant libraries, antigen-binding ARMs were enriched by a factor of 10(4)-10(5)-fold in a single cycle, with further enrichment in repeated cycles. While demonstrated here for antibodies, the method has the potential to be applied equally for selection of receptors or peptides from libraries.

Interaction of Carthamus tinctorius lignan arctigenin with the binding site of tryptophan-degrading enzyme indoleamine 2,3-dioxygenase☆

PubMed Central

Temml, Veronika; Kuehnl, Susanne; Schuster, Daniela; Schwaiger, Stefan; Stuppner, Hermann; Fuchs, Dietmar

2013-01-01

Mediterranean Carthamus tinctorius (Safflower) is used for treatment of inflammatory conditions and neuropsychiatric disorders. Recently C. tinctorius lignans arctigenin and trachelogenin but not matairesinol were described to interfere with the activity of tryptophan-degrading enzyme indoleamine 2,3-dioxygenase (IDO) in peripheral blood mononuclear cells in vitro. We examined a potential direct influence of compounds on IDO enzyme activity applying computational calculations based on 3D geometry of the compounds. The interaction pattern analysis and force field-based minimization was performed within LigandScout 3.03, the docking simulation with MOE 2011.10 using the X-ray crystal structure of IDO. Results confirm the possibility of an intense interaction of arctigenin and trachelogenin with the binding site of the enzyme, while matairesinol had no such effect. PMID:24251110

Simulation of electron-proton coupling with a Monte Carlo method: application to cytochrome c3 using continuum electrostatics.

PubMed Central

Baptista, A M; Martel, P J; Soares, C M

1999-01-01

A new method is presented for simulating the simultaneous binding equilibrium of electrons and protons on protein molecules, which makes it possible to study the full equilibrium thermodynamics of redox and protonation processes, including electron-proton coupling. The simulations using this method reflect directly the pH and electrostatic potential of the environment, thus providing a much closer and realistic connection with experimental parameters than do usual methods. By ignoring the full binding equilibrium, calculations usually overlook the twofold effect that binding fluctuations have on the behavior of redox proteins: first, they affect the energy of the system by creating partially occupied sites; second, they affect its entropy by introducing an additional empty/occupied site disorder (here named occupational entropy). The proposed method is applied to cytochrome c3 of Desulfovibrio vulgaris Hildenborough to study its redox properties and electron-proton coupling (redox-Bohr effect), using a continuum electrostatic method based on the linear Poisson-Boltzmann equation. Unlike previous studies using other methods, the full reduction order of the four hemes at physiological pH is successfully predicted. The sites more strongly involved in the redox-Bohr effect are identified by analysis of their titration curves/surfaces and the shifts of their midpoint redox potentials and pKa values. Site-site couplings are analyzed using statistical correlations, a method much more realistic than the usual analysis based on direct interactions. The site found to be more strongly involved in the redox-Bohr effect is propionate D of heme I, in agreement with previous studies; other likely candidates are His67, the N-terminus, and propionate D of heme IV. Even though the present study is limited to equilibrium conditions, the possible role of binding fluctuations in the concerted transfer of protons and electrons under nonequilibrium conditions is also discussed. The occupational entropy contributions to midpoint redox potentials and pKa values are computed and shown to be significant. PMID:10354425

Nanomechanical mapping of first binding steps of a virus to animal cells

NASA Astrophysics Data System (ADS)

Alsteens, David; Newton, Richard; Schubert, Rajib; Martinez-Martin, David; Delguste, Martin; Roska, Botond; Müller, Daniel J.

2017-02-01

Viral infection is initiated when a virus binds to cell surface receptors. Because the cell membrane is dynamic and heterogeneous, imaging living cells and simultaneously quantifying the first viral binding events is difficult. Here, we show an atomic force and confocal microscopy set-up that allows the surface receptor landscape of cells to be imaged and the virus binding events within the first millisecond of contact with the cell to be mapped at high resolution (<50 nm). We present theoretical approaches to contour the free-energy landscape of early binding events between an engineered virus and cell surface receptors. We find that the first bond formed between the viral glycoprotein and its cognate cell surface receptor has relatively low lifetime and free energy, but this increases as additional bonds form rapidly (≤1 ms). The formation of additional bonds occurs with positive allosteric modulation and the three binding sites of the viral glycoprotein are quickly occupied. Our quantitative approach can be readily applied to study the binding of other viruses to animal cells.

Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luthin, G.R.; Wolfe, B.B.

The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

PubMed

Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

1997-02-28

The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

Existence of three subtypes of bradykinin B2 receptors in guinea pig.

PubMed

Seguin, L; Widdowson, P S; Giesen-Crouse, E

1992-12-01

We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

PubMed

Denys, A; Allain, F; Carpentier, M; Spik, G

1998-12-15

Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

Competitive binding experiments can reduce the false positive results of affinity-based ultrafiltration-HPLC: A case study for identification of potent xanthine oxidase inhibitors from Perilla frutescens extract.

PubMed

Wang, Zhiqiang; Kwon, Shin Hwa; Hwang, Seung Hwan; Kang, Young-Hee; Lee, Jae-Yong; Lim, Soon Sung

2017-03-24

The purpose of this study was to assess the possibility of using competitive binding experiments with ultrafiltration-HPLC analysis to identify potent xanthine oxidase (XO) inhibitors from the Perilla frutescens extract as an attempt to reduce the number of false positive results. To isolate the enzyme-ligand complex from unbound compounds, the P. frutescens extract was either incubated in the absence of XO, in the presence of XO, or with the active site blocked XO before the ultrafiltration was performed. Allopurinaol was used as the XO active site blocker. The unbound compounds were subjected to HPLC analysis. The degree of total binding (TBD) and degree of specific binding (SBD) of each compound were calculated using the peak areas. TBD represents the binding affinities of compounds from the P. frutescens extract for the XO binding site. SBD represents the XO competitive binding between allopurinol and ligands from the extract samples. Two criteria were applied to select putative targets that could help avoid false positives. These include TBD>30% and SBD>10%. Using that approach, kaempferol-3-O-rutinoside, rosmarinic acid, methyl-rosmarinic acid, apigenin, and 4',5,7-trimethoxyflavone were identified, from total 11 compounds, as potent XO inhibitors. Finally, apigenin, 4',5,7-trimethoxyflavone, and luteolin were XO inhibitors verified through an XO inhibition assay and structural simulation of the complex. These results showed that the newly developed strategy has the advantage that the number of targets identified via ultrafiltration-HPLC can be narrowed from many false positives. However, not all false positives can be eliminated with this approach. Some potent inhibitors might also be excluded with the use of this method. The limitations of this method are also discussed herein. Copyright © 2017 Elsevier B.V. All rights reserved.

Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

PubMed

Nguyen, T V; Juorio, A V

1989-10-01

The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

Impact of germline and somatic missense variations on drug binding sites.

PubMed

Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

2017-03-01

Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

2012-06-28

mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

PubMed

Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

2011-05-31

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

PubMed

Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

2018-06-01

Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

Distinct p53 genomic binding patterns in normal and cancer-derived human cells

PubMed Central

McCorkle, Sean R; McCombie, WR; Dunn, John J

2011-01-01

Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

Ethylene binding site affinity in ripening apples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, S.M.; Sisler, E.C.

1993-09-01

Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Functional identification and characterization of sodium binding sites in Na symporters

PubMed Central

Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

2013-01-01

Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

PubMed Central

Navé, Jean-François; Benveniste, Pierre

1984-01-01

The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

Electrostatic Interactions in Aminoglycoside-RNA Complexes

PubMed Central

Kulik, Marta; Goral, Anna M.; Jasiński, Maciej; Dominiak, Paulina M.; Trylska, Joanna

2015-01-01

Electrostatic interactions often play key roles in the recognition of small molecules by nucleic acids. An example is aminoglycoside antibiotics, which by binding to ribosomal RNA (rRNA) affect bacterial protein synthesis. These antibiotics remain one of the few valid treatments against hospital-acquired infections by Gram-negative bacteria. It is necessary to understand the amplitude of electrostatic interactions between aminoglycosides and their rRNA targets to introduce aminoglycoside modifications that would enhance their binding or to design new scaffolds. Here, we calculated the electrostatic energy of interactions and its per-ring contributions between aminoglycosides and their primary rRNA binding site. We applied either the methodology based on the exact potential multipole moment (EPMM) or classical molecular mechanics force field single-point partial charges with Coulomb formula. For EPMM, we first reconstructed the aspherical electron density of 12 aminoglycoside-RNA complexes from the atomic parameters deposited in the University at Buffalo Databank. The University at Buffalo Databank concept assumes transferability of electron density between atoms in chemically equivalent vicinities and allows reconstruction of the electron densities from experimental structural data. From the electron density, we then calculated the electrostatic energy of interaction using EPMM. Finally, we compared the two approaches. The calculated electrostatic interaction energies between various aminoglycosides and their binding sites correlate with experimentally obtained binding free energies. Based on the calculated energetic contributions of water molecules mediating the interactions between the antibiotic and rRNA, we suggest possible modifications that could enhance aminoglycoside binding affinity. PMID:25650932

Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

PubMed Central

Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

2015-01-01

The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

Fc-Binding Ligands of Immunoglobulin G: An Overview of High Affinity Proteins and Peptides

PubMed Central

Choe, Weonu; Durgannavar, Trishaladevi A.; Chung, Sang J.

2016-01-01

The rapidly increasing application of antibodies has inspired the development of several novel methods to isolate and target antibodies using smart biomaterials that mimic the binding of Fc-receptors to antibodies. The Fc-binding domain of antibodies is the primary binding site for e.g., effector proteins and secondary antibodies, whereas antigens bind to the Fab region. Protein A, G, and L, surface proteins expressed by pathogenic bacteria, are well known to bind immunoglobulin and have been widely exploited in antibody purification strategies. Several difficulties are encountered when bacterial proteins are used in antibody research and application. One of the major obstacles hampering the use of bacterial proteins is sample contamination with trace amounts of these proteins, which can invoke an immune response in the host. Many research groups actively develop synthetic ligands that are able to selectively and strongly bind to antibodies. Among the reported ligands, peptides that bind to the Fc-domain of antibodies are attractive tools in antibody research. Besides their use as high affinity ligands in antibody purification chromatography, Fc-binding peptides are applied e.g., to localize antibodies on nanomaterials and to increase the half-life of proteins in serum. In this review, recent developments of Fc-binding peptides are presented and their binding characteristics and diverse applications are discussed. PMID:28774114

Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Postprocessing of docked protein-ligand complexes using implicit solvation models.

PubMed

Lindström, Anton; Edvinsson, Lotta; Johansson, Andreas; Andersson, C David; Andersson, Ida E; Raubacher, Florian; Linusson, Anna

2011-02-28

Molecular docking plays an important role in drug discovery as a tool for the structure-based design of small organic ligands for macromolecules. Possible applications of docking are identification of the bioactive conformation of a protein-ligand complex and the ranking of different ligands with respect to their strength of binding to a particular target. We have investigated the effect of implicit water on the postprocessing of binding poses generated by molecular docking using MM-PB/GB-SA (molecular mechanics Poisson-Boltzmann and generalized Born surface area) methodology. The investigation was divided into three parts: geometry optimization, pose selection, and estimation of the relative binding energies of docked protein-ligand complexes. Appropriate geometry optimization afforded more accurate binding poses for 20% of the complexes investigated. The time required for this step was greatly reduced by minimizing the energy of the binding site using GB solvation models rather than minimizing the entire complex using the PB model. By optimizing the geometries of docking poses using the GB(HCT+SA) model then calculating their free energies of binding using the PB implicit solvent model, binding poses similar to those observed in crystal structures were obtained. Rescoring of these poses according to their calculated binding energies resulted in improved correlations with experimental binding data. These correlations could be further improved by applying the postprocessing to several of the most highly ranked poses rather than focusing exclusively on the top-scored pose. The postprocessing protocol was successfully applied to the analysis of a set of Factor Xa inhibitors and a set of glycopeptide ligands for the class II major histocompatibility complex (MHC) A(q) protein. These results indicate that the protocol for the postprocessing of docked protein-ligand complexes developed in this paper may be generally useful for structure-based design in drug discovery.

Co-Localization of the Oncogenic Transcription Factor MYCN and the DNA Methyl Binding Protein MeCP2 at Genomic Sites in Neuroblastoma

PubMed Central

Murphy, Derek M.; Buckley, Patrick G.; Das, Sudipto; Watters, Karen M.; Bryan, Kenneth; Stallings, Raymond L.

2011-01-01

Background MYCN is a transcription factor that is expressed during the development of the neural crest and its dysregulation plays a major role in the pathogenesis of pediatric cancers such as neuroblastoma, medulloblastoma and rhabdomyosarcoma. MeCP2 is a CpG methyl binding protein which has been associated with a number of cancers and developmental disorders, particularly Rett syndrome. Methods and Findings Using an integrative global genomics approach involving chromatin immunoprecipitation applied to microarrays, we have determined that MYCN and MeCP2 co-localize to gene promoter regions, as well as inter/intragenic sites, within the neuroblastoma genome (MYCN amplified Kelly cells) at high frequency (70.2% of MYCN sites were also positive for MeCP2). Intriguingly, the frequency of co-localization was significantly less at promoter regions exhibiting substantial hypermethylation (8.7%), as determined by methylated DNA immunoprecipitation (MeDIP) applied to the same microarrays. Co-immunoprecipitation of MYCN using an anti-MeCP2 antibody indicated that a MYCN/MeCP2 interaction occurs at protein level. mRNA expression profiling revealed that the median expression of genes with promoters bound by MYCN was significantly higher than for genes bound by MeCP2, and that genes bound by both proteins had intermediate expression. Pathway analysis was carried out for genes bound by MYCN, MeCP2 or MYCN/MeCP2, revealing higher order functions. Conclusions Our results indicate that MYCN and MeCP2 protein interact and co-localize to similar genomic sites at very high frequency, and that the patterns of binding of these proteins can be associated with significant differences in transcriptional activity. Although it is not yet known if this interaction contributes to neuroblastoma disease pathogenesis, it is intriguing that the interaction occurs at the promoter regions of several genes important for the development of neuroblastoma, including ALK, AURKA and BDNF. PMID:21731748

Co-localization of the oncogenic transcription factor MYCN and the DNA methyl binding protein MeCP2 at genomic sites in neuroblastoma.

PubMed

Murphy, Derek M; Buckley, Patrick G; Das, Sudipto; Watters, Karen M; Bryan, Kenneth; Stallings, Raymond L

2011-01-01

MYCN is a transcription factor that is expressed during the development of the neural crest and its dysregulation plays a major role in the pathogenesis of pediatric cancers such as neuroblastoma, medulloblastoma and rhabdomyosarcoma. MeCP2 is a CpG methyl binding protein which has been associated with a number of cancers and developmental disorders, particularly Rett syndrome. Using an integrative global genomics approach involving chromatin immunoprecipitation applied to microarrays, we have determined that MYCN and MeCP2 co-localize to gene promoter regions, as well as inter/intragenic sites, within the neuroblastoma genome (MYCN amplified Kelly cells) at high frequency (70.2% of MYCN sites were also positive for MeCP2). Intriguingly, the frequency of co-localization was significantly less at promoter regions exhibiting substantial hypermethylation (8.7%), as determined by methylated DNA immunoprecipitation (MeDIP) applied to the same microarrays. Co-immunoprecipitation of MYCN using an anti-MeCP2 antibody indicated that a MYCN/MeCP2 interaction occurs at protein level. mRNA expression profiling revealed that the median expression of genes with promoters bound by MYCN was significantly higher than for genes bound by MeCP2, and that genes bound by both proteins had intermediate expression. Pathway analysis was carried out for genes bound by MYCN, MeCP2 or MYCN/MeCP2, revealing higher order functions. Our results indicate that MYCN and MeCP2 protein interact and co-localize to similar genomic sites at very high frequency, and that the patterns of binding of these proteins can be associated with significant differences in transcriptional activity. Although it is not yet known if this interaction contributes to neuroblastoma disease pathogenesis, it is intriguing that the interaction occurs at the promoter regions of several genes important for the development of neuroblastoma, including ALK, AURKA and BDNF.

Autoradiographic localization of endothelin-1 binding sites in porcine skin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Y.D.; Springall, D.R.; Wharton, J.

Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

2004-10-28

We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

PubMed

Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

2017-02-07

Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

1987-07-01

Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

IspE Inhibitors Identified by a Combination of In Silico and In Vitro High-Throughput Screening

PubMed Central

Tidten-Luksch, Naomi; Grimaldi, Raffaella; Torrie, Leah S.; Frearson, Julie A.; Hunter, William N.; Brenk, Ruth

2012-01-01

CDP-ME kinase (IspE) contributes to the non-mevalonate or deoxy-xylulose phosphate (DOXP) pathway for isoprenoid precursor biosynthesis found in many species of bacteria and apicomplexan parasites. IspE has been shown to be essential by genetic methods and since it is absent from humans it constitutes a promising target for antimicrobial drug development. Using in silico screening directed against the substrate binding site and in vitro high-throughput screening directed against both, the substrate and co-factor binding sites, non-substrate-like IspE inhibitors have been discovered and structure-activity relationships were derived. The best inhibitors in each series have high ligand efficiencies and favourable physico-chemical properties rendering them promising starting points for drug discovery. Putative binding modes of the ligands were suggested which are consistent with established structure-activity relationships. The applied screening methods were complementary in discovering hit compounds, and a comparison of both approaches highlights their strengths and weaknesses. It is noteworthy that compounds identified by virtual screening methods provided the controls for the biochemical screens. PMID:22563402

Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

PubMed

Jiang, Peng; Singh, Mona; Coller, Hilary A

2013-01-01

Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

PubMed

Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

2013-03-19

Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

PubMed Central

Tam, S W; Cook, L

1984-01-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

Effect of PDGF-B aptamer on PDGFRβ/PDGF-B interaction: Molecular dynamics study.

PubMed

Vu, Cong Quang; Rotkrua, Pichayanoot; Soontornworajit, Boonchoy; Tantirungrotechai, Yuthana

2018-06-01

PDGFRβ/PDGF-B interaction plays a role in angiogenesis, and is mandatory in wound healing and cancer treatment. It has been reported that the PDGF-B aptamer was able to bind to PDGF-B, thus regulating the angiogenesis. However, the binding interaction between the aptamer and the growth factor, including the binding sites, has not been well investigated. This study applied a molecular dynamics (MD) simulation to investigate the aptamer-growth factor interaction in the presence or absence of a receptor (PDGFRβ). Characterization of the structure of an aptamer-growth factor complex revealed binding sites from each section in the complex. Upon the complex formation, PDGF-B and its aptamer exhibited less flexibility in their molecular movement, as indicated by the minimum values of RMSD, RMSF, loop-to-loop distance, and the summation of PCA eigenvalues. Our study of residue pairwise interaction demonstrated that the binding interaction was mainly contributed by electrostatic interaction between the positively-charged amino acid and the negatively-charged phosphate backbone. The role of the PDGF-B aptamer in PDGFRβ/PDGF-B interaction was also investigated. We demonstrated that the stability of the Apt-PDGF-B complex could prevent the presence of a competitor, of PDGFRβ, interrupting the binding process. Because the aptamer was capable of binding with PDGF-B, and blocking the growth factor from the PDGFRβ, it could down regulate the consequent signaling pathway. We provide evidence that the PDGF-BB aptamer is a promising molecule for regulation of angiogenesis. The MD study provides a molecular understanding to modification of the aptamer binding interaction, which could be used in a number of medical applications. Copyright © 2018 Elsevier Inc. All rights reserved.

High-and low-affinity binding sites for Cd on the bacterial cell walls of Bacillus subtilis and Shewanella oneidensis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, B.; Boyanov, M.; Bunker, B. A.

2010-08-01

Bulk Cd adsorption isotherm experiments, thermodynamic equilibrium modeling, and Cd K edge EXAFS were used to constrain the mechanisms of proton and Cd adsorption to bacterial cells of the commonly occurring Gram-positive and Gram-negative bacteria, Bacillus subtilis and Shewanella oneidensis, respectively. Potentiometric titrations were used to characterize the functional group reactivity of the S. oneidensis cells, and we model the titration data using the same type of non-electrostatic surface complexation approach as was applied to titrations of B. subtilis suspensions by Fein et al. (2005). Similar to the results for B. subtilis, the S. oneidensis cells exhibit buffering behavior frommore » approximately pH 3-9 that requires the presence of four distinct sites, with pK{sub a} values of 3.3 {+-} 0.2, 4.8 {+-} 0.2, 6.7 {+-} 0.4, and 9.4 {+-} 0.5, and site concentrations of 8.9({+-}2.6) x 10{sup -5}, 1.3({+-}0.2) x 10{sup -4}, 5.9({+-}3.3) x 10{sup -5}, and 1.1({+-}0.6) x 10{sup -4} moles/g bacteria (wet mass), respectively. The bulk Cd isotherm adsorption data for both species, conducted at pH 5.9 as a function of Cd concentration at a fixed biomass concentration, were best modeled by reactions with a Cd:site stoichiometry of 1:1. EXAFS data were collected for both bacterial species as a function of Cd concentration at pH 5.9 and 10 g/L bacteria. The EXAFS results show that the same types of binding sites are responsible for Cd sorption to both bacterial species at all Cd loadings tested (1-200 ppm). Carboxyl sites are responsible for the binding at intermediate Cd loadings. Phosphoryl ligands are more important than carboxyl ligands for Cd binding at high Cd loadings. For the lowest Cd loadings studied here, a sulfhydryl site was found to dominate the bound Cd budgets for both species, in addition to the carboxyl and phosphoryl sites that dominate the higher loadings. The EXAFS results suggest that both Gram-positive and Gram-negative bacterial cell walls have a low concentration of very high-affinity sulfhydryl sites which become masked by the more abundant carboxyl and phosphoryl sites at higher metal:bacteria ratios. This study demonstrates that metal loading plays a vital role in determining the important metal-binding reactions that occur on bacterial cell walls, and that high affinity, low-density sites can be revealed by spectroscopy of biomass samples. Such sites may control the fate and transport of metals in realistic geologic settings, where metal concentrations are low.« less

Conformational flexibility of DENV NS2B/NS3pro: from the inhibitor effect to the serotype influence

NASA Astrophysics Data System (ADS)

Piccirillo, Erika; Merget, Benjamin; Sotriffer, Christoph A.; do Amaral, Antonia T.

2016-03-01

The dengue virus (DENV) has four well-known serotypes, namely DENV1 to DENV4, which together cause 50-100 million infections worldwide each year. DENV NS2B/NS3pro is a protease recognized as a valid target for DENV antiviral drug discovery. However, NS2B/NS3pro conformational flexibility, involving in particular the NS2B region, is not yet completely understood and, hence, a big challenge for any virtual screening (VS) campaign. Molecular dynamics (MD) simulations were performed in this study to explore the DENV3 NS2B/NS3pro binding-site flexibility and obtain guidelines for further VS studies. MD simulations were done with and without the Bz-nKRR-H inhibitor, showing that the NS2B region stays close to the NS3pro core even in the ligand-free structure. Binding-site conformational states obtained from the simulations were clustered and further analysed using GRID/PCA, identifying four conformations of potential importance for VS studies. A virtual screening applied to a set of 31 peptide-based DENV NS2B/NS3pro inhibitors, taken from literature, illustrated that selective alternative pharmacophore models can be constructed based on conformations derived from MD simulations. For the first time, the NS2B/NS3pro binding-site flexibility was evaluated for all DENV serotypes using homology models followed by MD simulations. Interestingly, the number of NS2B/NS3pro conformational states differed depending on the serotype. Binding-site differences could be identified that may be crucial to subsequent VS studies.

Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

PubMed

Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

2007-05-01

The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

2012-02-05

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lerch, Thomas F.; Chapman, Michael S.

2012-05-24

Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

Location of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

Locations of Bromide Ions in Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

1998-01-01

Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Down-regulation of pituitary receptors for luteinizing hormone-releasing hormone (LH-RH) in rats by LH-RH antagonist Cetrorelix.

PubMed Central

Halmos, G; Schally, A V; Pinski, J; Vadillo-Buenfil, M; Groot, K

1996-01-01

Antagonists of luteinizing hormone-releasing hormone (LH-RH), unlike the LH-RH agonists, suppress gonadotropins and sex steroid secretion immediately after administration, without initial stimulatory effects. [Ac-D-Nal(2)1,D-Ph(4Cl)2,D-Pal(3)3,D-Cit6,D-Ala10]LH-R H (SB-75; Cetrorelix) is a modern, potent antagonistic analog of LH-RH. In this study, the binding characteristics of receptors for LH-RH in membrane fractions from rat anterior pituitaries were investigated after a single injection of Cetrorelix at a dose of 100 microg per rat. To determine whether the treatment with Cetrorelix can affect the concentration of measurable LH-RH binding sites, we applied an in vitro method to desaturate LH-RH receptors by chaotropic agents such as manganous chloride (MnCl2) and ammonium thiocyanate (NH4SCN). Our results show that the percentages of occupied LH-RH receptors at 1, 3, and 6 h after administration of Cetrorelix were approximately 28%, 14%, and 10%, respectively, of total receptors. At later time intervals, we could not detect occupied LH-RH binding sites. Ligand competition assays, following in vitro desaturation, demonstrated that rat pituitary LH-RH receptors were significantly (P < 0.01) down-regulated for at least 72 h after administration of Cetrorelix. The lowest receptor concentration was found 3-6 h after Cetrorelix treatment and a recovery in receptor number began within approximately 24 h. The down-regulation of LH-RH binding sites induced by Cetrorelix was accompanied by serum LH and testosterone suppression. Higher LH-RH receptor concentrations coincided with elevated serum hormone levels at later time intervals. Our results indicate that administration of LH-RH antagonist Cetrorelix produces a marked down-regulation of pituitary receptors for LH-RH and not merely an occupancy of binding sites. PMID:8637885

Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

PubMed

Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

2013-01-01

Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

PubMed Central

Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

2011-01-01

Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

PubMed Central

Dubois, B W; Cherian, S F; Evers, A S

1993-01-01

There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biegon, A.; Rainbow, T.C.

1983-05-01

The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

PubMed

Kim, Yea Woon; Kim, AeRi

2017-07-20

Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

PubMed Central

Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

2017-01-01

The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

NASA Astrophysics Data System (ADS)

Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

2017-01-01

Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

PubMed Central

Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

2008-01-01

The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

Detection of specific protein-protein interactions in nanocages by engineering bipartite FlAsH binding sites.

PubMed

Cornell, Thomas A; Fu, Jing; Newland, Stephanie H; Orner, Brendan P

2013-11-06

Proteins that form cage-like structures have been of much recent cross-disciplinary interest due to their application to bioconjugate and materials chemistry, their biological functions spanning multiple essential cellular processes, and their complex structure, often defined by highly symmetric protein–protein interactions. Thus, establishing the fundamentals of their formation, through detecting and quantifying important protein–protein interactions, could be crucial to understanding essential cellular machinery, and for further development of protein-based technologies. Herein we describe a method to monitor the assembly of protein cages by detecting specific, oligomerization state dependent, protein–protein interactions. Our strategy relies on engineering protein monomers to include cysteine pairs that are presented proximally if the cage state assembles. These assembled pairs of cysteines act as binding sites for the fluorescent reagent FlAsH, which, once bound, provides a readout for successful oligomerization. As a proof of principle, we applied this technique to the iron storage protein, DNA-binding protein from starved cells from E. coli. Several linker lengths and conformations for the presentation of the cysteine pairs were screened to optimize the engineered binding sites. We confirmed that our designs were successful in both lysates and with purified proteins, and that FlAsH binding was dependent upon cage assembly. Following successful characterization of the assay, its throughput was expanded. A two-dimension matrix of pH and denaturing buffer conditions was screened to optimize nanocage stability. We intend to use this method for the high throughput screening of protein cage libraries and of conditions for the generation of inorganic nanoparticles within the cavity of these and other cage proteins.

Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palacios, J.M.; Chinaglia, G.; Rigo, M.

1991-02-01

Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

PubMed

Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

2014-01-01

We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

PubMed Central

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

PubMed

Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

1996-10-11

In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

Binding Leverage as a Molecular Basis for Allosteric Regulation

PubMed Central

Mitternacht, Simon; Berezovsky, Igor N.

2011-01-01

Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

PubMed Central

2011-01-01

Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

PubMed

Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

2016-11-01

Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

On the inhibitor effects of bergamot juice flavonoids binding to the 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme.

PubMed

Leopoldini, Monica; Malaj, Naim; Toscano, Marirosa; Sindona, Giovanni; Russo, Nino

2010-10-13

Density functional theory was applied to study the binding mode of new flavonoids as possible inhibitors of the 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), an enzyme that catalyzes the four-electron reduction of HMGCoA to mevalonate, the committed step in the biosynthesis of sterols. The investigated flavonoid conjugates brutieridin and melitidin were recently quantified in the bergamot fruit extracts and identified to be structural analogues of statins, lipids concentration lowering drugs that inhibit HMGR. Computations allowed us to perform a detailed analysis of the geometrical and electronic features affecting the binding of these compounds, as well as that of the excellent simvastatin drug, to the active site of the enzyme and to give better insight into the inhibition process.

Anisotropy of fluctuation dynamics of proteins with an elastic network model.

PubMed Central

Atilgan, A R; Durell, S R; Jernigan, R L; Demirel, M C; Keskin, O; Bahar, I

2001-01-01

Fluctuations about the native conformation of proteins have proven to be suitably reproduced with a simple elastic network model, which has shown excellent agreement with a number of different properties for a wide variety of proteins. This scalar model simply investigates the magnitudes of motion of individual residues in the structure. To use the elastic model approach further for developing the details of protein mechanisms, it becomes essential to expand this model to include the added details of the directions of individual residue fluctuations. In this paper a new tool is presented for this purpose and applied to the retinol-binding protein, which indicates enhanced flexibility in the region of entry to the ligand binding site and for the portion of the protein binding to its carrier protein. PMID:11159421

Reduction and Reoxidation of Humic Acid: Influence on Spectroscopic Properties and Proton Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maurer, F.; Christl, I; Kretzschmar, R

2010-01-01

Previous studies on proton and metal binding to humic substances have not considered a potential influence of reduction and oxidation of functional groups. Therefore, we investigated how proton binding of a purified soil humic acid was affected by reduction. Reduction of the humic acid was carried out using an electrochemical cell that allowed us to measure the amounts of electrons and protons involved in reduction reactions. We further applied spectroscopic methods (UV-vis, fluorescence, FT-IR, C-1s NEXAFS) to detect possible chemical changes in the humic acid induced by reduction and reoxidation. The effect of reduction on proton binding was determined withmore » acid-base titrations in the pH range 4-10 under controlled redox conditions. During reduction, 0.54 mol kg{sup -1} protons and 0.55 mol kg{sup -1} electrons were transferred to humic acid. NICA-Donnan modeling revealed an equivalent increase in proton-reactive sites (0.52 mol kg{sup -1}) in the alkaline pH-range. Our results indicate that reduction of humic acid increased the amount of proton-reactive sites by 15% compared to the untreated state. Spectroscopic differences between the untreated and reduced humic acid were minor, apart from a lower UV-vis absorption of the reduced humic acid between 400 and 700 nm.« less

Thermodynamics of camphor migration in cytochrome P450cam by atomistic simulations.

PubMed

Rydzewski, J; Nowak, W

2017-08-10

Understanding the mechanisms of ligand binding to enzymes is of paramount importance for the design of new drugs. Here, we report on the use of a novel biased molecular dynamics (MD) methodology to study the mechanism of camphor binding to cytochrome P450cam. Microsecond-long MD simulations allowed us to observe reaction coordinates characterizing ligand diffusion from the active site of cytochrome P450cam to solvent via three egress routes. These atomistic simulations were used to estimate thermodynamic quantities along the reaction coordinates and indicate diverse binding configurations. The results suggest that the diffusion of camphor along the pathway near the substrate recognition site (SRS) is thermodynamically preferred. In addition, we show that the diffusion near the SRS is triggered by a transition from a heterogeneous collection of closed ligand-bound conformers to the basin comprising the open conformations of cytochrome P450cam. The conformational change accompanying this switch is characterized by the retraction of the F and G helices and the disorder of the B' helix. These results are corroborated by experimental studies and provide detailed insight into ligand binding and conformational behavior of the cytochrome family. The presented methodology is general and can be applied to other ligand-protein systems.

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zoghbi, M. E.; Altenberg, G. A.

The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

Phage display—A powerful technique for immunotherapy

PubMed Central

Bazan, Justyna; Całkosiński, Ireneusz; Gamian, Andrzej

2012-01-01

One of the most effective molecular diversity techniques is phage display. This technology is based on a direct linkage between phage phenotype and its encapsulated genotype, which leads to presentation of molecule libraries on the phage surface. Phage display is utilized in studying protein-ligand interactions, receptor binding sites and in improving or modifying the affinity of proteins for their binding partners. Generating monoclonal antibodies and improving their affinity, cloning antibodies from unstable hybridoma cells and identifying epitopes, mimotopes and functional or accessible sites from antigens are also important advantages of this technology. Techniques originating from phage display have been applied to transfusion medicine, neurological disorders, mapping vascular addresses and tissue homing of peptides. Phages have been applicable to immunization therapies, which may lead to development of new tools used for treating autoimmune and cancer diseases. This review describes the phage display technology and presents the recent advancements in therapeutic applications of phage display. PMID:22906939

Biochemical characterization of Aspergillus awamori exoinulinase: substrate binding characteristics and regioselectivity of hydrolysis.

PubMed

Kulminskaya, Anna A; Arand, Michael; Eneyskaya, Elena V; Ivanen, Dina R; Shabalin, Konstantin A; Shishlyannikov, Sergei M; Saveliev, Andrew N; Korneeva, Olga S; Neustroev, Kirill N

2003-08-21

1H-NMR analysis was applied to investigate the hydrolytic activity of Aspergillus awamori inulinase. The obtained NMR signals and deduced metabolite pattern revealed that the enzyme cleaves off only fructose from inulin and does not possess transglycosylating activity. Kinetics for the enzyme hydrolysis of inulooligosaccharides with different degree of polymerization (d.p.) were recorded. The enzyme hydrolyzed both beta2,1- as well as beta2,6-fructosyl linkages in fructooligosaccharides. From the k(cat)/K(m) ratios obtained with inulooligosaccharides with d.p. from 2 to 7, we deduce that the catalytic site of the inulinase contains at least five fructosyl-binding sites and can be classified as exo-acting enzyme. Product analysis of inulopentaose and inulohexaose hydrolysis by the Aspergillus inulinase provided no evidence for a possible multiple-attack mode of action, suggesting that the enzyme acts exclusively as an exoinulinase.

Catalyst recognition of cis-1,2-diols enables site-selective functionalization of complex molecules

NASA Astrophysics Data System (ADS)

Sun, Xixi; Lee, Hyelee; Lee, Sunggi; Tan, Kian L.

2013-09-01

Carbohydrates and natural products serve essential roles in nature, and also provide core scaffolds for pharmaceutical agents and vaccines. However, the inherent complexity of these molecules imposes significant synthetic hurdles for their selective functionalization and derivatization. Nature has, in part, addressed these issues by employing enzymes that are able to orient and activate substrates within a chiral pocket, which increases dramatically both the rate and selectivity of organic transformations. In this article we show that similar proximity effects can be utilized in the context of synthetic catalysts to achieve general and predictable site-selective functionalization of complex molecules. Unlike enzymes, our catalysts apply a single reversible covalent bond to recognize and bind to specific functional group displays within substrates. By combining this unique binding selectivity and asymmetric catalysis, we are able to modify the less reactive axial positions within monosaccharides and natural products.

The basics of thiols and cysteines in redox biology and chemistry.

PubMed

Poole, Leslie B

2015-03-01

Cysteine is one of the least abundant amino acids, yet it is frequently found as a highly conserved residue within functional (regulatory, catalytic, or binding) sites in proteins. It is the unique chemistry of the thiol or thiolate group of cysteine that imparts to functional sites their specialized properties (e.g., nucleophilicity, high-affinity metal binding, and/or ability to form disulfide bonds). Highlighted in this review are some of the basic biophysical and biochemical properties of cysteine groups and the equations that apply to them, particularly with respect to pKa and redox potential. Also summarized are the types of low-molecular-weight thiols present in high concentrations in most cells, as well as the ways in which modifications of cysteinyl residues can impart or regulate molecular functions important to cellular processes, including signal transduction. Copyright © 2014 Elsevier Inc. All rights reserved.

DOCLASP - Docking ligands to target proteins using spatial and electrostatic congruence extracted from a known holoenzyme and applying simple geometrical transformations.

PubMed

Chakraborty, Sandeep

2014-01-01

The ability to accurately and effectively predict the interaction between proteins and small drug-like compounds has long intrigued researchers for pedagogic, humanitarian and economic reasons. Protein docking methods (AutoDock, GOLD, DOCK, FlexX and Glide to name a few) rank a large number of possible conformations of protein-ligand complexes using fast algorithms. Previously, it has been shown that structural congruence leading to the same enzymatic function necessitates the congruence of electrostatic properties (CLASP). The current work presents a methodology for docking a ligand into a target protein, provided that there is at least one known holoenzyme with ligand bound - DOCLASP (Docking using CLASP). The contact points of the ligand in the holoenzyme defines a motif, which is used to query the target enzyme using CLASP. If there are significant matches, the holoenzyme and the target protein are superimposed based on congruent atoms. The same linear and rotational transformations are also applied to the ligand, thus creating a unified coordinate framework having the holoenzyme, the ligand and the target enzyme. In the current work, the dipeptidyl peptidase-IV inhibitor vildagliptin was docked to the PI-PLC structure complexed with myo-inositol using DOCLASP. Also, corroboration of the docking of phenylthiourea to the modelled structure of polyphenol oxidase (JrPPO1) from walnut is provided based on the subsequently solved structure of JrPPO1 (PDBid:5CE9). Analysis of the binding of the antitrypanosomial drug suramin to nine non-homologous proteins in the PDB database shows a diverse set of binding motifs, and multiple binding sites in the phospholipase A2-likeproteins from the Bothrops genus of pitvipers. The conformational changes in the suramin molecule on binding highlights the challenges in docking flexible ligands into an already 'plastic' binding site. Thus, DOCLASP presents a method for 'soft docking' ligands to proteins with low computational requirements.

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

Site of ADP-ribosylation and the RNA-binding site are situated in different domains of the elongation factor EF-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davydova, E.K.

1987-01-01

One of the proteins participating in the process of elongation of polypeptide chains - elongation factor 2 (EF-2) - can be ADP-ribosylated at a unique amino acid residue - diphthamide. Since the ADP-ribosylation of EF-2 at dipthamide leads to a loss of affinity of the factor for RNA while the presence of RNA inhibits the ADP-ribosylation reaction, it seemed probable to the authors that diphthamide participated directly in the binding of EF-2 to DNA. The experiments presented in this article showed that this was not the case: diphthamide and the RNA-binding site are situated on different domains of EF-2. Thus,more » ADP-ribosylation of factor EF-2 in one domain leads to a loss of the ability to bind to RNA in the other. The authors investigated the mutual arrangement of diphthamide and the RNA-binding site on the EF-2 molecule by preparing a factor from rabbit reticulocytes and subjecting it to proteolytic digestion with elastase. The factor was incubated with elastase for 15 min at 37/sup 0/C at an enzyme:substrate ratio of 1:100 in buffer solution containing 20 mM Tris-HCl, pH 7.6, 10 mM KCl, 1 mM MgCl/sub 2/, and 2 mM dithiothreitol. The reaction was stopped by adding para-methylsulfonyl fluoride to 50 micro-M. The authors obtained a preparation as a result of proteolysis and applied it on a column with RNA-Sepharose and separated into two fractions: RNA-binding and without affinity for RNA. The initial preparation and its fractions were subjected to exhaustive ADP-ribosylation in the presence of diphtheria toxin and (U-/sup 14/C) nicotinaide adenine dinucleotide ((/sup 14/C)NAD) (296 mCi/mmole). The samples were analyzed electrophoretically in a polyacrylamide gel gradient in the presence of sodium dodecyl sulfate. For the detection of (/sup 14/C) ADP-ribosylated components, the gels were dried and exposed with RM-V x-ray film.« less

Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

PubMed

Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

1986-08-15

The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

RBind: computational network method to predict RNA binding sites.

PubMed

Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

2018-04-26

Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

PubMed

Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

2017-04-01

BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

A novel substance P binding site in bovine adrenal medulla.

PubMed

Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

1990-05-04

Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tam, S.W.; Cook, L.

1984-09-01

The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

Novel approach of fragment-based lead discovery applied to renin inhibitors.

PubMed

Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki

2016-11-15

A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.

Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

PubMed

Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

1996-01-04

In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

Accurate and sensitive quantification of protein-DNA binding affinity.

PubMed

Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

2018-04-17

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

Accurate and sensitive quantification of protein-DNA binding affinity

PubMed Central

Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

2018-01-01

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

PubMed Central

Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

2012-01-01

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

PubMed

Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

2014-06-02

The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

New Horizons on Molecular Pharmacology Applied to Drug Discovery: When Resonance Overcomes Radioligand Binding.

PubMed

Pernomian, Larissa; Gomes, Mayara Santos; Moreira, Josimar Dornelas; da Silva, Carlos Henrique Tomich de Paula; Rosa, Joaquin Maria Campos; Cardoso, Cristina Ribeiro de Barros

2017-01-01

One of the cornerstones of rational drug development is the measurement of molecular parameters derived from ligand-receptor interaction, which guides therapeutic windows definition. Over the last decades, radioligand binding has provided valuable contributions in this field as key method for such purposes. However, its limitations spurred the development of more exquisite techniques for determining such parameters. For instance, safety risks related to radioactivity waste, expensive and controlled disposal of radioisotopes, radiotracer separation-dependence for affinity analysis, and one-site mathematical models-based fitting of data make radioligand binding a suboptimal approach in providing measures of actual affinity conformations from ligands and G proteincoupled receptors (GPCR). Current advances on high-throughput screening (HTS) assays have markedly extended the options of sparing sensitive ways for monitoring ligand affinity. The advent of the novel bioluminescent donor NanoLuc luciferase (Nluc), engineered from Oplophorus gracilirostris luciferase, allowed fitting bioluminescence resonance energy transfer (BRET) for monitoring ligand binding. Such novel approach named Nluc-based BRET (NanoBRET) binding assay consists of a real-time homogeneous proximity assay that overcomes radioligand binding limitations but ensures the quality in affinity measurements. Here, we cover the main advantages of NanoBRET protocol and the undesirable drawbacks of radioligand binding as molecular methods that span pharmacological toolbox applied to Drug Discovery. Also, we provide a novel perspective for the application of NanoBRET technology in affinity assays for multiple-state binding mechanisms involving oligomerization and/or functional biased selectivity. This new angle was proposed based on specific biophysical criteria required for the real-time homogeneity assigned to the proximity NanoBRET protocol. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

PubMed Central

Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

2014-01-01

Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ford, K.A.; LaBarbera, A.R.

1988-11-01

The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

PubMed Central

Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

2013-01-01

Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

PubMed

Wei, Qing; La, David; Kihara, Daisuke

2017-01-01

Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

NASA Astrophysics Data System (ADS)

Poornima, C. S.; Dean, P. M.

1995-12-01

Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sultatos, L.G.; Kaushik, R.

2008-08-01

The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

PubMed

Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

2017-01-01

Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyd, S.K.

1987-01-01

Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

PubMed

Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

2011-05-01

The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Zeller, L; Lightstone, F C

2002-01-01

The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

PubMed Central

Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

1993-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

Influence of sulfhydryl sites on metal binding by bacteria

NASA Astrophysics Data System (ADS)

Nell, Ryan M.; Fein, Jeremy B.

2017-02-01

The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

PubMed Central

Liaw, S. H.; Kuo, I.; Eisenberg, D.

1995-01-01

Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen P.

2006-10-17

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

RNA binding protein and binding site useful for expression of recombinant molecules

DOEpatents

Mayfield, Stephen

2000-01-01

The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

GenProBiS: web server for mapping of sequence variants to protein binding sites.

PubMed

Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

2017-07-03

Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

PubMed Central

Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

2011-01-01

Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

Ultrasensitivity and sharp threshold theorems for multisite systems

NASA Astrophysics Data System (ADS)

Dougoud, M.; Mazza, C.; Vinckenbosch, L.

2017-02-01

This work studies the ultrasensitivity of multisite binding processes where ligand molecules can bind to several binding sites. It considers more particularly recent models involving complex chemical reactions in allosteric phosphorylation processes and for transcription factors and nucleosomes competing for binding on DNA. New statistics-based formulas for the Hill coefficient and the effective Hill coefficient are provided and necessary conditions for a system to be ultrasensitive are exhibited. It is first shown that the ultrasensitivity of binding processes can be approached using sharp-threshold theorems which have been developed in applied probability theory and statistical mechanics for studying sharp threshold phenomena in reliability theory, random graph theory and percolation theory. Special classes of binding process are then introduced and are described as density dependent birth and death process. New precise large deviation results for the steady state distribution of the process are obtained, which permits to show that switch-like ultrasensitive responses are strongly related to the multi-modality of the steady state distribution. Ultrasensitivity occurs if and only if the entropy of the dynamical system has more than one global minimum for some critical ligand concentration. In this case, the Hill coefficient is proportional to the number of binding sites, and the system is highly ultrasensitive. The classical effective Hill coefficient I is extended to a new cooperativity index I q , for which we recommend the computation of a broad range of values of q instead of just the standard one I  =  I 0.9 corresponding to the 10%-90% variation in the dose-response. It is shown that this single choice can sometimes mislead the conclusion by not detecting ultrasensitivity. This new approach allows a better understanding of multisite ultrasensitive systems and provides new tools for the design of such systems.

Cofactor-binding sites in proteins of deviating sequence: comparative analysis and clustering in torsion angle, cavity, and fold space.

PubMed

Stegemann, Björn; Klebe, Gerhard

2012-02-01

Small molecules are recognized in protein-binding pockets through surface-exposed physicochemical properties. To optimize binding, they have to adopt a conformation corresponding to a local energy minimum within the formed protein-ligand complex. However, their conformational flexibility makes them competent to bind not only to homologous proteins of the same family but also to proteins of remote similarity with respect to the shape of the binding pockets and folding pattern. Considering drug action, such observations can give rise to unexpected and undesired cross reactivity. In this study, datasets of six different cofactors (ADP, ATP, NAD(P)(H), FAD, and acetyl CoA, sharing an adenosine diphosphate moiety as common substructure), observed in multiple crystal structures of protein-cofactor complexes exhibiting sequence identity below 25%, have been analyzed for the conformational properties of the bound ligands, the distribution of physicochemical properties in the accommodating protein-binding pockets, and the local folding patterns next to the cofactor-binding site. State-of-the-art clustering techniques have been applied to group the different protein-cofactor complexes in the different spaces. Interestingly, clustering in cavity (Cavbase) and fold space (DALI) reveals virtually the same data structuring. Remarkable relationships can be found among the different spaces. They provide information on how conformations are conserved across the host proteins and which distinct local cavity and fold motifs recognize the different portions of the cofactors. In those cases, where different cofactors are found to be accommodated in a similar fashion to the same fold motifs, only a commonly shared substructure of the cofactors is used for the recognition process. Copyright © 2011 Wiley Periodicals, Inc.

Interaction between phloretin and the red blood cell membrane

PubMed Central

1976-01-01

Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

A peek into tropomyosin binding and unfolding on the actin filament.

PubMed

Singh, Abhishek; Hitchcock-Degregori, Sarah E

2009-07-24

Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

sc-PDB: a 3D-database of ligandable binding sites--10 years on.

PubMed

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

PubMed

Ahmed, Ahmed H; Oswald, Robert E

2010-03-11

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

PubMed Central

Ahmed, Ahmed H.; Oswald, Robert E.

2010-01-01

Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

PubMed

Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

2013-07-01

Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

PubMed

Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

2017-09-14

U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

Discovery of novel STAT3 small molecule inhibitors via in silico site-directed fragment-based drug design.

PubMed

Yu, Wenying; Xiao, Hui; Lin, Jiayuh; Li, Chenglong

2013-06-13

Constitutive activation of signal transducer and activator of transcription 3 (STAT3) has been validated as an attractive therapeutic target for cancer therapy. To stop both STAT3 activation and dimerization, a viable strategy is to design inhibitors blocking its SH2 domain phosphotyrosine binding site that is responsible for both actions. A new fragment-based drug design (FBDD) strategy, in silico site-directed FBDD, was applied in this study. A designed novel compound, 5,8-dioxo-6-(pyridin-3-ylamino)-5,8-dihydronaphthalene-1-sulfonamide (LY5), was confirmed to bind to STAT3 SH2 by fluorescence polarization assay. In addition, four out of the five chosen compounds have IC50 values lower than 5 μM for the U2OS cancer cells. 8 (LY5) has an IC50 range in 0.5-1.4 μM in various cancer cell lines. 8 also suppresses tumor growth in an in vivo mouse model. This study has demonstrated the utility of this approach and could be used to other drug targets in general.

New insights into the molecular characteristics behind the function of Renilla luciferase.

PubMed

Fanaei-Kahrani, Zahra; Ganjalikhany, Mohamad Reza; Rasa, Seyed Mohammad Mahdi; Emamzadeh, Rahman

2018-02-01

Renilla Luciferase (RLuc) is a blue light emitter protein which can be applied as a valuable tool in medical diagnosis. But due to lack of the crystal structure of RLuc-ligand complex, the functional motions and catalytic mechanism of this enzyme remain largely unknown. In the present study, the active site properties and the ligand-receptor interactions of the native RLuc and its red-shifted light emitting variant (Super RLuc 8) were investigated using molecular docking approach, molecular dynamics (MD) analysis, and MM-PBSA method. The detailed analysis of the main clusters led to identifying a lid-like structure and its functional motions. Furthermore, an induced-fit mechanism is proposed where ligand-binding induces conformational changes of the active site. Our findings give an insight into the deeper understanding of RLuc conformational changes during binding steps and ligand-receptor pattern. Moreover, our work broaden our understanding of how active site geometry is adjusted to support the catalytic activity and red-shifted light emission in Super RLuc 8. © 2017 Wiley Periodicals, Inc.

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

PubMed

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

PubMed

Marshall, J C; Shakespear, R A; Odell, W D

1976-11-01

Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauch, Eva-Maria; Bernard, Steffen M.; La, David

Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

Spatial Analysis and Quantification of the Thermodynamic Driving Forces in Protein-Ligand Binding: Binding Site Variability

PubMed Central

Raman, E. Prabhu; MacKerell, Alexander D.

2015-01-01

The thermodynamic driving forces behind small molecule-protein binding are still not well understood, including the variability of those forces associated with different types of ligands in different binding pockets. To better understand these phenomena we calculate spatially resolved thermodynamic contributions of the different molecular degrees of freedom for the binding of propane and methanol to multiple pockets on the proteins Factor Xa and p38 MAP kinase. Binding thermodynamics are computed using a statistical thermodynamics based end-point method applied on a canonical ensemble comprising the protein-ligand complexes and the corresponding free states in an explicit solvent environment. Energetic and entropic contributions of water and ligand degrees of freedom computed from the configurational ensemble provides an unprecedented level of detail into the mechanisms of binding. Direct protein-ligand interaction energies play a significant role in both non-polar and polar binding, which is comparable to water reorganization energy. Loss of interactions with water upon binding strongly compensates these contributions leading to relatively small binding enthalpies. For both solutes, the entropy of water reorganization is found to favor binding in agreement with the classical view of the “hydrophobic effect”. Depending on the specifics of the binding pocket, both energy-entropy compensation and reinforcement mechanisms are observed. Notable is the ability to visualize the spatial distribution of the thermodynamic contributions to binding at atomic resolution showing significant differences in the thermodynamic contributions of water to the binding of propane versus methanol. PMID:25625202

An alternate binding site for PPARγ ligands

PubMed Central

Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2014-01-01

PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

PubMed

Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

2015-11-01

Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

Oligomycin frames a common drug-binding site in the ATP synthase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

PubMed

Nisius, Britta; Gohlke, Holger

2012-09-24

Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

Dissecting partner recognition by an intrinsically disordered protein using descriptive random mutagenesis.

PubMed

Gruet, Antoine; Dosnon, Marion; Vassena, Andrea; Lombard, Vincent; Gerlier, Denis; Bignon, Christophe; Longhi, Sonia

2013-09-23

In view of getting insights into the molecular determinants of the binding efficiency of intrinsically disordered proteins (IDPs), we used random mutagenesis. As a proof of concept, we chose the interaction between the intrinsically disordered C-terminal domain of the measles virus nucleoprotein (NTAIL) and the X domain (XD) of the viral phosphoprotein and assessed how amino acid substitutions introduced at random within NTAIL affect partner recognition. In contrast with directed evolution approaches, we did not apply any selection and used the gene library approach not for production purposes but for achieving a better understanding of the NTAIL/XD interaction. For that reason, and to differentiate our approach from similar approaches that make use of systematic (i.e., targeted) mutagenesis, we propose to call it "descriptive random mutagenesis" (DRM). NTAIL variants generated by error-prone PCR were picked at random in the absence of selection pressure and were characterized in terms of sequence and binding abilities toward XD. DRM not only identified determinants of NTAIL/XD interaction that were in good agreement with previous work but also provided new insights. In particular, we discovered that the primary interaction site is poorly evolvable in terms of binding abilities toward XD. We also identified a critical NTAIL residue whose role in stabilizing the NTAIL/XD complex had previously escaped detection, and we identified NTAIL regulatory sites that dampen the interaction while being located outside the primary interaction site. Results show that DRM is a valuable approach to study binding abilities of IDPs. © 2013 Elsevier Ltd. All rights reserved.

On the role of water density fluctuations in the inhibition of a proton channel

PubMed Central

Gianti, Eleonora; Delemotte, Lucie; Klein, Michael L.; Carnevale, Vincenzo

2016-01-01

Hv1 is a transmembrane four-helix bundle that transports protons in a voltage-controlled manner. Its crucial role in many pathological conditions, including cancer and ischemic brain damage, makes Hv1 a promising drug target. Starting from the recently solved crystal structure of Hv1, we used structural modeling and molecular dynamics simulations to characterize the channel’s most relevant conformations along the activation cycle. We then performed computational docking of known Hv1 inhibitors, 2-guanidinobenzimidazole (2GBI) and analogs. Although salt-bridge patterns and electrostatic potential profiles are well-defined and distinctive features of activated versus nonactivated states, the water distribution along the channel lumen is dynamic and reflects a conformational heterogeneity inherent to each state. In fact, pore waters assemble into intermittent hydrogen-bonded clusters that are replaced by the inhibitor moieties upon ligand binding. The entropic gain resulting from releasing these conformationally restrained waters to the bulk solvent is likely a major contributor to the binding free energy. Accordingly, we mapped the water density fluctuations inside the pore of the channel and identified the regions of maximum fluctuation within putative binding sites. Two sites appear as outstanding: One is the already known binding pocket of 2GBI, which is accessible to ligands from the intracellular side; the other is a site located at the exit of the proton permeation pathway. Our analysis of the waters confined in the hydrophobic cavities of Hv1 suggests a general strategy for drug discovery that can be applied to any ion channel. PMID:27956641

BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements.

PubMed

De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

2015-12-01

The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

PubMed Central

De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

2015-01-01

Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

PubMed

Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

2008-12-09

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

PubMed Central

Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

2009-01-01

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

[3H]MK-801 binding sites in post-mortem human frontal cortex.

PubMed

Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

1989-03-29

The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

The action of blocking agents applied to the inner face of Ca(2+)-activated K+ channels from human erythrocytes.

PubMed

Dunn, P M

1998-09-15

The actions of clotrimazole and cetiedil, two drugs known to inhibit the Gardos channel, have been studied on single intermediate conductance calcium-activated potassium (IKCa) channels in inside out patches from human red blood cells, and compared with those of TEA and Ba2+ applied to the cytoplasmic face of the membrane. TEA produced a fast block which was observed as a reduction in the amplitude of the single channel current. This effect was weakly voltage dependent with the fraction of the membrane potential sensed by TEA at its binding site (delta) of 0.18 and a Kd at 0 mV of 20.5 mM. Ba2+ was a very potent blocker of the channel, breaking the single channel activity up into bursts, inter-spersed with silent periods lasting several seconds. The effect of Ba2+ was very voltage sensitive, delta = 0.44, and a Kd at 0 mV of 0.15 microM. Clotrimazole applied to the inner face of the membrane at a concentration < or = 1 microM produced a slow block resulting in bursts of channel activity separated by quiescent periods lasting many seconds. The effect of clotrimazole was mimicked by a quaternary derivative UCL 1559, in keeping with an action at the cytoplasmic face of the channel. A high concentration of cetiedil (100 microM) produced only a weak block of the channel. The kinetics of this action were very slow, with burst and inter-burst intervals lasting several minutes. While inhibition of the Gardos channel by cetiedil is unlikely to involve an intracellular site of action, if clotrimazole is able to penetrate the membrane, part of its effect may result from binding to an intracellular site on the channel.

Predicting a small molecule-kinase interaction map: A machine learning approach

PubMed Central

2011-01-01

Background We present a machine learning approach to the problem of protein ligand interaction prediction. We focus on a set of binding data obtained from 113 different protein kinases and 20 inhibitors. It was attained through ATP site-dependent binding competition assays and constitutes the first available dataset of this kind. We extract information about the investigated molecules from various data sources to obtain an informative set of features. Results A Support Vector Machine (SVM) as well as a decision tree algorithm (C5/See5) is used to learn models based on the available features which in turn can be used for the classification of new kinase-inhibitor pair test instances. We evaluate our approach using different feature sets and parameter settings for the employed classifiers. Moreover, the paper introduces a new way of evaluating predictions in such a setting, where different amounts of information about the binding partners can be assumed to be available for training. Results on an external test set are also provided. Conclusions In most of the cases, the presented approach clearly outperforms the baseline methods used for comparison. Experimental results indicate that the applied machine learning methods are able to detect a signal in the data and predict binding affinity to some extent. For SVMs, the binding prediction can be improved significantly by using features that describe the active site of a kinase. For C5, besides diversity in the feature set, alignment scores of conserved regions turned out to be very useful. PMID:21708012

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-03-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

PubMed Central

Rostagno, A A; Schwarzbauer, J E; Gold, L I

1999-01-01

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

sc-PDB: a 3D-database of ligandable binding sites—10 years on

PubMed Central

Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

2015-01-01

The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

PubMed

Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

2018-05-29

Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

PubMed Central

Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

2008-01-01

The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

PubMed Central

Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

2012-01-01

Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

PubMed

Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

2014-01-01

We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

PubMed

Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

2018-03-23

The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

NASA Astrophysics Data System (ADS)

Naderi, Ebadollah; Ghaisas, S. V.

2016-08-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com; Ghaisas, S. V.

2016-08-15

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked outmore » from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.« less

Small constrained SP1-7 analogs bind to a unique site and promote anti-allodynic effects following systemic injection in mice.

PubMed

Jonsson, A; Fransson, R; Haramaki, Y; Skogh, A; Brolin, E; Watanabe, H; Nordvall, G; Hallberg, M; Sandström, A; Nyberg, F

2015-07-09

Previous results have shown that the substance P (SP) N-terminal fragment SP1-7 may attenuate hyperalgesia and produce anti-allodynia in animals using various experimental models for neuropathic pain. The heptapeptide was found to induce its effects through binding to and activating specific sites apart from any known neurokinin or opioid receptor. Furthermore, we have applied a medicinal chemistry program to develop lead compounds mimicking the effect of SP1-7. The present study was designed to evaluate the pharmacological effect of these compounds using the mouse spared nerve injury (SNI) model of chronic neuropathic pain. Also, as no comprehensive screen with the aim to identify the SP1-7 target has yet been performed we screened our lead compound H-Phe-Phe-NH2 toward a panel of drug targets. The extensive target screen, including 111 targets, did not reveal any hit for the binding site among a number of known receptors or enzymes involved in pain modulation. Our animal studies confirmed that SP1-7, but also synthetic analogs thereof, possesses anti-allodynic effects in the mouse SNI model of neuropathic pain. One of the lead compounds, a constrained H-Phe-Phe-NH2 analog, was shown to exhibit a significant anti-allodynic effect. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

NASA Astrophysics Data System (ADS)

Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

2018-02-01

Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

2011-01-01

Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

A deep learning framework for modeling structural features of RNA-binding protein targets

PubMed Central

Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

2016-01-01

RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

PubMed Central

Middendorf, Thomas R.

2017-01-01

A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

PubMed

Mizuno, S; Ogawa, N; Mori, A

1982-12-01

Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

PubMed

Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

2008-05-01

The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

PubMed

Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

2014-03-01

Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

PubMed

Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

2006-07-01

High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

PubMed Central

Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

2010-01-01

The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

PubMed

Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

2017-07-05

Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

PubMed

Streiff, John H; Jones, Keith A

2008-10-01

The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

PubMed

Gold, Nicola D; Jackson, Richard M

2006-02-03

The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

Analysis of functional importance of binding sites in the Drosophila gap gene network model.

PubMed

Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

2015-01-01

The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

PubMed

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

PubMed

Dudev, Todor; Chang, Li-Ying; Lim, Carmay

2005-03-23

Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

PubMed

Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

2005-04-19

The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

Design, synthesis and antimalarial screening of some hybrid 4-aminoquinoline-triazine derivatives against pf-DHFR-TS.

PubMed

Sahu, Supriya; Ghosh, Surajit Kumar; Kalita, Junmoni; Dutta, Mayurakhi; Bhat, Hans Raj

2016-04-01

Existing antifolate antimalarial drugs have shown resistance due to the mutations at some amino acid positions of Plasmodium falciparum DHFR-TS. In the present study, to overcome this resistance, a new series of hybrid 4-aminoquinoline-triazine derivatives were designed and docked into the active site of Pf-DHFR-TS (PDB i.d. 1J3K) using validated CDOCKER protocol. Binding energy was calculated by applying CHARMm forcefield. Binding energy and the pattern of interaction of the docked compounds were analysed. Fifteen compounds were selected for synthesis based on their binding energy values and docking poses. Synthesized compounds were characterised by FTIR, (1)H NMR, (13)C NMR, mass spectroscopy and were screened for antimalarial activity against 3D7 strain of Plasmodium falciparum. Copyright © 2016 Elsevier Inc. All rights reserved.

Comparison of molecular mechanics-Poisson-Boltzmann surface area (MM-PBSA) and molecular mechanics-three-dimensional reference interaction site model (MM-3D-RISM) method to calculate the binding free energy of protein-ligand complexes: Effect of metal ion and advance statistical test

NASA Astrophysics Data System (ADS)

Pandey, Preeti; Srivastava, Rakesh; Bandyopadhyay, Pradipta

2018-03-01

The relative performance of MM-PBSA and MM-3D-RISM methods to estimate the binding free energy of protein-ligand complexes is investigated by applying these to three proteins (Dihydrofolate Reductase, Catechol-O-methyltransferase, and Stromelysin-1) differing in the number of metal ions they contain. None of the computational methods could distinguish all the ligands based on their calculated binding free energies (as compared to experimental values). The difference between the two comes from both polar and non-polar part of solvation. For charged ligand case, MM-PBSA and MM-3D-RISM give a qualitatively different result for the polar part of solvation.

Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

PubMed

Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

2013-11-01

The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Use of tissue-specific microRNA to control pathology of wild-type adenovirus without attenuation of its ability to kill cancer cells.

PubMed

Cawood, Ryan; Chen, Hannah H; Carroll, Fionnadh; Bazan-Peregrino, Miriam; van Rooijen, Nico; Seymour, Leonard W

2009-05-01

Replicating viruses have broad applications in biomedicine, notably in cancer virotherapy and in the design of attenuated vaccines; however, uncontrolled virus replication in vulnerable tissues can give pathology and often restricts the use of potent strains. Increased knowledge of tissue-selective microRNA expression now affords the possibility of engineering replicating viruses that are attenuated at the RNA level in sites of potential pathology, but retain wild-type replication activity at sites not expressing the relevant microRNA. To assess the usefulness of this approach for the DNA virus adenovirus, we have engineered a hepatocyte-safe wild-type adenovirus 5 (Ad5), which normally mediates significant toxicity and is potentially lethal in mice. To do this, we have included binding sites for hepatocyte-selective microRNA mir-122 within the 3' UTR of the E1A transcription cassette. Imaging versions of these viruses, produced by fusing E1A with luciferase, showed that inclusion of mir-122 binding sites caused up to 80-fold decreased hepatic expression of E1A following intravenous delivery to mice. Animals administered a ten-times lethal dose of wild-type Ad5 (5x10(10) viral particles/mouse) showed substantial hepatic genome replication and extensive liver pathology, while inclusion of 4 microRNA binding sites decreased replication 50-fold and virtually abrogated liver toxicity. This modified wild-type virus retained full activity within cancer cells and provided a potent, liver-safe oncolytic virus. In addition to providing many potent new viruses for cancer virotherapy, microRNA control of virus replication should provide a new strategy for designing safe attenuated vaccines applied across a broad range of viral diseases.

Resolving the problem of trapped water in binding cavities: prediction of host-guest binding free energies in the SAMPL5 challenge by funnel metadynamics

NASA Astrophysics Data System (ADS)

Bhakat, Soumendranath; Söderhjelm, Pär

2017-01-01

The funnel metadynamics method enables rigorous calculation of the potential of mean force along an arbitrary binding path and thereby evaluation of the absolute binding free energy. A problem of such physical paths is that the mechanism characterizing the binding process is not always obvious. In particular, it might involve reorganization of the solvent in the binding site, which is not easily captured with a few geometrically defined collective variables that can be used for biasing. In this paper, we propose and test a simple method to resolve this trapped-water problem by dividing the process into an artificial host-desolvation step and an actual binding step. We show that, under certain circumstances, the contribution from the desolvation step can be calculated without introducing further statistical errors. We apply the method to the problem of predicting host-guest binding free energies in the SAMPL5 blind challenge, using two octa-acid hosts and six guest molecules. For one of the hosts, well-converged results are obtained and the prediction of relative binding free energies is the best among all the SAMPL5 submissions. For the other host, which has a narrower binding pocket, the statistical uncertainties are slightly higher; longer simulations would therefore be needed to obtain conclusive results.

Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giannopoulos, G.; Jackson, K.; Kredentser, J.

The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

PubMed

Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

2014-11-18

Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

NASA Astrophysics Data System (ADS)

Pang, Yuan-Ping; Kozikowski, Alan P.

1994-12-01

We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

PubMed

Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

2016-06-01

Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Energetics and kinetics of cooperative cofilin-actin filament interactions.

PubMed

Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

2006-08-11

We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

2008-08-19

Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

Association weight matrix for the genetic dissection of puberty in beef cattle.

PubMed

Fortes, Marina R S; Reverter, Antonio; Zhang, Yuandan; Collis, Eliza; Nagaraj, Shivashankar H; Jonsson, Nick N; Prayaga, Kishore C; Barris, Wes; Hawken, Rachel J

2010-08-03

We describe a systems biology approach for the genetic dissection of complex traits based on applying gene network theory to the results from genome-wide associations. The associations of single-nucleotide polymorphisms (SNP) that were individually associated with a primary phenotype of interest, age at puberty in our study, were explored across 22 related traits. Genomic regions were surveyed for genes harboring the selected SNP. As a result, an association weight matrix (AWM) was constructed with as many rows as genes and as many columns as traits. Each {i, j} cell value in the AWM corresponds to the z-score normalized additive effect of the ith gene (via its neighboring SNP) on the jth trait. Columnwise, the AWM recovered the genetic correlations estimated via pedigree-based restricted maximum-likelihood methods. Rowwise, a combination of hierarchical clustering, gene network, and pathway analyses identified genetic drivers that would have been missed by standard genome-wide association studies. Finally, the promoter regions of the AWM-predicted targets of three key transcription factors (TFs), estrogen-related receptor gamma (ESRRG), Pal3 motif, bound by a PPAR-gamma homodimer, IR3 sites (PPARG), and Prophet of Pit 1, PROP paired-like homeobox 1 (PROP1), were surveyed to identify binding sites corresponding to those TFs. Applied to our case, the AWM results recapitulate the known biology of puberty, captured experimentally validated binding sites, and identified candidate genes and gene-gene interactions for further investigation.

Association weight matrix for the genetic dissection of puberty in beef cattle

PubMed Central

Fortes, Marina R. S.; Reverter, Antonio; Zhang, Yuandan; Collis, Eliza; Nagaraj, Shivashankar H.; Jonsson, Nick N.; Prayaga, Kishore C.; Barris, Wes; Hawken, Rachel J.

2010-01-01

We describe a systems biology approach for the genetic dissection of complex traits based on applying gene network theory to the results from genome-wide associations. The associations of single-nucleotide polymorphisms (SNP) that were individually associated with a primary phenotype of interest, age at puberty in our study, were explored across 22 related traits. Genomic regions were surveyed for genes harboring the selected SNP. As a result, an association weight matrix (AWM) was constructed with as many rows as genes and as many columns as traits. Each {i, j} cell value in the AWM corresponds to the z-score normalized additive effect of the ith gene (via its neighboring SNP) on the jth trait. Columnwise, the AWM recovered the genetic correlations estimated via pedigree-based restricted maximum-likelihood methods. Rowwise, a combination of hierarchical clustering, gene network, and pathway analyses identified genetic drivers that would have been missed by standard genome-wide association studies. Finally, the promoter regions of the AWM-predicted targets of three key transcription factors (TFs), estrogen-related receptor γ (ESRRG), Pal3 motif, bound by a PPAR-γ homodimer, IR3 sites (PPARG), and Prophet of Pit 1, PROP paired-like homeobox 1 (PROP1), were surveyed to identify binding sites corresponding to those TFs. Applied to our case, the AWM results recapitulate the known biology of puberty, captured experimentally validated binding sites, and identified candidate genes and gene–gene interactions for further investigation. PMID:20643938

ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

PubMed

Konc, Janez; Janežič, Dušanka

2014-07-01

The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

2005-08-22

Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

PubMed Central

Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

2007-01-01

In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

PubMed

Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

1994-10-27

Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

PubMed Central

Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

2012-01-01

An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

PubMed

Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

2017-01-01

Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

PubMed

Morley, B J; Garner, L L

1990-06-11

Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

NASA Astrophysics Data System (ADS)

Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

NASA Astrophysics Data System (ADS)

Qian, Long; Kussell, Edo

The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

PubMed Central

Jalak, Jürgen; Väljamäe, Priit

2014-01-01

Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

PubMed Central

Gibbons, R. J.; Moreno, E. C.; Etherden, I.

1983-01-01

The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

1990-01-01

Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

The Structural Basis of ATP as an Allosteric Modulator

PubMed Central

Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

2014-01-01

Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

PubMed Central

Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

2014-01-01

A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

Dynamics of human protein kinase Aurora A linked to drug selectivity

DOE PAGES

Pitsawong, Warintra; Buosi, Vanessa; Otten, Renee; ...

2018-06-14

Protein kinases are major drug targets, but the development of highly-selective inhibitors has been challenging due to the similarity of their active sites. The observation of distinct structural states of the fully-conserved Asp-Phe-Gly (DFG) loop has put the concept of conformational selection for the DFG-state at the center of kinase drug discovery. Recently, it was shown that Gleevec selectivity for the Tyr-kinases Abl was instead rooted in conformational changes after drug binding. Here, we investigate whether protein dynamics after binding is a more general paradigm for drug selectivity by characterizing the binding of several approved drugs to the Ser/Thr-kinase Auroramore » A. Using a combination of biophysical techniques, we propose a universal drug-binding mechanism, that rationalizes selectivity, affinity and long on-target residence time for kinase inhibitors. These new concepts, where protein dynamics in the drug-bound state plays the crucial role, can be applied to inhibitor design of targets outside the kinome.« less

Dynamics of human protein kinase Aurora A linked to drug selectivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pitsawong, Warintra; Buosi, Vanessa; Otten, Renee

Protein kinases are major drug targets, but the development of highly-selective inhibitors has been challenging due to the similarity of their active sites. The observation of distinct structural states of the fully-conserved Asp-Phe-Gly (DFG) loop has put the concept of conformational selection for the DFG-state at the center of kinase drug discovery. Recently, it was shown that Gleevec selectivity for the Tyr-kinases Abl was instead rooted in conformational changes after drug binding. Here, we investigate whether protein dynamics after binding is a more general paradigm for drug selectivity by characterizing the binding of several approved drugs to the Ser/Thr-kinase Auroramore » A. Using a combination of biophysical techniques, we propose a universal drug-binding mechanism, that rationalizes selectivity, affinity and long on-target residence time for kinase inhibitors. These new concepts, where protein dynamics in the drug-bound state plays the crucial role, can be applied to inhibitor design of targets outside the kinome.« less

Selective class IIa histone deacetylase inhibition via a nonchelating zinc-binding group.

PubMed

Lobera, Mercedes; Madauss, Kevin P; Pohlhaus, Denise T; Wright, Quentin G; Trocha, Mark; Schmidt, Darby R; Baloglu, Erkan; Trump, Ryan P; Head, Martha S; Hofmann, Glenn A; Murray-Thompson, Monique; Schwartz, Benjamin; Chakravorty, Subhas; Wu, Zining; Mander, Palwinder K; Kruidenier, Laurens; Reid, Robert A; Burkhart, William; Turunen, Brandon J; Rong, James X; Wagner, Craig; Moyer, Mary B; Wells, Carrow; Hong, Xuan; Moore, John T; Williams, Jon D; Soler, Dulce; Ghosh, Shomir; Nolan, Michael A

2013-05-01

In contrast to studies on class I histone deacetylase (HDAC) inhibitors, the elucidation of the molecular mechanisms and therapeutic potential of class IIa HDACs (HDAC4, HDAC5, HDAC7 and HDAC9) is impaired by the lack of potent and selective chemical probes. Here we report the discovery of inhibitors that fill this void with an unprecedented metal-binding group, trifluoromethyloxadiazole (TFMO), which circumvents the selectivity and pharmacologic liabilities of hydroxamates. We confirm direct metal binding of the TFMO through crystallographic approaches and use chemoproteomics to demonstrate the superior selectivity of the TFMO series relative to a hydroxamate-substituted analog. We further apply these tool compounds to reveal gene regulation dependent on the catalytic active site of class IIa HDACs. The discovery of these inhibitors challenges the design process for targeting metalloenzymes through a chelating metal-binding group and suggests therapeutic potential for class IIa HDAC enzyme blockers distinct in mechanism and application compared to current HDAC inhibitors.

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

PubMed

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

PubMed

Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

2018-02-01

Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

Elimination of a ligand gating site generates a supersensitive olfactory receptor.

PubMed

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

2016-06-21

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

Elimination of a ligand gating site generates a supersensitive olfactory receptor

PubMed Central

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

2016-01-01

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

2009-06-08

The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

PubMed Central

Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

2013-01-01

Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

Characteristic of theophylline imprinted monolithic column and its application for determination of xanthine derivatives caffeine and theophylline in green tea.

PubMed

Sun, Han-wen; Qiao, Feng-xia; Liu, Guang-yu

2006-11-17

Theophylline imprinted monolithic columns were designed and prepared for rapid separation of a homologous series of xanthine derivatives, caffeine, and theophylline by an in situ thermal-initiated copolymerization technique. Caffeine and theophylline were fully separated both under isocratic and gradient elutions on this kind of monolithic molecularly imprinted polymers (MIP) column. The broad peak showed in isocratic elution could be improved in gradient elution. Some chromatographic conditions such as mobile phase composition, flow rate, and the temperature on the retention times were investigated. Hydrogen bonding interaction and hydrophobic interaction played an important role in the retention and separation. The binding capacity was evaluated by static adsorption and Scatchard analysis, which showed that the dissociation constant (KD) and the maximum binding capacity (Qmax) were 1.50 mol/L, and 236 micromol/g for high affinity binding site, and 7.97 mol/L and 785 micromol/g for lower affinity binding site, respectively. Thermodynamic data (DeltaDeltaH and DeltaDeltaS) obtained by Van't Hoff plots revealed an enthalpy-controlled separation. The morphological characteristics of monolithic MIP were investigated by scanning electron microscope, which showed that both mesopores and macropores were formed in the monolith. The present monolithic MIP column was successfully applied for the quantitative determination of caffeine and theophylline in different kinds of green tea.

Rosetta FlexPepDock ab-initio: simultaneous folding, docking and refinement of peptides onto their receptors.

PubMed

Raveh, Barak; London, Nir; Zimmerman, Lior; Schueler-Furman, Ora

2011-04-29

Flexible peptides that fold upon binding to another protein molecule mediate a large number of regulatory interactions in the living cell and may provide highly specific recognition modules. We present Rosetta FlexPepDock ab-initio, a protocol for simultaneous docking and de-novo folding of peptides, starting from an approximate specification of the peptide binding site. Using the Rosetta fragments library and a coarse-grained structural representation of the peptide and the receptor, FlexPepDock ab-initio samples efficiently and simultaneously the space of possible peptide backbone conformations and rigid-body orientations over the receptor surface of a given binding site. The subsequent all-atom refinement of the coarse-grained models includes full side-chain modeling of both the receptor and the peptide, resulting in high-resolution models in which key side-chain interactions are recapitulated. The protocol was applied to a benchmark in which peptides were modeled over receptors in either their bound backbone conformations or in their free, unbound form. Near-native peptide conformations were identified in 18/26 of the bound cases and 7/14 of the unbound cases. The protocol performs well on peptides from various classes of secondary structures, including coiled peptides with unusual turns and kinks. The results presented here significantly extend the scope of state-of-the-art methods for high-resolution peptide modeling, which can now be applied to a wide variety of peptide-protein interactions where no prior information about the peptide backbone conformation is available, enabling detailed structure-based studies and manipulation of those interactions. © 2011 Raveh et al.

Rosetta FlexPepDock ab-initio: Simultaneous Folding, Docking and Refinement of Peptides onto Their Receptors

PubMed Central

Raveh, Barak; London, Nir; Zimmerman, Lior; Schueler-Furman, Ora

2011-01-01

Flexible peptides that fold upon binding to another protein molecule mediate a large number of regulatory interactions in the living cell and may provide highly specific recognition modules. We present Rosetta FlexPepDock ab-initio, a protocol for simultaneous docking and de-novo folding of peptides, starting from an approximate specification of the peptide binding site. Using the Rosetta fragments library and a coarse-grained structural representation of the peptide and the receptor, FlexPepDock ab-initio samples efficiently and simultaneously the space of possible peptide backbone conformations and rigid-body orientations over the receptor surface of a given binding site. The subsequent all-atom refinement of the coarse-grained models includes full side-chain modeling of both the receptor and the peptide, resulting in high-resolution models in which key side-chain interactions are recapitulated. The protocol was applied to a benchmark in which peptides were modeled over receptors in either their bound backbone conformations or in their free, unbound form. Near-native peptide conformations were identified in 18/26 of the bound cases and 7/14 of the unbound cases. The protocol performs well on peptides from various classes of secondary structures, including coiled peptides with unusual turns and kinks. The results presented here significantly extend the scope of state-of-the-art methods for high-resolution peptide modeling, which can now be applied to a wide variety of peptide-protein interactions where no prior information about the peptide backbone conformation is available, enabling detailed structure-based studies and manipulation of those interactions. PMID:21572516

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

1988-05-01

Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

HMGB1 Protein Binds to Influenza Virus Nucleoprotein and Promotes Viral Replication

PubMed Central

Moisy, Dorothée; Avilov, Sergiy V.; Jacob, Yves; Laoide, Brid M.; Ge, Xingyi; Baudin, Florence; Jestin, Jean-Luc

2012-01-01

Influenza virus has evolved replication strategies that hijack host cell pathways. To uncover interactions between viral macromolecules and host proteins, we applied a phage display strategy. A library of human cDNA expression products displayed on filamentous phages was submitted to affinity selection for influenza viral ribonucleoproteins (vRNPs). High-mobility-group box (HMGB) proteins were found to bind to the nucleoprotein (NP) component of vRNPs. HMGB1 and HMGB2 bind directly to the purified NP in the absence of viral RNA, and the HMG box A domain is sufficient to bind the NP. We show that HMGB1 associates with the viral NP in the nuclei of infected cells, promotes viral growth, and enhances the activity of the viral polymerase. The presence of a functional HMGB1 DNA-binding site is required to enhance influenza virus replication. Glycyrrhizin, which reduces HMGB1 binding to DNA, inhibits influenza virus polymerase activity. Our data show that the HMGB1 protein can play a significant role in intranuclear replication of influenza viruses, thus extending previous findings on the bornavirus and on a number of DNA viruses. PMID:22696656

Lighting Up the Thioflavin T by Parallel-Stranded TG(GA) n DNA Homoduplexes.

PubMed

Zhu, Jinbo; Yan, Zhiqiang; Zhou, Weijun; Liu, Chuanbo; Wang, Jin; Wang, Erkang

2018-06-22

Thioflavin T (ThT) was once regarded to be a specific fluorescent probe for the human telomeric G-quadruplex, but more other kinds of DNA were found that can also bind to ThT in recent years. Herein, we focus on G-rich parallel-stranded DNA and utilize fluorescence, absorbance, circular dichroism, and surface plasmon resonance spectroscopy to investigate its interaction with ThT. Pyrene label and molecular modeling are applied to unveil the binding mechanism. We find a new class of non-G-quadruplex G-rich parallel-stranded ( ps) DNA with the sequence of TG(GA) n can bind to ThT and increase the fluorescence with an enhancement ability superior to G-quadruplex. The optimal binding specificity for ThT is conferred by two parts. The first part is composed of two bases TG at the 5' end, which is a critical domain and plays an important role in the formation of the binding site for ThT. The second part is the rest alternative d(GA) bases, which forms the ps homoduplex and cooperates with the TG bases at the 5' end to bind the ThT.

Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romm, E.; Marks, M.J.; Collins, A.C.

1990-01-01

Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

Binding of (/sup 3/H)Forskolin to rat brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seamon, K.B.; Vaillancourt, R.; Edwards, M.

1984-08-01

(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

Biophysical Fitness Landscapes for Transcription Factor Binding Sites

PubMed Central

Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

2014-01-01

Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

PubMed

Yokoyama, Ken Daigoro; Pollock, David D

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

PubMed Central

Yokoyama, Ken Daigoro; Pollock, David D.

2012-01-01

Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

Near-IR MCD of the nonheme ferrous active site in naphthalene 1,2-dioxygenase: correlation to crystallography and structural insight into the mechanism of Rieske dioxygenases.

PubMed

Ohta, Takehiro; Chakrabarty, Sarmistha; Lipscomb, John D; Solomon, Edward I

2008-02-06

Near-IR MCD and variable temperature, variable field (VTVH) MCD have been applied to naphthalene 1,2-dioxygenase (NDO) to describe the coordination geometry and electronic structure of the mononuclear nonheme ferrous catalytic site in the resting and substrate-bound forms with the Rieske 2Fe2S cluster oxidized and reduced. The structural results are correlated with the crystallographic studies of NDO and other related Rieske nonheme iron oxygenases to develop molecular level insights into the structure/function correlation for this class of enzymes. The MCD data for resting NDO with the Rieske center oxidized indicate the presence of a six-coordinate high-spin ferrous site with a weak axial ligand which becomes more tightly coordinated when the Rieske center is reduced. Binding of naphthalene to resting NDO (Rieske oxidized and reduced) converts the six-coordinate sites into five-coordinate (5c) sites with elimination of a water ligand. In the Rieske oxidized form the 5c sites are square pyramidal but transform to a 1:2 mixture of trigonal bipyramial/square pyramidal sites when the Rieske center is reduced. Thus the geometric and electronic structure of the catalytic site in the presence of substrate can be significantly affected by the redox state of the Rieske center. The catalytic ferrous site is primed for the O2 reaction when substrate is bound in the active site in the presence of the reduced Rieske site. These structural changes ensure that two electrons and the substrate are present before the binding and activation of O2, which avoids the uncontrolled formation and release of reactive oxygen species.

Nucleotide-dependent bisANS binding to tubulin.

PubMed

Chakraborty, S; Sarkar, N; Bhattacharyya, B

1999-07-13

Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

1988-01-01

(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

Impact of disruption of secondary binding site S2 on dopamine transporter function.

PubMed

Zhen, Juan; Reith, Maarten E A

2016-09-01

The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

PubMed

Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

2011-11-14

The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

PubMed Central

Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

2001-01-01

Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

System and method for detecting components of a mixture including a valving scheme for competition assays

DOEpatents

Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

2017-09-19

Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

System and method for detecting components of a mixture including a valving scheme for competition assays

DOEpatents

Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

2017-07-11

Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Autoradiographic demonstration of oxytocin-binding sites in the macula densa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoeckel, M.E.; Freund-Mercier, M.J.

1989-08-01

Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

High-affinity cannabinoid binding site in brain: A possible marijuana receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nye, J.S.

The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

PubMed

Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

2006-04-24

A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

DTIC Science & Technology

positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

PubMed Central

Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

2010-01-01

Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

PubMed Central

Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

2011-01-01

The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

HOCOMOCO: towards a complete collection of transcription factor binding models for human and mouse via large-scale ChIP-Seq analysis.

PubMed

Kulakovskiy, Ivan V; Vorontsov, Ilya E; Yevshin, Ivan S; Sharipov, Ruslan N; Fedorova, Alla D; Rumynskiy, Eugene I; Medvedeva, Yulia A; Magana-Mora, Arturo; Bajic, Vladimir B; Papatsenko, Dmitry A; Kolpakov, Fedor A; Makeev, Vsevolod J

2018-01-04

We present a major update of the HOCOMOCO collection that consists of patterns describing DNA binding specificities for human and mouse transcription factors. In this release, we profited from a nearly doubled volume of published in vivo experiments on transcription factor (TF) binding to expand the repertoire of binding models, replace low-quality models previously based on in vitro data only and cover more than a hundred TFs with previously unknown binding specificities. This was achieved by systematic motif discovery from more than five thousand ChIP-Seq experiments uniformly processed within the BioUML framework with several ChIP-Seq peak calling tools and aggregated in the GTRD database. HOCOMOCO v11 contains binding models for 453 mouse and 680 human transcription factors and includes 1302 mononucleotide and 576 dinucleotide position weight matrices, which describe primary binding preferences of each transcription factor and reliable alternative binding specificities. An interactive interface and bulk downloads are available on the web: http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco11. In this release, we complement HOCOMOCO by MoLoTool (Motif Location Toolbox, http://molotool.autosome.ru) that applies HOCOMOCO models for visualization of binding sites in short DNA sequences. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

PubMed

Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

2017-03-16

Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

1986-06-01

(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

PubMed

Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

2008-06-01

In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Ovariectomized Rats with Established Osteopenia have Diminished Mesenchymal Stem Cells in the Bone Marrow and Impaired Homing, Osteoinduction and Bone Regeneration at the Fracture Site.

PubMed

Tewari, Deepshikha; Khan, Mohd Parvez; Sagar, Nitin; China, Shyamsundar P; Singh, Atul K; Kheruka, Subhash C; Barai, Sukanta; Tewari, Mahesh C; Nagar, Geet K; Vishwakarma, Achchhe L; Ogechukwu, Omeje E; Bellare, Jayesh R; Gambhir, Sanjay; Chattopadhyay, Naibedya

2015-04-01

We investigated deleterious changes that take place in mesenchymal stem cells (MSC) and its fracture healing competence in ovariectomy (Ovx)-induced osteopenia. MSC from bone marrow (BM) of ovary intact (control) and Ovx rats was isolated. (99m)Tc-HMPAO (Technitium hexamethylpropylene amine oxime) labeled MSC was systemically transplanted to rats and fracture tropism assessed by SPECT/CT. PKH26 labeled MSC (PKH26-MSC) was bound in scaffold and applied to fracture site (drill-hole in femur metaphysis). Osteoinduction was quantified by calcein binding and microcomputed tomography. Estrogen receptor (ER) antagonist, fulvestrant was used to determine ER dependence of osteo-induction by MSC. BM-MSC number was strikingly reduced and doubling time increased in Ovx rats compared to control. SPECT/CT showed reduced localization of (99m)Tc-HMPAO labeled MSC to the fracture site, 3 h post-transplantation in Ovx rats as compared with controls. Post-transplantation, Ovx MSC labeled with PKH26 (Ovx PKH26-MSC) localized less to fracture site than control PKH26-MSC. Transplantation of either control or Ovx MSC enhanced calcein binding and bone volume at the callus of control rats over placebo group however Ovx MSC had lower efficacy than control MSC. Fulvestrant blocked osteoinduction by control MSC. When scaffold bound MSC was applied to fracture, osteoinduction by Ovx PKH26-MSC was less than control PKH26-MSC. In Ovx rats, control MSC/E2 treatment but not Ovx MSC showed osteoinduction. Regenerated bone was irregularly deposited in Ovx MSC group. In conclusion, Ovx is associated with diminished BM-MSC number and its growth, and Ovx MSC displays impaired engraftment to fracture and osteoinduction besides disordered bone regeneration.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, M.W.; Chen, J.P.; Wallis, C.

1992-02-26

({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

PubMed Central

Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

1998-01-01

The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

PubMed

Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

1991-11-01

The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

Combined glyco- and protein-Fc engineering simultaneously enhance cytotoxicity and half-life of a therapeutic antibody.

PubMed

Monnet, Céline; Jorieux, Sylvie; Souyris, Nathalie; Zaki, Ouafa; Jacquet, Alexandra; Fournier, Nathalie; Crozet, Fabien; de Romeuf, Christophe; Bouayadi, Khalil; Urbain, Rémi; Behrens, Christian K; Mondon, Philippe; Fontayne, Alexandre

2014-01-01

While glyco-engineered monoclonal antibodies (mAbs) with improved antibody-dependent cell-mediated cytotoxicity (ADCC) are reaching the market, extensive efforts have also been made to improve their pharmacokinetic properties to generate biologically superior molecules. Most therapeutic mAbs are human or humanized IgG molecules whose half-life is dependent on the neonatal Fc receptor FcRn. FcRn reduces IgG catabolism by binding to the Fc domain of endocytosed IgG in acidic lysosomal compartments, allowing them to be recycled into the blood. Fc-engineered mAbs with increased FcRn affinity resulted in longer in vivo half-life in animal models, but also in healthy humans. These Fc-engineered mAbs were obtained by alanine scanning, directed mutagenesis or in silico approach of the FcRn binding site. In our approach, we applied a random mutagenesis technology (MutaGen™) to generate mutations evenly distributed over the whole Fc sequence of human IgG1. IgG variants with improved FcRn-binding were then isolated from these Fc-libraries using a pH-dependent phage display selection process. Two successive rounds of mutagenesis and selection were performed to identify several mutations that dramatically improve FcRn binding. Notably, many of these mutations were unpredictable by rational design as they were located distantly from the FcRn binding site, validating our random molecular approach. When produced on the EMABling(®) platform allowing effector function increase, our IgG variants retained both higher ADCC and higher FcRn binding. Moreover, these IgG variants exhibited longer half-life in human FcRn transgenic mice. These results clearly demonstrate that glyco-engineering to improve cytotoxicity and protein-engineering to increase half-life can be combined to further optimize therapeutic mAbs.

Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

PubMed

Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

2016-07-19

The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

PubMed

Barnert, R H; Zeichhardt, H; Habermehl, K O

1992-02-01

Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

Cooperative interplay of let-7 mimic and HuR with MYC RNA.

PubMed

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

PubMed

Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

2018-06-06

Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

PubMed

Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

2015-12-01

CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

PubMed Central

Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

2007-01-01

Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

Investigation of glucose binding sites on insulin.

PubMed

Zoete, Vincent; Meuwly, Markus; Karplus, Martin

2004-05-15

Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

PubMed Central

James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

2015-01-01

Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

Oriented antibody immobilization on self-assembled monolayers applied as impedance biosensors

NASA Astrophysics Data System (ADS)

Tsugimura, Kaiki; Ohnuki, Hitoshi; Wu, Haiyun; Endo, Hideaki; Tsuya, Daiju; Izumi, Mitsuru

2017-11-01

Oriented immobilization of antibodies on a sensor chip is crucial for enhancing both the sensitivity and antigen-binding capacity of immunosensors. Here, we report a comparative study of the effect of oriented and random antibody immobilization on the binding efficiency by electrochemical impedance spectroscopy (EIS). Oriented immobilization of anti-myoglobin immunoglobulin G (anti-Myo IgG) was achieved by bonding to an Fc receptor of protein G (PrG) on a self-assembled monolayer (SAM), which results in the myoglobin (Myo) binding sites being exposed outside the sensing surface. Random immobilization of anti-Myo IgG was achieved by direct covalent attachment to the SAM surface. Both immobilizations were applied to interdigitated electrodes to enhance the electrochemical signal, and the Myo biosensor performance was then evaluated by a series of EIS measurements. We found that (i) the rate of the normalized charge transfer resistance for the oriented sample was 3 times higher than that for the random sample and (ii) the detection limit was 0.001 ng/mL, which is the lowest recorded detection limit among Myo immunosensors based on EIS. These findings indicate that oriented antibody immobilization is crucial for preparing highly sensitive EIS-based biosensors.

Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

PubMed

Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

1988-01-01

The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

Selective amyloid β oligomer assay based on abasic site-containing molecular beacon and enzyme-free amplification.

PubMed

Zhu, Linling; Zhang, Junying; Wang, Fengyang; Wang, Ya; Lu, Linlin; Feng, Chongchong; Xu, Zhiai; Zhang, Wen

2016-04-15

Amyloid-beta (Aβ) oligomers are highly toxic species in the process of Aβ aggregation and are regarded as potent therapeutic targets and diagnostic markers for Alzheimer's disease (AD). Herein, a label-free molecular beacon (MB) system integrated with enzyme-free amplification strategy was developed for simple and highly selective assay of Aβ oligomers. The MB system was constructed with abasic site (AP site)-containing stem-loop DNA and a fluorescent ligand 2-amino-5,6,7-trimethyl-1,8-naphyridine (ATMND), of which the fluorescence was quenched upon binding to the AP site in DNA stem. Enzyme-free amplification was realized by target-triggered continuous opening of two delicately designed MBs (MB1 and MB2). Target DNA hybridization with MB1 and then MB2 resulted in the release of two ATMND molecules in one binding event. Subsequent target recycling could greatly amplify the detection sensitivity due to the greatly enhanced turn-on emission of ATMND fluorescence. Combining with Aβ oligomers aptamers, the strategy was applied to analyze Aβ oligomers and the results showed that it could quantify Aβ oligomers with high selectivity and monitor the Aβ aggregation process. This novel method may be conducive to improve the diagnosis and pathogenic study of Alzheimer's disease. Copyright © 2015 Elsevier B.V. All rights reserved.

Mapping the binding site of snurportin 1 on native U1 snRNP by cross-linking and mass spectrometry

PubMed Central

Kühn-Hölsken, Eva; Lenz, Christof; Dickmanns, Achim; Hsiao, He-Hsuan; Richter, Florian M.; Kastner, Berthold; Ficner, Ralf; Urlaub, Henning

2010-01-01

Mass spectrometry allows the elucidation of molecular details of the interaction domains of the individual components in macromolecular complexes subsequent to cross-linking of the individual components. Here, we applied chemical and UV cross-linking combined with tandem mass-spectrometric analysis to identify contact sites of the nuclear import adaptor snurportin 1 to the small ribonucleoprotein particle U1 snRNP in addition to the known interaction of m3G cap and snurportin 1. We were able to define previously unknown sites of protein–protein and protein–RNA interactions on the molecular level within U1 snRNP. We show that snurportin 1 interacts with its central m3G-cap-binding domain with Sm proteins and with its extreme C-terminus with stem-loop III of U1 snRNA. The crosslinking data support the idea of a larger interaction area between snurportin 1 and U snRNPs and the contact sites identified prove useful for modeling the spatial arrangement of snurportin 1 domains when bound to U1 snRNP. Moreover, this suggests a functional nuclear import complex that assembles around the m3G cap and the Sm proteins only when the Sm proteins are bound and arranged in the proper orientation to the cognate Sm site in U snRNA. PMID:20421206

Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

PubMed

Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

2017-03-17

Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

PubMed Central

Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2008-01-01

Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

NASA Astrophysics Data System (ADS)

Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

2018-03-01

To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

PubMed

Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

2017-09-01

Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Inhibition of GABA-gated chloride channels by 12,14-dichlorodehydroabietic acid in mammalian brain

PubMed Central

Nicholson, Russell A; Lees, George; Zheng, Jian; Verdon, Bernard

1999-01-01

12,14-dichlorodehydroabietic acid (12,14-Cl2DHA) reduced GABA-stimulated uptake of 36Cl− into mouse brain synaptoneurosomes suggesting inhibition of mammalian GABAA receptor function. 12,14-Cl2DHA did not affect the binding of [3H]-muscimol to brain membranes but displaced specifically bound [3H]-EBOB. The inhibitory effect on [3H]-EBOB binding was not reversible. 12,14-Cl2DHA reduced the availability of [3H]-EBOB binding sites (Bmax) without changing the KD of the radioligand for remaining sites. 12,14-Cl2DHA did not affect the rate of association of [3H]-EBOB with its chloride channel receptor, but increased the initial rate of [3H]-EBOB dissociation. 12,14-Cl2DHA enhanced the incidence of EPSCs when rapidly applied to cultured rat cortical neurones. Longer exposures produced block of IPSCs with marked increases in the frequency of EPSCs and min EPSCs. 12,14-Cl2DHA also irreversibly suppressed chloride currents evoked by pulses of exogenous GABA in these cells. Ultimately, 12,14-Cl2DHA inhibited all synaptic traffic and action currents in current clamped cells indicating that, in contrast to picrotoxinin (which causes paroxysmal bursting), it is not fully selective for the GABAA receptor-chloride channel complex. The depolarizing block seen with 12,14-Cl2DHA in amphotericin-perforated preparations implicates loss of Ca2+ buffering in the polarity change and this may account for inhibition of spontaneous action potentials. Our investigation demonstrates that 12,14-Cl2DHA blocks GABA-dependent chloride entry in mammalian brain and operates as a non-competitive insurmountable GABAA antagonist. The mechanism likely involves either irreversible binding of 12,14-Cl2DHA to the trioxabicyclooctane recognition site or a site that is allosterically coupled to it. We cannot exclude, however, the possibility that 12,14-Cl2DHA causes localized proteolysis or more extensive conformational change within a critical subunit of the chloride channel. PMID:10204999

Catalytic site interactions in yeast OMP synthase.

PubMed

Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

2014-01-15

The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

Single d-metal atoms on F(s) and F(s+) defects of MgO(001): a theoretical study across the periodic table.

PubMed

Neyman, Konstantin M; Inntam, Chan; Matveev, Alexei V; Nasluzov, Vladimir A; Rösch, Notker

2005-08-24

Single d-metal atoms on oxygen defects F(s) and F(s+) of the MgO(001) surface were studied theoretically. We employed an accurate density functional method combined with cluster models, embedded in an elastic polarizable environment, and we applied two gradient-corrected exchange-correlation functionals. In this way, we quantified how 17 metal atoms from groups 6-11 of the periodic table (Cu, Ag, Au; Ni, Pd, Pt; Co, Rh, Ir; Fe, Ru, Os; Mn, Re; and Cr, Mo, W) interact with terrace sites of MgO. We found bonding with F(s) and F(s+) defects to be in general stronger than that with O2- sites, except for Mn-, Re-, and Fe/F(s) complexes. In M/F(s) systems, electron density is accumulated on the metal center in a notable fashion. The binding energy on both kinds of O defects increases from 3d- to 4d- to 5d-atoms of a given group, at variance with the binding energy trend established earlier for the M/O2- complexes, 4d < 3d < 5d. Regarding the evolution of the binding energy along a period, group 7 atoms are slightly destabilized compared to their group 6 congeners in both the F(s) and F(s+) complexes; for later transition elements, the binding energy increases gradually up to group 10 and finally decreases again in group 11, most strongly on the F(s) site. This trend is governed by the negative charge on the adsorbed atoms. We discuss implications for an experimental detection of metal atoms on oxide supports based on computed core-level energies.