Sample records for binding sites based

  1. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  2. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  3. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  4. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  5. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  6. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  8. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  9. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  10. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fagan, Patricia A.

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

  11. Chelate effects in sulfate binding by amide/urea-based ligands.

    PubMed

    Jia, Chuandong; Wang, Qi-Qiang; Begum, Rowshan Ara; Day, Victor W; Bowman-James, Kristin

    2015-07-07

    The influence of chelate and mini-chelate effects on sulfate binding was explored for six amide-, amide/amine-, urea-, and urea/amine-based ligands. Two of the urea-based hosts were selective for SO4(2-) in water-mixed DMSO-d6 systems. Results indicated that the mini-chelate effect provided by a single urea group with two NH binding sites appears to provide enhanced binding over two amide groups. Furthermore, additional urea binding sites incorporated into the host framework appeared to overcome to some extent competing hydration effects with increasing water content.

  12. Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

    PubMed Central

    Jayasena, S D; Johnston, B H

    1992-01-01

    tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

  13. A web server for analysis, comparison and prediction of protein ligand binding sites.

    PubMed

    Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

    2016-03-25

    One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

  14. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  15. Exploring the free-energy landscape of carbohydrate-protein complexes: development and validation of scoring functions considering the binding-site topology

    NASA Astrophysics Data System (ADS)

    Eid, Sameh; Saleh, Noureldin; Zalewski, Adam; Vedani, Angelo

    2014-12-01

    Carbohydrates play a key role in a variety of physiological and pathological processes and, hence, represent a rich source for the development of novel therapeutic agents. Being able to predict binding mode and binding affinity is an essential, yet lacking, aspect of the structure-based design of carbohydrate-based ligands. We assembled a diverse data set comprising 273 carbohydrate-protein crystal structures with known binding affinity and evaluated the prediction accuracy of a large collection of well-established scoring and free-energy functions, as well as combinations thereof. Unfortunately, the tested functions were not capable of reproducing binding affinities in the studied complexes. To simplify the complex free-energy surface of carbohydrate-protein systems, we classified the studied proteins according to the topology and solvent exposure of the carbohydrate-binding site into five distinct categories. A free-energy model based on the proposed classification scheme reproduced binding affinities in the carbohydrate data set with an r 2 of 0.71 and root-mean-squared-error of 1.25 kcal/mol ( N = 236). The improvement in model performance underlines the significance of the differences in the local micro-environments of carbohydrate-binding sites and demonstrates the usefulness of calibrating free-energy functions individually according to binding-site topology and solvent exposure.

  16. Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

    PubMed

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-04-01

    Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

  17. Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

    PubMed Central

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-01-01

    Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

  18. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  19. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  20. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  1. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  2. Discovery of Novel Nonactive Site Inhibitors of the Prothrombinase Enzyme Complex.

    PubMed

    Kapoor, Karan; McGill, Nicole; Peterson, Cynthia B; Meyers, Harold V; Blackburn, Michael N; Baudry, Jerome

    2016-03-28

    The risk of serious bleeding is a major liability of anticoagulant drugs that are active-site competitive inhibitors targeting the Factor Xa (FXa) prothrombin (PT) binding site. The present work identifies several new classes of small molecule anticoagulants that can act as nonactive site inhibitors of the prothrombinase (PTase) complex composed of FXa and Factor Va (FVa). These new classes of anticoagulants were identified, using a novel agnostic computational approach to identify previously unrecognized binding pockets at the FXa-FVa interface. From about three million docking calculations of 281,128 compounds in a conformational ensemble of FXa heavy chains identified by molecular dynamics (MD) simulations, 97 compounds and their structural analogues were selected for experimental validation, through a series of inhibition assays. The compound selection was based on their predicted binding affinities to FXa and their ability to successfully bind to multiple protein conformations while showing selectivity for particular binding sites at the FXa/FVa interface. From these, thirty-one (31) compounds were experimentally identified as nonactive site inhibitors. Concentration-based assays further identified 10 compounds represented by four small-molecule families of inhibitors that achieve dose-independent partial inhibition of PTase activity in a nonactive site-dependent and self-limiting mechanism. Several compounds were identified for their ability to bind to protein conformations only seen during MD, highlighting the importance of accounting for protein flexibility in structure-based drug discovery approaches.

  3. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  4. DeepSite: protein-binding site predictor using 3D-convolutional neural networks.

    PubMed

    Jiménez, J; Doerr, S; Martínez-Rosell, G; Rose, A S; De Fabritiis, G

    2017-10-01

    An important step in structure-based drug design consists in the prediction of druggable binding sites. Several algorithms for detecting binding cavities, those likely to bind to a small drug compound, have been developed over the years by clever exploitation of geometric, chemical and evolutionary features of the protein. Here we present a novel knowledge-based approach that uses state-of-the-art convolutional neural networks, where the algorithm is learned by examples. In total, 7622 proteins from the scPDB database of binding sites have been evaluated using both a distance and a volumetric overlap approach. Our machine-learning based method demonstrates superior performance to two other competitive algorithmic strategies. DeepSite is freely available at www.playmolecule.org. Users can submit either a PDB ID or PDB file for pocket detection to our NVIDIA GPU-equipped servers through a WebGL graphical interface. gianni.defabritiis@upf.edu. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  5. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  6. Binding-Site Assessment by Virtual Fragment Screening

    PubMed Central

    Huang, Niu; Jacobson, Matthew P.

    2010-01-01

    The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules) would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock ∼11000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors. PMID:20404926

  7. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  8. Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

    PubMed

    Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

    2009-04-01

    Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

  9. DNA binding sites characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, Alexandre; Vallverdu, Montserrat; Claria, Francesc; Soria, José Manuel; Caminal, Pere

    2006-01-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measure such as Renyi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency based Renyi measures. Results are reported in this manuscript comparing transition frequencies (i.e. dinucelotides) and base frequencies for Shannon and parametric Renyi for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that, for the evaluated datasets, the information provided by both approaches is not redundant, as they evolve differently under increasing Renyi orders.

  10. Cryptic binding sites on proteins: definition, detection, and druggability.

    PubMed

    Vajda, Sandor; Beglov, Dmitri; Wakefield, Amanda E; Egbert, Megan; Whitty, Adrian

    2018-05-22

    Many proteins in their unbound structures lack surface pockets appropriately sized for drug binding. Hence, a variety of experimental and computational tools have been developed for the identification of cryptic sites that are not evident in the unbound protein but form upon ligand binding, and can provide tractable drug target sites. The goal of this review is to discuss the definition, detection, and druggability of such sites, and their potential value for drug discovery. Novel methods based on molecular dynamics simulations are particularly promising and yield a large number of transient pockets, but it has been shown that only a minority of such sites are generally capable of binding ligands with substantial affinity. Based on recent studies, current methodology can be improved by combining molecular dynamics with fragment docking and machine learning approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Analysis of factors influencing hydration site prediction based on molecular dynamics simulations.

    PubMed

    Yang, Ying; Hu, Bingjie; Lill, Markus A

    2014-10-27

    Water contributes significantly to the binding of small molecules to proteins in biochemical systems. Molecular dynamics (MD) simulation based programs such as WaterMap and WATsite have been used to probe the locations and thermodynamic properties of hydration sites at the surface or in the binding site of proteins generating important information for structure-based drug design. However, questions associated with the influence of the simulation protocol on hydration site analysis remain. In this study, we use WATsite to investigate the influence of factors such as simulation length and variations in initial protein conformations on hydration site prediction. We find that 4 ns MD simulation is appropriate to obtain a reliable prediction of the locations and thermodynamic properties of hydration sites. In addition, hydration site prediction can be largely affected by the initial protein conformations used for MD simulations. Here, we provide a first quantification of this effect and further indicate that similar conformations of binding site residues (RMSD < 0.5 Å) are required to obtain consistent hydration site predictions.

  12. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  13. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  14. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  15. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  16. A rigorous multiple independent binding site model for determining cell-based equilibrium dissociation constants.

    PubMed

    Drake, Andrew W; Klakamp, Scott L

    2007-01-10

    A new 4-parameter nonlinear equation based on the standard multiple independent binding site model (MIBS) is presented for fitting cell-based ligand titration data in order to calculate the ligand/cell receptor equilibrium dissociation constant and the number of receptors/cell. The most commonly used linear (Scatchard Plot) or nonlinear 2-parameter model (a single binding site model found in commercial programs like Prism(R)) used for analysis of ligand/receptor binding data assumes only the K(D) influences the shape of the titration curve. We demonstrate using simulated data sets that, depending upon the cell surface receptor expression level, the number of cells titrated, and the magnitude of the K(D) being measured, this assumption of always being under K(D)-controlled conditions can be erroneous and can lead to unreliable estimates for the binding parameters. We also compare and contrast the fitting of simulated data sets to the commonly used cell-based binding equation versus our more rigorous 4-parameter nonlinear MIBS model. It is shown through these simulations that the new 4-parameter MIBS model, when used for cell-based titrations under optimal conditions, yields highly accurate estimates of all binding parameters and hence should be the preferred model to fit cell-based experimental nonlinear titration data.

  17. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  18. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  19. Designing of MIP based QCM sensor having thymine recognition sites based on biomimicking DNA approach.

    PubMed

    Diltemiz, S Emir; Hür, D; Ersöz, A; Denizli, A; Say, R

    2009-11-15

    Quartz crystal microbalance (QCM) sensors coated with molecular imprinted polymers (MIP) have been developed for the determination of thymine. In this method, methacryloylamidoadenine (MA-Ade) have used as a new monomer and thymine template for inspiration of DNA nucleobases interaction. The thymine can be simultaneously hydrogen binding to MA-Ade and fit into the shape-selective cavities. Thus, the interaction between nucleobases has an effect on the binding ability of the QCM sensors. The binding affinity of the thymine imprinted sensors has investigated by using the Langmuir isotherm. The thymine imprinted QCM electrodes have shown homogeneous binding sites for thymine (K(a): 1.0 x 10(5)M(-1)) while heterogeneous binding sites for uracil. On the other hand, recognition selectivity of the QCM sensor based on thymine imprinted polymer toward to uracil, ssDNA and ssRNA has been reported in this work.

  20. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  1. Evaluation of a novel virtual screening strategy using receptor decoy binding sites.

    PubMed

    Patel, Hershna; Kukol, Andreas

    2016-08-23

    Virtual screening is used in biomedical research to predict the binding affinity of a large set of small organic molecules to protein receptor targets. This report shows the development and evaluation of a novel yet straightforward attempt to improve this ranking in receptor-based molecular docking using a receptor-decoy strategy. This strategy includes defining a decoy binding site on the receptor and adjusting the ranking of the true binding-site virtual screen based on the decoy-site screen. The results show that by docking against a receptor-decoy site with Autodock Vina, improved Receiver Operator Characteristic Enrichment (ROCE) was achieved for 5 out of fifteen receptor targets investigated, when up to 15 % of a decoy site rank list was considered. No improved enrichment was seen for 7 targets, while for 3 targets the ROCE was reduced. The extent to which this strategy can effectively improve ligand prediction is dependent on the target receptor investigated.

  2. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  3. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Detecting cis-regulatory binding sites for cooperatively binding proteins

    PubMed Central

    van Oeffelen, Liesbeth; Cornelis, Pierre; Van Delm, Wouter; De Ridder, Fedor; De Moor, Bart; Moreau, Yves

    2008-01-01

    Several methods are available to predict cis-regulatory modules in DNA based on position weight matrices. However, the performance of these methods generally depends on a number of additional parameters that cannot be derived from sequences and are difficult to estimate because they have no physical meaning. As the best way to detect cis-regulatory modules is the way in which the proteins recognize them, we developed a new scoring method that utilizes the underlying physical binding model. This method requires no additional parameter to account for multiple binding sites; and the only necessary parameters to model homotypic cooperative interactions are the distances between adjacent protein binding sites in basepairs, and the corresponding cooperative binding constants. The heterotypic cooperative binding model requires one more parameter per cooperatively binding protein, which is the concentration multiplied by the partition function of this protein. In a case study on the bacterial ferric uptake regulator, we show that our scoring method for homotypic cooperatively binding proteins significantly outperforms other PWM-based methods where biophysical cooperativity is not taken into account. PMID:18400778

  5. Binding Sites Analyser (BiSA): Software for Genomic Binding Sites Archiving and Overlap Analysis

    PubMed Central

    Khushi, Matloob; Liddle, Christopher; Clarke, Christine L.; Graham, J. Dinny

    2014-01-01

    Genome-wide mapping of transcription factor binding and histone modification reveals complex patterns of interactions. Identifying overlaps in binding patterns by different factors is a major objective of genomic studies, but existing methods to archive large numbers of datasets in a personalised database lack sophistication and utility. Therefore we have developed transcription factor DNA binding site analyser software (BiSA), for archiving of binding regions and easy identification of overlap with or proximity to other regions of interest. Analysis results can be restricted by chromosome or base pair overlap between regions or maximum distance between binding peaks. BiSA is capable of reporting overlapping regions that share common base pairs; regions that are nearby; regions that are not overlapping; and average region sizes. BiSA can identify genes located near binding regions of interest, genomic features near a gene or locus of interest and statistical significance of overlapping regions can also be reported. Overlapping results can be visualized as Venn diagrams. A major strength of BiSA is that it is supported by a comprehensive database of publicly available transcription factor binding sites and histone modifications, which can be directly compared to user data. The documentation and source code are available on http://bisa.sourceforge.net PMID:24533055

  6. Recognizing metal and acid radical ion-binding sites by integrating ab initio modeling with template-based transferals.

    PubMed

    Hu, Xiuzhen; Dong, Qiwen; Yang, Jianyi; Zhang, Yang

    2016-11-01

    More than half of proteins require binding of metal and acid radical ions for their structure and function. Identification of the ion-binding locations is important for understanding the biological functions of proteins. Due to the small size and high versatility of the metal and acid radical ions, however, computational prediction of their binding sites remains difficult. We proposed a new ligand-specific approach devoted to the binding site prediction of 13 metal ions (Zn 2+ , Cu 2+ , Fe 2+ , Fe 3+ , Ca 2+ , Mg 2+ , Mn 2+ , Na + , K + ) and acid radical ion ligands (CO3 2- , NO2 - , SO4 2- , PO4 3- ) that are most frequently seen in protein databases. A sequence-based ab initio model is first trained on sequence profiles, where a modified AdaBoost algorithm is extended to balance binding and non-binding residue samples. A composite method IonCom is then developed to combine the ab initio model with multiple threading alignments for further improving the robustness of the binding site predictions. The pipeline was tested using 5-fold cross validations on a comprehensive set of 2,100 non-redundant proteins bound with 3,075 small ion ligands. Significant advantage was demonstrated compared with the state of the art ligand-binding methods including COACH and TargetS for high-accuracy ion-binding site identification. Detailed data analyses show that the major advantage of IonCom lies at the integration of complementary ab initio and template-based components. Ion-specific feature design and binding library selection also contribute to the improvement of small ion ligand binding predictions. http://zhanglab.ccmb.med.umich.edu/IonCom CONTACT: hxz@imut.edu.cn or zhng@umich.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Aalberts, Daniel P.; Garland, Jeffrey A.

    2004-03-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  8. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  9. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  10. Analysis of Factors Influencing Hydration Site Prediction Based on Molecular Dynamics Simulations

    PubMed Central

    2015-01-01

    Water contributes significantly to the binding of small molecules to proteins in biochemical systems. Molecular dynamics (MD) simulation based programs such as WaterMap and WATsite have been used to probe the locations and thermodynamic properties of hydration sites at the surface or in the binding site of proteins generating important information for structure-based drug design. However, questions associated with the influence of the simulation protocol on hydration site analysis remain. In this study, we use WATsite to investigate the influence of factors such as simulation length and variations in initial protein conformations on hydration site prediction. We find that 4 ns MD simulation is appropriate to obtain a reliable prediction of the locations and thermodynamic properties of hydration sites. In addition, hydration site prediction can be largely affected by the initial protein conformations used for MD simulations. Here, we provide a first quantification of this effect and further indicate that similar conformations of binding site residues (RMSD < 0.5 Å) are required to obtain consistent hydration site predictions. PMID:25252619

  11. Discovery of d-amino acid oxidase inhibitors based on virtual screening against the lid-open enzyme conformation.

    PubMed

    Szilágyi, Bence; Skok, Žiga; Rácz, Anita; Frlan, Rok; Ferenczy, György G; Ilaš, Janez; Keserű, György M

    2018-06-01

    d-Amino acid oxidase (DAAO) inhibitors are typically small polar compounds with often suboptimal pharmacokinetic properties. Features of the native binding site limit the operational freedom of further medicinal chemistry efforts. We therefore initiated a structure based virtual screening campaign based on the X-ray structures of DAAO complexes where larger ligands shifted the loop (lid opening) covering the native binding site. The virtual screening of our in-house collection followed by the in vitro test of the best ranked compounds led to the identification of a new scaffold with micromolar IC 50 . Subsequent SAR explorations enabled us to identify submicromolar inhibitors. Docking studies supported by in vitro activity measurements suggest that compounds bind to the active site with a salt-bridge characteristic to DAAO inhibitor binding. In addition, displacement of and interaction with the loop covering the active site contributes significantly to the activity of the most potent compounds. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  13. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  14. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  15. Activity-Based Probes for Isoenzyme- and Site-Specific Functional Characterization of Glutathione S -Transferases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoddard, Ethan G.; Killinger, Bryan J.; Nair, Reji N.

    Glutathione S-transferases (GSTs) comprise a highly diverse family of phase II drug metabolizing enzymes whose shared function is the conjugation of reduced glutathione to various endo- and xenobiotics. Although the conglomerate activity of these enzymes can be measured by colorimetric assays, measurement of the individual contribution from specific isoforms and their contribution to the detoxification of xenobiotics in complex biological samples has not been possible. For this reason, we have developed two activity-based probes that characterize active glutathione transferases in mammalian tissues. The GST active site is comprised of a glutathione binding “G site” and a distinct substrate binding “Hmore » site”. Therefore, we developed (1) a glutathione-based photoaffinity probe (GSH-ABP) to target the “G site”, and (2) a probe designed to mimic a substrate molecule and show “H site” activity (GST-ABP). The GSH-ABP features a photoreactive moiety for UV-induced covalent binding to GSTs and glutathione-binding enzymes. The GST-ABP is a derivative of a known mechanism-based GST inhibitor that binds within the active site and inhibits GST activity. Validation of probe targets and “G” and “H” site specificity was carried out using a series of competitors in liver homogenates. Herein, we present robust tools for the novel characterization of enzyme- and active site-specific GST activity in mammalian model systems.« less

  16. Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.

    PubMed

    Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O

    2010-08-01

    Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.

  17. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  18. Fragment-based screen against HIV protease.

    PubMed

    Perryman, Alexander L; Zhang, Qing; Soutter, Holly H; Rosenfeld, Robin; McRee, Duncan E; Olson, Arthur J; Elder, John E; Stout, C David

    2010-03-01

    We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 A resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the 'exo site' adjacent to the Gly(16)Gly(17)Gln(18)loop where the amide of Gly(17)is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys(14)and Leu(63). Another fragment, indole-6-carboxylic acid, binds on the 'outside/top of the flap' via hydrophobic contacts with Trp(42), Pro(44), Met(46), and Lys(55), a hydrogen bond with Val(56), and a salt-bridge with Arg(57). 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target.

  19. Mojo Hand, a TALEN design tool for genome editing applications.

    PubMed

    Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C

    2013-01-16

    Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.

  20. Thermodynamic Characterization of Hydration Sites from Integral Equation-Derived Free Energy Densities: Application to Protein Binding Sites and Ligand Series.

    PubMed

    Güssregen, Stefan; Matter, Hans; Hessler, Gerhard; Lionta, Evanthia; Heil, Jochen; Kast, Stefan M

    2017-07-24

    Water molecules play an essential role for mediating interactions between ligands and protein binding sites. Displacement of specific water molecules can favorably modulate the free energy of binding of protein-ligand complexes. Here, the nature of water interactions in protein binding sites is investigated by 3D RISM (three-dimensional reference interaction site model) integral equation theory to understand and exploit local thermodynamic features of water molecules by ranking their possible displacement in structure-based design. Unlike molecular dynamics-based approaches, 3D RISM theory allows for fast and noise-free calculations using the same detailed level of solute-solvent interaction description. Here we correlate molecular water entities instead of mere site density maxima with local contributions to the solvation free energy using novel algorithms. Distinct water molecules and hydration sites are investigated in multiple protein-ligand X-ray structures, namely streptavidin, factor Xa, and factor VIIa, based on 3D RISM-derived free energy density fields. Our approach allows the semiquantitative assessment of whether a given structural water molecule can potentially be targeted for replacement in structure-based design. Finally, PLS-based regression models from free energy density fields used within a 3D-QSAR approach (CARMa - comparative analysis of 3D RISM Maps) are shown to be able to extract relevant information for the interpretation of structure-activity relationship (SAR) trends, as demonstrated for a series of serine protease inhibitors.

  1. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Sequence-Based Prediction of RNA-Binding Residues in Proteins.

    PubMed

    Walia, Rasna R; El-Manzalawy, Yasser; Honavar, Vasant G; Dobbs, Drena

    2017-01-01

    Identifying individual residues in the interfaces of protein-RNA complexes is important for understanding the molecular determinants of protein-RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein-RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein-RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner.

  3. Sequence-Based Prediction of RNA-Binding Residues in Proteins

    PubMed Central

    Walia, Rasna R.; EL-Manzalawy, Yasser; Honavar, Vasant G.; Dobbs, Drena

    2017-01-01

    Identifying individual residues in the interfaces of protein–RNA complexes is important for understanding the molecular determinants of protein–RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein–RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein–RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner. PMID:27787829

  4. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  5. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  6. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

    PubMed

    Schneider, T D

    2001-12-01

    The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

  7. Identification of metal ion binding sites based on amino acid sequences

    PubMed Central

    Cao, Xiaoyong; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

    2017-01-01

    The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html. PMID:28854211

  8. Identification of metal ion binding sites based on amino acid sequences.

    PubMed

    Cao, Xiaoyong; Hu, Xiuzhen; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

    2017-01-01

    The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html.

  9. Dissecting Orthosteric Contacts for a Reverse-Fragment-Based Ligand Design.

    PubMed

    Chandramohan, Arun; Tulsian, Nikhil K; Anand, Ganesh S

    2017-08-01

    Orthosteric sites on proteins are formed typically from noncontiguous interacting sites in three-dimensional space where the composite binding interaction of a biological ligand is mediated by multiple synergistic interactions of its constituent functional groups. Through these multiple interactions, ligands stabilize both the ligand binding site and the local secondary structure. However, relative energetic contributions of the individual contacts in these protein-ligand interactions are difficult to resolve. Deconvolution of the contributions of these various functional groups in natural inhibitors/ligand would greatly aid in iterative fragment-based drug discovery (FBDD). In this study, we describe an approach of progressive unfolding of a target protein using a gradient of denaturant urea to reveal the individual energetic contributions of various ligand-functional groups to the affinity of the entire ligand. Through calibrated unfolding of two protein-ligand systems: cAMP-bound regulatory subunit of Protein Kinase A (RIα) and IBMX-bound phosphodiesterase8 (PDE8), monitored by amide hydrogen-deuterium exchange mass spectrometry, we show progressive disruption of individual orthosteric contacts in the ligand binding sites, allowing us to rank the energetic contributions of these individual interactions. In the two cAMP-binding sites of RIα, exocyclic phosphate oxygens of cAMP were identified to mediate stronger interactions than ribose 2'-OH in both the RIα-cAMP binding interfaces. Further, we have also ranked the relative contributions of the different functional groups of IBMX based on their interactions with the orthosteric residues of PDE8. This strategy for deconstruction of individual binding sites and identification of the strongest functional group interaction in enzyme orthosteric sites offers a rational starting point for FBDD.

  10. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  11. Prediction of Ordered Water Molecules in Protein Binding Sites from Molecular Dynamics Simulations: The Impact of Ligand Binding on Hydration Networks.

    PubMed

    Rudling, Axel; Orro, Adolfo; Carlsson, Jens

    2018-02-26

    Water plays a major role in ligand binding and is attracting increasing attention in structure-based drug design. Water molecules can make large contributions to binding affinity by bridging protein-ligand interactions or by being displaced upon complex formation, but these phenomena are challenging to model at the molecular level. Herein, networks of ordered water molecules in protein binding sites were analyzed by clustering of molecular dynamics (MD) simulation trajectories. Locations of ordered waters (hydration sites) were first identified from simulations of high resolution crystal structures of 13 protein-ligand complexes. The MD-derived hydration sites reproduced 73% of the binding site water molecules observed in the crystal structures. If the simulations were repeated without the cocrystallized ligands, a majority (58%) of the crystal waters in the binding sites were still predicted. In addition, comparison of the hydration sites obtained from simulations carried out in the absence of ligands to those identified for the complexes revealed that the networks of ordered water molecules were preserved to a large extent, suggesting that the locations of waters in a protein-ligand interface are mainly dictated by the protein. Analysis of >1000 crystal structures showed that hydration sites bridged protein-ligand interactions in complexes with different ligands, and those with high MD-derived occupancies were more likely to correspond to experimentally observed ordered water molecules. The results demonstrate that ordered water molecules relevant for modeling of protein-ligand complexes can be identified from MD simulations. Our findings could contribute to development of improved methods for structure-based virtual screening and lead optimization.

  12. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  13. Experimental determination and modeling of arsenic complexation with humic and fulvic acids.

    PubMed

    Fakour, Hoda; Lin, Tsair-Fuh

    2014-08-30

    The complexation of humic acid (HA) and fulvic acid (FA) with arsenic (As) in water was studied. Experimental results indicate that arsenic may form complexes with HA and FA with a higher affinity for arsenate than for arsenite. With the presence of iron oxide based adsorbents, binding of arsenic to HA/FA in water was significantly suppressed, probably due to adsorption of As and HA/FA. A two-site ligand binding model, considering only strong and weak site types of binding affinity, was successfully developed to describe the complexation of arsenic on the two natural organic fractions. The model showed that the numbers of weak sites were more than 10 times those of strong sites on both HA and FA for both arsenic species studied. The numbers of both types of binding sites were found to be proportional to the HA concentrations, while the apparent stability constants, defined for describing binding affinity between arsenic and the sites, are independent of the HA concentrations. To the best of our knowledge, this is the first study to characterize the impact of HA concentrations on the applicability of the ligand binding model, and to extrapolate the model to FA. The obtained results may give insights on the complexation of arsenic in HA/FA laden groundwater and on the selection of more effective adsorption-based treatment methods for natural waters. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  15. Investigation of copper(II) binding to the protein precursor of Non-Amyloid-Beta Component of Alzheimer Disease Amyloid Plaque

    NASA Astrophysics Data System (ADS)

    Rose, Francis; Hodak, Miroslav; Bernholc, Jerry

    2007-03-01

    The Non-Amyloid-Beta Component Precursor (NACP) is a natively unfolded synaptic protein that is implicated in Alzheimers and Parkinsons diseases. Its aggregation into fibrillar structures is accelerated by the binding of copper(II). Experimental studies suggest that the dominant copper binding site is located at the histidine residue in NACP. Based on this evidence we assembled a model fragment of the binding site and used DFT to analyze the conformational details of the most probable binding motifs. We investigated the overall conformational effects with classical MD by constraining the copper binding site to the most energetically favorable geometry obtained from the DFT calculations. These results are compared and contrasted with those of the unbound NACP.

  16. Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

    PubMed

    DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

    2003-07-08

    Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

  17. Simultaneous fluorescence light-up and selective multicolor nucleobase recognition based on sequence-dependent strong binding of berberine to DNA abasic site.

    PubMed

    Wu, Fei; Shao, Yong; Ma, Kun; Cui, Qinghua; Liu, Guiying; Xu, Shujuan

    2012-04-28

    Label-free DNA nucleobase recognition by fluorescent small molecules has received much attention due to its simplicity in mutation identification and drug screening. However, sequence-dependent fluorescence light-up nucleobase recognition and multicolor emission with individual emission energy for individual nucleobases have been seldom realized. Herein, an abasic site (AP site) in a DNA duplex was employed as a binding field for berberine, one of isoquinoline alkaloids. Unlike weak binding of berberine to the fully matched DNAs without the AP site, strong binding of berberine to the AP site occurs and the berberine's fluorescence light-up behaviors are highly dependent on the target nucleobases opposite the AP site in which the targets thymine and cytosine produce dual emission bands, while the targets guanine and adenine only give a single emission band. Furthermore, more intense emissions are observed for the target pyrimidines than purines. The flanking bases of the AP site also produce some modifications of the berberine's emission behavior. The binding selectivity of berberine at the AP site is also confirmed by measurements of fluorescence resonance energy transfer, excited-state lifetime, DNA melting and fluorescence quenching by ferrocyanide and sodium chloride. It is expected that the target pyrimidines cause berberine to be stacked well within DNA base pairs near the AP site, which results in a strong resonance coupling of the electronic transitions to the particular vibration mode to produce the dual emissions. The fluorescent signal-on and emission energy-modulated sensing for nucleobases based on this fluorophore is substantially advantageous over the previously used fluorophores. We expect that this approach will be developed as a practical device for differentiating pyrimidines from purines by positioning an AP site toward a target that is available for readout by this alkaloid probe. This journal is © The Royal Society of Chemistry 2012

  18. Sugar-binding sites of the HA1 subcomponent of Clostridium botulinum type C progenitor toxin.

    PubMed

    Nakamura, Toshio; Tonozuka, Takashi; Ide, Azusa; Yuzawa, Takayuki; Oguma, Keiji; Nishikawa, Atsushi

    2008-02-22

    Clostridium botulinum type C 16S progenitor toxin contains a hemagglutinin (HA) subcomponent, designated HA1, which appears to play an important role in the effective internalization of the toxin in gastrointestinal epithelial cells and in creating a broad specificity for the oligosaccharide structure that corresponds to various targets. In this study, using the recombinant protein fused to glutathione S-transferase, we investigated the binding specificity of the HA1 subcomponent to sugars and estimated the binding sites of HA1 based on X-ray crystallography and soaking experiments using various sugars. N-Acetylneuraminic acid, N-acetylgalactosamine, and galactose effectively inhibited the binding that occurs between glutathione S-transferase-HA1 and mucins, whereas N-acetylglucosamine and glucose did not inhibit it. The crystal structures of HA1 complex with N-acetylneuraminic acid, N-acetylgalactosamine, and galactose were also determined. There are two sugar-binding sites, sites I and II. Site I corresponds to the electron densities noted for all sugars and is located at the C-terminal beta-trefoil domain, while site II corresponds to the electron densities noted only for galactose. An aromatic amino acid residue, Trp176, at site I has a stacking interaction with the hexose ring of the sugars. On the other hand, there is no aromatic residue at site II; thus, the interaction with galactose seems to be poor. The double mutant W176A at site I and D271F at site II has no avidity for N-acetylneuraminic acid but has avidity for galactose. In this report, the binding specificity of botulinum C16S toxin HA1 to various sugars is demonstrated based on its structural features.

  19. Coordination of two sequential ester-transfer reactions: exogenous guanosine binding promotes the subsequent ωG binding to a group I intron

    PubMed Central

    Bao, Penghui; Wu, Qi-Jia; Yin, Ping; Jiang, Yanfei; Wang, Xu; Xie, Mao-Hua; Sun, Tao; Huang, Lin; Mo, Ding-Ding; Zhang, Yi

    2008-01-01

    Self-splicing of group I introns is accomplished by two sequential ester-transfer reactions mediated by sequential binding of two different guanosine ligands, but it is yet unclear how the binding is coordinated at a single G-binding site. Using a three-piece trans-splicing system derived from the Candida intron, we studied the effect of the prior GTP binding on the later ωG binding by assaying the ribozyme activity in the second reaction. We showed that adding GTP simultaneously with and prior to the esterified ωG in a substrate strongly accelerated the second reaction, suggesting that the early binding of GTP facilitates the subsequent binding of ωG. GTP-mediated facilitation requires C2 amino and C6 carbonyl groups on the Watson–Crick edge of the base but not the phosphate or sugar groups, suggesting that the base triple interactions between GTP and the binding site are important for the subsequent ωG binding. Strikingly, GTP binding loosens a few local structures of the ribozyme including that adjacent to the base triple, providing structural basis for a rapid exchange of ωG for bound GTP. PMID:18978026

  20. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  1. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  2. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  3. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  4. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  6. Nicotinamide Cofactors Suppress Active-Site Labeling of Aldehyde Dehydrogenases.

    PubMed

    Stiti, Naim; Chandrasekar, Balakumaran; Strubl, Laura; Mohammed, Shabaz; Bartels, Dorothea; van der Hoorn, Renier A L

    2016-06-17

    Active site labeling by (re)activity-based probes is a powerful chemical proteomic tool to globally map active sites in native proteomes without using substrates. Active site labeling is usually taken as a readout for the active state of the enzyme because labeling reflects the availability and reactivity of active sites, which are hallmarks for enzyme activities. Here, we show that this relationship holds tightly, but we also reveal an important exception to this rule. Labeling of Arabidopsis ALDH3H1 with a chloroacetamide probe occurs at the catalytic Cys, and labeling is suppressed upon nitrosylation and oxidation, and upon treatment with other Cys modifiers. These experiments display a consistent and strong correlation between active site labeling and enzymatic activity. Surprisingly, however, labeling is suppressed by the cofactor NAD(+), and this property is shared with other members of the ALDH superfamily and also detected for unrelated GAPDH enzymes with an unrelated hydantoin-based probe in crude extracts of plant cell cultures. Suppression requires cofactor binding to its binding pocket. Labeling is also suppressed by ALDH modulators that bind at the substrate entrance tunnel, confirming that labeling occurs through the substrate-binding cavity. Our data indicate that cofactor binding adjusts the catalytic Cys into a conformation that reduces the reactivity toward chloroacetamide probes.

  7. Specific minor groove solvation is a crucial determinant of DNA binding site recognition

    PubMed Central

    Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

    2014-01-01

    The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

  8. A new design for a green calcium indicator with a smaller size and a reduced number of calcium-binding sites

    PubMed Central

    Barykina, Natalia V.; Subach, Oksana M.; Doronin, Danila A.; Sotskov, Vladimir P.; Roshchina, Marina A.; Kunitsyna, Tatiana A.; Malyshev, Aleksey Y.; Smirnov, Ivan V.; Azieva, Asya M.; Sokolov, Ilya S.; Piatkevich, Kiryl D.; Burtsev, Mikhail S.; Varizhuk, Anna M.; Pozmogova, Galina E.; Anokhin, Konstantin V.; Subach, Fedor V.; Enikolopov, Grigori N.

    2016-01-01

    Genetically encoded calcium indicators (GECIs) are mainly represented by two- or one-fluorophore-based sensors. One type of two-fluorophore-based sensor, carrying Opsanus troponin C (TnC) as the Ca2+-binding moiety, has two binding sites for calcium ions, providing a linear response to calcium ions. One-fluorophore-based sensors have four Ca2+-binding sites but are better suited for in vivo experiments. Herein, we describe a novel design for a one-fluorophore-based GECI with two Ca2+-binding sites. The engineered sensor, called NTnC, uses TnC as the Ca2+-binding moiety, inserted in the mNeonGreen fluorescent protein. Monomeric NTnC has higher brightness and pH-stability in vitro compared with the standard GECI GCaMP6s. In addition, NTnC shows an inverted fluorescence response to Ca2+. Using NTnC, we have visualized Ca2+ dynamics during spontaneous activity of neuronal cultures as confirmed by control NTnC and its mutant, in which the affinity to Ca2+ is eliminated. Using whole-cell patch clamp, we have demonstrated that NTnC dynamics in neurons are similar to those of GCaMP6s and allow robust detection of single action potentials. Finally, we have used NTnC to visualize Ca2+ neuronal activity in vivo in the V1 cortical area in awake and freely moving mice using two-photon microscopy or an nVista miniaturized microscope. PMID:27677952

  9. Elucidating the druggable interface of protein-protein interactions using fragment docking and coevolutionary analysis.

    PubMed

    Bai, Fang; Morcos, Faruck; Cheng, Ryan R; Jiang, Hualiang; Onuchic, José N

    2016-12-13

    Protein-protein interactions play a central role in cellular function. Improving the understanding of complex formation has many practical applications, including the rational design of new therapeutic agents and the mechanisms governing signal transduction networks. The generally large, flat, and relatively featureless binding sites of protein complexes pose many challenges for drug design. Fragment docking and direct coupling analysis are used in an integrated computational method to estimate druggable protein-protein interfaces. (i) This method explores the binding of fragment-sized molecular probes on the protein surface using a molecular docking-based screen. (ii) The energetically favorable binding sites of the probes, called hot spots, are spatially clustered to map out candidate binding sites on the protein surface. (iii) A coevolution-based interface interaction score is used to discriminate between different candidate binding sites, yielding potential interfacial targets for therapeutic drug design. This approach is validated for important, well-studied disease-related proteins with known pharmaceutical targets, and also identifies targets that have yet to be studied. Moreover, therapeutic agents are proposed by chemically connecting the fragments that are strongly bound to the hot spots.

  10. Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

    PubMed

    Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

    2012-06-01

    DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  12. Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

    PubMed Central

    Wozniak, Christopher E.; Hughes, Kelly T.

    2008-01-01

    Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

  13. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  14. Simplified biased random walk model for RecA-protein-mediated homology recognition offers rapid and accurate self-assembly of long linear arrays of binding sites

    NASA Astrophysics Data System (ADS)

    Kates-Harbeck, Julian; Tilloy, Antoine; Prentiss, Mara

    2013-07-01

    Inspired by RecA-protein-based homology recognition, we consider the pairing of two long linear arrays of binding sites. We propose a fully reversible, physically realizable biased random walk model for rapid and accurate self-assembly due to the spontaneous pairing of matching binding sites, where the statistics of the searched sample are included. In the model, there are two bound conformations, and the free energy for each conformation is a weakly nonlinear function of the number of contiguous matched bound sites.

  15. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  16. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  17. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    PubMed Central

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  18. The good, the bad and the dubious: VHELIBS, a validation helper for ligands and binding sites

    PubMed Central

    2013-01-01

    Background Many Protein Data Bank (PDB) users assume that the deposited structural models are of high quality but forget that these models are derived from the interpretation of experimental data. The accuracy of atom coordinates is not homogeneous between models or throughout the same model. To avoid basing a research project on a flawed model, we present a tool for assessing the quality of ligands and binding sites in crystallographic models from the PDB. Results The Validation HElper for LIgands and Binding Sites (VHELIBS) is software that aims to ease the validation of binding site and ligand coordinates for non-crystallographers (i.e., users with little or no crystallography knowledge). Using a convenient graphical user interface, it allows one to check how ligand and binding site coordinates fit to the electron density map. VHELIBS can use models from either the PDB or the PDB_REDO databank of re-refined and re-built crystallographic models. The user can specify threshold values for a series of properties related to the fit of coordinates to electron density (Real Space R, Real Space Correlation Coefficient and average occupancy are used by default). VHELIBS will automatically classify residues and ligands as Good, Dubious or Bad based on the specified limits. The user is also able to visually check the quality of the fit of residues and ligands to the electron density map and reclassify them if needed. Conclusions VHELIBS allows inexperienced users to examine the binding site and the ligand coordinates in relation to the experimental data. This is an important step to evaluate models for their fitness for drug discovery purposes such as structure-based pharmacophore development and protein-ligand docking experiments. PMID:23895374

  19. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  1. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  2. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

  3. Structural basis for the binding of tryptophan-based motifs by δ-COP

    PubMed Central

    Suckling, Richard J.; Poon, Pak Phi; Travis, Sophie M.; Majoul, Irina V.; Hughson, Frederick M.; Evans, Philip R.; Duden, Rainer; Owen, David J.

    2015-01-01

    Coatomer consists of two subcomplexes: the membrane-targeting, ADP ribosylation factor 1 (Arf1):GTP-binding βγδζ-COP F-subcomplex, which is related to the adaptor protein (AP) clathrin adaptors, and the cargo-binding αβ’ε-COP B-subcomplex. We present the structure of the C-terminal μ-homology domain of the yeast δ-COP subunit in complex with the WxW motif from its binding partner, the endoplasmic reticulum-localized Dsl1 tether. The motif binds at a site distinct from that used by the homologous AP μ subunits to bind YxxΦ cargo motifs with its two tryptophan residues sitting in compatible pockets. We also show that the Saccharomyces cerevisiae Arf GTPase-activating protein (GAP) homolog Gcs1p uses a related WxxF motif at its extreme C terminus to bind to δ-COP at the same site in the same way. Mutations designed on the basis of the structure in conjunction with isothermal titration calorimetry confirm the mode of binding and show that mammalian δ-COP binds related tryptophan-based motifs such as that from ArfGAP1 in a similar manner. We conclude that δ-COP subunits bind Wxn(1–6)[WF] motifs within unstructured regions of proteins that influence the lifecycle of COPI-coated vesicles; this conclusion is supported by the observation that, in the context of a sensitizing domain deletion in Dsl1p, mutating the tryptophan-based motif-binding site in yeast causes defects in both growth and carboxypeptidase Y trafficking/processing. PMID:26578768

  4. Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

    2010-01-01

    The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

  5. Diversity of Cyclic Di-GMP-Binding Proteins and Mechanisms

    PubMed Central

    2015-01-01

    ABSTRACT Cyclic di-GMP (c-di-GMP) synthetases and hydrolases (GGDEF, EAL, and HD-GYP domains) can be readily identified in bacterial genome sequences by using standard bioinformatic tools. In contrast, identification of c-di-GMP receptors remains a difficult task, and the current list of experimentally characterized c-di-GMP-binding proteins is likely incomplete. Several classes of c-di-GMP-binding proteins have been structurally characterized; for some others, the binding sites have been identified; and for several potential c-di-GMP receptors, the binding sites remain to be determined. We present here a comparative structural analysis of c-di-GMP-protein complexes that aims to discern the common themes in the binding mechanisms that allow c-di-GMP receptors to bind it with (sub)micromolar affinities despite the 1,000-fold excess of GTP. The available structures show that most receptors use their Arg and Asp/Glu residues to bind c-di-GMP monomers, dimers, or tetramers with stacked guanine bases. The only exception is the EAL domains that bind c-di-GMP monomers in an extended conformation. We show that in c-di-GMP-binding signature motifs, Arg residues bind to the O-6 and N-7 atoms at the Hoogsteen edge of the guanine base, while Asp/Glu residues bind the N-1 and N-2 atoms at its Watson-Crick edge. In addition, Arg residues participate in stacking interactions with the guanine bases of c-di-GMP and the aromatic rings of Tyr and Phe residues. This may account for the presence of Arg residues in the active sites of every receptor protein that binds stacked c-di-GMP. We also discuss the implications of these structural data for the improved understanding of the c-di-GMP signaling mechanisms. PMID:26055114

  6. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  7. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  8. Fast pressure jumps can perturb calcium and magnesium binding to troponin C F29W.

    PubMed

    Pearson, David S; Swartz, Darl R; Geeves, Michael A

    2008-11-18

    We have used rapid pressure jump and stopped-flow fluorometry to investigate calcium and magnesium binding to F29W chicken skeletal troponin C. Increased pressure perturbed calcium binding to the N-terminal sites in the presence and absence of magnesium and provided an estimate for the volume change upon calcium binding (-12 mL/mol). We observed a biphasic response to a pressure change which was characterized by fast and slow reciprocal relaxation times of the order 1000/s and 100/s. Between pCa 8-5.4 and at troponin C concentrations of 8-28 muM, the slow relaxation times were invariant, indicating that a protein isomerization was rate-limiting. The fast event was only detected over a very narrow pCa range (5.6-5.4). We have devised a model based on a Monod-Wyman-Changeux cooperative mechanism with volume changes of -9 and +6 mL/mol for the calcium binding to the regulatory sites and closed to open protein isomerization steps, respectively. In the absence of magnesium, we discovered that calcium binding to the C-terminal sites could be detected, despite their position distal to the calcium-sensitive tryptophan, with a volume change of +25 mL/mol. We used this novel observation to measure competitive magnesium binding to the C-terminal sites and deduced an affinity in the range 200-300 muM (and a volume change of +35 mL/mol). This affinity is an order of magnitude tighter than equilibrium fluorescence data suggest based on a model of direct competitive binding. Magnesium thus indirectly modulates binding to the N-terminal sites, which may act as a fine-tuning mechanism in vivo.

  9. Fast Pressure Jumps Can Perturb Calcium and Magnesium Binding to Troponin C F29W

    PubMed Central

    Pearson, David S.; Swartz, Darl R.; Geeves, Michael A.

    2009-01-01

    We have used rapid pressure jump and stopped-flow fluorimetry to investigate calcium and magnesium binding to F29W chicken skeletal troponin C. Increased pressure perturbed calcium binding to the N-terminal sites in the presence and absence of magnesium and provided an estimate for the volume change upon calcium binding (-12 mL.mol-1). We observed a biphasic response to a pressure change which was characterized by fast and slow reciprocal relaxation times of the order 1000 s-1 and 100 s-1. Between pCa 8-5.4 and at troponin C concentrations of 8-28 μM, the slow relaxation times were invariant indicating that a protein isomerization was rate-limiting. The fast event was only detected over a very narrow pCa range (5.6-5.4). We have devised a model based on a Monod-Wyman-Changeux cooperative mechanism with volume changes of -9 and +6 mL/mol for the calcium binding to the regulatory sites and closed to open protein isomerization steps respectively. In the absence of magnesium, we discovered that calcium binding to the C-terminal sites could be detected, despite their position distal to the calcium sensitive tryptophan, with a volume change of +25 mL/mol. We used this novel observation to measure competitive magnesium binding to the C-terminal sites and deduced an affinity in the range 200 - 300 μM (and a volume change of +35 mL/mol). This affinity is an order of magnitude tighter than equilibrium fluorescence data suggest based on a model of direct competitive binding. Magnesium thus indirectly modulates binding to the N-terminal sites, which may act as a fine-tuning mechanism in vivo. PMID:18942859

  10. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  11. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  12. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  13. Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vivian, J. P.; Porter, C.; Wilce, J. A.

    2006-11-01

    A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

  14. Protein-protein docking with binding site patch prediction and network-based terms enhanced combinatorial scoring.

    PubMed

    Gong, Xinqi; Wang, Panwen; Yang, Feng; Chang, Shan; Liu, Bin; He, Hongqiu; Cao, Libin; Xu, Xianjin; Li, Chunhua; Chen, Weizu; Wang, Cunxin

    2010-11-15

    Protein-protein docking has made much progress in recent years, but challenges still exist. Here we present the application of our docking approach HoDock in CAPRI. In this approach, a binding site prediction is implemented to reduce docking sampling space and filter out unreasonable docked structures, and a network-based enhanced combinatorial scoring function HPNCscore is used to evaluate the decoys. The experimental information was combined with the predicted binding site to pick out the most likely key binding site residues. We applied the HoDock method in the recent rounds of the CAPRI experiments, and got good results as predictors on targets 39, 40, and 41. We also got good results as scorers on targets 35, 37, 40, and 41. This indicates that our docking approach can contribute to the progress of protein-protein docking methods and to the understanding of the mechanism of protein-protein interactions. © 2010 Wiley-Liss, Inc.

  15. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  16. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  17. ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

    PubMed

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

  18. ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

    PubMed Central

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

  19. Exploring the binding pathways of the 14-3-3ζ protein: Structural and free-energy profiles revealed by Hamiltonian replica exchange molecular dynamics with distancefield distance restraints

    PubMed Central

    Nagy, Gabor; Oostenbrink, Chris; Hritz, Jozef

    2017-01-01

    The 14-3-3 protein family performs regulatory functions in eukaryotic organisms by binding to a large number of phosphorylated protein partners. Whilst the binding mode of the phosphopeptides within the primary 14-3-3 binding site is well established based on the crystal structures of their complexes, little is known about the binding process itself. We present a computational study of the process by which phosphopeptides bind to the 14-3-3ζ protein. Applying a novel scheme combining Hamiltonian replica exchange molecular dynamics and distancefield restraints allowed us to map and compare the most likely phosphopeptide-binding pathways to the 14-3-3ζ protein. The most important structural changes to the protein and peptides involved in the binding process were identified. In order to bind phosphopeptides to the primary interaction site, the 14-3-3ζ adopted a newly found wide-opened conformation. Based on our findings we additionally propose a secondary interaction site on the inner surface of the 14-3-3ζ dimer, and a direct interference on the binding process by the flexible C-terminal tail. A minimalistic model was designed to allow for the efficient calculation of absolute binding affinities. Binding affinities calculated from the potential of mean force along the binding pathway are in line with the available experimental estimates for two of the studied systems. PMID:28727767

  20. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  1. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  2. A Single Base Difference between Pit-1 Binding Sites at the hGH Promoter and Locus Control Region Specifies Distinct Pit-1 Conformations and Functions

    PubMed Central

    Shewchuk, Brian M.; Ho, Yugong; Liebhaber, Stephen A.; Cooke, Nancy E.

    2006-01-01

    Activation of the human growth hormone (hGH-N) gene in pituitary somatotropes is mediated by a locus control region (LCR). This LCR is composed of DNase I-hypersensitive sites (HS) located −14.5 kb to −32 kb relative to the hGH-N promoter. HSI, at −14.5 kb, is the dominant determinant of hGH-N expression and is essential for establishment of a 32-kb domain of histone acetylation that encompasses the active hGH locus. This activity is conferred by three binding sites for the POU domain transcription factor Pit-1. These Pit-1 elements are sufficient to activate hGH-N expression in the mouse pituitary. In contrast, Pit-1 sites at the hGH-N promoter are consistently unable to mediate similar activity. In the present study, we demonstrate that the functional difference between the promoter-proximal and the HSI Pit-1 binding sites can be attributed in part to a single base difference. This base affects the conformation of the Pit-1/DNA complex, and reciprocal exchange of the divergent bases between the two sets of Pit-1 elements results in a partial reversal of their transgenic activities. These data support a model in which the Pit-1 binding sites in the hGH LCR allosterically program the bound Pit-1 complex for chromatin activating functions. PMID:16914737

  3. Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

    PubMed

    Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

    2007-08-15

    In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

  4. Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

    PubMed

    Landini, P; Volkert, M R

    1995-04-07

    The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

  5. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  6. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  7. Pyrrole-Based Antitubulin Agents: Two Distinct Binding Modalities Are Predicted for C-2 Analogues in the Colchicine Site

    PubMed Central

    2011-01-01

    3,5-Dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2-carboxylic acid ethyl ester is a promising antitubulin lead agent that targets the colchicine site of tubulin. C-2 analogues were synthesized and tested for microtubule depolymerizing and antiproliferative activity. Molecular modeling studies using both GOLD docking and HINT (Hydropathic INTeraction) scoring revealed two distinct binding modes that explain the structure–activity relationships and are in accord with the structural basis of colchicine binding to tubulin. The binding mode of higher activity compounds is buried deeper in the site and overlaps well with rings A and C of colchicine, while the lower activity binding mode shows fewer critical contacts with tubulin. The model distinguishes highly active compounds from those with weaker activities and provides novel insights into the colchicine site and compound design. PMID:22611477

  8. Pyrrole-Based Antitubulin Agents: Two Distinct Binding Modalities are Predicted for C-2 Analogs in the Colchicine Site.

    PubMed

    Da, Chenxiao; Telang, Nakul; Barelli, Peter; Jia, Xin; Gupton, John T; Mooberry, Susan L; Kellogg, Glen E

    2012-01-12

    3,5-dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2-carboxylic acid ethyl ester is a promising antitubulin lead agent that targets the colchicine site of tubulin. C-2 analogs were synthesized and tested for microtubule depolymerizing and antiproliferative activity. Molecular modeling studies using both GOLD docking and HINT (Hydropathic INTeraction) scoring revealed two distinct binding modes that explain the structural-activity relationships and are in accord with the structural basis of colchicine binding to tubulin. The binding mode of higher activity compounds is buried deeper in the site and overlaps well with rings A and C of colchicine, while the lower activity binding mode shows fewer critical contacts with tubulin. The model distinguishes highly active compounds from those with weaker activities and provides novel insights into the colchicine site and compound design.

  9. A global optimization algorithm for protein surface alignment

    PubMed Central

    2010-01-01

    Background A relevant problem in drug design is the comparison and recognition of protein binding sites. Binding sites recognition is generally based on geometry often combined with physico-chemical properties of the site since the conformation, size and chemical composition of the protein surface are all relevant for the interaction with a specific ligand. Several matching strategies have been designed for the recognition of protein-ligand binding sites and of protein-protein interfaces but the problem cannot be considered solved. Results In this paper we propose a new method for local structural alignment of protein surfaces based on continuous global optimization techniques. Given the three-dimensional structures of two proteins, the method finds the isometric transformation (rotation plus translation) that best superimposes active regions of two structures. We draw our inspiration from the well-known Iterative Closest Point (ICP) method for three-dimensional (3D) shapes registration. Our main contribution is in the adoption of a controlled random search as a more efficient global optimization approach along with a new dissimilarity measure. The reported computational experience and comparison show viability of the proposed approach. Conclusions Our method performs well to detect similarity in binding sites when this in fact exists. In the future we plan to do a more comprehensive evaluation of the method by considering large datasets of non-redundant proteins and applying a clustering technique to the results of all comparisons to classify binding sites. PMID:20920230

  10. Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

    PubMed

    Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

    2015-01-01

    Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

  11. Ubiquitin vinyl methyl ester binding orients the misaligned active site of the ubiquitin hydrolase UCHL1 into productive conformation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boudreaux, David A.; Maiti, Tushar K.; Davies, Christopher W.

    Ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is a Parkinson disease-associated, putative cysteine protease found abundantly and selectively expressed in neurons. The crystal structure of apo UCHL1 showed that the active-site residues are not aligned in a canonical form, with the nucleophilic cysteine being 7.7 {angstrom} from the general base histidine, an arrangement consistent with an inactive form of the enzyme. Here we report the crystal structures of the wild type and two Parkinson disease-associated variants of the enzyme, S18Y and I93M, bound to a ubiquitin-based suicide substrate, ubiquitin vinyl methyl ester. These structures reveal that ubiquitin vinyl methyl ester binds primarilymore » at two sites on the enzyme, with its carboxy terminus at the active site and with its amino-terminal {beta}-hairpin at the distal site - a surface-exposed hydrophobic crevice 17 {angstrom} away from the active site. Binding at the distal site initiates a cascade of side-chain movements in the enzyme that starts at a highly conserved, surface-exposed phenylalanine and is relayed to the active site resulting in the reorientation and proximal placement of the general base within 4 {angstrom} of the catalytic cysteine, an arrangement found in productive cysteine proteases. Mutation of the distal-site, surface-exposed phenylalanine to alanine reduces ubiquitin binding and severely impairs the catalytic activity of the enzyme. These results suggest that the activity of UCHL1 may be regulated by its own substrate.« less

  12. Loop-to-helix transition in the structure of multidrug regulator AcrR at the entrance of the drug-binding cavity.

    PubMed

    Manjasetty, Babu A; Halavaty, Andrei S; Luan, Chi-Hao; Osipiuk, Jerzy; Mulligan, Rory; Kwon, Keehwan; Anderson, Wayne F; Joachimiak, Andrzej

    2016-04-01

    Multidrug transcription regulator AcrR from Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 belongs to the tetracycline repressor family, one of the largest groups of bacterial transcription factors. The crystal structure of dimeric AcrR was determined and refined to 1.56Å resolution. The tertiary and quaternary structures of AcrR are similar to those of its homologs. The multidrug binding site was identified based on structural alignment with homologous proteins and has a di(hydroxyethyl)ether molecule bound. Residues from helices α4 and α7 shape the entry into this binding site. The structure of AcrR reveals that the extended helical conformation of helix α4 is stabilized by the hydrogen bond between Glu67 (helix α4) and Gln130 (helix α7). Based on the structural comparison with the closest homolog structure, the Escherichia coli AcrR, we propose that this hydrogen bond is responsible for control of the loop-to-helix transition within helix α4. This local conformational switch of helix α4 may be a key step in accessing the multidrug binding site and securing ligands at the binding site. Solution small-molecule binding studies suggest that AcrR binds ligands with their core chemical structure resembling the tetracyclic ring of cholesterol. Copyright © 2016. Published by Elsevier Inc.

  13. [Adenylate cyclase from rabbit heart: substrate binding site].

    PubMed

    Perfil'eva, E A; Khropov, Iu V; Khachatrian, L; Bulargina, T V; Baranova, L A

    1981-08-01

    The effects of 17 ATP analogs on the solubilized rabbit heart adenylate cyclase were studied. The triphosphate chain, position 8 of the adenine base and the ribose residue of the ATP molecule were modified. Despite the presence of the alkylating groups in two former types of the analogs tested, no covalent blocking of the active site of the enzyme was observed. Most of the compounds appeared to be competitive reversible inhibitors. The kinetic data confirmed the importance of the triphosphate chain for substrate binding in the active site of adenylate cyclase. (Formula: See Text) The inhibitors with different substituents in position 8 of the adenine base had a low affinity for the enzyme. The possible orientation of the triphosphate chain and the advantages of anti-conformation of the ATP molecule for their binding in the active site of adenylate cyclase are discussed.

  14. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Xun; Guanga, Gerald P; Wan, Cheng

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Manjasetty, Babu A.; Halavaty, Andrei S.; Luan, Chi-Hao

    Multidrug transcription regulator AcrR from Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 belongs to the tetracycline repressor family, one of the largest groups of bacterial transcription factors. The crystal structure of dimeric AcrR was determined and refined to 1.56 Å resolution. The tertiary and quaternary structures of AcrR are similar to those of its homologs. The multidrug binding site was identified based on structural alignment with homologous proteins and has a di(hydroxyethyl)ether molecule bound. Residues from helices a4 and a7 shape the entry into this binding site. The structure of AcrR reveals that the extended helical conformation of helixmore » a4 is stabilized by the hydrogen bond between Glu67 (helix a4) and Gln130 (helix a7). Based on the structural comparison with the closest homolog structure, the Escherichia coli AcrR, we propose that this hydrogen bond is responsible for control of the loop-to-helix transition within helix a4. This local conformational switch of helix a4 may be a key step in accessing the multidrug binding site and securing ligands at the binding site. Solution smallmolecule binding studies suggest that AcrR binds ligands with their core chemical structure resembling the tetracyclic ring of cholesterol.« less

  16. FINDSITE-metal: Integrating evolutionary information and machine learning for structure-based metal binding site prediction at the proteome level

    PubMed Central

    Brylinski, Michal; Skolnick, Jeffrey

    2010-01-01

    The rapid accumulation of gene sequences, many of which are hypothetical proteins with unknown function, has stimulated the development of accurate computational tools for protein function prediction with evolution/structure-based approaches showing considerable promise. In this paper, we present FINDSITE-metal, a new threading-based method designed specifically to detect metal binding sites in modeled protein structures. Comprehensive benchmarks using different quality protein structures show that weakly homologous protein models provide sufficient structural information for quite accurate annotation by FINDSITE-metal. Combining structure/evolutionary information with machine learning results in highly accurate metal binding annotations; for protein models constructed by TASSER, whose average Cα RMSD from the native structure is 8.9 Å, 59.5% (71.9%) of the best of top five predicted metal locations are within 4 Å (8 Å) from a bound metal in the crystal structure. For most of the targets, multiple metal binding sites are detected with the best predicted binding site at rank 1 and within the top 2 ranks in 65.6% and 83.1% of the cases, respectively. Furthermore, for iron, copper, zinc, calcium and magnesium ions, the binding metal can be predicted with high, typically 70-90%, accuracy. FINDSITE-metal also provides a set of confidence indexes that help assess the reliability of predictions. Finally, we describe the proteome-wide application of FINDSITE-metal that quantifies the metal binding complement of the human proteome. FINDSITE-metal is freely available to the academic community at http://cssb.biology.gatech.edu/findsite-metal/. PMID:21287609

  17. Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III.

    PubMed

    Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok

    2011-02-01

    RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  18. Kinetics of heavy metal adsorption and desorption in soil: Developing a unified model based on chemical speciation

    NASA Astrophysics Data System (ADS)

    Peng, Lanfang; Liu, Paiyu; Feng, Xionghan; Wang, Zimeng; Cheng, Tao; Liang, Yuzhen; Lin, Zhang; Shi, Zhenqing

    2018-03-01

    Predicting the kinetics of heavy metal adsorption and desorption in soil requires consideration of multiple heterogeneous soil binding sites and variations of reaction chemistry conditions. Although chemical speciation models have been developed for predicting the equilibrium of metal adsorption on soil organic matter (SOM) and important mineral phases (e.g. Fe and Al (hydr)oxides), there is still a lack of modeling tools for predicting the kinetics of metal adsorption and desorption reactions in soil. In this study, we developed a unified model for the kinetics of heavy metal adsorption and desorption in soil based on the equilibrium models WHAM 7 and CD-MUSIC, which specifically consider metal kinetic reactions with multiple binding sites of SOM and soil minerals simultaneously. For each specific binding site, metal adsorption and desorption rate coefficients were constrained by the local equilibrium partition coefficients predicted by WHAM 7 or CD-MUSIC, and, for each metal, the desorption rate coefficients of various binding sites were constrained by their metal binding constants with those sites. The model had only one fitting parameter for each soil binding phase, and all other parameters were derived from WHAM 7 and CD-MUSIC. A stirred-flow method was used to study the kinetics of Cd, Cu, Ni, Pb, and Zn adsorption and desorption in multiple soils under various pH and metal concentrations, and the model successfully reproduced most of the kinetic data. We quantitatively elucidated the significance of different soil components and important soil binding sites during the adsorption and desorption kinetic processes. Our model has provided a theoretical framework to predict metal adsorption and desorption kinetics, which can be further used to predict the dynamic behavior of heavy metals in soil under various natural conditions by coupling other important soil processes.

  19. Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

    PubMed Central

    Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2007-01-01

    We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

  20. Site Identification by Ligand Competitive Saturation (SILCS) simulations for fragment-based drug design.

    PubMed

    Faller, Christina E; Raman, E Prabhu; MacKerell, Alexander D; Guvench, Olgun

    2015-01-01

    Fragment-based drug design (FBDD) involves screening low molecular weight molecules ("fragments") that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind nonoverlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy.The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is "soaked" in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called "FragMaps" can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine "Grid Free Energies (GFEs)," which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities.

  1. Crystal structures of botulinum neurotoxin DC in complex with its protein receptors synaptotagmin I and II.

    PubMed

    Berntsson, Ronnie Per-Arne; Peng, Lisheng; Svensson, Linda Marie; Dong, Min; Stenmark, Pål

    2013-09-03

    Botulinum neurotoxins (BoNTs) can cause paralysis at exceptionally low concentrations and include seven serotypes (BoNT/A-G). The chimeric BoNT/DC toxin has a receptor binding domain similar to the same region in BoNT/C. However, BoNT/DC does not share protein receptor with BoNT/C. Instead, it shares synaptotagmin (Syt) I and II as receptors with BoNT/B, despite their low sequence similarity. Here, we present the crystal structures of the binding domain of BoNT/DC in complex with the recognition domains of its protein receptors, Syt-I and Syt-II. The structures reveal that BoNT/DC possesses a Syt binding site, distinct from the established Syt-II binding site in BoNT/B. Structure-based mutagenesis further shows that hydrophobic interactions play a key role in Syt binding. The structures suggest that the BoNT/DC ganglioside binding sites are independent of the protein receptor binding site. Our results reveal the remarkable versatility in the receptor recognition of the BoNTs. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. High-Affinity Low-Capacity and Low-Affinity High-Capacity N-Acetyl-2-Aminofluorene (AAF) Macromolecular Binding Sites Are Revealed During the Growth Cycle of Adult Rat Hepatocytes in Primary Culture.

    PubMed

    Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L

    2018-05-01

    Long-term cultures of primary adult rat hepatocytes were used to study the effects of N-acetyl-2-aminofluorene (AAF) on hepatocyte proliferation during the growth cycle; on the initiation of hepatocyte DNA synthesis in quiescent cultures; and, on hepatocyte DNA replication following the initiation of DNA synthesis. Scatchard analyses were used to identify the pharmacologic properties of radiolabeled AAF metabolite binding to hepatocyte macromolecules. Two classes of growth cycle-dependent AAF metabolite binding sites-a high-affinity low-capacity site (designated Site I) and a low-affinity high-capacity site (designated Site II)-associated with two spatially distinct classes of macromolecular targets, were revealed. Based upon radiolabeled AAF metabolite binding to purified hepatocyte genomic DNA or to DNA, RNA, proteins, and lipids from isolated nuclei, Site IDAY 4 targets (KD[APPARENT] ≈ 2-4×10-6 M and BMAX[APPARENT] ≈ 6 pmol/106 cells/24 h) were consistent with genomic DNA; and with AAF metabolized by a nuclear cytochrome P450. Based upon radiolabeled AAF binding to total cellular lysates, Site IIDAY 4 targets (KD[APPARENT] ≈ 1.5×10-3 M and BMAX[APPARENT] ≈ 350 pmol/106 cells/24 h) were consistent with cytoplasmic proteins; and with AAF metabolized by cytoplasmic cytochrome P450s. DNA synthesis was not inhibited by concentrations of AAF that saturated DNA binding in the neighborhood of the Site I KD. Instead, hepatocyte DNA synthesis inhibition required higher concentrations of AAF approaching the Site II KD. These observations raise the possibility that carcinogenic DNA adducts derived from AAF metabolites form below concentrations of AAF that inhibit replicative and repair DNA synthesis.

  3. Contacts between the factor TUF and RPG sequences.

    PubMed

    Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

    1990-08-25

    The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

  4. Fragment-Based Screen against HIV Protease

    PubMed Central

    Perryman, A. L.; Zhang, Q.; Soutter, H. H.; Rosenfeld, R.; McRee, D. E.; Olson, A. J.; Elder, J. E.; Stout, C. D.

    2009-01-01

    We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 Å resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the ‘exo site’ adjacent to the Gly16Gly17Gln18 loop where the amide of Gly17 is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys14 and Leu63. Another fragment, indole-6-carboxylic acid, binds on the ‘outside/top of the flap’ via hydrophobic contacts with Trp42, Pro44, Met46, and Lys55, a hydrogen bond with Val56, and a salt-bridge with Arg57. 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target. PMID:20659109

  5. The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis

    PubMed Central

    Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert

    2015-01-01

    During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414

  6. The novel fluorescent CDP-analogue (Pbeta)MABA-CDP is a specific probe for the NMP binding site of UMP/CMP kinase.

    PubMed

    Rudolph, M G; Veit, T J; Reinstein, J

    1999-12-01

    Direct thermodynamic and kinetic investigations of the binding of nucleotides to the nucleoside monophosphate (NMP) site of NMP kinases have not been possible so far because a spectroscopic probe was not available. By coupling a fluorescent N-methylanthraniloyl- (mant) group to the beta-phosphate of CDP via a butyl linker, a CDP analogue [(Pbeta)MABA-CDP] was obtained that still binds specifically to the NMP site of UmpKdicty, because the base and the ribose moieties, which are involved in specific interactions, are not modified. This allows the direct determination of binding constants for its substrates in competition experiments.

  7. The novel fluorescent CDP-analogue (Pbeta)MABA-CDP is a specific probe for the NMP binding site of UMP/CMP kinase.

    PubMed Central

    Rudolph, M. G.; Veit, T. J.; Reinstein, J.

    1999-01-01

    Direct thermodynamic and kinetic investigations of the binding of nucleotides to the nucleoside monophosphate (NMP) site of NMP kinases have not been possible so far because a spectroscopic probe was not available. By coupling a fluorescent N-methylanthraniloyl- (mant) group to the beta-phosphate of CDP via a butyl linker, a CDP analogue [(Pbeta)MABA-CDP] was obtained that still binds specifically to the NMP site of UmpKdicty, because the base and the ribose moieties, which are involved in specific interactions, are not modified. This allows the direct determination of binding constants for its substrates in competition experiments. PMID:10631985

  8. Protein docking prediction using predicted protein-protein interface.

    PubMed

    Li, Bin; Kihara, Daisuke

    2012-01-10

    Many important cellular processes are carried out by protein complexes. To provide physical pictures of interacting proteins, many computational protein-protein prediction methods have been developed in the past. However, it is still difficult to identify the correct docking complex structure within top ranks among alternative conformations. We present a novel protein docking algorithm that utilizes imperfect protein-protein binding interface prediction for guiding protein docking. Since the accuracy of protein binding site prediction varies depending on cases, the challenge is to develop a method which does not deteriorate but improves docking results by using a binding site prediction which may not be 100% accurate. The algorithm, named PI-LZerD (using Predicted Interface with Local 3D Zernike descriptor-based Docking algorithm), is based on a pair wise protein docking prediction algorithm, LZerD, which we have developed earlier. PI-LZerD starts from performing docking prediction using the provided protein-protein binding interface prediction as constraints, which is followed by the second round of docking with updated docking interface information to further improve docking conformation. Benchmark results on bound and unbound cases show that PI-LZerD consistently improves the docking prediction accuracy as compared with docking without using binding site prediction or using the binding site prediction as post-filtering. We have developed PI-LZerD, a pairwise docking algorithm, which uses imperfect protein-protein binding interface prediction to improve docking accuracy. PI-LZerD consistently showed better prediction accuracy over alternative methods in the series of benchmark experiments including docking using actual docking interface site predictions as well as unbound docking cases.

  9. Physical signals for protein-DNA recognition

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2009-09-01

    This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.

  10. GPU-Based Point Cloud Superpositioning for Structural Comparisons of Protein Binding Sites.

    PubMed

    Leinweber, Matthias; Fober, Thomas; Freisleben, Bernd

    2018-01-01

    In this paper, we present a novel approach to solve the labeled point cloud superpositioning problem for performing structural comparisons of protein binding sites. The solution is based on a parallel evolution strategy that operates on large populations and runs on GPU hardware. The proposed evolution strategy reduces the likelihood of getting stuck in a local optimum of the multimodal real-valued optimization problem represented by labeled point cloud superpositioning. The performance of the GPU-based parallel evolution strategy is compared to a previously proposed CPU-based sequential approach for labeled point cloud superpositioning, indicating that the GPU-based parallel evolution strategy leads to qualitatively better results and significantly shorter runtimes, with speed improvements of up to a factor of 1,500 for large populations. Binary classification tests based on the ATP, NADH, and FAD protein subsets of CavBase, a database containing putative binding sites, show average classification rate improvements from about 92 percent (CPU) to 96 percent (GPU). Further experiments indicate that the proposed GPU-based labeled point cloud superpositioning approach can be superior to traditional protein comparison approaches based on sequence alignments.

  11. Fragment-Based Optimization of Small Molecule CXCL12 Inhibitors for Antagonizing the CXCL12/CXCR4 Interaction

    PubMed Central

    Ziarek, Joshua J.; Liu, Yan; Smith, Emmanuel; Zhang, Guolin; Peterson, Francis C.; Chen, Jun; Yu, Yongping; Chen, Yu; Volkman, Brian F.; Li, Rongshi

    2013-01-01

    The chemokine CXCL12 and its G protein-coupled receptor (GPCR) CXCR4 are high-priority clinical targets because of their involvement in metastatic cancers (also implicated in autoimmune disease and cardiovascular disease). Because chemokines interact with two distinct sites to bind and activate their receptors, both the GPCRs and chemokines are potential targets for small molecule inhibition. A number of chemokines have been validated as targets for drug development, but virtually all drug discovery efforts focus on the GPCRs. However, all CXCR4 receptor antagonists with the exception of MSX-122 have failed in clinical trials due to unmanageable toxicities, emphasizing the need for alternative strategies to interfere with CXCL12/CXCR4-guided metastatic homing. Although targeting the relatively featureless surface of CXCL12 was presumed to be challenging, focusing efforts at the sulfotyrosine (sY) binding pockets proved successful for procuring initial hits. Using a hybrid structure-based in silico/NMR screening strategy, we recently identified a ligand that occludes the receptor recognition site. From this initial hit, we designed a small fragment library containing only nine tetrazole derivatives using a fragment-based and bioisostere approach to target the sY binding sites of CXCL12. Compound binding modes and affinities were studied by 2D NMR spectroscopy, X-ray crystallography, molecular docking and cell-based functional assays. Our results demonstrate that the sY binding sites are conducive to the development of high affinity inhibitors with better ligand efficiency (LE) than typical protein-protein interaction inhibitors (LE ≤ 0.24). Our novel tetrazole-based fragment 18 was identified to bind the sY21 site with a Kd of 24 μM (LE = 0.30). Optimization of 18 yielded compound 25 which specifically inhibits CXCL12-induced migration with an improvement in potency over the initial hit 9. The fragment from this library that exhibited the highest affinity and ligand efficiency (11: Kd = 13 μM, LE = 0.33) may serve as a starting point for development of inhibitors targeting the sY12 site. PMID:23368099

  12. Guanidinoneomycin B Recognition of an HIV-1 RNA Helix

    PubMed Central

    Staple, David W.; Venditti, Vincenzo; Niccolai, Neri; Elson-Schwab, Lev; Tor, Yitzhak; Butcher, Samuel E.

    2009-01-01

    Aminoglycoside antibiotics are small-molecule drugs that bind RNA. The affinity and specificity of aminoglycoside binding to RNA can be increased through chemical modification, such as guanidinylation. Here, we report the binding of guanidinoneomycin B (GNB) to an RNA helix from the HIV-1 frameshift site. The binding of GNB increases the melting temperature (Tm) of the frameshift-site RNA by at least 10°8C, to a point at which a melting transition is not even observed in 2m urea. A structure of the complex was obtained by using multidimensional heteronuclear NMR spectroscopic methods. We also used a novel paramagnetic-probe assay to identify the site of GNB binding to the surface of the RNA. GNB makes major-groove contacts to two sets of Watson–Crick bases and is in van der Waals contact with a highly structured ACAA tetraloop. Rings I and II of GNB fit into the major groove and form the binding interface with the RNA, whereas rings III and IV are exposed to the solvent and disordered. The binding of GNB causes a broadening of the major groove across the binding site. PMID:18058789

  13. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed Central

    Brierley, I; Hoggett, J G

    1992-01-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site. Images Fig. 1. Fig. 3. Fig. 4. PMID:1322129

  14. The properties of small Ag clusters bound to DNA bases.

    PubMed

    Soto-Verdugo, Víctor; Metiu, Horia; Gwinn, Elisabeth

    2010-05-21

    We study the binding of neutral silver clusters, Ag(n) (n=1-6), to the DNA bases adenine (A), cytosine (C), guanine (G), and thymine (T) and the absorption spectra of the silver cluster-base complexes. Using density functional theory (DFT), we find that the clusters prefer to bind to the doubly bonded ring nitrogens and that binding to T is generally much weaker than to C, G, and A. Ag(3) and Ag(4) make the stronger bonds. Bader charge analysis indicates a mild electron transfer from the base to the clusters for all bases, except T. The donor bases (C, G, and A) bind to the sites on the cluster where the lowest unoccupied molecular orbital has a pronounced protrusion. The site where cluster binds to the base is controlled by the shape of the higher occupied states of the base. Time-dependent DFT calculations show that different base-cluster isomers may have very different absorption spectra. In particular, we find new excitations in base-cluster molecules, at energies well below those of the isolated components, and with strengths that depend strongly on the orientations of planar clusters with respect to the base planes. Our results suggest that geometric constraints on binding, imposed by designed DNA structures, may be a feasible route to engineering the selection of specific cluster-base assemblies.

  15. Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

    PubMed Central

    Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

    2017-01-01

    The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

  16. The effects of para-chloromercuribenzoic acid and different oxidative and sulfhydryl agents on a novel, non-AT1, non-AT2 angiotensin binding site identified as neurolysin

    PubMed Central

    Santos, Kira L.; Vento, Megan A; Wright, John W.; Speth, Robert C.

    2013-01-01

    A novel, non-AT1, non-AT2 brain binding site for angiotensin peptides that is unmasked by p-chloromercuribenzoate (PCMB) has been identified as a membrane associated variant of neurolysin. The ability of different organic and inorganic oxidative and sulfhydryl reactive agents to unmask or inhibit 125I-Sar1Ile8 angiotensin II (SI-Ang II) binding to this site was presently examined. In tissue membranes from homogenates of rat brain and testis incubated in assay buffer containing losartan (10 μM) and PD123319 (10 μM) plus 100 μM PCMB, 5 of the 39 compounds tested inhibited 125I-SI Ang II binding in brain and testis. Mersalyl acid, mercuric chloride (HgCl2) and silver nitrate (AgNO3) most potently inhibited 125I-SI Ang II binding with IC50’s ~1–20 μM This HgCl2 inhibition was independent of any interaction of HgCl2 with angiotensin II (Ang II) based on the lack of effect of HgCl2 on the dipsogenic effects of intracerebroventricularly administered Ang II and 125I-SI Ang II binding to AT1 receptors in the liver. Among sulfhydryl reagents, cysteamine and reduced glutathione (GSH), but not oxidized glutathione (GSSG) up to 1 mM, inhibited PCMB-unmasked 125I-SI Ang II binding in brain and testis. Thimerosal and 4-hydroxymercuribenzoate moderately inhibited PCMB-unmasked 125I-SI Ang II binding in brain and testis at 100 μM; however, they also unmasked non-AT1, non-AT2 binding independent of PCMB. 4-hydroxybenzoic acid did not promote 125 I-SI Ang II binding to this binding site indicating that only specific organomercurial compounds can unmask the binding site. The common denominator for all of these interacting substances is the ability to bind to protein cysteine sulfur. Comparison of cysteines between neurolysin and the closely related enzyme thimet oligopeptidase revealed an unconserved cysteine (cys650, based on the full length variant) in the proposed ligand binding channel (Brown et al., 2001) [1] near the active site of neurolysin. It is proposed that the mercuric ion in PCMB and closely related organomercurial compounds binds to cys650, while the acidic anion forms an ionic bond with a nearby arginine or lysine along the channel to effect a conformational change in neurolysin that promotes Ang II binding. PMID:23511333

  17. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi

    2016-01-01

    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  18. Binding of warfarin influences the acid-base equilibrium of H242 in sudlow site I of human serum albumin.

    PubMed

    Perry, Jennifer L; Goldsmith, Michael R; Williams, T Richard; Radack, Kyle P; Christensen, Trine; Gorham, Justin; Pasquinelli, Melissa A; Toone, Eric J; Beratan, David N; Simon, John D

    2006-01-01

    Sudlow Site I of human serum albumin (HSA) is located in subdomain IIA of the protein and serves as a binding cavity for a variety of ligands. In this study, the binding of warfarin (W) is examined using computational techniques and isothermal titration calorimetry (ITC). The structure of the docked warfarin anion (W-) to Site I is similar to that revealed by X-ray crystallography, with a calculated binding constant of 5.8 x 10(5) M(-1). ITC experiments (pH 7.13 and I = 0.1) carried out in three different buffers (MOPs, phosphate and Tris) reveal binding of W- is accompanied by uptake of 0.30+/-0.02 protons from the solvent. This measurement suggests that the binding of W- is stabilized by an ion-pair interaction between protonated H242 and the phenoxide group of W-.

  19. Free-Energy-Based Protein Design: Re-Engineering Cellular Retinoic Acid Binding Protein II Assisted by the Moveable-Type Approach.

    PubMed

    Zhong, Haizhen A; Santos, Elizabeth M; Vasileiou, Chrysoula; Zheng, Zheng; Geiger, James H; Borhan, Babak; Merz, Kenneth M

    2018-03-14

    How to fine-tune the binding free energy of a small-molecule to a receptor site by altering the amino acid residue composition is a key question in protein engineering. Indeed, the ultimate solution to this problem, to chemical accuracy (±1 kcal/mol), will result in profound and wide-ranging applications in protein design. Numerous tools have been developed to address this question using knowledge-based models to more computationally intensive molecular dynamics simulations-based free energy calculations, but while some success has been achieved there remains room for improvement in terms of overall accuracy and in the speed of the methodology. Here we report a fast, knowledge-based movable-type (MT)-based approach to estimate the absolute and relative free energy of binding as influenced by mutations in a small-molecule binding site in a protein. We retrospectively validate our approach using mutagenesis data for retinoic acid binding to the Cellular Retinoic Acid Binding Protein II (CRABPII) system and then make prospective predictions that are borne out experimentally. The overall performance of our approach is supported by its success in identifying mutants that show high or even sub-nano-molar binding affinities of retinoic acid to the CRABPII system.

  20. Cyanide does more to inhibit heme enzymes, than merely serving as an active-site ligand

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parashar, Abhinav; Venkatachalam, Avanthika; Gideon, Daniel Andrew

    Highlights: • Cyanide (CN) is a well-studied toxic principle, known to inhibit heme-enzymes. • Inhibition is supposed to result from CN binding at the active site as a ligand. • Diverse heme enzymes’ CN inhibition profiles challenge prevailing mechanism. • Poor binding efficiency of CN at low enzyme concentrations and ligand pressures. • CN-based diffusible radicals cause ‘non-productive electron transfers’ (inhibition). - Abstract: The toxicity of cyanide is hitherto attributed to its ability to bind to heme proteins’ active site and thereby inhibit their activity. It is shown herein that the long-held interpretation is inadequate to explain several observations inmore » heme-enzyme reaction systems. Generation of cyanide-based diffusible radicals in heme-enzyme reaction milieu could shunt electron transfers (by non-active site processes), and thus be detrimental to the efficiency of oxidative outcomes.« less

  1. Multiheteromacrocycles that Complex Metal Ions. Sixth Progress Report, 1 May 1979-30 April 1980

    DOE R&D Accomplishments Database

    Cram, D. J.

    1980-01-15

    Objective is to design synthesize, and evaluate cyclic and polycyclic host organic compounds for their abilities to complex and lipophilize guest metal ions, their complexes, and their clusters. Host organic compounds consist of strategically placed solvating, coordinating, and ion-pairing sites tied together by covalent bonds through hydrocarbon units around cavities shaped to be occupied by guest metal ions or by metal ions plus their ligands. Specificity in complexation is sought by matching the following properties of host and guest: cavity and metal ion sizes; geometric arrangements of binding sites; number of binding sites; character of binding sites; and valences. During this period, hemispherands based on an aryloxy or cyclic urea unit, spherands based on aryloxyl units only, and their complexes with alkali metals and alkaline earths were investigated. An attempt to separate {sup 6}Li and {sup 7}Li by gel permeation chromatography of lithiospherium chloride failed. (DLC)

  2. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    2016-10-01

    The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  3. CisMapper: predicting regulatory interactions from transcription factor ChIP-seq data

    PubMed Central

    O'Connor, Timothy; Bodén, Mikael

    2017-01-01

    Abstract Identifying the genomic regions and regulatory factors that control the transcription of genes is an important, unsolved problem. The current method of choice predicts transcription factor (TF) binding sites using chromatin immunoprecipitation followed by sequencing (ChIP-seq), and then links the binding sites to putative target genes solely on the basis of the genomic distance between them. Evidence from chromatin conformation capture experiments shows that this approach is inadequate due to long-distance regulation via chromatin looping. We present CisMapper, which predicts the regulatory targets of a TF using the correlation between a histone mark at the TF's bound sites and the expression of each gene across a panel of tissues. Using both chromatin conformation capture and differential expression data, we show that CisMapper is more accurate at predicting the target genes of a TF than the distance-based approaches currently used, and is particularly advantageous for predicting the long-range regulatory interactions typical of tissue-specific gene expression. CisMapper also predicts which TF binding sites regulate a given gene more accurately than using genomic distance. Unlike distance-based methods, CisMapper can predict which transcription start site of a gene is regulated by a particular binding site of the TF. PMID:28204599

  4. Predicting Ligand Binding Sites on Protein Surfaces by 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Jian, Jhih-Wei; Elumalai, Pavadai; Pitti, Thejkiran; Wu, Chih Yuan; Tsai, Keng-Chang; Chang, Jeng-Yih; Peng, Hung-Pin; Yang, An-Suei

    2016-01-01

    Predicting ligand binding sites (LBSs) on protein structures, which are obtained either from experimental or computational methods, is a useful first step in functional annotation or structure-based drug design for the protein structures. In this work, the structure-based machine learning algorithm ISMBLab-LIG was developed to predict LBSs on protein surfaces with input attributes derived from the three-dimensional probability density maps of interacting atoms, which were reconstructed on the query protein surfaces and were relatively insensitive to local conformational variations of the tentative ligand binding sites. The prediction accuracy of the ISMBLab-LIG predictors is comparable to that of the best LBS predictors benchmarked on several well-established testing datasets. More importantly, the ISMBLab-LIG algorithm has substantial tolerance to the prediction uncertainties of computationally derived protein structure models. As such, the method is particularly useful for predicting LBSs not only on experimental protein structures without known LBS templates in the database but also on computationally predicted model protein structures with structural uncertainties in the tentative ligand binding sites. PMID:27513851

  5. Self-assembled nanospheres with multiple endohedral binding sites pre-organize catalysts and substrates for highly efficient reactions

    NASA Astrophysics Data System (ADS)

    Wang, Qi-Qiang; Gonell, Sergio; Leenders, Stefan H. A. M.; Dürr, Maximilian; Ivanović-Burmazović, Ivana; Reek, Joost N. H.

    2016-03-01

    Tuning reagent and catalyst concentrations is crucial in the development of efficient catalytic transformations. In enzyme-catalysed reactions the substrate is bound—often by multiple non-covalent interactions—in a well-defined pocket close to the active site of the enzyme; this pre-organization facilitates highly efficient transformations. Here we report an artificial system that co-encapsulates multiple catalysts and substrates within the confined space defined by an M12L24 nanosphere that contains 24 endohedral guanidinium-binding sites. Cooperative binding means that sulfonate guests are bound much more strongly than carboxylates. This difference has been used to fix gold-based catalysts firmly, with the remaining binding sites left to pre-organize substrates. This strategy was applied to a Au(I)-catalysed cyclization of acetylenic acid to enol lactone in which the pre-organization resulted in much higher reaction rates. We also found that the encapsulated sulfonate-containing Au(I) catalysts did not convert neutral (acid) substrates, and so could have potential in the development of substrate-selective catalysis and base-triggered on/off switching of catalysis.

  6. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  7. Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1

    PubMed Central

    Malina, Jaroslav; Scott, Peter; Brabec, Viktor

    2015-01-01

    Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo–helical ‘flexicate’ complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3]4+ incorporating the common NN–NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo–helical complexes for cancer chemotherapy. PMID:25940617

  8. Multiple sup 3 H-oxytocin binding sites in rat myometrial plasma membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Crankshaw, D.; Gaspar, V.; Pliska, V.

    1990-01-01

    The affinity spectrum method has been used to analyse binding isotherms for {sup 3}H-oxytocin to rat myometrial plasma membranes. Three populations of binding sites with dissociation constants (Kd) of 0.6-1.5 x 10(-9), 0.4-1.0 x 10(-7) and 7 x 10(-6) mol/l were identified and their existence verified by cluster analysis based on similarities between Kd, binding capacity and Hill coefficient. When experimental values were compared to theoretical curves constructed using the estimated binding parameters, good fits were obtained. Binding parameters obtained by this method were not influenced by the presence of GTP gamma S (guanosine-5'-O-3-thiotriphosphate) in the incubation medium. The bindingmore » parameters agree reasonably well with those found in uterine cells, they support the existence of a medium affinity site and may allow for an explanation of some of the discrepancies between binding and response in this system.« less

  9. Site Identification by Ligand Competitive Saturation (SILCS) Simulations for Fragment-Based Drug Design

    PubMed Central

    Faller, Christina E.; Raman, E. Prabhu; MacKerell, Alexander D.; Guvench, Olgun

    2015-01-01

    Fragment-based drug design (FBDD) involves screening low molecular weight molecules (“fragments”) that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind non-overlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy. The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is “soaked” in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called “FragMaps” can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine “Grid Free Energies (GFEs),” which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities. PMID:25709034

  10. Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library*

    PubMed Central

    Kiefer, Jonathan D.; Srinivas, Raja R.; Lobner, Elisabeth; Tisdale, Alison W.; Mehta, Naveen K.; Yang, Nicole J.; Tidor, Bruce; Wittrup, K. Dane

    2016-01-01

    The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (Tm of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. PMID:27582495

  11. The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

    PubMed Central

    Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

    2013-01-01

    The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

  12. Structural Chemistry of Human RNA Methyltransferases.

    PubMed

    Schapira, Matthieu

    2016-03-18

    RNA methyltransferases (RNMTs) play important roles in RNA stability, splicing, and epigenetic mechanisms. They constitute a promising target class that is underexplored by the medicinal chemistry community. Information of relevance to drug design can be extracted from the rich structural coverage of human RNMTs. In this work, the structural chemistry of this protein family is analyzed in depth. Unlike most methyltransferases, RNMTs generally feature a substrate-binding site that is largely open on the cofactor-binding pocket, favoring the design of bisubstrate inhibitors. Substrate purine or pyrimidines are often sandwiched between hydrophobic walls that can accommodate planar ring systems. When the substrate base is laying on a shallow surface, a 5' flanking base is sometimes anchored in a druggable cavity. The cofactor-binding site is structurally more diverse than in protein methyltransferases and more druggable in SPOUT than in Rossman-fold enzymes. Finally, conformational plasticity observed both at the substrate and cofactor binding sites may be a challenge for structure-based drug design. The landscape drawn here may inform ongoing efforts toward the discovery of the first human RNMT inhibitors.

  13. Thermodynamic modeling of donor splice site recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Garland, Jeffrey A.; Aalberts, Daniel P.

    2004-04-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 small nuclear RNA with the donor ( 5' ) splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our “finding with binding” method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  14. Step-By-Step In Vitro Mutagenesis: Lessons From Fucose-Binding Lectin PA-IIL.

    PubMed

    Mrázková, Jana; Malinovská, Lenka; Wimmerová, Michaela

    2017-01-01

    Site-directed mutagenesis is a powerful technique which is used to understand the basis of interactions between proteins and their binding partners, as well as to modify these interactions. Methods of rational design that are based on detailed knowledge of the structure of a protein of interest are often used for preliminary investigations of the possible outcomes which can result from the practical application of site-directed mutagenesis. Also, random mutagenesis can be used in tandem with site-directed mutagenesis for an examination of amino acid "hotspots."Lectins are sugar-binding proteins which, among other functions, mediate the recognition of host cells by a pathogen and its adhesion to the host cell surface. Hence, lectins and their binding properties are studied and engineered using site-directed mutagenesis.In this chapter, we describe a site-directed mutagenesis method used for investigating the sugar binding pattern of the PA-IIL lectin from the pathogenic bacterium Pseudomonas aeruginosa. Moreover, procedures for the production and purification of PA-IIL mutants are described, and several basic methods for characterizing the mutants are discussed.

  15. Inhibition of ferric ion to oxalate oxidase shed light on the substrate binding site.

    PubMed

    Pang, Yu; Lan, Wanjun; Huang, Xuelei; Zuo, Guanke; Liu, Hui; Zhang, Jingyan

    2015-10-01

    Oxalate oxidase (OxOx), a well known enzyme catalyzes the cleavage of oxalate to carbon dioxide with reduction of dioxygen to hydrogen peroxide, however its catalytic process is not well understood. To define the substrate binding site, interaction of Fe(3+) ions with OxOx was systemically investigated using biochemical method, circular dichrosim spectroscopy, microscale thermophoresis, and computer modeling. We demonstrated that Fe(3+) is a non-competitive inhibitor with a milder binding affinity to OxOx, and the secondary structure of the OxOx was slightly altered upon its binding. On the basis of the structural properties of the OxOx and its interaction with Fe(3+) ions, two residue clusters of OxOx were assigned as potential Fe(3+) binding sites, the mechanism of the inhibition of Fe(3+) was delineated. Importantly, the residues that interact with Fe(3+) ions are involved in the substrate orienting based on computer docking. Consequently, the interaction of OxOx with Fe(3+) highlights insight into substrate binding site in OxOx.

  16. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  17. Tuning the ion selectivity of tetrameric cation channels by changing the number of ion binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Derebe, Mehabaw G.; Sauer, David B.; Zeng, Weizhong

    2015-11-30

    Selective ion conduction across ion channel pores is central to cellular physiology. To understand the underlying principles of ion selectivity in tetrameric cation channels, we engineered a set of cation channel pores based on the nonselective NaK channel and determined their structures to high resolution. These structures showcase an ensemble of selectivity filters with a various number of contiguous ion binding sites ranging from 2 to 4, with each individual site maintaining a geometry and ligand environment virtually identical to that of equivalent sites in K{sup +} channel selectivity filters. Combined with single channel electrophysiology, we show that only themore » channel with four ion binding sites is K{sup +} selective, whereas those with two or three are nonselective and permeate Na{sup +} and K{sup +} equally well. These observations strongly suggest that the number of contiguous ion binding sites in a single file is the key determinant of the channel's selectivity properties and the presence of four sites in K{sup +} channels is essential for highly selective and efficient permeation of K{sup +} ions.« less

  18. An NMR-Based Structural Rationale for Contrasting Stoichiometry and Ligand Binding Site(s) in Fatty Acid-binding Proteins†

    PubMed Central

    He, Yan; Estephan, Rima; Yang, Xiaomin; Vela, Adriana; Wang, Hsin; Bernard, Cédric; Stark, Ruth E.

    2011-01-01

    Liver fatty acid-binding protein (LFABP) is a 14-kDa cytosolic polypeptide, differing from other family members in number of ligand binding sites, diversity of bound ligands, and transfer of fatty acid(s) to membranes primarily via aqueous diffusion rather than direct collisional interactions. Distinct two-dimensional 1H-15N NMR signals indicative of slowly exchanging LFABP assemblies formed during stepwise ligand titration were exploited, without solving the protein-ligand complex structures, to yield the stoichiometries for the bound ligands, their locations within the protein binding cavity, the sequence of ligand occupation, and the corresponding protein structural accommodations. Chemical shifts were monitored for wild-type LFABP and a R122L/S124A mutant in which electrostatic interactions viewed as essential to fatty acid binding were removed. For wild-type LFABP the results compared favorably with previous tertiary structures of oleate-bound wild-type LFABP in crystals and in solution: there are two oleates, one U-shaped ligand that positions the long hydrophobic chain deep within the cavity and another extended structure with the hydrophobic chain facing the cavity and the carboxylate group lying close to the protein surface. The NMR titration validated a prior hypothesis that the first oleate to enter the cavity occupies the internal protein site. In contrast, 1H/15N chemical shift changes supported only one liganded oleate for R122L/S124A LFABP, at an intermediate location within the protein cavity. A rationale based on protein sequence and electrostatics was developed to explain the stoichiometry and binding site trends for LFABPs and to put these findings into context within the larger protein family. PMID:21226535

  19. Physical constraints determine the logic of bacterial promoter architectures

    PubMed Central

    Ezer, Daphne; Zabet, Nicolae Radu; Adryan, Boris

    2014-01-01

    Site-specific transcription factors (TFs) bind to their target sites on the DNA, where they regulate the rate at which genes are transcribed. Bacterial TFs undergo facilitated diffusion (a combination of 3D diffusion around and 1D random walk on the DNA) when searching for their target sites. Using computer simulations of this search process, we show that the organization of the binding sites, in conjunction with TF copy number and binding site affinity, plays an important role in determining not only the steady state of promoter occupancy, but also the order at which TFs bind. These effects can be captured by facilitated diffusion-based models, but not by standard thermodynamics. We show that the spacing of binding sites encodes complex logic, which can be derived from combinations of three basic building blocks: switches, barriers and clusters, whose response alone and in higher orders of organization we characterize in detail. Effective promoter organizations are commonly found in the E. coli genome and are highly conserved between strains. This will allow studies of gene regulation at a previously unprecedented level of detail, where our framework can create testable hypothesis of promoter logic. PMID:24476912

  20. Predicting Displaceable Water Sites Using Mixed-Solvent Molecular Dynamics.

    PubMed

    Graham, Sarah E; Smith, Richard D; Carlson, Heather A

    2018-02-26

    Water molecules are an important factor in protein-ligand binding. Upon binding of a ligand with a protein's surface, waters can either be displaced by the ligand or may be conserved and possibly bridge interactions between the protein and ligand. Depending on the specific interactions made by the ligand, displacing waters can yield a gain in binding affinity. The extent to which binding affinity may increase is difficult to predict, as the favorable displacement of a water molecule is dependent on the site-specific interactions made by the water and the potential ligand. Several methods have been developed to predict the location of water sites on a protein's surface, but the majority of methods are not able to take into account both protein dynamics and the interactions made by specific functional groups. Mixed-solvent molecular dynamics (MixMD) is a cosolvent simulation technique that explicitly accounts for the interaction of both water and small molecule probes with a protein's surface, allowing for their direct competition. This method has previously been shown to identify both active and allosteric sites on a protein's surface. Using a test set of eight systems, we have developed a method using MixMD to identify conserved and displaceable water sites. Conserved sites can be determined by an occupancy-based metric to identify sites which are consistently occupied by water even in the presence of probe molecules. Conversely, displaceable water sites can be found by considering the sites which preferentially bind probe molecules. Furthermore, the inclusion of six probe types allows the MixMD method to predict which functional groups are capable of displacing which water sites. The MixMD method consistently identifies sites which are likely to be nondisplaceable and predicts the favorable displacement of water sites that are known to be displaced upon ligand binding.

  1. Insights into the binding behavior of native and non-native cytochromes to photosystem I from Thermosynechococcus elongatus.

    PubMed

    Kölsch, Adrian; Hejazi, Mahdi; Stieger, Kai R; Feifel, Sven C; Kern, Jan F; Müh, Frank; Lisdat, Fred; Lokstein, Heiko; Zouni, Athina

    2018-06-08

    The binding of photosystem I (PS I) from Thermosynechococcus elongatus to the native cytochrome (cyt) c 6 and cyt c from horse heart (cyt c HH ) was analyzed by oxygen consumption measurements, isothermal titration calorimetry (ITC), and rigid body docking combined with electrostatic computations of binding energies. Although PS I has a higher affinity for cyt c HH than for cyt c 6 , the influence of ionic strength and pH on binding is different in the two cases. ITC and theoretical computations revealed the existence of unspecific binding sites for cyt c HH besides one specific binding site close to P 700 Binding to PS I was found to be the same for reduced and oxidized cyt c HH Based on this information, suitable conditions for cocrystallization of cyt c HH with PS I were found, resulting in crystals with a PS I:cyt c HH ratio of 1:1. A crystal structure at 3.4-Å resolution was obtained, but cyt c HH cannot be identified in the electron density map because of unspecific binding sites and/or high flexibility at the specific binding site. Modeling the binding of cyt c 6 to PS I revealed a specific binding site where the distance and orientation of cyt c 6 relative to P 700 are comparable with cyt c 2 from purple bacteria relative to P 870 This work provides new insights into the binding modes of different cytochromes to PS I, thus facilitating steps toward solving the PS I-cyt c costructure and a more detailed understanding of natural electron transport processes.

  2. Analysis of an artificial zinc finger epigenetic modulator: widespread binding but limited regulation

    PubMed Central

    Grimmer, Matthew R.; Stolzenburg, Sabine; Ford, Ethan; Lister, Ryan; Blancafort, Pilar; Farnham, Peggy J.

    2014-01-01

    Artificial transcription factors (ATFs) and genomic nucleases based on a DNA binding platform consisting of multiple zinc finger domains are currently being developed for clinical applications. However, no genome-wide investigations into their binding specificity have been performed. We have created six-finger ATFs to target two different 18 nt regions of the human SOX2 promoter; each ATF is constructed such that it contains or lacks a super KRAB domain (SKD) that interacts with a complex containing repressive histone methyltransferases. ChIP-seq analysis of the effector-free ATFs in MCF7 breast cancer cells identified thousands of binding sites, mostly in promoter regions; the addition of an SKD domain increased the number of binding sites ∼5-fold, with a majority of the new sites located outside of promoters. De novo motif analyses suggest that the lack of binding specificity is due to subsets of the finger domains being used for genomic interactions. Although the ATFs display widespread binding, few genes showed expression differences; genes repressed by the ATF-SKD have stronger binding sites and are more enriched for a 12 nt motif. Interestingly, epigenetic analyses indicate that the transcriptional repression caused by the ATF-SKD is not due to changes in active histone modifications. PMID:25122745

  3. aPPRove: An HMM-Based Method for Accurate Prediction of RNA-Pentatricopeptide Repeat Protein Binding Events

    PubMed Central

    Harrison, Thomas; Ruiz, Jaime; Sloan, Daniel B.; Ben-Hur, Asa; Boucher, Christina

    2016-01-01

    Pentatricopeptide repeat containing proteins (PPRs) bind to RNA transcripts originating from mitochondria and plastids. There are two classes of PPR proteins. The P class contains tandem P-type motif sequences, and the PLS class contains alternating P, L and S type sequences. In this paper, we describe a novel tool that predicts PPR-RNA interaction; specifically, our method, which we call aPPRove, determines where and how a PLS-class PPR protein will bind to RNA when given a PPR and one or more RNA transcripts by using a combinatorial binding code for site specificity proposed by Barkan et al. Our results demonstrate that aPPRove successfully locates how and where a PPR protein belonging to the PLS class can bind to RNA. For each binding event it outputs the binding site, the amino-acid-nucleotide interaction, and its statistical significance. Furthermore, we show that our method can be used to predict binding events for PLS-class proteins using a known edit site and the statistical significance of aligning the PPR protein to that site. In particular, we use our method to make a conjecture regarding an interaction between CLB19 and the second intronic region of ycf3. The aPPRove web server can be found at www.cs.colostate.edu/~approve. PMID:27560805

  4. Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction.

    PubMed

    Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H

    2017-01-09

    The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Translation of Polioviral mRNA Is Inhibited by Cleavage of Polypyrimidine Tract-Binding Proteins Executed by Polioviral 3Cpro

    PubMed Central

    Back, Sung Hoon; Kim, Yoon Ki; Kim, Woo Jae; Cho, Sungchan; Oh, Hoe Rang; Kim, Jung-Eun; Jang, Sung Key

    2002-01-01

    The translation of polioviral mRNA occurs through an internal ribosomal entry site (IRES). Several RNA-binding proteins, such as polypyrimidine tract-binding protein (PTB) and poly(rC)-binding protein (PCBP), are required for the poliovirus IRES-dependent translation. Here we report that a poliovirus protein, 3Cpro (and/or 3CDpro), cleaves PTB isoforms (PTB1, PTB2, and PTB4). Three 3Cpro target sites (one major target site and two minor target sites) exist in PTBs. PTB fragments generated by poliovirus infection are redistributed to the cytoplasm from the nucleus, where most of the intact PTBs are localized. Moreover, these PTB fragments inhibit polioviral IRES-dependent translation in a cell-based assay system. We speculate that the proteolytic cleavage of PTBs may contribute to the molecular switching from translation to replication of polioviral RNA. PMID:11836431

  6. Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

    PubMed

    Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

    2018-03-28

    Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

  7. Extended Graph-Based Models for Enhanced Similarity Search in Cavbase.

    PubMed

    Krotzky, Timo; Fober, Thomas; Hüllermeier, Eyke; Klebe, Gerhard

    2014-01-01

    To calculate similarities between molecular structures, measures based on the maximum common subgraph are frequently applied. For the comparison of protein binding sites, these measures are not fully appropriate since graphs representing binding sites on a detailed atomic level tend to get very large. In combination with an NP-hard problem, a large graph leads to a computationally demanding task. Therefore, for the comparison of binding sites, a less detailed coarse graph model is used building upon so-called pseudocenters. Consistently, a loss of structural data is caused since many atoms are discarded and no information about the shape of the binding site is considered. This is usually resolved by performing subsequent calculations based on additional information. These steps are usually quite expensive, making the whole approach very slow. The main drawback of a graph-based model solely based on pseudocenters, however, is the loss of information about the shape of the protein surface. In this study, we propose a novel and efficient modeling formalism that does not increase the size of the graph model compared to the original approach, but leads to graphs containing considerably more information assigned to the nodes. More specifically, additional descriptors considering surface characteristics are extracted from the local surface and attributed to the pseudocenters stored in Cavbase. These properties are evaluated as additional node labels, which lead to a gain of information and allow for much faster but still very accurate comparisons between different structures.

  8. Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method.

    PubMed

    Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

    2014-08-01

    Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

  9. Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method

    NASA Astrophysics Data System (ADS)

    Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

    2014-08-01

    Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

  10. ProBiS tools (algorithm, database, and web servers) for predicting and modeling of biologically interesting proteins.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2017-09-01

    ProBiS (Protein Binding Sites) Tools consist of algorithm, database, and web servers for prediction of binding sites and protein ligands based on the detection of structurally similar binding sites in the Protein Data Bank. In this article, we review the operations that ProBiS Tools perform, provide comments on the evolution of the tools, and give some implementation details. We review some of its applications to biologically interesting proteins. ProBiS Tools are freely available at http://probis.cmm.ki.si and http://probis.nih.gov. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

    2011-07-29

    Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

  12. Volatile anesthetics, not intravenous anesthetic propofol bind to and attenuate the activation of platelet receptor integrin αIIbβ3.

    PubMed

    Yuki, Koichi; Bu, Weiming; Shimaoka, Motomu; Eckenhoff, Roderic

    2013-01-01

    In clinical reports, the usage of isoflurane and sevoflurane was associated with more surgical field bleeding in endoscopic sinus surgeries as compared to propofol. The activation of platelet receptor αIIbβ3 is a crucial event for platelet aggregation and clot stability. Here we studied the effect of isoflurane, sevoflurane, and propofol on the activation of αIIbβ3. The effect of anesthetics on the activation of αIIbβ3 was probed using the activation sensitive antibody PAC-1 in both cell-based (platelets and αIIbβ3 transfectants) and cell-free assays. The binding sites of isoflurane on αIIbβ3 were explored using photoactivatable isoflurane (azi-isoflurane). The functional implication of revealed isoflurane binding sites were studied using alanine-scanning mutagenesis. Isoflurane and sevoflurane diminished the binding of PAC-1 to wild-type αIIbβ3 transfectants, but not to the high-affinity mutant, β3-N305T. Both anesthetics also impaired PAC-1 binding in a cell-free assay. In contrast, propofol did not affect the activation of αIIbβ3. Residues adducted by azi-isoflurane were near the calcium binding site (an important regulatory site termed SyMBS) just outside of the ligand binding site. The mutagenesis experiments demonstrated that these adducted residues were important in regulating integrin activation. Isoflurane and sevoflurane, but not propofol, impaired the activation of αIIbβ3. Azi-isoflurane binds to the regulatory site of integrin αIIbβ3, thereby suggesting that isoflurane blocks ligand binding of αIIbβ3 in not a competitive, but an allosteric manner.

  13. Inherent limitations of probabilistic models for protein-DNA binding specificity

    PubMed Central

    Ruan, Shuxiang

    2017-01-01

    The specificities of transcription factors are most commonly represented with probabilistic models. These models provide a probability for each base occurring at each position within the binding site and the positions are assumed to contribute independently. The model is simple and intuitive and is the basis for many motif discovery algorithms. However, the model also has inherent limitations that prevent it from accurately representing true binding probabilities, especially for the highest affinity sites under conditions of high protein concentration. The limitations are not due to the assumption of independence between positions but rather are caused by the non-linear relationship between binding affinity and binding probability and the fact that independent normalization at each position skews the site probabilities. Generally probabilistic models are reasonably good approximations, but new high-throughput methods allow for biophysical models with increased accuracy that should be used whenever possible. PMID:28686588

  14. Towards novel therapeutics for HIV through fragment-based screening and drug design.

    PubMed

    Tiefendbrunn, Theresa; Stout, C David

    2014-01-01

    Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.

  15. Aging, estradiol and time of day differentially affect serotonin transporter binding in the central nervous system of female rats.

    PubMed

    Krajnak, Kristine; Rosewell, Katherine L; Duncan, Marilyn J; Wise, Phyllis M

    2003-11-14

    Estrogen-related changes in serotonergic neuronal transmission, including changes in the number of serotonin transporter (SERT) binding sites, have been cited as a possible cause for changes in mood, memory and sleep that occur during the menopausal transition. However, both aging and estradiol regulate SERT binding sites in the brain. The goal of this experiment was to determine how aging and estrogen interact to regulate SERT levels in the forebrain of young and reproductively senescent female Sprague-Dawley rats using [3H]paroxetine. The density of specific [3H]paroxetine binding in various brain regions was compared in young (2-4 months) and reproductively senescent (10-12 months) female rats at three times of day. In most brain regions examined, estrogen and aging independently increased the number of [3H]paroxetine binding sites. The only region that displayed a reduction in [3H]paroxetine binding with age was the suprachiasmatic nucleus (SCN). Time of day influenced [3H]paroxetine binding in the SCN and the paraventricular thalamus (PVT), two regions known to be involved in the regulation of circadian rhythms. Aging and/or estrogen also altered the pattern of binding in these regions. Thus, based on the results of this study, we conclude that aging and estrogen both act to regulate SERT binding sites in the forebrain of female rats, and that this regulation is region specific.

  16. Real-Time Ligand Binding Pocket Database Search Using Local Surface Descriptors

    PubMed Central

    Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

    2010-01-01

    Due to the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of a particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two dimensional pseudo-Zernike moments or the 3D Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark study employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed. PMID:20455259

  17. Real-time ligand binding pocket database search using local surface descriptors.

    PubMed

    Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

    2010-07-01

    Because of the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two-dimensional pseudo-Zernike moments or the three-dimensional Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark studies employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed.

  18. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  19. Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1.

    PubMed

    Malina, Jaroslav; Scott, Peter; Brabec, Viktor

    2015-06-23

    Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo-helical 'flexicate' complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3](4+) incorporating the common NN-NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo-helical complexes for cancer chemotherapy. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Identifying Interactions that Determine Fragment Binding at Protein Hotspots.

    PubMed

    Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L

    2016-05-12

    Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.

  1. Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Zhongchuan; Xie, Tian; Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of

    2016-03-24

    The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature ofmore » CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.« less

  2. Identification and characterization of the sodium-binding site of activated protein C.

    PubMed

    He, X; Rezaie, A R

    1999-02-19

    Activated protein C (APC) requires both Ca2+ and Na+ for its optimal catalytic function. In contrast to the Ca2+-binding sites, the Na+-binding site(s) of APC has not been identified. Based on a recent study with thrombin, the 221-225 loop is predicted to be a potential Na+-binding site in APC. The sequence of this loop is not conserved in trypsin. We engineered a Gla domainless form of protein C (GDPC) in which the 221-225 loop was replaced with the corresponding loop of trypsin. We found that activated GDPC (aGDPC) required Na+ (or other alkali cations) for its amidolytic activity with dissociation constant (Kd(app)) = 44.1 +/- 8.6 mM. In the presence of Ca2+, however, the requirement for Na+ by aGDPC was eliminated, and Na+ stimulated the cleavage rate 5-6-fold with Kd(app) = 2.3 +/- 0.3 mM. Both cations were required for efficient factor Va inactivation by aGDPC. In the presence of Ca2+, the catalytic function of the mutant was independent of Na+. Unlike aGDPC, the mutant did not discriminate among monovalent cations. We conclude that the 221-225 loop is a Na+-binding site in APC and that an allosteric link between the Na+ and Ca2+ binding loops modulates the structure and function of this anticoagulant enzyme.

  3. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold

    2010-10-01

    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  4. Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

    PubMed Central

    Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

    2016-01-01

    Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114

  5. Identification of cation-binding sites on actin that drive polymerization and modulate bending stiffness

    PubMed Central

    Kang, Hyeran; Bradley, Michael J.; McCullough, Brannon R.; Pierre, Anaëlle; Grintsevich, Elena E.; Reisler, Emil; De La Cruz, Enrique M.

    2012-01-01

    The assembly of actin monomers into filaments and networks plays vital roles throughout eukaryotic biology, including intracellular transport, cell motility, cell division, determining cellular shape, and providing cells with mechanical strength. The regulation of actin assembly and modulation of filament mechanical properties are critical for proper actin function. It is well established that physiological salt concentrations promote actin assembly and alter the overall bending mechanics of assembled filaments and networks. However, the molecular origins of these salt-dependent effects, particularly if they involve nonspecific ionic strength effects or specific ion-binding interactions, are unknown. Here, we demonstrate that specific cation binding at two discrete sites situated between adjacent subunits along the long-pitch helix drive actin polymerization and determine the filament bending rigidity. We classify the two sites as “polymerization” and “stiffness” sites based on the effects that mutations at the sites have on salt-dependent filament assembly and bending mechanics, respectively. These results establish the existence and location of the cation-binding sites that confer salt dependence to the assembly and mechanics of actin filaments. PMID:23027950

  6. HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

    PubMed Central

    Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

    1996-01-01

    HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

  7. Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carra,J.; McHugh, C.; Mulligan, S.

    2007-01-01

    We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding tomore » a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.« less

  8. Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction.

    PubMed

    Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

    2014-01-01

    Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.

  9. Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

    PubMed

    Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

    2006-07-07

    We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

  10. Understanding the mechanisms of protein-DNA interactions

    NASA Astrophysics Data System (ADS)

    Lavery, Richard

    2004-03-01

    Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

  11. Prediction of Protein-Protein Interaction Sites Using Electrostatic Desolvation Profiles

    PubMed Central

    Fiorucci, Sébastien; Zacharias, Martin

    2010-01-01

    Abstract Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. PMID:20441756

  12. Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

    PubMed

    Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

    2015-05-19

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

  13. Insulator function and topological domain border strength scale with architectural protein occupancy

    PubMed Central

    2014-01-01

    Background Chromosome conformation capture studies suggest that eukaryotic genomes are organized into structures called topologically associating domains. The borders of these domains are highly enriched for architectural proteins with characterized roles in insulator function. However, a majority of architectural protein binding sites localize within topological domains, suggesting sites associated with domain borders represent a functionally different subclass of these regulatory elements. How topologically associating domains are established and what differentiates border-associated from non-border architectural protein binding sites remain unanswered questions. Results By mapping the genome-wide target sites for several Drosophila architectural proteins, including previously uncharacterized profiles for TFIIIC and SMC-containing condensin complexes, we uncover an extensive pattern of colocalization in which architectural proteins establish dense clusters at the borders of topological domains. Reporter-based enhancer-blocking insulator activity as well as endogenous domain border strength scale with the occupancy level of architectural protein binding sites, suggesting co-binding by architectural proteins underlies the functional potential of these loci. Analyses in mouse and human stem cells suggest that clustering of architectural proteins is a general feature of genome organization, and conserved architectural protein binding sites may underlie the tissue-invariant nature of topologically associating domains observed in mammals. Conclusions We identify a spectrum of architectural protein occupancy that scales with the topological structure of chromosomes and the regulatory potential of these elements. Whereas high occupancy architectural protein binding sites associate with robust partitioning of topologically associating domains and robust insulator function, low occupancy sites appear reserved for gene-specific regulation within topological domains. PMID:24981874

  14. Interaction of Zn(II)bleomycin-A2 and Zn(II)peplomycin with a DNA hairpin containing the 5'-GT-3' binding site in comparison with the 5'-GC-3' binding site studied by NMR spectroscopy.

    PubMed

    Follett, Shelby E; Ingersoll, Azure D; Murray, Sally A; Reilly, Teresa M; Lehmann, Teresa E

    2017-10-01

    Bleomycins are a group of glycopeptide antibiotics synthesized by Streptomyces verticillus that are widely used for the treatment of various neoplastic diseases. These antibiotics have the ability to chelate a metal center, mainly Fe(II), and cause site-specific DNA cleavage. Bleomycins are differentiated by their C-terminal regions. Although this antibiotic family is a successful course of treatment for some types of cancers, it is known to cause pulmonary fibrosis. Previous studies have identified that bleomycin-related pulmonary toxicity is linked to the C-terminal region of these drugs. This region has been shown to closely interact with DNA. We examined the binding of Zn(II)peplomycin and Zn(II)bleomycin-A 2 to a DNA hairpin of sequence 5'-CCAGTATTTTTACTGG-3', containing the binding site 5'-GT-3', and compared the results with those obtained from our studies of the same MBLMs bound to a DNA hairpin containing the binding site 5'-GC-3'. We provide evidence that the DNA base sequence has a strong impact in the final structure of the drug-target complex.

  15. SNP2TFBS - a database of regulatory SNPs affecting predicted transcription factor binding site affinity.

    PubMed

    Kumar, Sunil; Ambrosini, Giovanna; Bucher, Philipp

    2017-01-04

    SNP2TFBS is a computational resource intended to support researchers investigating the molecular mechanisms underlying regulatory variation in the human genome. The database essentially consists of a collection of text files providing specific annotations for human single nucleotide polymorphisms (SNPs), namely whether they are predicted to abolish, create or change the affinity of one or several transcription factor (TF) binding sites. A SNP's effect on TF binding is estimated based on a position weight matrix (PWM) model for the binding specificity of the corresponding factor. These data files are regenerated at regular intervals by an automatic procedure that takes as input a reference genome, a comprehensive SNP catalogue and a collection of PWMs. SNP2TFBS is also accessible over a web interface, enabling users to view the information provided for an individual SNP, to extract SNPs based on various search criteria, to annotate uploaded sets of SNPs or to display statistics about the frequencies of binding sites affected by selected SNPs. Homepage: http://ccg.vital-it.ch/snp2tfbs/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Insulin Mimetic Peptide Disrupts the Primary Binding Site of the Insulin Receptor*

    PubMed Central

    Lawrence, Callum F.; Margetts, Mai B.; Menting, John G.; Smith, Nicholas A.; Smith, Brian J.; Ward, Colin W.; Lawrence, Michael C.

    2016-01-01

    Sets of synthetic peptides that interact with the insulin receptor ectodomain have been discovered by phage display and reported in the literature. These peptides were grouped into three classes termed Site 1, Site 2, and Site 3 based on their mutual competition of binding to the receptor. Further refinement has yielded, in particular, a 36-residue Site 2-Site 1 fusion peptide, S519, that binds the insulin receptor with subnanomolar affinity and exhibits agonist activity in both lipogenesis and glucose uptake assays. Here, we report three-dimensional crystallographic detail of the interaction of the C-terminal, 16-residue Site 1 component (S519C16) of S519 with the first leucine-rich repeat domain (L1) of the insulin receptor. Our structure shows that S519C16 binds to the same site on the L1 surface as that occupied by a critical component of the primary binding site, namely the helical C-terminal segment of the insulin receptor α-chain (termed αCT). In particular, the two phenylalanine residues within the FYXWF motif of S519C16 are seen to engage the insulin receptor L1 domain surface in a fashion almost identical to the respective αCT residues Phe701 and Phe705. The structure provides a platform for the further development of peptidic and/or small molecule agents directed toward the insulin receptor and/or the type 1 insulin-like growth factor receptor. PMID:27281820

  17. Structure- and Modeling-based Identification of the Adenovirus E4orf4 Binding Site in the Protein Phosphatase 2A B55α Subunit*

    PubMed Central

    Horowitz, Ben; Sharf, Rakefet; Avital-Shacham, Meirav; Pechkovsky, Antonina; Kleinberger, Tamar

    2013-01-01

    The adenovirus E4orf4 protein regulates the progression of viral infection and when expressed outside the context of the virus it induces nonclassical, cancer cell-specific apoptosis. All E4orf4 functions known to date require an interaction between E4orf4 and protein phosphatase 2A (PP2A), which is mediated through PP2A regulatory B subunits. Specifically, an interaction with the B55α subunit is required for induction of cell death by E4orf4. To gain a better insight into the E4orf4-PP2A interaction, mapping of the E4orf4 interaction site in PP2A-B55α has been undertaken. To this end we used a combination of bioinformatics analyses of PP2A-B55α and of E4orf4, which led to the prediction of E4orf4 binding sites on the surface of PP2A-B55α. Mutation analysis, immunoprecipitation, and GST pulldown assays based on the theoretical predictions revealed that the E4orf4 binding site included the α1 and α2 helices described in the B55α structure and involved at least three residues located in these helices facing each other. Loss of E4orf4 binding was accompanied by reduced contribution of the B55α mutants to E4orf4-induced cell death. The identified E4orf4 binding domain lies above the previously described substrate binding site and does not overlap it, although its location could be consistent with direct or indirect effects on substrate binding. This work assigns for the first time a functional significance to the α1,α2 helices of B55α, and we suggest that the binding site defined by these helices could also contribute to interactions between PP2A and some of its cellular regulators. PMID:23530045

  18. Molecular Hybridization of Potent and Selective γ-Hydroxybutyric Acid (GHB) Ligands: Design, Synthesis, Binding Studies, and Molecular Modeling of Novel 3-Hydroxycyclopent-1-enecarboxylic Acid (HOCPCA) and trans-γ-Hydroxycrotonic Acid (T-HCA) Analogs.

    PubMed

    Krall, Jacob; Jensen, Claus Hatt; Bavo, Francesco; Falk-Petersen, Christina Birkedahl; Haugaard, Anne Stæhr; Vogensen, Stine Byskov; Tian, Yongsong; Nittegaard-Nielsen, Mia; Sigurdardóttir, Sara Björk; Kehler, Jan; Kongstad, Kenneth Thermann; Gloriam, David E; Clausen, Rasmus Prætorius; Harpsøe, Kasper; Wellendorph, Petrine; Frølund, Bente

    2017-11-09

    γ-Hydroxybutyric acid (GHB) is a neuroactive substance with specific high-affinity binding sites. To facilitate target identification and ligand optimization, we herein report a comprehensive structure-affinity relationship study for novel ligands targeting these binding sites. A molecular hybridization strategy was used based on the conformationally restricted 3-hydroxycyclopent-1-enecarboxylic acid (HOCPCA) and the linear GHB analog trans-4-hydroxycrotonic acid (T-HCA). In general, all structural modifications performed on HOCPCA led to reduced affinity. In contrast, introduction of diaromatic substituents into the 4-position of T-HCA led to high-affinity analogs (medium nanomolar K i ) for the GHB high-affinity binding sites as the most high-affinity analogs reported to date. The SAR data formed the basis for a three-dimensional pharmacophore model for GHB ligands, which identified molecular features important for high-affinity binding, with high predictive validity. These findings will be valuable in the further processes of both target characterization and ligand identification for the high-affinity GHB binding sites.

  19. pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families

    PubMed Central

    Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas

    2014-01-01

    The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248

  20. Hidden relationships between metalloproteins unveiled by structural comparison of their metal sites

    NASA Astrophysics Data System (ADS)

    Valasatava, Yana; Andreini, Claudia; Rosato, Antonio

    2015-03-01

    Metalloproteins account for a substantial fraction of all proteins. They incorporate metal atoms, which are required for their structure and/or function. Here we describe a new computational protocol to systematically compare and classify metal-binding sites on the basis of their structural similarity. These sites are extracted from the MetalPDB database of minimal functional sites (MFSs) in metal-binding biological macromolecules. Structural similarity is measured by the scoring function of the available MetalS2 program. Hierarchical clustering was used to organize MFSs into clusters, for each of which a representative MFS was identified. The comparison of all representative MFSs provided a thorough structure-based classification of the sites analyzed. As examples, the application of the proposed computational protocol to all heme-binding proteins and zinc-binding proteins of known structure highlighted the existence of structural subtypes, validated known evolutionary links and shed new light on the occurrence of similar sites in systems at different evolutionary distances. The present approach thus makes available an innovative viewpoint on metalloproteins, where the functionally crucial metal sites effectively lead the discovery of structural and functional relationships in a largely protein-independent manner.

  1. Proposed Mode of Binding and Action of Positive Allosteric Modulators at Opioid Receptors

    PubMed Central

    2016-01-01

    Available crystal structures of opioid receptors provide a high-resolution picture of ligand binding at the primary (“orthosteric”) site, that is, the site targeted by endogenous ligands. Recently, positive allosteric modulators of opioid receptors have also been discovered, but their modes of binding and action remain unknown. Here, we use a metadynamics-based strategy to efficiently sample the binding process of a recently discovered positive allosteric modulator of the δ-opioid receptor, BMS-986187, in the presence of the orthosteric agonist SNC-80, and with the receptor embedded in an explicit lipid–water environment. The dynamics of BMS-986187 were enhanced by biasing the potential acting on the ligand–receptor distance and ligand–receptor interaction contacts. Representative lowest-energy structures from the reconstructed free-energy landscape revealed two alternative ligand binding poses at an allosteric site delineated by transmembrane (TM) helices TM1, TM2, and TM7, with some participation of TM6. Mutations of amino acid residues at these proposed allosteric sites were found to either affect the binding of BMS-986187 or its ability to modulate the affinity and/or efficacy of SNC-80. Taken together, these combined experimental and computational studies provide the first atomic-level insight into the modulation of opioid receptor binding and signaling by allosteric modulators. PMID:26841170

  2. Models of metal binding structures in fulvic acid from the Suwannee River, Georgia

    USGS Publications Warehouse

    Leenheer, J.A.; Brown, G.K.; MacCarthy, P.; Cabaniss, S.E.

    1998-01-01

    Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The 'metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-1R spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short- chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The `metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-IR spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.

  3. Properties of the anion-binding site of pharaonis Halorhodopsin studied by ultrafast pump-probe spectroscopy and low-temperature FTIR spectroscopy.

    PubMed

    Nakashima, Keisuke; Nakamura, Takumi; Takeuchi, Satoshi; Shibata, Mikihiro; Demura, Makoto; Tahara, Tahei; Kandori, Hideki

    2009-06-18

    Halorhodopsin (HR) is a light-driven chloride pump. Cl(-) is bound in the Schiff base region of the retinal chromophore, and unidirectional Cl(-) transport is probably enforced by the specific hydrogen-bonding interaction with the protonated Schiff base and internal water molecules. It is known that HR from Natronobacterium pharaonis (pHR) also pumps NO(3)(-) with similar efficiency, suggesting that NO(3)(-) binds to the Cl(-)-binding site. In the present study, we investigated the properties of the anion-binding site by means of ultrafast pump-probe spectroscopy and low-temperature FTIR spectroscopy. The obtained data were surprisingly similar between pHR-NO(3)(-) and pHR-Cl(-), even though the shapes and sizes of the two anions are quite different. Femtosecond pump-probe spectroscopy showed very similar excited-state dynamics between pHR-NO(3)(-) and pHR-Cl(-). Low-temperature FTIR spectroscopy of unlabeled and [zeta-(15)N]Lys-labeled pHR revealed almost identical hydrogen-bonding strengths of the protonated retinal Schiff base between pHR-NO(3)(-) and pHR-Cl(-), which is similarly strengthened after retinal isomerization. There were spectral variations for water stretching vibrations between pHR-NO(3)(-) and pHR-Cl(-), suggesting that the water molecules hydrate each anion. Nevertheless, the overall spectral features were similar for the two species. These observations strongly suggest that the anion-binding site has a flexible structure and that the interaction between retinal and the anions is weak, despite the presence of an electrostatic interaction. Such a flexible hydrogen-bonding network in the Schiff base region in HR appears to be in remarkable contrast to that in light-driven proton-pumping proteins.

  4. Coherent Conformational Degrees of Freedom as a Structural Basis for Allosteric Communication

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Conformational changes in allosteric regulation can to a large extent be described as motion along one or a few coherent degrees of freedom. The states involved are inherent to the protein, in the sense that they are visited by the protein also in the absence of effector ligands. Previously, we developed the measure binding leverage to find sites where ligand binding can shift the conformational equilibrium of a protein. Binding leverage is calculated for a set of motion vectors representing independent conformational degrees of freedom. In this paper, to analyze allosteric communication between binding sites, we introduce the concept of leverage coupling, based on the assumption that only pairs of sites that couple to the same conformational degrees of freedom can be allosterically connected. We demonstrate how leverage coupling can be used to analyze allosteric communication in a range of enzymes (regulated by both ligand binding and post-translational modifications) and huge molecular machines such as chaperones. Leverage coupling can be calculated for any protein structure to analyze both biological and latent catalytic and regulatory sites. PMID:22174669

  5. Structural Basis for the Recognition of Tyrosine-based Sorting Signals by the μ3A Subunit of the AP-3 Adaptor Complex*

    PubMed Central

    Mardones, Gonzalo A.; Burgos, Patricia V.; Lin, Yimo; Kloer, Daniel P.; Magadán, Javier G.; Hurley, James H.; Bonifacino, Juan S.

    2013-01-01

    Tyrosine-based signals fitting the YXXØ motif mediate sorting of transmembrane proteins to endosomes, lysosomes, the basolateral plasma membrane of polarized epithelial cells, and the somatodendritic domain of neurons through interactions with the homologous μ1, μ2, μ3, and μ4 subunits of the corresponding AP-1, AP-2, AP-3, and AP-4 complexes. Previous x-ray crystallographic analyses identified distinct binding sites for YXXØ signals on μ2 and μ4, which were located on opposite faces of the proteins. To elucidate the mode of recognition of YXXØ signals by other members of the μ family, we solved the crystal structure at 1.85 Å resolution of the C-terminal domain of the μ3 subunit of AP-3 (isoform A) in complex with a peptide encoding a YXXØ signal (SDYQRL) from the trans-Golgi network protein TGN38. The μ3A C-terminal domain consists of an immunoglobulin-like β-sandwich organized into two subdomains, A and B. The YXXØ signal binds in an extended conformation to a site on μ3A subdomain A, at a location similar to the YXXØ-binding site on μ2 but not μ4. The binding sites on μ3A and μ2 exhibit similarities and differences that account for the ability of both proteins to bind distinct sets of YXXØ signals. Biochemical analyses confirm the identification of the μ3A site and show that this protein binds YXXØ signals with 14–19 μm affinity. The surface electrostatic potential of μ3A is less basic than that of μ2, in part explaining the association of AP-3 with intracellular membranes having less acidic phosphoinositides. PMID:23404500

  6. Structural basis for the recognition of tyrosine-based sorting signals by the μ3A subunit of the AP-3 adaptor complex.

    PubMed

    Mardones, Gonzalo A; Burgos, Patricia V; Lin, Yimo; Kloer, Daniel P; Magadán, Javier G; Hurley, James H; Bonifacino, Juan S

    2013-03-29

    Tyrosine-based signals fitting the YXXØ motif mediate sorting of transmembrane proteins to endosomes, lysosomes, the basolateral plasma membrane of polarized epithelial cells, and the somatodendritic domain of neurons through interactions with the homologous μ1, μ2, μ3, and μ4 subunits of the corresponding AP-1, AP-2, AP-3, and AP-4 complexes. Previous x-ray crystallographic analyses identified distinct binding sites for YXXØ signals on μ2 and μ4, which were located on opposite faces of the proteins. To elucidate the mode of recognition of YXXØ signals by other members of the μ family, we solved the crystal structure at 1.85 Å resolution of the C-terminal domain of the μ3 subunit of AP-3 (isoform A) in complex with a peptide encoding a YXXØ signal (SDYQRL) from the trans-Golgi network protein TGN38. The μ3A C-terminal domain consists of an immunoglobulin-like β-sandwich organized into two subdomains, A and B. The YXXØ signal binds in an extended conformation to a site on μ3A subdomain A, at a location similar to the YXXØ-binding site on μ2 but not μ4. The binding sites on μ3A and μ2 exhibit similarities and differences that account for the ability of both proteins to bind distinct sets of YXXØ signals. Biochemical analyses confirm the identification of the μ3A site and show that this protein binds YXXØ signals with 14-19 μm affinity. The surface electrostatic potential of μ3A is less basic than that of μ2, in part explaining the association of AP-3 with intracellular membranes having less acidic phosphoinositides.

  7. Identification of B. anthracis N(5)-carboxyaminoimidazole ribonucleotide mutase (PurE) active site binding compounds via fragment library screening.

    PubMed

    Lei, Hao; Jones, Christopher; Zhu, Tian; Patel, Kavankumar; Wolf, Nina M; Fung, Leslie W-M; Lee, Hyun; Johnson, Michael E

    2016-02-15

    The de novo purine biosynthesis pathway is an attractive target for antibacterial drug design, and PurE from this pathway has been identified to be crucial for Bacillus anthracis survival in serum. In this study we adopted a fragment-based hit discovery approach, using three screening methods-saturation transfer difference nucleus magnetic resonance (STD-NMR), water-ligand observed via gradient spectroscopy (WaterLOGSY) NMR, and surface plasmon resonance (SPR), against B. anthracis PurE (BaPurE) to identify active site binding fragments by initially testing 352 compounds in a Zenobia fragment library. Competition STD NMR with the BaPurE product effectively eliminated non-active site binding hits from the primary hits, selecting active site binders only. Binding affinities (dissociation constant, KD) of these compounds varied between 234 and 301μM. Based on test results from the Zenobia compounds, we subsequently developed and applied a streamlined fragment screening strategy to screen a much larger library consisting of 3000 computationally pre-selected fragments. Thirteen final fragment hits were confirmed to exhibit binding affinities varying from 14μM to 700μM, which were categorized into five different basic scaffolds. All thirteen fragment hits have ligand efficiencies higher than 0.30. We demonstrated that at least two fragments from two different scaffolds exhibit inhibitory activity against the BaPurE enzyme. Published by Elsevier Ltd.

  8. Understanding Cryptic Pocket Formation in Protein Targets by Enhanced Sampling Simulations.

    PubMed

    Oleinikovas, Vladimiras; Saladino, Giorgio; Cossins, Benjamin P; Gervasio, Francesco L

    2016-11-02

    Cryptic pockets, that is, sites on protein targets that only become apparent when drugs bind, provide a promising alternative to classical binding sites for drug development. Here, we investigate the nature and dynamical properties of cryptic sites in four pharmacologically relevant targets, while comparing the efficacy of various simulation-based approaches in discovering them. We find that the studied cryptic sites do not correspond to local minima in the computed conformational free energy landscape of the unliganded proteins. They thus promptly close in all of the molecular dynamics simulations performed, irrespective of the force-field used. Temperature-based enhanced sampling approaches, such as Parallel Tempering, do not improve the situation, as the entropic term does not help in the opening of the sites. The use of fragment probes helps, as in long simulations occasionally it leads to the opening and binding to the cryptic sites. Our observed mechanism of cryptic site formation is suggestive of an interplay between two classical mechanisms: induced-fit and conformational selection. Employing this insight, we developed a novel Hamiltonian Replica Exchange-based method "SWISH" (Sampling Water Interfaces through Scaled Hamiltonians), which combined with probes resulted in a promising general approach for cryptic site discovery. We also addressed the issue of "false-positives" and propose a simple approach to distinguish them from druggable cryptic pockets. Our simulations, whose cumulative sampling time was more than 200 μs, help in clarifying the molecular mechanism of pocket formation, providing a solid basis for the choice of an efficient computational method.

  9. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  10. Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

    PubMed

    Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

    2013-06-14

    Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

  11. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  12. A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

    PubMed

    Isalan, M; Klug, A; Choo, Y

    2001-07-01

    DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

  13. Structure-affinity relationships for the binding of actinomycin D to DNA

    NASA Astrophysics Data System (ADS)

    Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

    1997-03-01

    Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

  14. msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding

    PubMed Central

    Gilad, Yoav; Pritchard, Jonathan K.; Stephens, Matthew

    2015-01-01

    Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede. PMID:26406244

  15. msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding.

    PubMed

    Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew

    2015-01-01

    Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.

  16. Which model based on fluorescence quenching is suitable to study the interaction between trans-resveratrol and BSA?

    NASA Astrophysics Data System (ADS)

    Wei, Xin Lin; Xiao, Jian Bo; Wang, Yuanfeng; Bai, Yalong

    2010-01-01

    There are several models by means of quenching fluorescence of BSA to determine the binding parameters. The binding parameters obtained from different models are quite different from each other. Which model is suitable to study the interaction between trans-resveratrol and BSA? Herein, twelve models based fluorescence quenching of BSA were compared. The number of binding sites increasing with increased binding constant for similar compounds binding to BSA maybe one approach to resolve this question. For example, here eleven flavonoids were tested to illustrate that the double logarithm regression curve is suitable to study binding polyphenols to BSA.

  17. A structural informatics approach to mine kinase knowledge bases.

    PubMed

    Brooijmans, Natasja; Mobilio, Dominick; Walker, Gary; Nilakantan, Ramaswamy; Denny, Rajiah A; Feyfant, Eric; Diller, David; Bikker, Jack; Humblet, Christine

    2010-03-01

    In this paper, we describe a combination of structural informatics approaches developed to mine data extracted from existing structure knowledge bases (Protein Data Bank and the GVK database) with a focus on kinase ATP-binding site data. In contrast to existing systems that retrieve and analyze protein structures, our techniques are centered on a database of ligand-bound geometries in relation to residues lining the binding site and transparent access to ligand-based SAR data. We illustrate the systems in the context of the Abelson kinase and related inhibitor structures. 2009 Elsevier Ltd. All rights reserved.

  18. Structural insights into substrate and inhibitor binding sites in human indoleamine 2,3-dioxygenase 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lewis-Ballester, Ariel; Pham, Khoa N.; Batabyal, Dipanwita

    Human indoleamine 2,3-dioxygenase 1 (hIDO1) is an attractive cancer immunotherapeutic target owing to its role in promoting tumoral immune escape. However, drug development has been hindered by limited structural information. Here, we report the crystal structures of hIDO1 in complex with its substrate, Trp, an inhibitor, epacadostat, and/or an effector, indole ethanol (IDE). The data reveal structural features of the active site (Sa) critical for substrate activation; in addition, they disclose a new inhibitor-binding mode and a distinct small molecule binding site (Si). Structure-guided mutation of a critical residue, F270, to glycine perturbs the Si site, allowing structural determination ofmore » an inhibitory complex, where both the Sa and Si sites are occupied by Trp. The Si site offers a novel target site for allosteric inhibitors and a molecular explanation for the previously baffling substrate-inhibition behavior of the enzyme. Taken together, the data open exciting new avenues for structure-based drug design.« less

  19. Aminoalcohols as Probes of the Two-subsite Active Site of Beta-D-xylosidase from Selenomonas ruminantium

    USDA-ARS?s Scientific Manuscript database

    Catalysis and inhibitor binding by the GH43 beta-xylosidase are governed by the protonation state of catalytic base (D14, pKa 5.0) and catalytic acid (E186, pKa 7.2) which reside in subsite -1 of the two-subsite active site. Cationic aminoalcohols are shown to bind exclusively to subsite -1 of the ...

  20. Strong Enrichment of Aromatic Residues in Binding Sites from a Charge-neutralized Hyperthermostable Sso7d Scaffold Library.

    PubMed

    Traxlmayr, Michael W; Kiefer, Jonathan D; Srinivas, Raja R; Lobner, Elisabeth; Tisdale, Alison W; Mehta, Naveen K; Yang, Nicole J; Tidor, Bruce; Wittrup, K Dane

    2016-10-21

    The Sso7d protein from the hyperthermophilic archaeon Sulfolobus solfataricus is an attractive binding scaffold because of its small size (7 kDa), high thermal stability (T m of 98 °C), and absence of cysteines and glycosylation sites. However, as a DNA-binding protein, Sso7d is highly positively charged, introducing a strong specificity constraint for binding epitopes and leading to nonspecific interaction with mammalian cell membranes. In the present study, we report charge-neutralized variants of Sso7d that maintain high thermal stability. Yeast-displayed libraries that were based on this reduced charge Sso7d (rcSso7d) scaffold yielded binders with low nanomolar affinities against mouse serum albumin and several epitopes on human epidermal growth factor receptor. Importantly, starting from a charge-neutralized scaffold facilitated evolutionary adaptation of binders to differentially charged epitopes on mouse serum albumin and human epidermal growth factor receptor, respectively. Interestingly, the distribution of amino acids in the small and rigid binding surface of enriched rcSso7d-based binders is very different from that generally found in more flexible antibody complementarity-determining region loops but resembles the composition of antibody-binding energetic hot spots. Particularly striking was a strong enrichment of the aromatic residues Trp, Tyr, and Phe in rcSso7d-based binders. This suggests that the rigidity and small size of this scaffold determines the unusual amino acid composition of its binding sites, mimicking the energetic core of antibody paratopes. Despite the high frequency of aromatic residues, these rcSso7d-based binders are highly expressed, thermostable, and monomeric, suggesting that the hyperstability of the starting scaffold and the rigidness of the binding surface confer a high tolerance to mutation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

    PubMed Central

    Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

    2000-01-01

    The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

  2. Tacrine-based dual binding site acetylcholinesterase inhibitors as potential disease-modifying anti-Alzheimer drug candidates.

    PubMed

    Camps, Pelayo; Formosa, Xavier; Galdeano, Carles; Gómez, Tània; Muñoz-Torrero, Diego; Ramírez, Lorena; Viayna, Elisabet; Gómez, Elena; Isambert, Nicolás; Lavilla, Rodolfo; Badia, Albert; Clos, M Victòria; Bartolini, Manuela; Mancini, Francesca; Andrisano, Vincenza; Bidon-Chanal, Axel; Huertas, Oscar; Dafni, Thomai; Luque, F Javier

    2010-09-06

    Two novel families of dual binding site acetylcholinesterase (AChE) inhibitors have been developed, consisting of a tacrine or 6-chlorotacrine unit as the active site interacting moiety, either the 5,6-dimethoxy-2-[(4-piperidinyl)methyl]-1-indanone fragment of donepezil (or the indane derivative thereof) or a 5-phenylpyrano[3,2-c]quinoline system, reminiscent to the tryciclic core of propidium, as the peripheral site interacting unit, and a linker of suitable length as to allow the simultaneous binding at both sites. These hybrid compounds are all potent and selective inhibitors of human AChE, and more interestingly, are able to interfere in vitro both formation and aggregation of the beta-amyloid peptide, the latter effects endowing these compounds with the potential to modify Alzheimer's disease progression. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  3. Recognition of functional sites in protein structures.

    PubMed

    Shulman-Peleg, Alexandra; Nussinov, Ruth; Wolfson, Haim J

    2004-06-04

    Recognition of regions on the surface of one protein, that are similar to a binding site of another is crucial for the prediction of molecular interactions and for functional classifications. We first describe a novel method, SiteEngine, that assumes no sequence or fold similarities and is able to recognize proteins that have similar binding sites and may perform similar functions. We achieve high efficiency and speed by introducing a low-resolution surface representation via chemically important surface points, by hashing triangles of physico-chemical properties and by application of hierarchical scoring schemes for a thorough exploration of global and local similarities. We proceed to rigorously apply this method to functional site recognition in three possible ways: first, we search a given functional site on a large set of complete protein structures. Second, a potential functional site on a protein of interest is compared with known binding sites, to recognize similar features. Third, a complete protein structure is searched for the presence of an a priori unknown functional site, similar to known sites. Our method is robust and efficient enough to allow computationally demanding applications such as the first and the third. From the biological standpoint, the first application may identify secondary binding sites of drugs that may lead to side-effects. The third application finds new potential sites on the protein that may provide targets for drug design. Each of the three applications may aid in assigning a function and in classification of binding patterns. We highlight the advantages and disadvantages of each type of search, provide examples of large-scale searches of the entire Protein Data Base and make functional predictions.

  4. Structural determinants of ubiquitin-CXC chemokine receptor 4 interaction.

    PubMed

    Saini, Vikas; Marchese, Adriano; Tang, Wei-Jen; Majetschak, Matthias

    2011-12-23

    Ubiquitin, a post-translational protein modifier inside the cell, functions as a CXC chemokine receptor (CXCR) 4 agonist outside the cell. However, the structural determinants of the interaction between extracellular ubiquitin and CXCR4 remain unknown. Utilizing C-terminal truncated ubiquitin and ubiquitin mutants, in which surface residues that are known to interact with ubiquitin binding domains in interacting proteins are mutated (Phe-4, Leu-8, Ile-44, Asp-58, Val-70), we provide evidence that the ubiquitin-CXCR4 interaction follows a two-site binding mechanism in which the hydrophobic surfaces surrounding Phe-4 and Val-70 are important for receptor binding, whereas the flexible C terminus facilitates receptor activation. Based on these findings and the available crystal structures, we then modeled the ubiquitin-CXCR4 interface with the RosettaDock software followed by small manual adjustments, which were guided by charge complementarity and anticipation of a conformational switch of CXCR4 upon activation. This model suggests three residues of CXCR4 (Phe-29, Phe-189, Lys-271) as potential interaction sites. Binding studies with HEK293 cells overexpressing wild type and CXCR4 after site-directed mutagenesis confirm that these residues are important for ubiquitin binding but that they do not contribute to the binding of stromal cell-derived factor 1α. Our findings suggest that the structural determinants of the CXCR4 agonist activity of ubiquitin mimic the typical structure-function relationship of chemokines. Furthermore, we provide evidence for separate and specific ligand binding sites on CXCR4. As exogenous ubiquitin has been shown to possess therapeutic potential, our findings are expected to facilitate the structure-based design of new compounds with ubiquitin-mimetic actions on CXCR4.

  5. Expression of melatonin receptors in arteries involved in thermoregulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Viswanathan, M.; Laitinen, J.T.; Saavedra, J.M.

    Melatonin binding sites were localized and characterized in the vasculature of the rat by using the melatonin analogue 2-(125I)iodomelatonin (125I-melatonin) and quantitative in vitro autoradiography. The expression of these sites was restricted to the caudal artery and to the arteries that form the circle of Willis at the base of the brain. The arterial 125I-melatonin binding was stable, saturable, and reversible. Saturation studies revealed that the binding represented a single class of high-affinity binding sites with a dissociation constant (Kd) of 3.4 x 10(-11) M in the anterior cerebral artery and 1.05 x 10(-10) M in the caudal artery. Themore » binding capacities (Bmax) in these arteries were 19 and 15 fmol/mg of protein, respectively. The relative order of potency of indoles for inhibition of 125I-melatonin binding at these sites was typical of a melatonin receptor: 2-iodomelatonin greater than melatonin greater than N-acetylserotonin much much greater than 5-hydroxytryptamine. Norepinephrine-induced contraction of the caudal artery in vitro was significantly prolonged and potentiated by melatonin in a concentration-dependent manner, suggesting that these arterial binding sites are functional melatonin receptors. Neither primary steps in smooth muscle contraction (inositol phospholipid hydrolysis) nor relaxation (adenylate cyclase activation) were affected by melatonin. Melatonin, through its action on the tone of these arteries, may cause circulatory adjustments in these arteries, which are believed to be involved in thermoregulation.« less

  6. Validating metal binding sites in macromolecule structures using the CheckMyMetal web server

    PubMed Central

    Zheng, Heping; Chordia, Mahendra D.; Cooper, David R.; Chruszcz, Maksymilian; Müller, Peter; Sheldrick, George M.

    2015-01-01

    Metals play vital roles in both the mechanism and architecture of biological macromolecules. Yet structures of metal-containing macromolecules where metals are misidentified and/or suboptimally modeled are abundant in the Protein Data Bank (PDB). This shows the need for a diagnostic tool to identify and correct such modeling problems with metal binding environments. The "CheckMyMetal" (CMM) web server (http://csgid.org/csgid/metal_sites/) is a sophisticated, user-friendly web-based method to evaluate metal binding sites in macromolecular structures in respect to 7350 metal binding sites observed in a benchmark dataset of 2304 high resolution crystal structures. The protocol outlines how the CMM server can be used to detect geometric and other irregularities in the structures of metal binding sites and alert researchers to potential errors in metal assignment. The protocol also gives practical guidelines for correcting problematic sites by modifying the metal binding environment and/or redefining metal identity in the PDB file. Several examples where this has led to meaningful results are described in the anticipated results section. CMM was designed for a broad audience—biomedical researchers studying metal-containing proteins and nucleic acids—but is equally well suited for structural biologists to validate new structures during modeling or refinement. The CMM server takes the coordinates of a metal-containing macromolecule structure in the PDB format as input and responds within a few seconds for a typical protein structure modeled with a few hundred amino acids. PMID:24356774

  7. Tb3+-cleavage assays reveal specific Mg2+ binding sites necessary to pre-fold the btuB riboswitch for AdoCbl binding

    NASA Astrophysics Data System (ADS)

    Choudhary, Pallavi K.; Gallo, Sofia; Sigel, Roland K. O.

    2017-03-01

    Riboswitches are RNA elements that bind specific metabolites in order to regulate the gene expression involved in controlling the cellular concentration of the respective molecule or ion. Ligand recognition is mostly facilitated by Mg2+ mediated pre-organization of the riboswitch to an active tertiary fold. To predict these specific Mg2+ induced tertiary interactions of the btuB riboswitch from E. coli, we here report Mg2+ binding pockets in its aptameric part in both, the ligand-free and the ligand-bound form. An ensemble of weak and strong metal ion binding sites distributed over the entire aptamer was detected by terbium(III) cleavage assays, Tb3+ being an established Mg2+ mimic. Interestingly many of the Mn+ (n = 2 or 3) binding sites involve conserved bases within the class of coenzyme B12-binding riboswitches. Comparison with the published crystal structure of the coenzyme B12 riboswitch of S. thermophilum aided in identifying a common set of Mn+ binding sites that might be crucial for tertiary interactions involved in the organization of the aptamer. Our results suggest that Mn+ binding at strategic locations of the btuB riboswitch indeed facilitates the assembly of the binding pocket needed for ligand recognition. Binding of the specific ligand, coenzyme B12 (AdoCbl), to the btuB aptamer does however not lead to drastic alterations of these Mn+ binding cores, indicating the lack of a major rearrangement within the three-dimensional structure of the RNA. This finding is strengthened by Tb3+ mediated footprints of the riboswitch's structure in its ligand-free and ligand-bound state indicating that AdoCbl indeed induces local changes rather than a global structural rearrangement.

  8. The 1.3 A resolution structure of the RNA tridecamer r(GCGUUUGAAACGC): metal ion binding correlates with base unstacking and groove contraction.

    PubMed

    Timsit, Youri; Bombard, Sophie

    2007-12-01

    Metal ions play a key role in RNA folding and activity. Elucidating the rules that govern the binding of metal ions is therefore an essential step for better understanding the RNA functions. High-resolution data are a prerequisite for a detailed structural analysis of ion binding on RNA and, in particular, the observation of monovalent cations. Here, the high-resolution crystal structures of the tridecamer duplex r(GCGUUUGAAACGC) crystallized under different conditions provides new structural insights on ion binding on GAAA/UUU sequences that exhibit both unusual structural and functional properties in RNA. The present study extends the repertory of RNA ion binding sites in showing that the two first bases of UUU triplets constitute a specific site for sodium ions. A striking asymmetric pattern of metal ion binding in the two equivalent halves of the palindromic sequence demonstrates that sequence and its environment act together to bind metal ions. A highly ionophilic half that binds six metal ions allows, for the first time, the observation of a disodium cluster in RNA. The comparison of the equivalent halves of the duplex provides experimental evidences that ion binding correlates with structural alterations and groove contraction.

  9. Modeling the evolution of regulatory elements by simultaneous detection and alignment with phylogenetic pair HMMs.

    PubMed

    Majoros, William H; Ohler, Uwe

    2010-12-16

    The computational detection of regulatory elements in DNA is a difficult but important problem impacting our progress in understanding the complex nature of eukaryotic gene regulation. Attempts to utilize cross-species conservation for this task have been hampered both by evolutionary changes of functional sites and poor performance of general-purpose alignment programs when applied to non-coding sequence. We describe a new and flexible framework for modeling binding site evolution in multiple related genomes, based on phylogenetic pair hidden Markov models which explicitly model the gain and loss of binding sites along a phylogeny. We demonstrate the value of this framework for both the alignment of regulatory regions and the inference of precise binding-site locations within those regions. As the underlying formalism is a stochastic, generative model, it can also be used to simulate the evolution of regulatory elements. Our implementation is scalable in terms of numbers of species and sequence lengths and can produce alignments and binding-site predictions with accuracy rivaling or exceeding current systems that specialize in only alignment or only binding-site prediction. We demonstrate the validity and power of various model components on extensive simulations of realistic sequence data and apply a specific model to study Drosophila enhancers in as many as ten related genomes and in the presence of gain and loss of binding sites. Different models and modeling assumptions can be easily specified, thus providing an invaluable tool for the exploration of biological hypotheses that can drive improvements in our understanding of the mechanisms and evolution of gene regulation.

  10. Cloud Computing for Protein-Ligand Binding Site Comparison

    PubMed Central

    2013-01-01

    The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery. PMID:23762824

  11. Cloud computing for protein-ligand binding site comparison.

    PubMed

    Hung, Che-Lun; Hua, Guan-Jie

    2013-01-01

    The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery.

  12. DNA-bending properties of TF1.

    PubMed

    Schneider, G J; Sayre, M H; Geiduschek, E P

    1991-10-05

    Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.

  13. Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

    PubMed

    Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

    2017-01-01

    Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques.

    PubMed

    Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

    2017-03-30

    Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 10 5  M -1 ) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

  15. Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

    PubMed Central

    Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

    2017-01-01

    Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M−1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA. PMID:28358124

  16. Engineering Nucleotide Specificity of Succinyl-CoA Synthetase in Blastocystis: The Emerging Role of Gatekeeper Residues.

    PubMed

    Vashisht, Kapil; Verma, Sonia; Gupta, Sunita; Lynn, Andrew M; Dixit, Rajnikant; Mishra, Neelima; Valecha, Neena; Hamblin, Karleigh A; Maytum, Robin; Pandey, Kailash C; van der Giezen, Mark

    2017-01-24

    Charged, solvent-exposed residues at the entrance to the substrate binding site (gatekeeper residues) produce electrostatic dipole interactions with approaching substrates, and control their access by a novel mechanism called "electrostatic gatekeeper effect". This proof-of-concept study demonstrates that the nucleotide specificity can be engineered by altering the electrostatic properties of the gatekeeper residues outside the binding site. Using Blastocystis succinyl-CoA synthetase (SCS, EC 6.2.1.5), we demonstrated that the gatekeeper mutant (ED) resulted in ATP-specific SCS to show high GTP specificity. Moreover, nucleotide binding site mutant (LF) had no effect on GTP specificity and remained ATP-specific. However, via combination of the gatekeeper mutant with the nucleotide binding site mutant (ED+LF), a complete reversal of nucleotide specificity was obtained with GTP, but no detectable activity was obtained with ATP. This striking result of the combined mutant (ED+LF) was due to two changes; negatively charged gatekeeper residues (ED) favored GTP access, and nucleotide binding site residues (LF) altered ATP binding, which was consistent with the hypothesis of the "electrostatic gatekeeper effect". These results were further supported by molecular modeling and simulation studies. Hence, it is imperative to extend the strategy of the gatekeeper effect in a different range of crucial enzymes (synthetases, kinases, and transferases) to engineer substrate specificity for various industrial applications and substrate-based drug design.

  17. Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

    NASA Astrophysics Data System (ADS)

    Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

    2017-03-01

    Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M-1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

  18. The Role of miRNAs in the Progression of Prostate Cancer from Androgen-Dependent to Androgen-Independent Stages

    DTIC Science & Technology

    2012-09-01

    regulated by miR-99a/let7c/125b-2 cluster. Using bioinformatic prediction algorithm TargetScan, we identified 7 genes that are commonly targeted by miR-99a...HPeak, a Hidden Markov Model (HMM)-based peak identifying algorithm (http://www.sph.umich.edu/csg/qin/HPeak/). Seven AR binding sites were reported by...and ARBS2 by ALGGEN- PROMO, a matrix algorithm for predicting transcription factor binding sites based on TRANSFAC (http://alggen.lsi.upc.es/cgi- bin

  19. Ligand deconstruction: Why some fragment binding positions are conserved and others are not

    PubMed Central

    Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

    2015-01-01

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

  20. A novel methodological approach for the analysis of host-ligand interactions.

    PubMed

    Strat, Daniela; Missailidis, Sotiris; Drake, Alex F

    2007-02-02

    Traditional analysis of drug-binding data relies upon the Scatchard formalism. These methods rely upon the fitting of a linear equation providing intercept and gradient data that relate to physical properties, such as the binding constant, cooperativity coefficients and number of binding sites. However, the existence of different binding modes with different binding constants makes the implementation of these models difficult. This article describes a novel approach to the binding model of host-ligand interactions by using a derived analytical function describing the observed signal. The benefit of this method is that physically significant parameters, that is, binding constants and number of binding sites, are automatically derived by the use of a minimisation routine. This methodology was utilised to analyse the interactions between a novel antitumour agent and DNA. An optical spectroscopy study confirms that the pentacyclic acridine derivative (DH208) binds to nucleic acids. Two binding modes can be identified: a stronger one that involves intercalation and a weaker one that involves oriented outer-sphere binding. In both cases the plane of the bound acridine ring is parallel to the nucleic acid bases, orthogonal to the phosphate backbone. Ultraviolet (UV) and circular dichroism (CD) data were fitted using the proposed model. The binding constants and the number of binding sites derived from the model remained consistent across the different techniques used. The different wavelengths at which the measurements were made maintained the coherence of the results.

  1. Resolving protein structure-function-binding site relationships from a binding site similarity network perspective.

    PubMed

    Mudgal, Richa; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-07-01

    Functional annotation is seldom straightforward with complexities arising due to functional divergence in protein families or functional convergence between non-homologous protein families, leading to mis-annotations. An enzyme may contain multiple domains and not all domains may be involved in a given function, adding to the complexity in function annotation. To address this, we use binding site information from bound cognate ligands and catalytic residues, since it can help in resolving fold-function relationships at a finer level and with higher confidence. A comprehensive database of 2,020 fold-function-binding site relationships has been systematically generated. A network-based approach is employed to capture the complexity in these relationships, from which different types of associations are deciphered, that identify versatile protein folds performing diverse functions, same function associated with multiple folds and one-to-one relationships. Binding site similarity networks integrated with fold, function, and ligand similarity information are generated to understand the depth of these relationships. Apart from the observed continuity in the functional site space, network properties of these revealed versatile families with topologically different or dissimilar binding sites and structural families that perform very similar functions. As a case study, subtle changes in the active site of a set of evolutionarily related superfamilies are studied using these networks. Tracing of such similarities in evolutionarily related proteins provide clues into the transition and evolution of protein functions. Insights from this study will be helpful in accurate and reliable functional annotations of uncharacterized proteins, poly-pharmacology, and designing enzymes with new functional capabilities. Proteins 2017; 85:1319-1335. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  2. Prediction of protein-protein interaction sites using electrostatic desolvation profiles.

    PubMed

    Fiorucci, Sébastien; Zacharias, Martin

    2010-05-19

    Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. Copyright (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  3. Mechanisms of Zn(II) binded to collagen and its effect on the capacity of eco-friendly Zn-Cr combination tanning system.

    PubMed

    Cao, Shan; Liu, Bing; Cheng, Baozhen; Lu, Fuping; Wang, Yanping; Li, Yu

    2017-01-05

    The eco-friendly combination tanning process has been developed to reduce chromium in existing researches, which is based on zinc tanning agents. This can be considered as a less-chrome substitute for current tanning process. To gain deeper understanding of the binding mechanisms of zinc-collagen interaction, which are affected by tanning pH, experiments have been carried out. Analysis in this paper reveals how chemical bonds from the collagen's main function groups combine with zinc. XPS and NIR data was analyzed for further understanding of where the zinc binding sites lie on collagen fibers at different pH. The results indicate that high pH is helpful to amino-binding sites while low pH promotes carboxyl-binding sites on collagen fibers. Furthermore, from the effect of Zinc-chrome combination tanning, we can see that the new method reduces the chromium dosage in tanning process compared to the conventional chrome tanning method. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Combining solvent thermodynamic profiles with functionality maps of the Hsp90 binding site to predict the displacement of water molecules.

    PubMed

    Haider, Kamran; Huggins, David J

    2013-10-28

    Intermolecular interactions in the aqueous phase must compete with the interactions between the two binding partners and their solvating water molecules. In biological systems, water molecules in protein binding sites cluster at well-defined hydration sites and can form strong hydrogen-bonding interactions with backbone and side-chain atoms. Displacement of such water molecules is only favorable when the ligand can form strong compensating hydrogen bonds. Conversely, water molecules in hydrophobic regions of protein binding sites make only weak interactions, and the requirements for favorable displacement are less stringent. The propensity of water molecules for displacement can be identified using inhomogeneous fluid solvation theory (IFST), a statistical mechanical method that decomposes the solvation free energy of a solute into the contributions from different spatial regions and identifies potential binding hotspots. In this study, we employed IFST to study the displacement of water molecules from the ATP binding site of Hsp90, using a test set of 103 ligands. The predicted contribution of a hydration site to the hydration free energy was found to correlate well with the observed displacement. Additionally, we investigated if this correlation could be improved by using the energetic scores of favorable probe groups binding at the location of hydration sites, derived from a multiple copy simultaneous search (MCSS) method. The probe binding scores were not highly predictive of the observed displacement and did not improve the predictivity when used in combination with IFST-based hydration free energies. The results show that IFST alone can be used to reliably predict the observed displacement of water molecules in Hsp90. However, MCSS can augment IFST calculations by suggesting which functional groups should be used to replace highly displaceable water molecules. Such an approach could be very useful in improving the hit-to-lead process for new drug targets.

  5. Ligand Binding Site Detection by Local Structure Alignment and Its Performance Complementarity

    PubMed Central

    Lee, Hui Sun; Im, Wonpil

    2013-01-01

    Accurate determination of potential ligand binding sites (BS) is a key step for protein function characterization and structure-based drug design. Despite promising results of template-based BS prediction methods using global structure alignment (GSA), there is a room to improve the performance by properly incorporating local structure alignment (LSA) because BS are local structures and often similar for proteins with dissimilar global folds. We present a template-based ligand BS prediction method using G-LoSA, our LSA tool. A large benchmark set validation shows that G-LoSA predicts drug-like ligands’ positions in single-chain protein targets more precisely than TM-align, a GSA-based method, while the overall success rate of TM-align is better. G-LoSA is particularly efficient for accurate detection of local structures conserved across proteins with diverse global topologies. Recognizing the performance complementarity of G-LoSA to TM-align and a non-template geometry-based method, fpocket, a robust consensus scoring method, CMCS-BSP (Complementary Methods and Consensus Scoring for ligand Binding Site Prediction), is developed and shows improvement on prediction accuracy. The G-LoSA source code is freely available at http://im.bioinformatics.ku.edu/GLoSA. PMID:23957286

  6. Silver(I) complexes with DNA and RNA studied by Fourier transform infrared spectroscopy and capillary electrophoresis.

    PubMed Central

    Arakawa, H; Neault, J F; Tajmir-Riahi, H A

    2001-01-01

    Ag(I) is a strong nucleic acids binder and forms several complexes with DNA such as types I, II, and III. However, the details of the binding mode of silver(I) in the Ag-polynucleotides remains unknown. Therefore, it was of interest to examine the binding of Ag(I) with calf-thymus DNA and bakers yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentration of DNA or RNA and various concentrations of Ag(I). Fourier transform infrared spectroscopy and capillary electrophoresis were used to analyze the Ag(I) binding mode, the binding constant, and the polynucleotides' structural changes in the Ag-DNA and Ag-RNA complexes. The spectroscopic results showed that in the type I complex formed with DNA, Ag(I) binds to guanine N7 at low cation concentration (r = 1/80) and adenine N7 site at higher concentrations (r = 1/20 to 1/10), but not to the backbone phosphate group. At r = 1/2, type II complexes formed with DNA in which Ag(I) binds to the G-C and A-T base pairs. On the other hand, Ag(I) binds to the guanine N7 atom but not to the adenine and the backbone phosphate group in the Ag-RNA complexes. Although a minor alteration of the sugar-phosphate geometry was observed, DNA remained in the B-family structure, whereas RNA retained its A conformation. Scatchard analysis following capillary electrophoresis showed two binding sites for the Ag-DNA complexes with K(1) = 8.3 x 10(4) M(-1) for the guanine and K(2) = 1.5 x 10(4) M(-1) for the adenine bases. On the other hand, Ag-RNA adducts showed one binding site with K = 1.5 x 10(5) M(-1) for the guanine bases. PMID:11509371

  7. Definition of a consensus DNA-binding site for PecS, a global regulator of virulence gene expression in Erwinia chrysanthemi and identification of new members of the PecS regulon.

    PubMed

    Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William

    2004-07-16

    In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

  8. De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

    PubMed

    Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

    2011-02-10

    Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.

  9. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  10. Pharmacokinetics of warfarin in rats: role of serum protein binding and tissue distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheung, W.K.

    The purpose of this study was to explore the role of serum protein binding and tissue distribution in the non-linear pharmacokinetics of warfarin in rats. The first phase of the research was an attempt to elucidate the causes of intersubject differences in serum protein binding of warfarin in rats. It was found that the distribution of S-warfarin between blood and liver, kidneys, muscle, or fatty tissue was non-linear. Based on the tissue distribution data obtained, a physiologically-based pharmacokinetic model was developed to describe the time course of S-warfarin concentrations in the serum and tissues of rats. The proposed model wasmore » able to display the dose-dependent pharmacokinetics of warfarin in rats. Namely a lower clearance and a smaller apparent volume of distribution with increasing dose, which appear to be due to the presence of capacity-limited, high-affinity binding sites for warfarin in various tissues. To determine if the binding of warfarin to the high-affinity binding sites in the liver of rats is reversible, concentrations of S-warfarin in the liver and serum of rats were monitored for a very long time after an intravenous injection of a 1 mg/kg dose. In another study in rats, non-radioactive warfarin was found to be able to displace tissue-bound C/sup 14/-warfarin which was administered about 200 hours before the i.v. injection of the non-radioactive warfarin, showing that the binding of warfarin to the high-affinity binding sites in the body is persistent and reversible.« less

  11. A fragment-based approach leading to the discovery of a novel binding site and the selective CK2 inhibitor CAM4066.

    PubMed

    De Fusco, Claudia; Brear, Paul; Iegre, Jessica; Georgiou, Kathy Hadje; Sore, Hannah F; Hyvönen, Marko; Spring, David R

    2017-07-01

    Recently we reported the discovery of a potent and selective CK2α inhibitor CAM4066. This compound inhibits CK2 activity by exploiting a pocket located outside the ATP binding site (αD pocket). Here we describe in detail the journey that led to the discovery of CAM4066 using the challenging fragment linking strategy. Specifically, we aimed to develop inhibitors by linking a high-affinity fragment anchored in the αD site to a weakly binding warhead fragment occupying the ATP site. Moreover, we describe the remarkable impact that molecular modelling had on the development of this novel chemical tool. The work described herein shows potential for the development of a novel class of CK2 inhibitors. Copyright © 2017. Published by Elsevier Ltd.

  12. Thermochemistry of the specific binding of C12 surfactants to bovine serum albumin.

    PubMed

    Nielsen, A D; Borch, K; Westh, P

    2000-06-15

    The specific binding to bovine serum albumin (BSA) of anionic and non-ionic surfactants with C12 acyl chains has been studied by high sensitivity isothermal titration calorimetry. This method proved particularly effective in resolving the binding of anionic surfactants into separate classes of sites with different affinity. For sodium dodecylsulfate (SDS) the measured binding curves could be rationalized as association to two classes (high affinity/low affinity) of sites comprising, respectively, three and six similar (i.e. thermodynamically equivalent), independent sites. Changes in the thermodynamic functions enthalpy, standard free energy, standard entropy and heat capacity could be discerned for each class of binding site, as well as for micelle formation. These data suggest that binding to low affinity sites (in analogy with micelle formation) exhibits energetic parameters; in particular, a large negative change in heat capacity, which is characteristic of hydrophobic interactions. The thermodynamics of high affinity binding, on the other hand, is indicative of other dominant forces; most likely electrostatic interactions. Other anionic ligands investigated (laurate and dodecyl benzylsulfonate) showed a behavior similar to SDS, the most significant difference being the high affinity binding of the alkylbenzyl sulfonate. For this ligand, the thermodynamic data is indicative of a more loosely associated complex than for SDS and laurate. BSA was found to bind one or two of the non-ionic surfactants (NIS) hepta- or penta(ethylene glycol) monododecyl ether (C12EO7 and C12EO5) with binding constants about three orders of magnitude lower than for SDS. Hence, the free energy of the surfactant in the weakly bound BSA-NIS complex is only slightly favored over the micellar state. The binding process is characterized by very large exothermic enthalpy changes (larger than for the charged surfactants) and a large, positive increment in heat capacity. These observations cannot be reconciled with a molecular picture based on simple hydrophobic condensation onto non-polar patches on the protein surface.

  13. Investigation of the Binding Profiles of AZD2184 and Thioflavin T with Amyloid-β(1-42) Fibril by Molecular Docking and Molecular Dynamics Methods.

    PubMed

    Kuang, Guanglin; Murugan, N Arul; Tu, Yaoquan; Nordberg, Agneta; Ågren, Hans

    2015-09-03

    Detecting deposits of amyloid β fibrils in the brain is of paramount importance for an early diagnosis of Alzheimer's disease. A number of PET tracers have been developed for amyloid imaging, but many suffer from poor specificity and large signal to background ratio. Design of tracers with specificity and improved binding affinity requires knowledge about various potential binding sites in the amyloid β fibril available for the tracers and the nature of the local microenvironment of these sites. In this study we investigate the local structure of fibrils using two important probes, namely, thioflavin T (a fluorescent probe) and AZD2184 (a PET tracer). The target structures for amyloid-β(1-42) fibril are based on reported NMR solution models. By explicitly considering the effect of fibril flexibility on the available binding sites for all these models, the binding affinity of these probes has been investigated. The binding profiles of AZD2184 and thioflavin T were studied by molecular docking and molecular dynamics simulation methods. The two compounds were found to bind at the same sites of the fibril: three of which are within the fibril, and one is on the two sides of the Met35 residue on the surface. The binding affinity of AZD2184 and thioflavin T is found to be higher at the core sites than on the surface due to more contact residues. The binding affinity of AZD2184 is much higher than that of thioflavin T at every site due to electrostatic interaction and spatial restriction, which is in good agreement with experimental observation. However, the structural change of thioflavin T is much more significant than that of AZD2184, which is the chemical basis for its usage as a fluorescent probe. The ramifications of these results for the design and optimization of PET radioligands and fluorescent probes are briefly discussed.

  14. CorA Is a Copper Repressible Surface-Associated Copper(I)-Binding Protein Produced in Methylomicrobium album BG8

    PubMed Central

    Johnson, Kenneth A.; Ve, Thomas; Larsen, Øivind; Pedersen, Rolf B.; Lillehaug, Johan R.; Jensen, Harald B.; Helland, Ronny; Karlsen, Odd A.

    2014-01-01

    CorA is a copper repressible protein previously identified in the methanotrophic bacterium Methylomicrobium album BG8. In this work, we demonstrate that CorA is located on the cell surface and binds one copper ion per protein molecule, which, based on X-ray Absorption Near Edge Structure analysis, is in the reduced state (Cu(I)). The structure of endogenously expressed CorA was solved using X-ray crystallography. The 1.6 Å three-dimensional structure confirmed the binding of copper and revealed that the copper atom was coordinated in a mononuclear binding site defined by two histidines, one water molecule, and the tryptophan metabolite, kynurenine. This arrangement of the copper-binding site is similar to that of its homologous protein MopE* from Metylococcus capsulatus Bath, confirming the importance of kynurenine for copper binding in these proteins. Our findings show that CorA has an overall fold similar to MopE, including the unique copper(I)-binding site and most of the secondary structure elements. We suggest that CorA plays a role in the M. album BG8 copper acquisition. PMID:24498370

  15. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

    PubMed

    Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

    2010-08-03

    Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hsu, Hao-Chi; Tong, Simon; Zhou, Yuchen

    Human FABP5 and FABP7 are intracellular endocannabinoid transporters. SBFI-26 is an α-truxillic acid 1-naphthyl monoester that competitively inhibits the activities of FABP5 and FABP7 and produces antinociceptive and anti-inflammatory effects in mice. The synthesis of SBFI-26 yields several stereoisomers, and it is not known how the inhibitor binds the transporters. Here we report co-crystal structures of SBFI-26 in complex with human FABP5 and FABP7 at 2.2 and 1.9 Å resolution, respectively. We found that only (S)-SBFI-26 was present in the crystal structures. The inhibitor largely mimics the fatty acid binding pattern, but it also has several unique interactions. Notably, themore » FABP7 complex corroborates key aspects of the ligand binding pose at the canonical site previously predicted by virtual screening. In FABP5, SBFI-26 was unexpectedly found to bind at the substrate entry portal region in addition to binding at the canonical ligand-binding pocket. Our structural and binding energy analyses indicate that both R and S forms appear to bind the transporter equally well. We suggest that the S enantiomer observed in the crystal structures may be a result of the crystallization process selectively incorporating the (S)-SBFI-26–FABP complexes into the growing lattice, or that the S enantiomer may bind to the portal site more rapidly than to the canonical site, leading to an increased local concentration of the S enantiomer for binding to the canonical site. Our work reveals two binding poses of SBFI-26 in its target transporters. This knowledge will guide the development of more potent FABP inhibitors based upon the SBFI-26 scaffold.« less

  17. pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families.

    PubMed

    Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas

    2014-07-01

    The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Defects in the calcium-binding region drastically affect the cadherin-like domains of RET tyrosine kinase.

    PubMed

    Gao, Chunxia; Grøtli, Morten; Eriksson, Leif A

    2016-03-28

    Mutations in the rearranged during transfection (RET) tyrosine kinase gene leading to gain or loss of function have been associated with the development of several human cancers and Hirschsprung's disease (HSCR). However, to what extent these mutations affect individual bio-molecular functions remains unclear. In this article, the functionally significant mutations in the RET CLD1-4 calcium-binding site which lead to HSCR, and depletion of calcium ions in the RET CLD1-4 calcium binding site, were investigated by molecular dynamics simulations--to understand the mechanistic action of the mutations or loss of calcium ions in altering the protein kinase structure, dynamics, and stability. The mutations or loss of calcium ions change the local conformation and change the free energy landscape. Specifically, the mutations and loss of calcium ions decrease the radius of gyration of the whole structure, leading to improper protein folding and GFL-GFRα contact site reduction. Furthermore, based on the most populated conformation in the wildtype MD simulations, a pharmacophore was generated by fragment docking to identify key features of the possible inhibitors targeting the calcium binding site. Overall, the findings may provide useful structural insights into the molecular mechanism underlying RET calcium-binding site mutations and assist in development of novel drugs targeting the extracellular ligand contact site of wildtype RET.

  19. ProMateus—an open research approach to protein-binding sites analysis

    PubMed Central

    Neuvirth, Hani; Heinemann, Uri; Birnbaum, David; Tishby, Naftali; Schreiber, Gideon

    2007-01-01

    The development of bioinformatic tools by individual labs results in the abundance of parallel programs for the same task. For example, identification of binding site regions between interacting proteins is done using: ProMate, WHISCY, PPI-Pred, PINUP and others. All servers first identify unique properties of binding sites and then incorporate them into a predictor. Obviously, the resulting prediction would improve if the most suitable parameters from each of those predictors would be incorporated into one server. However, because of the variation in methods and databases, this is currently not feasible. Here, the protein-binding site prediction server is extended into a general protein-binding sites research tool, ProMateus. This web tool, based on ProMate's infrastructure enables the easy exploration and incorporation of new features and databases by the user, providing an evaluation of the benefit of individual features and their combination within a set framework. This transforms the individual research into a community exercise, bringing out the best from all users for optimized predictions. The analysis is demonstrated on a database of protein protein and protein-DNA interactions. This approach is basically different from that used in generating meta-servers. The implications of the open-research approach are discussed. ProMateus is available at http://bip.weizmann.ac.il/promate. PMID:17488838

  20. Designing and Testing of Novel Taxanes to Probe the Highly Complex Mechanisms by Which Taxanes Bind to Microtubules and Cause Cytotoxicity to Cancer Cells

    PubMed Central

    St. George, Marc; Ayoub, Ahmed T.; Banerjee, Asok; Churchill, Cassandra D. M.; Winter, Philip; Klobukowski, Mariusz; Cass, Carol E.; Ludueña, Richard F.; Tuszynski, Jack A.; Damaraju, Sambasivarao

    2015-01-01

    Our previous work identified an intermediate binding site for taxanes in the microtubule nanopore. The goal of this study was to test derivatives of paclitaxel designed to bind to this intermediate site differentially depending on the isotype of β-tubulin. Since β-tubulin isotypes have tissue-dependent expression—specifically, the βIII isotype is very abundant in aggressive tumors and much less common in normal tissues—this is expected to lead to tubulin targeted drugs that are more efficacious and have less side effects. Seven derivatives of paclitaxel were designed and four of these were amenable for synthesis in sufficient purity and yield for further testing in breast cancer model cell lines. None of the derivatives studied were superior to currently used taxanes, however computer simulations provided insights into the activity of the derivatives. Our results suggest that neither binding to the intermediate binding site nor the final binding site is sufficient to explain the activities of the derivative taxanes studied. These findings highlight the need to iteratively improve on the design of taxanes based on their activity in model systems. Knowledge gained on the ability of the engineered drugs to bind to targets and bring about activity in a predictable manner is a step towards personalizing therapies. PMID:26052950

  1. Ligand recognition by RAR and RXR receptors: binding and selectivity.

    PubMed

    Sussman, Fredy; de Lera, Angel R

    2005-10-06

    Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

  2. The effect of Berberine on the secondary structure of human serum albumin

    NASA Astrophysics Data System (ADS)

    Li, Ying; He, WenYing; Tian, Jianniao; Tang, Jianghong; Hu, Zhide; Chen, Xingguo

    2005-05-01

    The presence of several high affinity binding sites on human serum albumin (HSA) makes it a possible target for many drugs. This study is designed to examine the effect of Berberine (an ancient Chinese drug used for antimicrobial, antiplasmodial, antidiarrheal and cardiovascular) on the solution structure of HSA using fluorescence, Fourier transform infrared (FT-IR), circular dichroism (CD) spectroscopic methods. The fluorescence spectroscopic results show that the fluorescence intensity of HSA was significantly decreased in the presence of Berberine. The Scatchard's plots indicated that the binding of Berberine to HSA at 296, 303, 318 K is characterized by one binding site with the binding constant is 4.071(±0.128)×10 4, 3.741(±0.089)×10 4, 3.454(±0.110)×10 4 M -1, respectively. The protein conformation is altered (FT-IR and CD data) with reductions of α-helices from 54 to 47% for free HSA to 45-32% and with increases of turn structure5% for free HSA to 18% in the presence of Berberine. The binding process was exothermic, enthalpy driven and spontaneous, as indicated by the thermodynamic analyses, Berberine bound to HSA was mainly based on hydrophobic interaction and electrostatic interaction cannot be excluded from the binding. Furthermore, the displace experiments indicate that Berberine can bind to the subdomain IIA, that is, high affinity site (site II).

  3. Binding of manganese(II) to a tertiary stabilized hammerhead ribozyme as studied by electron paramagnetic resonance spectroscopy

    PubMed Central

    KISSELEVA, NATALIA; KHVOROVA, ANASTASIA; WESTHOF, ERIC; SCHIEMANN, OLAV

    2005-01-01

    Electron paramagnetic resonance (EPR) spectroscopy is used to study the binding of MnII ions to a tertiary stabilized hammer-head ribozyme (tsHHRz) and to compare it with the binding to the minimal hammerhead ribozyme (mHHRz). Continuous wave EPR measurements show that the tsHHRz possesses a single high-affinity MnII binding site with a KD of ≤10 nM at an NaCl concentration of 0.1 M. This dissociation constant is at least two orders of magnitude smaller than the KD determined previously for the single high-affinity MnII site in the mHHRz. In addition, whereas the high-affinity MnII is displaced from the mHHRz upon binding of the aminoglycoside antibiotic neomycin B, it is not from the tsHHRz. Despite these pronounced differences in binding, a comparison between the electron spin echo envelope modulation and hyperfine sublevel correlation spectra of the minimal and tertiary stabilized HHRz demonstrates that the structure of both binding sites is very similar. This suggests that the MnII is located in both ribozymes between the bases A9 and G10.1 of the sheared G · A tandem base pair, as shown previously and in detail for the mHHRz. Thus, the much stronger MnII binding in the tsHHRz is attributed to the interaction between the two external loops, which locks in the RNA fold, trapping the MnII in the tightly bound conformation, whereas the absence of long-range loop–loop interactions in the mHHRz leads to more dynamical and open conformations, decreasing MnII binding. PMID:15611296

  4. Biological role and structural mechanism of twinfilin–capping protein interaction

    PubMed Central

    Falck, Sandra; Paavilainen, Ville O; Wear, Martin A; Grossmann, J Günter; Cooper, John A; Lappalainen, Pekka

    2004-01-01

    Twinfilin and capping protein (CP) are highly conserved actin-binding proteins that regulate cytoskeletal dynamics in organisms from yeast to mammals. Twinfilin binds actin monomer, while CP binds the barbed end of the actin filament. Remarkably, twinfilin and CP also bind directly to each other, but the mechanism and role of this interaction in actin dynamics are not defined. Here, we found that the binding of twinfilin to CP does not affect the binding of either protein to actin. Furthermore, site-directed mutagenesis studies revealed that the CP-binding site resides in the conserved C-terminal tail region of twinfilin. The solution structure of the twinfilin–CP complex supports these conclusions. In vivo, twinfilin's binding to both CP and actin monomer was found to be necessary for twinfilin's role in actin assembly dynamics, based on genetic studies with mutants that have defined biochemical functions. Our results support a novel model for how sequential interactions between actin monomers, twinfilin, CP, and actin filaments promote cytoskeletal dynamics. PMID:15282541

  5. Structure of a retro-binding peptide inhibitor complexed with human alpha-thrombin.

    PubMed

    Tabernero, L; Chang, C Y; Ohringer, S L; Lau, W F; Iwanowicz, E J; Han, W C; Wang, T C; Seiler, S M; Roberts, D G; Sack, J S

    1995-02-10

    The crystallographic structure of the ternary complex between human alpha-thrombin, hirugen and the peptidyl inhibitor Phe-alloThr-Phe-O-CH3, which is acylated at its N terminus with 4-guanidino butanoic acid (BMS-183507), has been determined at 2.6 A resolution. The structure reveals a unique "retro-binding" mode for this tripeptide active site inhibitor. The inhibitor binds with its alkyl-guanidine moiety in the primary specificity pocket and its two phenyl rings occupying the hydrophobic proximal and distal pockets of the thrombin active site. In this arrangement the backbone of the tripeptide forms a parallel beta-strand to the thrombin main-chain at the binding site. This is opposite to the orientation of the natural substrate, fibrinogen, and all the small active site-directed thrombin inhibitors whose bound structures have been previously reported. BMS-183507 is the first synthetic inhibitor proved to bind in a retro-binding fashion to thrombin, in a fashion similar to that of the N-terminal residues of the natural inhibitor hirudin. Furthermore, this new potent thrombin inhibitor (Ki = 17.2 nM) is selective for thrombin over other serine proteases tested and may be a template to be considered in designing hirudin-based thrombin inhibitors with interactions at the specificity pocket.

  6. Structural and biochemical studies on ATP binding and hydrolysis by the Escherichia coli RNA chaperone Hfq.

    PubMed

    Hämmerle, Hermann; Beich-Frandsen, Mads; Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

    2012-01-01

    In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)(15) and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq(65)) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions.

  7. An Inductive Logic Programming Approach to Validate Hexose Binding Biochemical Knowledge.

    PubMed

    Nassif, Houssam; Al-Ali, Hassan; Khuri, Sawsan; Keirouz, Walid; Page, David

    2010-01-01

    Hexoses are simple sugars that play a key role in many cellular pathways, and in the regulation of development and disease mechanisms. Current protein-sugar computational models are based, at least partially, on prior biochemical findings and knowledge. They incorporate different parts of these findings in predictive black-box models. We investigate the empirical support for biochemical findings by comparing Inductive Logic Programming (ILP) induced rules to actual biochemical results. We mine the Protein Data Bank for a representative data set of hexose binding sites, non-hexose binding sites and surface grooves. We build an ILP model of hexose-binding sites and evaluate our results against several baseline machine learning classifiers. Our method achieves an accuracy similar to that of other black-box classifiers while providing insight into the discriminating process. In addition, it confirms wet-lab findings and reveals a previously unreported Trp-Glu amino acids dependency.

  8. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  9. TALE-PvuII fusion proteins--novel tools for gene targeting.

    PubMed

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.

  10. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  11. Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites

    PubMed Central

    Dupont, Daniel M.; Thuesen, Cathrine K.; Bøtkjær, Kenneth A.; Behrens, Manja A.; Dam, Karen; Sørensen, Hans P.; Pedersen, Jan S.; Ploug, Michael; Jensen, Jan K.; Andreasen, Peter A.

    2015-01-01

    Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126) with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site. PMID:25793507

  12. Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

    PubMed

    Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

  13. Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

    PubMed Central

    Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

  14. Analogs of methyllycaconitine as novel noncompetitive inhibitors of nicotinic receptors: pharmacological characterization, computational modeling, and pharmacophore development.

    PubMed

    McKay, Dennis B; Chang, Cheng; González-Cestari, Tatiana F; McKay, Susan B; El-Hajj, Raed A; Bryant, Darrell L; Zhu, Michael X; Swaan, Peter W; Arason, Kristjan M; Pulipaka, Aravinda B; Orac, Crina M; Bergmeier, Stephen C

    2007-05-01

    As a novel approach to drug discovery involving neuronal nicotinic acetylcholine receptors (nAChRs), our laboratory targeted nonagonist binding sites (i.e., noncompetitive binding sites, negative allosteric binding sites) located on nAChRs. Cultured bovine adrenal cells were used as neuronal models to investigate interactions of 67 analogs of methyllycaconitine (MLA) on native alpha3beta4* nAChRs. The availability of large numbers of structurally related molecules presents a unique opportunity for the development of pharmacophore models for noncompetitive binding sites. Our MLA analogs inhibited nicotine-mediated functional activation of both native and recombinant alpha3beta4* nAChRs with a wide range of IC(50) values (0.9-115 microM). These analogs had little or no inhibitory effects on agonist binding to native or recombinant nAChRs, supporting noncompetitive inhibitory activity. Based on these data, two highly predictive 3D quantitative structure-activity relationship (comparative molecular field analysis and comparative molecular similarity index analysis) models were generated. These computational models were successfully validated and provided insights into the molecular interactions of MLA analogs with nAChRs. In addition, a pharmacophore model was constructed to analyze and visualize the binding requirements to the analog binding site. The pharmacophore model was subsequently applied to search structurally diverse molecular databases to prospectively identify novel inhibitors. The rapid identification of eight molecules from database mining and our successful demonstration of in vitro inhibitory activity support the utility of these computational models as novel tools for the efficient retrieval of inhibitors. These results demonstrate the effectiveness of computational modeling and pharmacophore development, which may lead to the identification of new therapeutic drugs that target novel sites on nAChRs.

  15. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  16. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  17. Small molecule correctors of F508del-CFTR discovered by structure-based virtual screening

    NASA Astrophysics Data System (ADS)

    Kalid, Ori; Mense, Martin; Fischman, Sharon; Shitrit, Alina; Bihler, Hermann; Ben-Zeev, Efrat; Schutz, Nili; Pedemonte, Nicoletta; Thomas, Philip J.; Bridges, Robert J.; Wetmore, Diana R.; Marantz, Yael; Senderowitz, Hanoch

    2010-12-01

    Folding correctors of F508del-CFTR were discovered by in silico structure-based screening utilizing homology models of CFTR. The intracellular segment of CFTR was modeled and three cavities were identified at inter-domain interfaces: (1) Interface between the two Nucleotide Binding Domains (NBDs); (2) Interface between NBD1 and Intracellular Loop (ICL) 4, in the region of the F508 deletion; (3) multi-domain interface between NBD1:2:ICL1:2:4. We hypothesized that compounds binding at these interfaces may improve the stability of the protein, potentially affecting the folding yield or surface stability. In silico structure-based screening was performed at the putative binding-sites and a total of 496 candidate compounds from all three sites were tested in functional assays. A total of 15 compounds, representing diverse chemotypes, were identified as F508del folding correctors. This corresponds to a 3% hit rate, tenfold higher than hit rates obtained in corresponding high-throughput screening campaigns. The same binding sites also yielded potentiators and, most notably, compounds with a dual corrector-potentiator activity (dual-acting). Compounds harboring both activity types may prove to be better leads for the development of CF therapeutics than either pure correctors or pure potentiators. To the best of our knowledge this is the first report of structure-based discovery of CFTR modulators.

  18. A fragment-based approach applied to a highly flexible target: Insights and challenges towards the inhibition of HSP70 isoforms

    NASA Astrophysics Data System (ADS)

    Jones, Alan M.; Westwood, Isaac M.; Osborne, James D.; Matthews, Thomas P.; Cheeseman, Matthew D.; Rowlands, Martin G.; Jeganathan, Fiona; Burke, Rosemary; Lee, Diane; Kadi, Nadia; Liu, Manjuan; Richards, Meirion; McAndrew, Craig; Yahya, Norhakim; Dobson, Sarah E.; Jones, Keith; Workman, Paul; Collins, Ian; van Montfort, Rob L. M.

    2016-10-01

    The heat shock protein 70s (HSP70s) are molecular chaperones implicated in many cancers and of significant interest as targets for novel cancer therapies. Several HSP70 inhibitors have been reported, but because the majority have poor physicochemical properties and for many the exact mode of action is poorly understood, more detailed mechanistic and structural insight into ligand-binding to HSP70s is urgently needed. Here we describe the first comprehensive fragment-based inhibitor exploration of an HSP70 enzyme, which yielded an amino-quinazoline fragment that was elaborated to a novel ATP binding site ligand with different physicochemical properties to known adenosine-based HSP70 inhibitors. Crystal structures of amino-quinazoline ligands bound to the different conformational states of the HSP70 nucleotide binding domain highlighted the challenges of a fragment-based approach when applied to this particular flexible enzyme class with an ATP-binding site that changes shape and size during its catalytic cycle. In these studies we showed that Ser275 is a key residue in the selective binding of ATP. Additionally, the structural data revealed a potential functional role for the ATP ribose moiety in priming the protein for the formation of the ATP-bound pre-hydrolysis complex by influencing the conformation of one of the phosphate binding loops.

  19. Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

    PubMed Central

    Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

    2012-01-01

    Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

  20. The binding sites for benztropines and dopamine in the dopamine transporter overlap

    PubMed Central

    Bisgaard, Heidi; Larsen, M. Andreas B.; Mazier, Sonia; Beuming, Thijs; Newman, Amy Hauck; Weinstein, Harel; Shi, Lei; Loland, Claus J.; Gether, Ulrik

    2013-01-01

    Analogues of benztropines (BZTs) are potent inhibitors of the dopamine transporter (DAT) but are less effective than cocaine as behavioral stimulants. As a result, there have been efforts to evaluate these compounds as leads for potential medication for cocaine addiction. Here we use computational modeling together with site-directed mutagenesis to characterize the binding site for BZTs in DAT. Docking into molecular models based on the structure of the bacterial homologue LeuT supported a BZT binding site that overlaps with the substrate binding pocket. In agreement, mutations of residues within the pocket, including Val1523.46* to Ala or Ile, Ser4228.60 to Ala and Asn1573.51 to Cys or Ala, resulted in decreased affinity for BZT and the analog JHW007, as assessed in [3H]dopamine uptake inhibition assays and/or [3H]CFT competition binding assay. A putative polar interaction of one of the phenyl ring fluorine substituents in JHW007 with Asn1573.51 was used as a criterion for determining likely binding poses and establish a structural context for the mutagenesis findings. The analysis positioned the other fluorine substituted phenyl ring of JHW007 in close proximity to Ala47910.51/Ala48010.52 in transmembrane segment (TM) 10. The lack of such an interaction for BZT led to a more tilted orientation, as compared to JHW007, bringing one of the phenyl rings even closer to Ala47910.51/Ala48010.52. Mutation of Ala47910.51 and Ala48010.52 to valines supported these predictions with a larger decrease in the affinity for BZT than for JHW007. Summarized, our data suggest that BZTs display a classical competitive binding mode with binding sites overlapping those of cocaine and dopamine. PMID:20816875

  1. KIRMES: kernel-based identification of regulatory modules in euchromatic sequences.

    PubMed

    Schultheiss, Sebastian J; Busch, Wolfgang; Lohmann, Jan U; Kohlbacher, Oliver; Rätsch, Gunnar

    2009-08-15

    Understanding transcriptional regulation is one of the main challenges in computational biology. An important problem is the identification of transcription factor (TF) binding sites in promoter regions of potential TF target genes. It is typically approached by position weight matrix-based motif identification algorithms using Gibbs sampling, or heuristics to extend seed oligos. Such algorithms succeed in identifying single, relatively well-conserved binding sites, but tend to fail when it comes to the identification of combinations of several degenerate binding sites, as those often found in cis-regulatory modules. We propose a new algorithm that combines the benefits of existing motif finding with the ones of support vector machines (SVMs) to find degenerate motifs in order to improve the modeling of regulatory modules. In experiments on microarray data from Arabidopsis thaliana, we were able to show that the newly developed strategy significantly improves the recognition of TF targets. The python source code (open source-licensed under GPL), the data for the experiments and a Galaxy-based web service are available at http://www.fml.mpg.de/raetsch/suppl/kirmes/.

  2. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  3. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  4. Study on the binding of procaine hydrochloride to DNA/DNA bases and the effect of CdS nanoparticles on the binding behavior.

    PubMed

    Ping, Gang; Lv, Gang; Gutmann, Sebastian; Chen, Chen; Zhang, Renyun; Wang, Xuemei

    2006-01-01

    The interaction between procaine hydrochloride and DNA/DNA bases in the absence and presence of cadmium sulfide (CdS) nanoparticles has been explored in this study by using differential pulse voltammetry, atomic force microscopy (AFM) and so on, which illustrates the different binding behaviors of procaine hydrochloride with different DNA bases. The results clearly indicate that the binding of purines to procaine hydrochloride is stronger than that of pyrimidines and the binding affinity is in the order of G > A > T > C. In addition, it was observed that the presence of CdS nanoparticles could remarkably enhance the probing sensitivity for the interaction between procaine hydrochloride and DNA/DNA bases. Furthermore, AFM study illustrates that procaine hydrochloride can bind to some specific sites of DNA chains, which indicates that procaine hydrochloride may interact with some special sequences of DNA.

  5. The Structural Basis for Recognition of the PreQ0 Metabolite by an Unusually Small Riboswitch Aptamer Domain*S⃞♦

    PubMed Central

    Spitale, Robert C.; Torelli, Andrew T.; Krucinska, Jolanta; Bandarian, Vahe; Wedekind, Joseph E.

    2009-01-01

    Riboswitches are RNA elements that control gene expression through metabolite binding. The preQ1 riboswitch exhibits the smallest known ligand-binding domain and is of interest for its economical organization and high affinity interactions with guanine-derived metabolites required to confer tRNA wobbling. Here we present the crystal structure of a preQ1 aptamer domain in complex with its precursor metabolite preQ0. The structure is highly compact with a core that features a stem capped by a well organized decaloop. The metabolite is recognized within a deep pocket via Watson-Crick pairing with C15. Additional hydrogen bonds are made to invariant bases U6 and A29. The ligand-bound state confers continuous helical stacking throughout the core fold, thus providing a platform to promote Watson-Crick base pairing between C9 of the decaloop and the first base of the ribosome-binding site, G33. The structure offers insight into the mode of ribosome-binding site sequestration by a minimal RNA fold stabilized by metabolite binding and has implications for understanding the molecular basis by which bacterial genes are regulated. PMID:19261617

  6. Specific phospholipid binding to Na,K-ATPase at two distinct sites.

    PubMed

    Habeck, Michael; Kapri-Pardes, Einat; Sharon, Michal; Karlish, Steven J D

    2017-03-14

    Membrane protein function can be affected by the physical state of the lipid bilayer and specific lipid-protein interactions. For Na,K-ATPase, bilayer properties can modulate pump activity, and, as observed in crystal structures, several lipids are bound within the transmembrane domain. Furthermore, Na,K-ATPase activity depends on phosphatidylserine (PS) and cholesterol, which stabilize the protein, and polyunsaturated phosphatidylcholine (PC) or phosphatidylethanolamine (PE), known to stimulate Na,K-ATPase activity. Based on lipid structural specificity and kinetic mechanisms, specific interactions of both PS and PC/PE have been inferred. Nevertheless, specific binding sites have not been identified definitively. We address this question with native mass spectrometry (MS) and site-directed mutagenesis. Native MS shows directly that one molecule each of 18:0/18:1 PS and 18:0/20:4 PC can bind specifically to purified human Na,K-ATPase (α 1 β 1 ). By replacing lysine residues at proposed phospholipid-binding sites with glutamines, the two sites have been identified. Mutations in the cytoplasmic αL8-9 loop destabilize the protein but do not affect Na,K-ATPase activity, whereas mutations in transmembrane helices (TM), αTM2 and αTM4, abolish the stimulation of activity by 18:0/20:4 PC but do not affect stability. When these data are linked to crystal structures, the underlying mechanism of PS and PC/PE effects emerges. PS (and cholesterol) bind between αTM 8, 9, 10, near the FXYD subunit, and maintain topological integrity of the labile C terminus of the α subunit (site A). PC/PE binds between αTM2, 4, 6, and 9 and accelerates the rate-limiting E 1 P-E 2 P conformational transition (site B). We discuss the potential physiological implications.

  7. The involvement of coordinative interactions in the binding of dihydrolipoamide dehydrogenase to titanium dioxide-Localization of a putative binding site.

    PubMed

    Dayan, Avraham; Babin, Gilad; Ganoth, Assaf; Kayouf, Nivin Samir; Nitoker Eliaz, Neta; Mukkala, Srijana; Tsfadia, Yossi; Fleminger, Gideon

    2017-08-01

    Titanium (Ti) and its alloys are widely used in orthodontic and orthopedic implants by virtue to their high biocompatibility, mechanical strength, and high resistance to corrosion. Biointegration of the implants with the tissue requires strong interactions, which involve biological molecules, proteins in particular, with metal oxide surfaces. An exocellular high-affinity titanium dioxide (TiO 2 )-binding protein (TiBP), purified from Rhodococcus ruber, has been previously studied in our lab. This protein was shown to be homologous with the orthologous cytoplasmic rhodococcal dihydrolipoamide dehydrogenase (rhDLDH). We have found that rhDLDH and its human homolog (hDLDH) share the TiO 2 -binding capabilities with TiBP. Intrigued by the unique TiO 2 -binding properties of hDLDH, we anticipated that it may serve as a molecular bridge between Ti-based medical structures and human tissues. The objective of the current study was to locate the region and the amino acids of the protein that mediate the protein-TiO 2 surface interaction. We demonstrated the role of acidic amino acids in the nonelectrostatic enzyme/dioxide interactions at neutral pH. The observation that the interaction of DLDH with various metal oxides is independent of their isoelectric values strengthens this notion. DLDH does not lose its enzymatic activity upon binding to TiO 2 , indicating that neither the enzyme undergoes major conformational changes nor the TiO 2 binding site is blocked. Docking predictions suggest that both rhDLDH and hDLDH bind TiO 2 through similar regions located far from the active site and the dimerization sites. The putative TiO 2 -binding regions of both the bacterial and human enzymes were found to contain a CHED (Cys, His, Glu, Asp) motif, which has been shown to participate in metal-binding sites in proteins. Copyright © 2017 John Wiley & Sons, Ltd.

  8. Affinity to bovine serum albumin and anticancer activity of some new water-soluble metal Schiff base complexes

    NASA Astrophysics Data System (ADS)

    Asadi, Mozaffar; Asadi, Zahra; Zarei, Leila; Sadi, Somaye Barzegar; Amirghofran, Zahra

    2014-12-01

    Metal Schiff-base complexes show biological activity but they are usually insoluble in water so four new water-soluble metal Schiff base complexes of Na2[M(5-SO3-1,2-salben]; (5-SO3-1,2-salben denoted N,N";-bis(5-sulphosalicyliden)-1,2-diaminobenzylamine and M = Mg, Mn, Cu, Zn) were synthesized and characterized. The formation constants of the metal complexes were determined by UV-Vis absorption spectroscopy. The interaction of these complexes with bovine serum albumin (BSA) was studied by fluorescence spectroscopy. Type of quenching, binding constants, number of binding sites and binding stoichiometries were determined by fluorescence quenching method. The results showed that the mentioned complexes strongly bound to BSA. Thermodynamic parameters indicated that hydrophobic association was the major binding force and that the interaction was entropy driven and enthalpically disfavoured. The displacement experiment showed that these complexes could bind to the subdomain IIA (site I) of albumin. Furthermore the synchronous fluorescence spectra showed that the microenvironment of the tryptophan residues was not apparently changed. Based on the Förster theory of non-radiation energy transfer, the distance between the donor (Trp residues) and the acceptor metal complexes was obtained. The growth inhibitory effect of complexes toward the K562 cancer cell line was measured.

  9. PolyU tail of rho-independent terminator of bacterial small RNAs is essential for Hfq action.

    PubMed

    Otaka, Hironori; Ishikawa, Hirokazu; Morita, Teppei; Aiba, Hiroji

    2011-08-09

    Major bacterial small RNAs (sRNAs) regulate the translation and stability of target mRNAs through base pairing with the help of the RNA chaperone Hfq. The Hfq-dependent sRNAs consist of three basic elements, mRNA base-pairing region, Hfq-binding site, and rho-independent terminator. Although the base-pairing region and the terminator are well documented in many sRNAs, the Hfq-binding site is less well-defined except that Hfq binds RNA with a preference for AU-rich sequences. Here, we performed mutational and biochemical studies to define the sRNA site required for Hfq action using SgrS as a model sRNA. We found that shortening terminator polyU tail eliminates the ability of SgrS to bind to Hfq and to silence ptsG mRNA. We also demonstrate that the SgrS terminator can be replaced with any foreign rho-independent terminators possessing a polyU tail longer than 8 without losing the ability to silence ptsG mRNA in an Hfq-dependent manner. Moreover, we found that shortening the terminator polyU tail of several other sRNAs also eliminates the ability to bind to Hfq and to regulate target mRNAs. We conclude that the polyU tail of sRNAs is essential for Hfq action in general. The data also indicate that the terminator polyU tail plays a role in Hfq-dependent stabilization of sRNAs.

  10. PolyU tail of rho-independent terminator of bacterial small RNAs is essential for Hfq action

    PubMed Central

    Otaka, Hironori; Ishikawa, Hirokazu; Morita, Teppei; Aiba, Hiroji

    2011-01-01

    Major bacterial small RNAs (sRNAs) regulate the translation and stability of target mRNAs through base pairing with the help of the RNA chaperone Hfq. The Hfq-dependent sRNAs consist of three basic elements, mRNA base-pairing region, Hfq-binding site, and rho-independent terminator. Although the base-pairing region and the terminator are well documented in many sRNAs, the Hfq-binding site is less well-defined except that Hfq binds RNA with a preference for AU-rich sequences. Here, we performed mutational and biochemical studies to define the sRNA site required for Hfq action using SgrS as a model sRNA. We found that shortening terminator polyU tail eliminates the ability of SgrS to bind to Hfq and to silence ptsG mRNA. We also demonstrate that the SgrS terminator can be replaced with any foreign rho-independent terminators possessing a polyU tail longer than 8 without losing the ability to silence ptsG mRNA in an Hfq-dependent manner. Moreover, we found that shortening the terminator polyU tail of several other sRNAs also eliminates the ability to bind to Hfq and to regulate target mRNAs. We conclude that the polyU tail of sRNAs is essential for Hfq action in general. The data also indicate that the terminator polyU tail plays a role in Hfq-dependent stabilization of sRNAs. PMID:21788484

  11. A model to estimate the relative position of sites for ligands in serum albumins

    NASA Astrophysics Data System (ADS)

    Motta, Art Adriel Emidio de Araújo; Grassini, Maria Carolina Vilela; Cortez, Célia Martins; Silva, Dilson

    2017-11-01

    In this work, we present a mathematical-computational model developed to estimate the relative position of ligand binding sites in HSA and BSA, based on the theory of fluorescence quenching, considering the molecular and spectrofluorimetric differences and similarities between these two albumins. Albumin is the largest and the most abundant serum protein in vertebrates. The ability to bind xenobiotics makes albumin important to the bioavailability and effectiveness of drugs.

  12. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  13. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  14. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  16. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  17. Zinc Finger Independent Genome-Wide Binding of Sp2 Potentiates Recruitment of Histone-Fold Protein Nf-y Distinguishing It from Sp1 and Sp3

    PubMed Central

    Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram

    2015-01-01

    Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500

  18. Calmodulin permanently associates with rat olfactory CNG channels under native conditions.

    PubMed

    Bradley, Jonathan; Bönigk, Wolfgang; Yau, King-Wai; Frings, Stephan

    2004-07-01

    An important mechanism by which vertebrate olfactory sensory neurons rapidly adapt to odorants is feedback modulation of the Ca(2+)-permeable cyclic nucleotide-gated (CNG) transduction channels. Extensive heterologous studies of homomeric CNGA2 channels have led to a molecular model of channel modulation based on the binding of calcium-calmodulin to a site on the cytoplasmic amino terminus of CNGA2. Native rat olfactory CNG channels, however, are heteromeric complexes of three homologous but distinct subunits. Notably, in heteromeric channels, we found no role for CNGA2 in feedback modulation. Instead, an IQ-type calmodulin-binding site on CNGB1b and a similar but previously unidentified site on CNGA4 are necessary and sufficient. These sites seem to confer binding of Ca(2+)-free calmodulin (apocalmodulin), which is then poised to trigger inhibition of native channels in the presence of Ca(2+).

  19. Time-resolved absorbance changes induced by fast acidification of bacteriorhodopsin in vesicle systems.

    PubMed Central

    Druckmann, S; Ottolenghi, M; Korenstein, R

    1985-01-01

    The direction of the accessibility to protons of the binding site in bacteriorhodopsin is of primary importance in elucidating the proton-pump mechanism. The problem is approached via the pH-dependent equilibrium bR560 in equilibrium bR605 in vesicles with preferentially oriented purple membranes. Fast acidification (stopped-flow) experiments with inside-out, monomeric, bR vesicles were carried out with and without a buffer enclosed in the vesicle interior. The results, showing a buffer-induced delay in the formation of bR605, indicate that the binding site is accessible to protons from the inside of the vesicles. We arrive at this conclusion also by working with inside-out trimeric vesicles in the presence and in the absence of H+ (and K+) ionophores. The results suggest that in Halobacterium halobium, the binding site and thus the retinal Schiff base are exposed to the outside of the cell. This conclusion is consistent with a pumping mechanism based on a light-induced pK change. PMID:3978185

  20. GREEN: A program package for docking studies in rational drug design

    NASA Astrophysics Data System (ADS)

    Tomioka, Nobuo; Itai, Akiko

    1994-08-01

    A program package, GREEN, has been developed that enables docking studies between ligand molecules and a protein molecule. Based on the structure of the protein molecule, the physical and chemical environment of the ligand-binding site is expressed as three-dimensional grid-point data. The grid-point data are used for the real-time evaluation of the protein-ligand interaction energy, as well as for the graphical representation of the binding-site environment. The interactive docking operation is facilitated by various built-in functions, such as energy minimization, energy contribution analysis and logging of the manipulation trajectory. Interactive modeling functions are incorporated for designing new ligand molecules while considering the binding-site environment and the protein-ligand interaction. As an example of the application of GREEN, a docking study is presented on the complex between trypsin and a synthetic trypsin inhibitor. The program package will be useful for rational drug design, based on the 3D structure of the target protein.

  1. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  2. Characterization of Protein-Carbohydrate Interactions by NMR Spectroscopy.

    PubMed

    Grondin, Julie M; Langelaan, David N; Smith, Steven P

    2017-01-01

    Solution-state nuclear magnetic resonance (NMR) spectroscopy can be used to monitor protein-carbohydrate interactions. Two-dimensional 1 H- 15 N heteronuclear single quantum coherence (HSQC)-based techniques described in this chapter can be used quickly and effectively to screen a set of possible carbohydrate binding partners, to quantify the dissociation constant (K d ) of any identified interactions, and to map the carbohydrate binding site on the structure of the protein. Here, we describe the titration of a family 32 carbohydrate binding module from Clostridium perfringens (CpCBM32) with the monosaccharide N-acetylgalactosamine (GalNAc), in which we calculate the apparent dissociation of the interaction, and map the GalNAc binding site onto the structure of CpCBM32.

  3. Characterization of the kinetics of Fe (II) binding by the R2 protein subunit of E. coli ribonucleotide reductase

    NASA Astrophysics Data System (ADS)

    Chaudhuri, Dipankar; , Joseph Martin Bollinger, Jr.

    2008-07-01

    The kinetics of Fe(II) binding to Escherichia coli Ribonucleotide reductase (R2) has been studied using rapid kinetics techniques including chemical quenched flow (CQF) Mössbauer spectroscopy. Based on the stopped flow absorption (SF-Abs) and CQF Mössbauer spectroscopy results, the pre-steady kinetics of binding of Fe(II) to the two sites A and B on R2 have been established with attendant conformational changes. Fe (II) binds to Site B tighter and faster and these and other results provide important information towards the di-iron cofactor assembly mechanism in R2 and could have possible implications for the development of modified and new anticancer and antiviral drugs.

  4. Structural Explanation for Allolactose (lac Operon Inducer) Synthesis by lacZ β-Galactosidase and the Evolutionary Relationship between Allolactose Synthesis and the lac Repressor

    PubMed Central

    Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.

    2013-01-01

    β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479

  5. Docking and Hydropathic Scoring of Polysubstituted Pyrrole Compounds with Anti-Tubulin Activity

    PubMed Central

    Tripathi, Ashutosh; Fornabaio, Micaela; Kellogg, Glen E.; Gupton, John T.; Gewirtz, David A.; Yeudall, W. Andrew; Vega, Nina E.; Mooberry, Susan L.

    2008-01-01

    Compounds that bind at the colchicine site of tubulin have drawn considerable attention with studies indicating that these agents suppress microtubule dynamics and inhibit tubulin polymerization. Data for eighteen polysubstituted pyrrole compounds are reported, including antiproliferative activity against human MDA-MB-435 cells and calculated free energies of binding following docking the compounds into models of αβ-tubulin. These docking calculations coupled with HINT interaction analyses are able to represent the complex structures and the binding modes of inhibitors such that calculated and measured free energies of binding correlate with an r2 of 0.76. Structural analysis of the binding pocket identifies important intermolecular contacts that mediate binding. As seen experimentally, the complex with JG-03-14 (3,5-dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2- carboxylic acid ethyl ester) is the most stable. These results illuminate the binding process and should be valuable in the design of new pyrrole-based colchicine site inhibitors as these compounds have very accessible syntheses. PMID:18083520

  6. Thermodynamics of DNA target site recognition by homing endonucleases

    PubMed Central

    Eastberg, Jennifer H.; Smith, Audrey McConnell; Zhao, Lei; Ashworth, Justin; Shen, Betty W.; Stoddard, Barry L.

    2007-01-01

    The thermodynamic profiles of target site recognition have been surveyed for homing endonucleases from various structural families. Similar to DNA-binding proteins that recognize shorter target sites, homing endonucleases display a narrow range of binding free energies and affinities, mediated by structural interactions that balance the magnitude of enthalpic and entropic forces. While the balance of ΔH and TΔS are not strongly correlated with the overall extent of DNA bending, unfavorable ΔHbinding is associated with unstacking of individual base steps in the target site. The effects of deleterious basepair substitutions in the optimal target sites of two LAGLIDADG homing endonucleases, and the subsequent effect of redesigning one of those endonucleases to accommodate that DNA sequence change, were also measured. The substitution of base-specific hydrogen bonds in a wild-type endonuclease/DNA complex with hydrophobic van der Waals contacts in a redesigned complex reduced the ability to discriminate between sites, due to nonspecific ΔSbinding. PMID:17947319

  7. Text Mining Improves Prediction of Protein Functional Sites

    PubMed Central

    Cohn, Judith D.; Ravikumar, Komandur E.

    2012-01-01

    We present an approach that integrates protein structure analysis and text mining for protein functional site prediction, called LEAP-FS (Literature Enhanced Automated Prediction of Functional Sites). The structure analysis was carried out using Dynamics Perturbation Analysis (DPA), which predicts functional sites at control points where interactions greatly perturb protein vibrations. The text mining extracts mentions of residues in the literature, and predicts that residues mentioned are functionally important. We assessed the significance of each of these methods by analyzing their performance in finding known functional sites (specifically, small-molecule binding sites and catalytic sites) in about 100,000 publicly available protein structures. The DPA predictions recapitulated many of the functional site annotations and preferentially recovered binding sites annotated as biologically relevant vs. those annotated as potentially spurious. The text-based predictions were also substantially supported by the functional site annotations: compared to other residues, residues mentioned in text were roughly six times more likely to be found in a functional site. The overlap of predictions with annotations improved when the text-based and structure-based methods agreed. Our analysis also yielded new high-quality predictions of many functional site residues that were not catalogued in the curated data sources we inspected. We conclude that both DPA and text mining independently provide valuable high-throughput protein functional site predictions, and that integrating the two methods using LEAP-FS further improves the quality of these predictions. PMID:22393388

  8. A novel reagentless sensing system for measuring glucose based on the galactose/glucose-binding protein

    NASA Technical Reports Server (NTRS)

    Salins, L. L.; Ware, R. A.; Ensor, C. M.; Daunert, S.

    2001-01-01

    The galactose/glucose-binding protein (GBP) is synthesized in the cytoplasm of Escherichia coli in a precursor form and exported into the periplasmic space upon cleavage of a 23-amino-acid leader sequence. GBP binds galactose and glucose in a highly specific manner. The ligand induces a hinge motion in GBP and the resultant protein conformational change constitutes the basis of the sensing system. The mglB gene, which codes for GBP, was isolated from the chromosome of E. coli using the polymerase chain reaction (PCR). Since wild-type GBP lacks cysteines in its structure, introducing this amino acid by site-directed mutagenesis ensures single-label attachment at specific sites with a sulfhydro-specific fluorescent probe. Site-directed mutagenesis by overlap extension PCR was performed to prepare three different mutants to introduce a single cysteine residue at positions 148, 152, and 182. Since these residues are not involved in ligand binding and since they are located at the edge of the binding cleft, they experience a significant change in environment upon binding of galactose or glucose. The sensing system strategy is based on the fluorescence changes of the probe as the protein undergoes a structural change on binding. In this work a reagentless sensing system has been rationally designed that can detect submicromolar concentrations of glucose. The calibration plots have a linear working range of three orders of magnitude. Although the system can sense galactose as well, this epimer is not a potential interfering substance since its concentration in blood is negligible. Copyright 2001 Academic Press.

  9. Integrating docking and molecular dynamics approaches for a series of proline-based 2,5-diketopiperazines as novel αβ-tubulin inhibitors.

    PubMed

    Fani, Najmeh; Bordbar, Abdol-Khalegh; Ghayeb, Yousef; Sepehri, Saghi

    2015-01-01

    In this work, docking tools were utilized in order to study the binding properties of more than five hundred of proline-based 2,5-diketopiperazine in the binding site of αβ-tubulin. Results revealed that 20 compounds among them showed lower binding energies in comparison with Tryprostatin-A, a well known tubulin inhibitor and therefore could be potential inhibitors of tubulin. However, the precise evaluation of binding poses represents the similar binding modes for all of these compounds and Tryprostatin-A. Finally, the best docked complex was subjected to a 25 ns molecular dynamics simulation to further validate the proposed binding mode of this compound.

  10. Massive GGAAs in genomic repetitive sequences serve as a nuclear reservoir of NF-κB.

    PubMed

    Wu, Jian; Wang, Qiao; Dai, Wei; Wang, Wei; Yue, Ming; Wang, Jinke

    2018-04-13

    Nuclear factor κB (NF-κB) is a DNA-binding transcription factor. Characterizing its genomic binding sites is crucial for understanding its gene regulatory function and mechanism in cells. This study characterized the binding sites of NF-κB RelA/p65 in the tumor neurosis factor-α (TNFα) stimulated HeLa cells by a precise chromatin immunoprecipitation-sequencing (ChIP-seq). The results revealed that NF-κB binds nontraditional motifs (nt-motifs) containing conserved GGAA quadruplet. Moreover, nt-motifs mainly distribute in the peaks nearby centromeres that contain a larger number of repetitive elements such as satellite, simple repeats and short interspersed nuclear elements (SINEs). This intracellular binding pattern was then confirmed by the in vitro detection, indicating that NF-κB dimers can bind the nontraditional κB (nt-κB) sites with low affinity. However, this binding hardly activates transcription. This study thus deduced that NF-κB binding nt-motifs may realize functions other than gene regulation as NF-κB binding traditional motifs (t-motifs). To testify the deduction, many ChIP-seq data of other cell lines were then analyzed. The results indicate that NF-κB binding nt-motifs is also widely present in other cells. The ChIP-seq data analysis also revealed that nt-motifs more widely distribute in the peaks with low-fold enrichment. Importantly, it was also found that NF-κB binding nt-motifs is mainly present in the resting cells, whereas NF-κB binding t-motifs is mainly present in the stimulated cells. Astonishingly, no known function was enriched by the gene annotation of nt-motif peaks. Based on these results, this study proposed that the nt-κB sites that extensively distribute in larger numbers of repeat elements function as a nuclear reservoir of NF-κB. The nuclear NF-κB proteins stored at nt-κB sites in the resting cells may be recruited to the t-κB sites for regulating its target genes upon stimulation. Copyright © 2018 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  11. Systematic optimization model and algorithm for binding sequence selection in computational enzyme design

    PubMed Central

    Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan

    2013-01-01

    A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589

  12. Major versus minor groove DNA binding of a bisarginylporphyrin hybrid molecule: A molecular mechanics investigation

    NASA Astrophysics Data System (ADS)

    Gresh, Nohad; Perrée-fauvet, Martine

    1999-03-01

    On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.

  13. Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

    PubMed Central

    Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

    2013-01-01

    The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

  14. Alternate SlyA and H-NS nucleoprotein complexes control hlyE expression in Escherichia coli K-12

    PubMed Central

    Lithgow, James K; Haider, Fouzia; Roberts, Ian S; Green, Jeffrey

    2007-01-01

    Haemolysin E is a cytolytic pore-forming toxin found in several Escherichia coli and Salmonella enterica strains. Expression of hlyE is repressed by the global regulator H-NS (histone-like nucleoid structuring protein), but can be activated by the regulator SlyA. Expression of a chromosomal hlyE–lacZ fusion in an E. coli slyA mutant was reduced to 60% of the wild-type level confirming a positive role for SlyA. DNase I footprint analysis revealed the presence of two separate SlyA binding sites, one located upstream, the other downstream of the hlyE transcriptional start site. These sites overlap AT-rich H-NS binding sites. Footprint and gel shift data showed that whereas H-NS prevented binding of RNA polymerase (RNAP) at the hlyE promoter (PhlyE), SlyA allowed binding of RNAP, but inhibited binding of H-NS. Accordingly, in vitro transcription analyses showed that addition of SlyA protein relieved H-NS-mediated repression of hlyE. Based on these observations a model for SlyA/H-NS regulation of hlyE expression is proposed in which the relative concentrations of SlyA and H-NS govern the nature of the nucleoprotein complexes formed at PhlyE. When H-NS is dominant RNAP binding is inhibited and hlyE expression is silenced; when SlyA is dominant H-NS binding is inhibited allowing RNAP access to the promoter facilitating hlyE transcription. PMID:17892462

  15. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  16. A Feature-Based Approach to Modeling Protein–DNA Interactions

    PubMed Central

    Segal, Eran

    2008-01-01

    Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

  17. An Iron Reservoir to the Catalytic Metal

    PubMed Central

    Liu, Fange; Geng, Jiafeng; Gumpper, Ryan H.; Barman, Arghya; Davis, Ian; Ozarowski, Andrew; Hamelberg, Donald; Liu, Aimin

    2015-01-01

    The rubredoxin motif is present in over 74,000 protein sequences and 2,000 structures, but few have known functions. A secondary, non-catalytic, rubredoxin-like iron site is conserved in 3-hydroxyanthranilate 3,4-dioxygenase (HAO), from single cellular sources but not multicellular sources. Through the population of the two metal binding sites with various metals in bacterial HAO, the structural and functional relationship of the rubredoxin-like site was investigated using kinetic, spectroscopic, crystallographic, and computational approaches. It is shown that the first metal presented preferentially binds to the catalytic site rather than the rubredoxin-like site, which selectively binds iron when the catalytic site is occupied. Furthermore, an iron ion bound to the rubredoxin-like site is readily delivered to an empty catalytic site of metal-free HAO via an intermolecular transfer mechanism. Through the use of metal analysis and catalytic activity measurements, we show that a downstream metabolic intermediate can selectively remove the catalytic iron. As the prokaryotic HAO is often crucial for cell survival, there is a need for ensuring its activity. These results suggest that the rubredoxin-like site is a possible auxiliary iron source to the catalytic center when it is lost during catalysis in a pathway with metabolic intermediates of metal-chelating properties. A spare tire concept is proposed based on this biochemical study, and this concept opens up a potentially new functional paradigm for iron-sulfur centers in iron-dependent enzymes as transient iron binding and shuttling sites to ensure full metal loading of the catalytic site. PMID:25918158

  18. A Structure-Based Mechanism for Arf1-Dependent Recruitment of Coatomer to Membranes

    PubMed Central

    Yu, Xinchao; Breitman, Marianna; Goldberg, Jonathan

    2012-01-01

    Summary Budding of COPI-coated vesicles from Golgi membranes requires an Arf-family G protein and the coatomer complex recruited from cytosol. Arf is also required with coatomer-related clathrin adaptor complexes to bud vesicles from the trans-Golgi network and endosomal compartments. To understand the structural basis for Arf-dependent recruitment of a vesicular coat to the membrane, we determined the structure of Arf1 bound to the γζ-COP subcomplex of coatomer. Structure-guided biochemical analysis reveals that a second Arf1-GTP molecule binds to βδ-COP at a site common to the γ- and β-COP subunits. The Arf1-binding sites on coatomer are spatially related to PtdIns4,5P2-binding sites on the endocytic AP2 complex, providing evidence that the orientation of membrane binding is general for this class of vesicular coat proteins. A bivalent GTP-dependent binding mode has implications for the dynamics of coatomer interaction with the Golgi and for the selection of cargo molecules. PMID:22304919

  19. Structural characterization of metal binding to a cold-adapted frataxin.

    PubMed

    Noguera, Martín E; Roman, Ernesto A; Rigal, Juan B; Cousido-Siah, Alexandra; Mitschler, André; Podjarny, Alberto; Santos, Javier

    2015-06-01

    Frataxin is an evolutionary conserved protein that participates in iron metabolism. Deficiency of this small protein in humans causes a severe neurodegenerative disease known as Friedreich's ataxia. A number of studies indicate that frataxin binds iron and regulates Fe-S cluster biosynthesis. Previous structural studies showed that metal binding occurs mainly in a region of high density of negative charge. However, a comprehensive characterization of the binding sites is required to gain further insights into the mechanistic details of frataxin function. In this work, we have solved the X-ray crystal structures of a cold-adapted frataxin from a psychrophilic bacterium in the presence of cobalt or europium ions. We have identified a number of metal-binding sites, mainly solvent exposed, several of which had not been observed in previous studies on mesophilic homologues. No major structural changes were detected upon metal binding, although the structures exhibit significant changes in crystallographic B-factors. The analysis of these B-factors, in combination with crystal packing and RMSD among structures, suggests the existence of localized changes in the internal motions. Based on these results, we propose that bacterial frataxins possess binding sites of moderate affinity for a quick capture and transfer of iron to other proteins and for the regulation of Fe-S cluster biosynthesis, modulating interactions with partner proteins.

  20. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  1. Investigation and identification of functional post-translational modification sites associated with drug binding and protein-protein interactions.

    PubMed

    Su, Min-Gang; Weng, Julia Tzu-Ya; Hsu, Justin Bo-Kai; Huang, Kai-Yao; Chi, Yu-Hsiang; Lee, Tzong-Yi

    2017-12-21

    Protein post-translational modification (PTM) plays an essential role in various cellular processes that modulates the physical and chemical properties, folding, conformation, stability and activity of proteins, thereby modifying the functions of proteins. The improved throughput of mass spectrometry (MS) or MS/MS technology has not only brought about a surge in proteome-scale studies, but also contributed to a fruitful list of identified PTMs. However, with the increase in the number of identified PTMs, perhaps the more crucial question is what kind of biological mechanisms these PTMs are involved in. This is particularly important in light of the fact that most protein-based pharmaceuticals deliver their therapeutic effects through some form of PTM. Yet, our understanding is still limited with respect to the local effects and frequency of PTM sites near pharmaceutical binding sites and the interfaces of protein-protein interaction (PPI). Understanding PTM's function is critical to our ability to manipulate the biological mechanisms of protein. In this study, to understand the regulation of protein functions by PTMs, we mapped 25,835 PTM sites to proteins with available three-dimensional (3D) structural information in the Protein Data Bank (PDB), including 1785 modified PTM sites on the 3D structure. Based on the acquired structural PTM sites, we proposed to use five properties for the structural characterization of PTM substrate sites: the spatial composition of amino acids, residues and side-chain orientations surrounding the PTM substrate sites, as well as the secondary structure, division of acidity and alkaline residues, and solvent-accessible surface area. We further mapped the structural PTM sites to the structures of drug binding and PPI sites, identifying a total of 1917 PTM sites that may affect PPI and 3951 PTM sites associated with drug-target binding. An integrated analytical platform (CruxPTM), with a variety of methods and online molecular docking tools for exploring the structural characteristics of PTMs, is presented. In addition, all tertiary structures of PTM sites on proteins can be visualized using the JSmol program. Resolving the function of PTM sites is important for understanding the role that proteins play in biological mechanisms. Our work attempted to delineate the structural correlation between PTM sites and PPI or drug-target binding. CurxPTM could help scientists narrow the scope of their PTM research and enhance the efficiency of PTM identification in the face of big proteome data. CruxPTM is now available at http://csb.cse.yzu.edu.tw/CruxPTM/ .

  2. Molecular Insights into the Potential Toxicological Interaction of 2-Mercaptothiazoline with the Antioxidant Enzyme—Catalase

    PubMed Central

    Huang, Zhenxing; Huang, Ming; Mi, Chenyu; Wang, Tao; Chen, Dong; Teng, Yue

    2016-01-01

    2-mercaptothiazoline (2-MT) is widely used in many industrial fields, but its residue is potentially harmful to the environment. In this study, to evaluate the biological toxicity of 2-MT at protein level, the interaction between 2-MT and the pivotal antioxidant enzyme—catalase (CAT) was investigated using multiple spectroscopic techniques and molecular modeling. The results indicated that the CAT fluorescence quenching caused by 2-MT should be dominated by a static quenching mechanism through formation of a 2-MT/CAT complex. Furthermore, the identifications of the binding constant, binding forces, and the number of binding sites demonstrated that 2-MT could spontaneously interact with CAT at one binding site mainly via Van der Waals’ forces and hydrogen bonding. Based on the molecular docking simulation and conformation dynamic characterization, it was found that 2-MT could bind into the junctional region of CAT subdomains and that the binding site was close to enzyme active sites, which induced secondary structural and micro-environmental changes in CAT. The experiments on 2-MT toxicity verified that 2-MT significantly inhibited CAT activity via its molecular interaction, where 2-MT concentration and exposure time both affected the inhibitory action. Therefore, the present investigation provides useful information for understanding the toxicological mechanism of 2-MT at the molecular level. PMID:27537873

  3. Structural and Biochemical Studies on ATP Binding and Hydrolysis by the Escherichia coli RNA Chaperone Hfq

    PubMed Central

    Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

    2012-01-01

    In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)15 and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq65) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions. PMID:23226421

  4. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting

    PubMed Central

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308

  6. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  7. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  8. Electromobility Shift Assay Reveals Evidence in Favor of Allele-Specific Binding of RUNX1 to the 5' Hypersensitive Site 4-Locus Control Region.

    PubMed

    Dehghani, Hossein; Ghobakhloo, Sepideh; Neishabury, Maryam

    2016-08-01

    In our previous studies on the Iranian β-thalassemia (β-thal) patients, we identified an association between the severity of the β-thal phenotype and the polymorphic palindromic site at the 5' hypersensitive site 4-locus control region (5'HS4-LCR) of the β-globin gene cluster. Furthermore, a linkage disequilibrium was observed between this region and XmnI-HBG2 in the patient population. Based on this data, it was suggested that the well-recognized phenotype-ameliorating role assigned to positive XmnI could be associated with its linked elements in the LCR. To investigate the functional significance of polymorphisms at the 5'HS4-LCR, we studied its influence on binding of transcription factors. Web-based predictions of transcription factor binding revealed a binding site for runt-related transcription factor 1 (RUNX1), when the allele at the center of the palindrome (TGGGG(A/G)CCCCA) was A but not when it was G. Furthermore, electromobility shift assay (EMSA) presented evidence in support of allele-specific binding of RUNX1 to 5'HS4. Considering that RUNX1 is a well-known regulator of hematopoiesis, these preliminary data suggest the importance of further studies to confirm this interaction and consequently investigate its functional and phenotypical relevance. These studies could help us to understand the molecular mechanism behind the phenotype modifying role of the 5'HS4-LCR polymorphic palindromic region (rs16912979), which has been observed in previous studies.

  9. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  10. Structure of Simian Immunodeficiency Virus Envelope Spikes Bound with CD4 and Monoclonal Antibody 36D5.

    PubMed

    Hu, Guiqing; Liu, Jun; Roux, Kenneth H; Taylor, Kenneth A

    2017-08-15

    The human immunodeficiency virus type 1 (HIV-1)/simian immunodeficiency virus (SIV) envelope spike (Env) mediates viral entry into host cells. The V3 loop of the gp120 component of the Env trimer contributes to the coreceptor binding site and is a target for neutralizing antibodies. We used cryo-electron tomography to visualize the binding of CD4 and the V3 loop monoclonal antibody (MAb) 36D5 to gp120 of the SIV Env trimer. Our results show that 36D5 binds gp120 at the base of the V3 loop and suggest that the antibody exerts its neutralization effect by blocking the coreceptor binding site. The antibody does this without altering the dynamics of the spike motion between closed and open states when CD4 is bound. The interaction between 36D5 and SIV gp120 is similar to the interaction between some broadly neutralizing anti-V3 loop antibodies and HIV-1 gp120. Two conformations of gp120 bound with CD4 are revealed, suggesting an intrinsic dynamic nature of the liganded Env trimer. CD4 binding substantially increases the binding of 36D5 to gp120 in the intact Env trimer, consistent with CD4-induced changes in the conformation of gp120 and the antibody binding site. Binding by MAb 36D5 does not substantially alter the proportions of the two CD4-bound conformations. The position of MAb 36D5 at the V3 base changes little between conformations, indicating that the V3 base serves as a pivot point during the transition between these two states. IMPORTANCE Glycoprotein spikes on the surfaces of SIV and HIV are the sole targets available to the immune system for antibody neutralization. Spikes evade the immune system by a combination of a thick layer of polysaccharide on the surface (the glycan shield) and movement between spike domains that masks the epitope conformation. Using SIV virions whose spikes were "decorated" with the primary cellular receptor (CD4) and an antibody (36D5) at part of the coreceptor binding site, we visualized multiple conformations trapped by the rapid freezing step, which were separated using statistical analysis. Our results show that the CD4-induced conformational dynamics of the spike enhances binding of the antibody. Copyright © 2017 American Society for Microbiology.

  11. Protein Surface Structural Recognition in Inactive Areas: A New Immobilization Strategy for Acetylcholinesterase.

    PubMed

    Diao, Jianxiong; Yu, Xiaolu; Ma, Lin; Li, Yuanqing; Sun, Ying

    2018-05-16

    This work reported a new method of design for the immobilization of acetylcholinesterase (AChE) based on its molecular structure to improve its sensitivity and stability. The immobilization binding site on the surface of AChE was determined using MOLCAD's multi-channel functionality. Then, 11 molecules ((+)-catechin, (-)-epicatechin, (-)-gallocatechin, hesperetin, naringenin, quercetin, taxifolin, (-)-epicatechin gallate, flupirtine, atropine, and hyoscyamine) were selected from the ZINC database (about 50 000 molecules) as candidate affinity ligands for AChE. The fluorescence results showed that the binding constant K b between AChE and the ligands ranged from 0.01344 × 10 4 to 4.689 × 10 4 M -1 and there was one independent class of binding site for the ligands on AChE. The AChE-ligand binding free energy ranged from -12.14 to -26.65 kJ mol -1 . Naringenin, hesperetin, and quercetin were the three most potent immobilized affinity ligands. In addition, it was confirmed that the binding between the immobilized ligands only occurred at a single site, located in an inactive area on the surface of AChE, and did not affect the enzymatic activity as shown through a competition experiment and enzyme assay. This method based on protein surface structural recognition with high sensitivity and stability can be used as a generic approach for design of the enzyme immobilization and biosensor development.

  12. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  13. Binding modes of environmental endocrine disruptors to human serum albumin: insights from STD-NMR, ITC, spectroscopic and molecular docking studies.

    PubMed

    Yang, Hongqin; Huang, Yanmei; Liu, Jiuyang; Tang, Peixiao; Sun, Qiaomei; Xiong, Xinnuo; Tang, Bin; He, Jiawei; Li, Hui

    2017-09-11

    Given that bisphenols have an endocrine-disrupting effect on human bodies, thoroughly exposing their potential effects at the molecular level is important. Saturation transfer difference (STD) NMR-based binding studies were performed to investigate the binding potential of two bisphenol representatives, namely, bisphenol B (BPB) and bisphenol E (BPE), toward human serum albumin (HSA). The relative STD (%) suggested that BPB and BPE show similar binding modes and orientations, in which the phenolic rings were spatially close to HSA binding site. ITC analysis results showed that BPB and BPE were bound to HSA with moderately strong binding affinity through electrostatic interactions and hydrogen bonds. The order of binding affinity of HSA for two test bisphenols is as follows: BPE > BPB. The results of fluorescence competitive experiments using 5-dimethylaminonaphthalene-1-sulfonamide and dansylsarcosine as competitors, combined with molecular docking indicated that both bisphenols are prone to attach to the binding site II in HSA. Spectroscopic results (FT-IR, CD, synchronous and 3D fluorescence spectra) showed that BPB/BPE induces different degrees of microenvironmental and conformational changes to HSA.

  14. The FTMap family of web servers for determining and characterizing ligand binding hot spots of proteins

    PubMed Central

    Kozakov, Dima; Grove, Laurie E.; Hall, David R.; Bohnuud, Tanggis; Mottarella, Scott; Luo, Lingqi; Xia, Bing; Beglov, Dmitri; Vajda, Sandor

    2016-01-01

    FTMap is a computational mapping server that identifies binding hot spots of macromolecules, i.e., regions of the surface with major contributions to the ligand binding free energy. To use FTMap, users submit a protein, DNA, or RNA structure in PDB format. FTMap samples billions of positions of small organic molecules used as probes and scores the probe poses using a detailed energy expression. Regions that bind clusters of multiple probe types identify the binding hot spots, in good agreement with experimental data. FTMap serves as basis for other servers, namely FTSite to predict ligand binding sites, FTFlex to account for side chain flexibility, FTMap/param to parameterize additional probes, and FTDyn to map ensembles of protein structures. Applications include determining druggability of proteins, identifying ligand moieties that are most important for binding, finding the most bound-like conformation in ensembles of unliganded protein structures, and providing input for fragment based drug design. FTMap is more accurate than classical mapping methods such as GRID and MCSS, and is much faster than the more recent approaches to protein mapping based on mixed molecular dynamics. Using 16 probe molecules, the FTMap server finds the hot spots of an average size protein in less than an hour. Since FTFlex performs mapping for all low energy conformers of side chains in the binding site, its completion time is proportionately longer. PMID:25855957

  15. Analysis of the Binding Sites of Porcine Sialoadhesin Receptor with PRRSV

    PubMed Central

    Jiang, Yibo; Khan, Faheem Ahmed; Pandupuspitasari, Nuruliarizki Shinta; Kadariya, Ishwari; Cheng, Zhangrui; Ren, Yuwei; Chen, Xing; Zhou, Ao; Yang, Liguo; Kong, Dexin; Zhang, Shujun

    2013-01-01

    Porcine reproductive and respiratory syndrome virus (PRRSV) can infect pigs and cause enormous economic losses to the pig industry worldwide. Porcine sialoadhesin (pSN) and CD163 have been identified as key viral receptors on porcine alveolar macrophages (PAM), a main target cell infected by PRRSV. In this study, the protein structures of amino acids 1–119 from the pSN and cSN (cattle sialoadhesin) N-termini (excluding the 19-amino acid signal peptide) were modeled via homology modeling based on mSN (mouse sialoadhesin) template structures using bioinformatics tools. Subsequently, pSN and cSN homology structures were superposed onto the mSN protein structure to predict the binding sites of pSN. As a validation experiment, the SN N-terminus (including the wild-type and site-directed-mutant-types of pSN and cSN) was cloned and expressed as a SN-GFP chimera protein. The binding activity between SN and PRRSV was confirmed by WB (Western blotting), FAR-WB (far Western blotting), ELISA (enzyme-linked immunosorbent assay) and immunofluorescence assay. We found that the S107 amino acid residue in the pSN N-terminal played a crucial role in forming a special cavity, as well as a hydrogen bond for enhancing PRRSV binding during PRRSV infection. S107 may be glycosylated during PRRSV infection and may also be involved in forming the cavity for binding PRRSV along with other sites, including W2, Y44, S45, R97, R105, W106 and V109. Additionally, S107 might also be important for pSN binding with PRRSV. However, the function of these binding sites must be confirmed by further studies. PMID:24351868

  16. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  17. Prediction of consensus binding mode geometries for related chemical series of positive allosteric modulators of adenosine and muscarinic acetylcholine receptors.

    PubMed

    Sakkal, Leon A; Rajkowski, Kyle Z; Armen, Roger S

    2017-06-05

    Following insights from recent crystal structures of the muscarinic acetylcholine receptor, binding modes of Positive Allosteric Modulators (PAMs) were predicted under the assumption that PAMs should bind to the extracellular surface of the active state. A series of well-characterized PAMs for adenosine (A 1 R, A 2A R, A 3 R) and muscarinic acetylcholine (M 1 R, M 5 R) receptors were modeled using both rigid and flexible receptor CHARMM-based molecular docking. Studies of adenosine receptors investigated the molecular basis of the probe-dependence of PAM activity by modeling in complex with specific agonist radioligands. Consensus binding modes map common pharmacophore features of several chemical series to specific binding interactions. These models provide a rationalization of how PAM binding slows agonist radioligand dissociation kinetics. M 1 R PAMs were predicted to bind in the analogous M 2 R PAM LY2119620 binding site. The M 5 R NAM (ML-375) was predicted to bind in the PAM (ML-380) binding site with a unique induced-fit receptor conformation. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  18. [Molecular docking of chlorogenic acid, 3,4-di-O-caffeoylquinic acid and 3,5-di-O-caffeoylquinic acid with human serum albumin].

    PubMed

    Zhou, Jing; Ma, Hong-yue; Fan, Xin-sheng; Xiao, Wei; Wang, Tuan-jie

    2012-10-01

    To investigate the mechanism of binding of human serum albumin (HSA) with potential sensitinogen, including chlorogenic acid and two isochlorogenic acids (3,4-di-O-caffeoylquinic acid and 3,5-di-O-caffeoylquinic acid). By using the docking algorithm of computer-aided molecular design and the Molegro Virtual Docker, the crystal structures of HSA with warfarin and diazepam (Protein Data Bank ID: 2BXD and 2BXF) were selected as molecular docking receptors of HSA sites I and II. According to docking scores, key residues and H-bond, the molecular docking mode was selected and confirmed. The molecular docking of chlorogenic acid and two isochlorogenic acids on sites I and II was compared based on the above design. The results from molecular docking indicated that chlorogenic acid, 3,4-di-O-caffeoylquinic acid and 3,5-di-O-caffeoylquinic acid could bind to HSA site I by high affinity scores of -112.3, -155.3 and -153.1, respectively. They could bind to site II on HSA by high affinity scores of -101.7, -138.5 and -133.4, respectively. In site I, two isochlorogenic acids interacted with the key apolar side-chains of Leu238 and Ala291 by higher affinity scores than chlorogenic acid. Furthermore, the H-bonds of isochlorogenic acids with polar residues inside the pocket and at the entrance of the pocket were different from chlorogenic acid. Moreover, the second coffee acyl of isochlorogenic acid occupied the right-hand apolar compartment in the pocket of HSA site I. In site I, the second coffee acyl of isochlorogenic acid formed the H-bonds with polar side-chains, which contributed isochlorogenic acid to binding with site II of HSA. The isochlorogenic acids with two coffee acyls have higher binding abilities with HSA than chlorogenic acid with one coffee acyl, suggesting that isochlorogenic acids binding with HSA may be sensitinogen.

  19. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  20. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  1. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  2. Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

    PubMed Central

    Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

    2001-01-01

    The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

  3. Homology modeling, binding site identification and docking study of human angiotensin II type I (Ang II-AT1) receptor.

    PubMed

    Vyas, Vivek K; Ghate, Manjunath; Patel, Kinjal; Qureshi, Gulamnizami; Shah, Surmil

    2015-08-01

    Ang II-AT1 receptors play an important role in mediating virtually all of the physiological actions of Ang II. Several drugs (SARTANs) are available, which can block the AT1 receptor effectively and lower the blood pressure in the patients with hypertension. Currently, there is no experimental Ang II-AT1 structure available; therefore, in this study we modeled Ang II-AT1 receptor structure using homology modeling followed by identification and characterization of binding sites and thereby assessing druggability of the receptor. Homology models were constructed using MODELLER and I-TASSER server, refined and validated using PROCHECK in which 96.9% of 318 residues were present in the favoured regions of the Ramachandran plots. Various Ang II-AT1 receptor antagonist drugs are available in the market as antihypertensive drug, so we have performed docking study with the binding site prediction algorithms to predict different binding pockets on the modeled proteins. The identification of 3D structures and binding sites for various known drugs will guide us for the structure-based drug design of novel compounds as Ang II-AT1 receptor antagonists for the treatment of hypertension. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  4. Kinetics of Cation and Oxyanion Adsorption and Desorption on Ferrihydrite: Roles of Ferrihydrite Binding Sites and a Unified Model.

    PubMed

    Tian, Lei; Shi, Zhenqing; Lu, Yang; Dohnalkova, Alice C; Lin, Zhang; Dang, Zhi

    2017-09-19

    Quantitative understanding the kinetics of toxic ion reactions with various heterogeneous ferrihydrite binding sites is crucial for accurately predicting the dynamic behavior of contaminants in environment. In this study, kinetics of As(V), Cr(VI), Cu(II), and Pb(II) adsorption and desorption on ferrihydrite was studied using a stirred-flow method, which showed that metal adsorption/desorption kinetics was highly dependent on the reaction conditions and varied significantly among four metals. High resolution scanning transmission electron microscopy coupled with energy-dispersive X-ray spectroscopy showed that all four metals were distributed within the ferrihydrite aggregates homogeneously after adsorption reactions. Based on the equilibrium model CD-MUSIC, we developed a novel unified kinetics model applicable for both cation and oxyanion adsorption and desorption on ferrihydrite, which is able to account for the heterogeneity of ferrihydrite binding sites, different binding properties of cations and oxyanions, and variations of solution chemistry. The model described the kinetic results well. We quantitatively elucidated how the equilibrium properties of the cation and oxyanion binding to various ferrihydrite sites and the formation of various surface complexes controlled the adsorption and desorption kinetics at different reaction conditions and time scales. Our study provided a unified modeling method for the kinetics of ion adsorption/desorption on ferrihydrite.

  5. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  6. Mutational analysis of the antigenomic trans-acting delta ribozyme: the alterations of the middle nucleotides located on the P1 stem.

    PubMed Central

    Ananvoranich, S; Lafontaine, D A; Perreault, J P

    1999-01-01

    Our previous report on delta ribozyme cleavage using a trans -acting antigenomic delta ribozyme and a collection of short substrates showed that the middle nucleotides of the P1 stem, the substrate binding site, are essential for the cleavage activity. Here we have further investigated the effect of alterations in the P1 stem on the kinetic and thermodynamic parameters of delta ribozyme cleavage using various ribozyme variants carrying single base mutations at putative positions reported. The kinetic and thermodynamic values obtained in mutational studies of the two middle nucleotides of the P1 stem suggest that the binding and active sites of the delta ribozyme are uniquely formed. Firstly, the substrate and the ribozyme are engaged in the formation of a helix, known as the P1 stem, which may contain a weak hydrogen bond(s) or a bulge. Secondly, a tertiary interaction involving the base moieties in the middle of the P1 stem likely plays a role in defining the chemical environment. As a con-sequence, the active site might form simultaneously or subsequently to the binding site during later steps of the pathway. PMID:10037808

  7. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  8. Site-directed antibody immobilization using a protein A-gold binding domain fusion protein for enhanced SPR immunosensing.

    PubMed

    de Juan-Franco, Elena; Caruz, Antonio; Pedrajas, J R; Lechuga, Laura M

    2013-04-07

    We have implemented a novel strategy for the oriented immobilization of antibodies onto a gold surface based on the use of a fusion protein, the protein A-gold binding domain (PAG). PAG consists of a gold binding peptide (GBP) coupled to the immunoglobulin-binding domains of staphylococcal protein A. This fusion protein provides an easy and fast oriented immobilization of antibodies preserving its native structure, while leaving the antigen binding sites (Fab) freely exposed. Using this immobilization strategy, we have demonstrated the performance of the immunosensing of the human Growth Hormone by SPR. A limit of detection of 90 ng mL(-1) was obtained with an inter-chip variability lower than 7%. The comparison of this method with other strategies for the direct immobilization of antibodies over gold surfaces has showed the enhanced sensitivity provided by the PAG approach.

  9. Discovery and Characterization of Non-ATP Site Inhibitors of the Mitogen Activated Protein (MAP) Kinases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Comess, Kenneth M.; Sun, Chaohong; Abad-Zapatero, Cele

    Inhibition of protein kinases has validated therapeutic utility for cancer, with at least seven kinase inhibitor drugs on the market. Protein kinase inhibition also has significant potential for a variety of other diseases, including diabetes, pain, cognition, and chronic inflammatory and immunologic diseases. However, as the vast majority of current approaches to kinase inhibition target the highly conserved ATP-binding site, the use of kinase inhibitors in treating nononcology diseases may require great selectivity for the target kinase. As protein kinases are signal transducers that are involved in binding to a variety of other proteins, targeting alternative, less conserved sites onmore » the protein may provide an avenue for greater selectivity. Here we report an affinity-based, high-throughput screening technique that allows nonbiased interrogation of small molecule libraries for binding to all exposed sites on a protein surface. This approach was used to screen both the c-Jun N-terminal protein kinase Jnk-1 (involved in insulin signaling) and p38{alpha} (involved in the formation of TNF{alpha} and other cytokines). In addition to canonical ATP-site ligands, compounds were identified that bind to novel allosteric sites. The nature, biological relevance, and mode of binding of these ligands were extensively characterized using two-dimensional {sup 1}H/{sup 13}C NMR spectroscopy, protein X-ray crystallography, surface plasmon resonance, and direct enzymatic activity and activation cascade assays. Jnk-1 and p38{alpha} both belong to the MAP kinase family, and the allosteric ligands for both targets bind similarly on a ledge of the protein surface exposed by the MAP insertion present in the CMGC family of protein kinases and distant from the active site. Medicinal chemistry studies resulted in an improved Jnk-1 ligand able to increase adiponectin secretion in human adipocytes and increase insulin-induced protein kinase PKB phosphorylation in human hepatocytes, in similar fashion to Jnk-1 siRNA and to rosiglitazone treatment. Together, the data suggest that these new ligand series bind to a novel, allosteric, and physiologically relevant site and therefore represent a unique approach to identify kinase inhibitors.« less

  10. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  11. Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

    PubMed Central

    Lill, R; Robertson, J M; Wintermeyer, W

    1989-01-01

    A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

  12. ATP hydrolysis in Eg5 kinesin involves a catalytic two-water mechanism.

    PubMed

    Parke, Courtney L; Wojcik, Edward J; Kim, Sunyoung; Worthylake, David K

    2010-02-19

    Motor proteins couple steps in ATP binding and hydrolysis to conformational switching both in and remote from the active site. In our kinesin.AMPPPNP crystal structure, closure of the active site results in structural transformations appropriate for microtubule binding and organizes an orthosteric two-water cluster. We conclude that a proton is shared between the lytic water, positioned for gamma-phosphate attack, and a second water that serves as a general base. To our knowledge, this is the first experimental detection of the catalytic base for any ATPase. Deprotonation of the second water by switch residues likely triggers subsequent large scale structural rearrangements. Therefore, the catalytic base is responsible for initiating nucleophilic attack of ATP and for relaying the positive charge over long distances to initiate mechanotransduction. Coordination of switch movements via sequential proton transfer along paired water clusters may be universal for nucleotide triphosphatases with conserved active sites, such as myosins and G-proteins.

  13. Functional Analysis of the Citrate Activator CitO from Enterococcus faecalis Implicates a Divalent Metal in Ligand Binding

    PubMed Central

    Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.

    2016-01-01

    The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980

  14. Native Mass Spectrometry in Fragment-Based Drug Discovery.

    PubMed

    Pedro, Liliana; Quinn, Ronald J

    2016-07-28

    The advent of native mass spectrometry (MS) in 1990 led to the development of new mass spectrometry instrumentation and methodologies for the analysis of noncovalent protein-ligand complexes. Native MS has matured to become a fast, simple, highly sensitive and automatable technique with well-established utility for fragment-based drug discovery (FBDD). Native MS has the capability to directly detect weak ligand binding to proteins, to determine stoichiometry, relative or absolute binding affinities and specificities. Native MS can be used to delineate ligand-binding sites, to elucidate mechanisms of cooperativity and to study the thermodynamics of binding. This review highlights key attributes of native MS for FBDD campaigns.

  15. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  16. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  17. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  18. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  19. Structural insights into conserved L-arabinose metabolic enzymes reveal the substrate binding site of a thermophilic L-arabinose isomerase.

    PubMed

    Lee, Yong-Jik; Lee, Sang-Jae; Kim, Seong-Bo; Lee, Sang Jun; Lee, Sung Haeng; Lee, Dong-Woo

    2014-03-18

    Structural genomics demonstrates that despite low levels of structural similarity of proteins comprising a metabolic pathway, their substrate binding regions are likely to be conserved. Herein based on the 3D-structures of the α/β-fold proteins involved in the ara operon, we attempted to predict the substrate binding residues of thermophilic Geobacillus stearothermophilus L-arabinose isomerase (GSAI) with no 3D-structure available. Comparison of the structures of L-arabinose catabolic enzymes revealed a conserved feature to form the substrate-binding modules, which can be extended to predict the substrate binding site of GSAI (i.e., D195, E261 and E333). Moreover, these data implicated that proteins in the l-arabinose metabolic pathway might retain their substrate binding niches as the modular structure through conserved molecular evolution even with totally different structural scaffolds. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  20. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria.

    PubMed

    Yang, Yunpeng; Zhang, Lu; Huang, He; Yang, Chen; Yang, Sheng; Gu, Yang; Jiang, Weihong

    2017-01-24

    Catabolite control protein A (CcpA) is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR) and carbon catabolite activation (CCA), two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt) consensus site that is called a catabolite response element (cre) within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named cre var , has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA). It was found that the length of the intervening spacer of cre var can affect CcpA binding affinity, and moreover, the core palindromic sequence of cre var is the key structure for regulation. Such a variable architecture of cre var shows potential importance for CcpA's diverse and fine regulation. A total of 103 potential cre var sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs), and 30 sites were confirmed to be bound by CcpA. These 30 cre var sites are associated with 27 genes involved in many important pathways. Also of significance, the cre var sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria. In Gram-positive bacteria, the global regulator CcpA controls a large number of important physiological and metabolic processes. Although a typical consensus CcpA-binding site, cre, has been identified, it remains poorly explored for the diversity of CcpA-mediated catabolite regulation. Here, we discovered a novel flexible CcpA-binding site architecture (cre var ) that is highly variable in both length and base composition but follows certain principles, providing new insights into how CcpA can differentially recognize a variety of target genes to form a complicated regulatory network. A comprehensive search further revealed the wide distribution of cre var sites in Gram-positive bacteria, indicating it may have a universal function. This finding is the first to characterize such a highly flexible transcription factor-binding site architecture, which would be valuable for deeper understanding of CcpA-mediated global catabolite regulation in bacteria. Copyright © 2017 Yang et al.

  1. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  2. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  3. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  4. Protein pharmacophore selection using hydration-site analysis

    PubMed Central

    Hu, Bingjie; Lill, Markus A.

    2012-01-01

    Virtual screening using pharmacophore models is an efficient method to identify potential lead compounds for target proteins. Pharmacophore models based on protein structures are advantageous because a priori knowledge of active ligands is not required and the models are not biased by the chemical space of previously identified actives. However, in order to capture most potential interactions between all potentially binding ligands and the protein, the size of the pharmacophore model, i.e. number of pharmacophore elements, is typically quite large and therefore reduces the efficiency of pharmacophore based screening. We have developed a new method to select important pharmacophore elements using hydration-site information. The basic premise is that ligand functional groups that replace water molecules in the apo protein contribute strongly to the overall binding affinity of the ligand, due to the additional free energy gained from releasing the water molecule into the bulk solvent. We computed the free energy of water released from the binding site for each hydration site using thermodynamic analysis of molecular dynamics (MD) simulations. Pharmacophores which are co-localized with hydration sites with estimated favorable contributions to the free energy of binding are selected to generate a reduced pharmacophore model. We constructed reduced pharmacophore models for three protein systems and demonstrated good enrichment quality combined with high efficiency. The reduction in pharmacophore model size reduces the required screening time by a factor of 200–500 compared to using all protein pharmacophore elements. We also describe a training process using a small set of known actives to reliably select the optimal set of criteria for pharmacophore selection for each protein system. PMID:22397751

  5. Interaction of antithrombin with sulfated, low molecular weight lignins: opportunities for potent, selective modulation of antithrombin function.

    PubMed

    Henry, Brian L; Connell, Justin; Liang, Aiye; Krishnasamy, Chandravel; Desai, Umesh R

    2009-07-31

    Antithrombin, a major regulator of coagulation and angiogenesis, is known to interact with several natural sulfated polysaccharides. Previously, we prepared sulfated low molecular weight variants of natural lignins, called sulfated dehydrogenation polymers (DHPs) (Henry, B. L., Monien, B. H., Bock, P. E., and Desai, U. R. (2007) J. Biol. Chem. 282, 31891-31899), which have now been found to exhibit interesting antithrombin binding properties. Sulfated DHPs represent a library of diverse noncarbohydrate aromatic scaffolds that possess structures completely different from heparin and heparan sulfate. Fluorescence binding studies indicate that sulfated DHPs bind to antithrombin with micromolar affinity under physiological conditions. Salt dependence of binding affinity indicates that the antithrombin-sulfated DHP interaction involves a massive 80-87% non-ionic component to the free energy of binding. Competitive binding studies with heparin pentasaccharide, epicatechin sulfate, and full-length heparin indicate that sulfated DHPs bind to both the pentasaccharide-binding site and extended heparin-binding site of antithrombin. Affinity capillary electrophoresis resolves a limited number of peaks of antithrombin co-complexes suggesting preferential binding of selected DHP structures to the serpin. Computational genetic algorithm-based virtual screening study shows that only one sulfated DHP structure, out of the 11 present in a library of plausible sequences, bound in the heparin-binding site with a high calculated score supporting selectivity of recognition. Enzyme inhibition studies indicate that only one of the three sulfated DHPs studied is a potent inhibitor of free factor VIIa in the presence of antithrombin. Overall, the chemo-enzymatic origin and antithrombin binding properties of sulfated DHPs present novel opportunities for potent and selective modulation of the serpin function, especially for inhibiting the initiation phase of hemostasis.

  6. Convergent transmission of RNAi guide-target mismatch information across Argonaute internal allosteric network.

    PubMed

    Joseph, Thomas T; Osman, Roman

    2012-01-01

    In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand "seed region" have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways.

  7. Convergent Transmission of RNAi Guide-Target Mismatch Information across Argonaute Internal Allosteric Network

    PubMed Central

    Joseph, Thomas T.; Osman, Roman

    2012-01-01

    In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand “seed region” have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways. PMID:23028290

  8. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  9. Relocating the Active-Site Lysine in Rhodopsin: 2. Evolutionary Intermediates.

    PubMed

    Devine, Erin L; Theobald, Douglas L; Oprian, Daniel D

    2016-08-30

    The visual pigment rhodopsin is a G protein-coupled receptor that covalently binds its retinal chromophore via a Schiff base linkage to an active-site Lys residue in the seventh transmembrane helix. Although this residue is strictly conserved among all type II retinylidene proteins, we found previously that the active-site Lys in bovine rhodopsin (Lys296) can be moved to three other locations (G90K, T94K, S186K) while retaining the ability to form a pigment with retinal and to activate transducin in a light-dependent manner [ Devine et al. ( 2013 ) Proc. Natl. Acad. Sci. USA 110 , 13351 - 13355 ]. Because the active-site Lys is not functionally constrained to be in helix seven, it is possible that it could relocate within the protein, most likely via an evolutionary intermediate with two active-site Lys. Therefore, in this study we characterized potential evolutionary intermediates with two Lys in the active site. Four mutant rhodopsins were prepared in which the original Lys296 was left untouched and a second Lys residue was substituted for G90K, T94K, S186K, or F293K. All four constructs covalently bind 11-cis-retinal, form a pigment, and activate transducin in a light-dependent manner. These results demonstrate that rhodopsin can tolerate a second Lys in the retinal binding pocket and suggest that an evolutionary intermediate with two Lys could allow migration of the Schiff base Lys to a position other than the observed, highly conserved location in the seventh TM helix. From sequence-based searches, we identified two groups of natural opsins, insect UV cones and neuropsins, that contain Lys residues at two positions in their active sites and also have intriguing spectral similarities to the mutant rhodopsins studied here.

  10. Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marrot, L.; Leng, M.

    The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less

  11. Modeling Shear Induced Von Willebrand Factor Binding to Collagen

    NASA Astrophysics Data System (ADS)

    Dong, Chuqiao; Wei, Wei; Morabito, Michael; Webb, Edmund; Oztekin, Alparslan; Zhang, Xiaohui; Cheng, Xuanhong

    2017-11-01

    Von Willebrand factor (vWF) is a blood glycoprotein that binds with platelets and collagen on injured vessel surfaces to form clots. VWF bioactivity is shear flow induced: at low shear, binding between VWF and other biological entities is suppressed; for high shear rate conditions - as are found near arterial injury sites - VWF elongates, activating its binding with platelets and collagen. Based on parameters derived from single molecule force spectroscopy experiments, we developed a coarse-grain molecular model to simulate bond formation probability as a function of shear rate. By introducing a binding criterion that depends on the conformation of a sub-monomer molecular feature of our model, the model predicts shear-induced binding, even for conditions where binding is highly energetically favorable. We further investigate the influence of various model parameters on the ability to predict shear-induced binding (vWF length, collagen site density and distribution, binding energy landscape, and slip/catch bond length) and demonstrate parameter ranges where the model provides good agreement with existing experimental data. Our results may be important for understanding vWF activity and also for achieving targeted drug therapy via biomimetic synthetic molecules. National Science Foundation (NSF),Division of Mathematical Sciences (DMS).

  12. Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

    NASA Astrophysics Data System (ADS)

    Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

    2014-07-01

    Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors.

  13. Positive and Negative Allosteric Modulation of an α1β3γ2 γ-Aminobutyric Acid Type A (GABAA) Receptor by Binding to a Site in the Transmembrane Domain at the γ+-β− Interface*

    PubMed Central

    Jayakar, Selwyn S.; Zhou, Xiaojuan; Savechenkov, Pavel Y.; Chiara, David C.; Desai, Rooma; Bruzik, Karol S.; Miller, Keith W.; Cohen, Jonathan B.

    2015-01-01

    In the process of developing safer general anesthetics, isomers of anesthetic ethers and barbiturates have been discovered that act as convulsants and inhibitors of γ-aminobutyric acid type A receptors (GABAARs) rather than potentiators. It is unknown whether these convulsants act as negative allosteric modulators by binding to the intersubunit anesthetic-binding sites in the GABAAR transmembrane domain (Chiara, D. C., Jayakar, S. S., Zhou, X., Zhang, X., Savechenkov, P. Y., Bruzik, K. S., Miller, K. W., and Cohen, J. B. (2013) J. Biol. Chem. 288, 19343–19357) or to known convulsant sites in the ion channel or extracellular domains. Here, we show that S-1-methyl-5-propyl-5-(m-trifluoromethyl-diazirynylphenyl) barbituric acid (S-mTFD-MPPB), a photoreactive analog of the convulsant barbiturate S-MPPB, inhibits α1β3γ2 but potentiates α1β3 GABAAR responses. In the α1β3γ2 GABAAR, S-mTFD-MPPB binds in the transmembrane domain with high affinity to the γ+-β− subunit interface site with negative energetic coupling to GABA binding in the extracellular domain at the β+-α− subunit interfaces. GABA inhibits S-[3H]mTFD-MPPB photolabeling of γ2Ser-280 (γM2–15′) in this site. In contrast, within the same site GABA enhances photolabeling of β3Met-227 in βM1 by an anesthetic barbiturate, R-[3H]methyl-5-allyl-5-(m-trifluoromethyl-diazirynylphenyl)barbituric acid (mTFD-MPAB), which differs from S-mTFD-MPPB in structure only by chirality and two hydrogens (propyl versus allyl). S-mTFD-MPPB and R-mTFD-MPAB are predicted to bind in different orientations at the γ+-β− site, based upon the distance in GABAAR homology models between γ2Ser-280 and β3Met-227. These results provide an explanation for S-mTFD-MPPB inhibition of α1β3γ2 GABAAR function and provide a first demonstration that an intersubunit-binding site in the GABAAR transmembrane domain binds negative and positive allosteric modulators. PMID:26229099

  14. Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

    NASA Astrophysics Data System (ADS)

    Song, Hong Yan; Su, Xiaodi

    In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

  15. A kinetic and thermodynamic framework for the Azoarcus group I ribozyme reaction

    PubMed Central

    Gleitsman, Kristin R.

    2014-01-01

    Determination of quantitative thermodynamic and kinetic frameworks for ribozymes derived from the Azoarcus group I intron and comparisons to their well-studied analogs from the Tetrahymena group I intron reveal similarities and differences between these RNAs. The guanosine (G) substrate binds to the Azoarcus and Tetrahymena ribozymes with similar equilibrium binding constants and similar very slow association rate constants. These and additional literature observations support a model in which the free ribozyme is not conformationally competent to bind G and in which the probability of assuming the binding-competent state is determined by tertiary interactions of peripheral elements. As proposed previously, the slow binding of guanosine may play a role in the specificity of group I intron self-splicing, and slow binding may be used analogously in other biological processes. The internal equilibrium between ribozyme-bound substrates and products is similar for these ribozymes, but the Azoarcus ribozyme does not display the coupling in the binding of substrates that is observed with the Tetrahymena ribozyme, suggesting that local preorganization of the active site and rearrangements within the active site upon substrate binding are different for these ribozymes. Our results also confirm the much greater tertiary binding energy of the 5′-splice site analog with the Azoarcus ribozyme, binding energy that presumably compensates for the fewer base-pairing interactions to allow the 5′-exon intermediate in self splicing to remain bound subsequent to 5′-exon cleavage and prior to exon ligation. Most generally, these frameworks provide a foundation for design and interpretation of experiments investigating fundamental properties of these and other structured RNAs. PMID:25246656

  16. Allosteric modulation of ATP-gated P2X receptor channels

    PubMed Central

    Coddou, Claudio; Stojilkovic, Stanko S.; Huidobro-Toro, J. Pablo

    2013-01-01

    Seven mammalian purinergic receptor subunits, denoted P2X1 to P2X7, and several spliced forms of these subunits have been cloned. When heterologously expressed, these cDNAs encode ATP-gated non-selective cation channels organized as trimers. All activated receptors produce cell depolarization and promote Ca2+ influx through their pores and indirectly by activating voltage-gated calcium channels. However, the biophysical and pharmacological properties of these receptors differ considerably, and the majority of these subunits are also capable of forming heterotrimers with other members of the P2X receptor family, which confers further different properties. These channels have three ATP binding domains, presumably located between neighboring subunits, and occupancy of at least two binding sites is needed for their activation. In addition to the orthosteric binding sites for ATP, these receptors have additional allosteric sites that modulate the agonist action at receptors, including sites for trace metals, protons, neurosteroids, reactive oxygen species and phosphoinositides. The allosteric regulation of P2X receptors is frequently receptor-specific and could be a useful tool to identify P2X members in native tissues and their roles in signaling. The focus of this review is on common and receptor-specific allosteric modulation of P2X receptors and the molecular base accounting for allosteric binding sites. PMID:21639805

  17. Hot-spot identification on a broad class of proteins and RNA suggest unifying principles of molecular recognition

    PubMed Central

    Kulp, John L.; Cloudsdale, Ian S.; Kulp, John L.

    2017-01-01

    Chemically diverse fragments tend to collectively bind at localized sites on proteins, which is a cornerstone of fragment-based techniques. A central question is how general are these strategies for predicting a wide variety of molecular interactions such as small molecule-protein, protein-protein and protein-nucleic acid for both experimental and computational methods. To address this issue, we recently proposed three governing principles, (1) accurate prediction of fragment-macromolecule binding free energy, (2) accurate prediction of water-macromolecule binding free energy, and (3) locating sites on a macromolecule that have high affinity for a diversity of fragments and low affinity for water. To test the generality of these concepts we used the computational technique of Simulated Annealing of Chemical Potential to design one small fragment to break the RecA-RecA protein-protein interaction and three fragments that inhibit peptide-deformylase via water-mediated multi-body interactions. Experiments confirm the predictions that 6-hydroxydopamine potently inhibits RecA and that PDF inhibition quantitatively tracks the water-mediated binding predictions. Additionally, the principles correctly predict the essential bound waters in HIV Protease, the surprisingly extensive binding site of elastase, the pinpoint location of electron transfer in dihydrofolate reductase, the HIV TAT-TAR protein-RNA interactions, and the MDM2-MDM4 differential binding to p53. The experimental confirmations of highly non-obvious predictions combined with the precise characterization of a broad range of known phenomena lend strong support to the generality of fragment-based methods for characterizing molecular recognition. PMID:28837642

  18. Hot-spot identification on a broad class of proteins and RNA suggest unifying principles of molecular recognition.

    PubMed

    Kulp, John L; Cloudsdale, Ian S; Kulp, John L; Guarnieri, Frank

    2017-01-01

    Chemically diverse fragments tend to collectively bind at localized sites on proteins, which is a cornerstone of fragment-based techniques. A central question is how general are these strategies for predicting a wide variety of molecular interactions such as small molecule-protein, protein-protein and protein-nucleic acid for both experimental and computational methods. To address this issue, we recently proposed three governing principles, (1) accurate prediction of fragment-macromolecule binding free energy, (2) accurate prediction of water-macromolecule binding free energy, and (3) locating sites on a macromolecule that have high affinity for a diversity of fragments and low affinity for water. To test the generality of these concepts we used the computational technique of Simulated Annealing of Chemical Potential to design one small fragment to break the RecA-RecA protein-protein interaction and three fragments that inhibit peptide-deformylase via water-mediated multi-body interactions. Experiments confirm the predictions that 6-hydroxydopamine potently inhibits RecA and that PDF inhibition quantitatively tracks the water-mediated binding predictions. Additionally, the principles correctly predict the essential bound waters in HIV Protease, the surprisingly extensive binding site of elastase, the pinpoint location of electron transfer in dihydrofolate reductase, the HIV TAT-TAR protein-RNA interactions, and the MDM2-MDM4 differential binding to p53. The experimental confirmations of highly non-obvious predictions combined with the precise characterization of a broad range of known phenomena lend strong support to the generality of fragment-based methods for characterizing molecular recognition.

  19. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  20. Thermodynamic Linkage Between Calmodulin Domains Binding Calcium and Contiguous Sites in the C-Terminal Tail of CaV1.2

    PubMed Central

    Evans, T. Idil Apak; Hell, Johannes; Shea, Madeline A.

    2011-01-01

    Calmodulin (CaM) binding to the intracellular C-terminal tail (CTT) of the cardiac L-type Ca2+ channel (CaV1.2) regulates Ca2+ entry by recognizing sites that contribute to negative feedback mechanisms for channel closing. CaM associates with CaV1.2 under low resting [Ca2+], but is poised to change conformation and position when intracellular [Ca2+] rises. CaM binding Ca2+, and the domains of CaM binding the CTT are linked thermodynamic functions. To better understand regulation, we determined the energetics of CaM domains binding to peptides representing pre-IQ sites A1588, and C1614 and the IQ motif studied as overlapping peptides IQ1644 and IQ′1650 as well as their effect on calcium binding. (Ca2+)4-CaM bound to all four peptides very favorably (Kd ≤ 2 nM). Linkage analysis showed that IQ1644–1670 bound with a Kd ~1 pM. In the pre-IQ region, (Ca2+)2-N-domain bound preferentially to A1588, while (Ca2+)2-C-domain preferred C1614. When bound to C1614, calcium binding in the N-domain affected the tertiary conformation of the C-domain. Based on the thermodynamics, we propose a structural mechanism for calcium-dependent conformational change in which the linker between CTT sites A and C buckles to form an A-C hairpin that is bridged by calcium-saturated CaM. PMID:21757287

  1. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  2. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  3. A stochastic context free grammar based framework for analysis of protein sequences

    PubMed Central

    Dyrka, Witold; Nebel, Jean-Christophe

    2009-01-01

    Background In the last decade, there have been many applications of formal language theory in bioinformatics such as RNA structure prediction and detection of patterns in DNA. However, in the field of proteomics, the size of the protein alphabet and the complexity of relationship between amino acids have mainly limited the application of formal language theory to the production of grammars whose expressive power is not higher than stochastic regular grammars. However, these grammars, like other state of the art methods, cannot cover any higher-order dependencies such as nested and crossing relationships that are common in proteins. In order to overcome some of these limitations, we propose a Stochastic Context Free Grammar based framework for the analysis of protein sequences where grammars are induced using a genetic algorithm. Results This framework was implemented in a system aiming at the production of binding site descriptors. These descriptors not only allow detection of protein regions that are involved in these sites, but also provide insight in their structure. Grammars were induced using quantitative properties of amino acids to deal with the size of the protein alphabet. Moreover, we imposed some structural constraints on grammars to reduce the extent of the rule search space. Finally, grammars based on different properties were combined to convey as much information as possible. Evaluation was performed on sites of various sizes and complexity described either by PROSITE patterns, domain profiles or a set of patterns. Results show the produced binding site descriptors are human-readable and, hence, highlight biologically meaningful features. Moreover, they achieve good accuracy in both annotation and detection. In addition, findings suggest that, unlike current state-of-the-art methods, our system may be particularly suited to deal with patterns shared by non-homologous proteins. Conclusion A new Stochastic Context Free Grammar based framework has been introduced allowing the production of binding site descriptors for analysis of protein sequences. Experiments have shown that not only is this new approach valid, but produces human-readable descriptors for binding sites which have been beyond the capability of current machine learning techniques. PMID:19814800

  4. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  5. Adenosine Monophosphate Binding Stabilizes the KTN Domain of the Shewanella denitrificans Kef Potassium Efflux System.

    PubMed

    Pliotas, Christos; Grayer, Samuel C; Ekkerman, Silvia; Chan, Anthony K N; Healy, Jess; Marius, Phedra; Bartlett, Wendy; Khan, Amjad; Cortopassi, Wilian A; Chandler, Shane A; Rasmussen, Tim; Benesch, Justin L P; Paton, Robert S; Claridge, Timothy D W; Miller, Samantha; Booth, Ian R; Naismith, James H; Conway, Stuart J

    2017-08-15

    Ligand binding is one of the most fundamental properties of proteins. Ligand functions fall into three basic types: substrates, regulatory molecules, and cofactors essential to protein stability, reactivity, or enzyme-substrate complex formation. The regulation of potassium ion movement in bacteria is predominantly under the control of regulatory ligands that gate the relevant channels and transporters, which possess subunits or domains that contain Rossmann folds (RFs). Here we demonstrate that adenosine monophosphate (AMP) is bound to both RFs of the dimeric bacterial Kef potassium efflux system (Kef), where it plays a structural role. We conclude that AMP binds with high affinity, ensuring that the site is fully occupied at all times in the cell. Loss of the ability to bind AMP, we demonstrate, causes protein, and likely dimer, instability and consequent loss of function. Kef system function is regulated via the reversible binding of comparatively low-affinity glutathione-based ligands at the interface between the dimer subunits. We propose this interfacial binding site is itself stabilized, at least in part, by AMP binding.

  6. Adenosine Monophosphate Binding Stabilizes the KTN Domain of the Shewanella denitrificans Kef Potassium Efflux System

    PubMed Central

    2017-01-01

    Ligand binding is one of the most fundamental properties of proteins. Ligand functions fall into three basic types: substrates, regulatory molecules, and cofactors essential to protein stability, reactivity, or enzyme–substrate complex formation. The regulation of potassium ion movement in bacteria is predominantly under the control of regulatory ligands that gate the relevant channels and transporters, which possess subunits or domains that contain Rossmann folds (RFs). Here we demonstrate that adenosine monophosphate (AMP) is bound to both RFs of the dimeric bacterial Kef potassium efflux system (Kef), where it plays a structural role. We conclude that AMP binds with high affinity, ensuring that the site is fully occupied at all times in the cell. Loss of the ability to bind AMP, we demonstrate, causes protein, and likely dimer, instability and consequent loss of function. Kef system function is regulated via the reversible binding of comparatively low-affinity glutathione-based ligands at the interface between the dimer subunits. We propose this interfacial binding site is itself stabilized, at least in part, by AMP binding. PMID:28656748

  7. Selective binding of choline by a phosphate-coordination-based triple helicate featuring an aromatic box.

    PubMed

    Jia, Chuandong; Zuo, Wei; Yang, Dong; Chen, Yanming; Cao, Liping; Custelcean, Radu; Hostaš, Jiří; Hobza, Pavel; Glaser, Robert; Wang, Yao-Yu; Yang, Xiao-Juan; Wu, Biao

    2017-10-16

    In nature, proteins have evolved sophisticated cavities tailored for capturing target guests selectively among competitors of similar size, shape, and charge. The fundamental principles guiding the molecular recognition, such as self-assembly and complementarity, have inspired the development of biomimetic receptors. In the current work, we report a self-assembled triple anion helicate (host 2) featuring a cavity resembling that of the choline-binding protein ChoX, as revealed by crystal and density functional theory (DFT)-optimized structures, which binds choline in a unique dual-site-binding mode. This similarity in structure leads to a similarly high selectivity of host 2 for choline over its derivatives, as demonstrated by the NMR and fluorescence competition experiments. Furthermore, host 2 is able to act as a fluorescence displacement sensor for discriminating choline, acetylcholine, L-carnitine, and glycine betaine effectively.The choline-binding protein ChoX exhibits a synergistic dual-site binding mode that allows it to discriminate choline over structural analogues. Here, the authors design a biomimetic triple anion helicate receptor whose selectivity for choline arises from a similar binding mechanism.

  8. Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

    PubMed

    Aslanoglu, Mehmet

    2006-03-01

    The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

  9. Diethylpyrocarbonate and permanganate provide evidence for an unusual DNA conformation induced by binding of the antitumour antibiotics bleomycin and phleomycin.

    PubMed Central

    Fox, K R; Grigg, G W

    1988-01-01

    DNA structural changes induced by bleomycin have been investigated using diethylpyrocarbonate and permanganate as probes under conditions in which the antibiotic binds to, but does not cut the DNA. Diethyl-pyrocarbonate shows an enhanced reaction with adenines in the presence of the antibiotic in the sequences GTA greater than GCA greater than GAA, on the 3' side of the drug cutting site (GPy). Permanganate ions display an enhanced reactivity at the second pyrimidine of the sequence GPyPy. The results are consistent with a model in which bleomycin distorts the structure of the base pair on the 3' side of its binding site. Images PMID:2451809

  10. Superposition-free comparison and clustering of antibody binding sites: implications for the prediction of the nature of their antigen

    PubMed Central

    Di Rienzo, Lorenzo; Milanetti, Edoardo; Lepore, Rosalba; Olimpieri, Pier Paolo; Tramontano, Anna

    2017-01-01

    We describe here a superposition free method for comparing the surfaces of antibody binding sites based on the Zernike moments and show that they can be used to quickly compare and cluster sets of antibodies. The clusters provide information about the nature of the bound antigen that, when combined with a method for predicting the number of direct antibody antigen contacts, allows the discrimination between protein and non-protein binding antibodies with an accuracy of 76%. This is of relevance in several aspects of antibody science, for example to select the framework to be used for a combinatorial antibody library. PMID:28338016

  11. X-ray structure of the ternary MTX·NADPH complex of the anthrax dihydrofolate reductase: A pharmacophore for dual-site inhibitor design

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz

    2009-11-18

    For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In themore » present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90 deg. and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3{angstrom} resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low {mu}M concentrations. The apparent K{sub d} for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 {mu}M.« less

  12. Computational Tools for Allosteric Drug Discovery: Site Identification and Focus Library Design.

    PubMed

    Huang, Wenkang; Nussinov, Ruth; Zhang, Jian

    2017-01-01

    Allostery is an intrinsic phenomenon of biological macromolecules involving regulation and/or signal transduction induced by a ligand binding to an allosteric site distinct from a molecule's active site. Allosteric drugs are currently receiving increased attention in drug discovery because drugs that target allosteric sites can provide important advantages over the corresponding orthosteric drugs including specific subtype selectivity within receptor families. Consequently, targeting allosteric sites, instead of orthosteric sites, can reduce drug-related side effects and toxicity. On the down side, allosteric drug discovery can be more challenging than traditional orthosteric drug discovery due to difficulties associated with determining the locations of allosteric sites and designing drugs based on these sites and the need for the allosteric effects to propagate through the structure, reach the ligand binding site and elicit a conformational change. In this study, we present computational tools ranging from the identification of potential allosteric sites to the design of "allosteric-like" modulator libraries. These tools may be particularly useful for allosteric drug discovery.

  13. Nonlinear scoring functions for similarity-based ligand docking and binding affinity prediction.

    PubMed

    Brylinski, Michal

    2013-11-25

    A common strategy for virtual screening considers a systematic docking of a large library of organic compounds into the target sites in protein receptors with promising leads selected based on favorable intermolecular interactions. Despite a continuous progress in the modeling of protein-ligand interactions for pharmaceutical design, important challenges still remain, thus the development of novel techniques is required. In this communication, we describe eSimDock, a new approach to ligand docking and binding affinity prediction. eSimDock employs nonlinear machine learning-based scoring functions to improve the accuracy of ligand ranking and similarity-based binding pose prediction, and to increase the tolerance to structural imperfections in the target structures. In large-scale benchmarking using the Astex/CCDC data set, we show that 53.9% (67.9%) of the predicted ligand poses have RMSD of <2 Å (<3 Å). Moreover, using binding sites predicted by recently developed eFindSite, eSimDock models ligand binding poses with an RMSD of 4 Å for 50.0-39.7% of the complexes at the protein homology level limited to 80-40%. Simulations against non-native receptor structures, whose mean backbone rearrangements vary from 0.5 to 5.0 Å Cα-RMSD, show that the ratio of docking accuracy and the estimated upper bound is at a constant level of ∼0.65. Pearson correlation coefficient between experimental and predicted by eSimDock Ki values for a large data set of the crystal structures of protein-ligand complexes from BindingDB is 0.58, which decreases only to 0.46 when target structures distorted to 3.0 Å Cα-RMSD are used. Finally, two case studies demonstrate that eSimDock can be customized to specific applications as well. These encouraging results show that the performance of eSimDock is largely unaffected by the deformations of ligand binding regions, thus it represents a practical strategy for across-proteome virtual screening using protein models. eSimDock is freely available to the academic community as a Web server at http://www.brylinski.org/esimdock .

  14. A highly selective and sensitive fluorescent chemosensor and its application for rapid on-site detection of Al3 +

    NASA Astrophysics Data System (ADS)

    Yue, Xiao-li; Wang, Zhao-qing; Li, Chao-rui; Yang, Zheng-yin

    2018-03-01

    In this paper, a simple naphthalene-based derivative (HL) has been designed and synthesized as a Al3 +-selective fluorescent chemosensor based on the PET mechanism. HL exhibited high selectivity and sensitivity towards Al3 + over other commonly coexisting metal ions in ethanol with a detection limit of 2.72 nM. The 1:1 binding stoichiometry of the complex (HL-Al3 +) was determined from the Job's plot based on fluorescence titrations and the ESI-MS spectrum data. Moreover, the binding site of HL with Al3 + was assured by the 1H NMR titration experiment. The binding constant (Ka) of the complex (HL-Al3 +) was calculated to be 5.06 × 104 M- 1 according to the Benesi-Hildebrand equation. In addition, the recognizing process of HL towards Al3 + was chemically reversible by adding Na2EDTA. Importantly, HL could directly and rapidly detect aluminum ion through the filter paper without resorting to additional instrumental analysis.

  15. Structure-based prediction of free energy changes of binding of PTP1B inhibitors

    NASA Astrophysics Data System (ADS)

    Wang, Jing; Ling Chan, Shek; Ramnarayan, Kal

    2003-08-01

    The goals were (1) to understand the driving forces in the binding of small molecule inhibitors to the active site of PTP1B and (2) to develop a molecular mechanics-based empirical free energy function for compound potency prediction. A set of compounds with known activities was docked onto the active site. The related energy components and molecular surface areas were calculated. The bridging water molecules were identified and their contributions were considered. Linear relationships were explored between the above terms and the binding free energies of compounds derived based on experimental inhibition constants. We found that minimally three terms are required to give rise to a good correlation (0.86) with predictive power in five-group cross-validation test (q2 = 0.70). The dominant terms are the electrostatic energy and non-electrostatic energy stemming from the intra- and intermolecular interactions of solutes and from those of bridging water molecules in complexes.

  16. Solution structure of a GAAA tetraloop receptor RNA.

    PubMed Central

    Butcher, S E; Dieckmann, T; Feigon, J

    1997-01-01

    The GAAA tetraloop receptor is an 11-nucleotide RNA sequence that participates in the tertiary folding of a variety of large catalytic RNAs by providing a specific binding site for GAAA tetraloops. Here we report the solution structure of the isolated tetraloop receptor as solved by multidimensional, heteronuclear magnetic resonance spectroscopy. The internal loop of the tetraloop receptor has three adenosines stacked in a cross-strand or zipper-like fashion. This arrangement produces a high degree of base stacking within the asymmetric internal loop without extrahelical bases or kinking the helix. Additional interactions within the internal loop include a U. U mismatch pair and a G.U wobble pair. A comparison with the crystal structure of the receptor RNA bound to its tetraloop shows that a conformational change has to occur upon tetraloop binding, which is in good agreement with previous biochemical data. A model for an alternative binding site within the receptor is proposed based on the NMR structure, phylogenetic data and previous crystallographic structures of tetraloop interactions. PMID:9405377

  17. An Augmented Pocketome: Detection and Analysis of Small-Molecule Binding Pockets in Proteins of Known 3D Structure.

    PubMed

    Bhagavat, Raghu; Sankar, Santhosh; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2018-03-06

    Protein-ligand interactions form the basis of most cellular events. Identifying ligand binding pockets in proteins will greatly facilitate rationalizing and predicting protein function. Ligand binding sites are unknown for many proteins of known three-dimensional (3D) structure, creating a gap in our understanding of protein structure-function relationships. To bridge this gap, we detect pockets in proteins of known 3D structures, using computational techniques. This augmented pocketome (PocketDB) consists of 249,096 pockets, which is about seven times larger than what is currently known. We deduce possible ligand associations for about 46% of the newly identified pockets. The augmented pocketome, when subjected to clustering based on similarities among pockets, yielded 2,161 site types, which are associated with 1,037 ligand types, together providing fold-site-type-ligand-type associations. The PocketDB resource facilitates a structure-based function annotation, delineation of the structural basis of ligand recognition, and provides functional clues for domains of unknown functions, allosteric proteins, and druggable pockets. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. G-LoSA for Prediction of Protein-Ligand Binding Sites and Structures.

    PubMed

    Lee, Hui Sun; Im, Wonpil

    2017-01-01

    Recent advances in high-throughput structure determination and computational protein structure prediction have significantly enriched the universe of protein structure. However, there is still a large gap between the number of available protein structures and that of proteins with annotated function in high accuracy. Computational structure-based protein function prediction has emerged to reduce this knowledge gap. The identification of a ligand binding site and its structure is critical to the determination of a protein's molecular function. We present a computational methodology for predicting small molecule ligand binding site and ligand structure using G-LoSA, our protein local structure alignment and similarity measurement tool. All the computational procedures described here can be easily implemented using G-LoSA Toolkit, a package of standalone software programs and preprocessed PDB structure libraries. G-LoSA and G-LoSA Toolkit are freely available to academic users at http://compbio.lehigh.edu/GLoSA . We also illustrate a case study to show the potential of our template-based approach harnessing G-LoSA for protein function prediction.

  19. ZifBASE: a database of zinc finger proteins and associated resources.

    PubMed

    Jayakanthan, Mannu; Muthukumaran, Jayaraman; Chandrasekar, Sanniyasi; Chawla, Konika; Punetha, Ankita; Sundar, Durai

    2009-09-09

    Information on the occurrence of zinc finger protein motifs in genomes is crucial to the developing field of molecular genome engineering. The knowledge of their target DNA-binding sequences is vital to develop chimeric proteins for targeted genome engineering and site-specific gene correction. There is a need to develop a computational resource of zinc finger proteins (ZFP) to identify the potential binding sites and its location, which reduce the time of in vivo task, and overcome the difficulties in selecting the specific type of zinc finger protein and the target site in the DNA sequence. ZifBASE provides an extensive collection of various natural and engineered ZFP. It uses standard names and a genetic and structural classification scheme to present data retrieved from UniProtKB, GenBank, Protein Data Bank, ModBase, Protein Model Portal and the literature. It also incorporates specialized features of ZFP including finger sequences and positions, number of fingers, physiochemical properties, classes, framework, PubMed citations with links to experimental structures (PDB, if available) and modeled structures of natural zinc finger proteins. ZifBASE provides information on zinc finger proteins (both natural and engineered ones), the number of finger units in each of the zinc finger proteins (with multiple fingers), the synergy between the adjacent fingers and their positions. Additionally, it gives the individual finger sequence and their target DNA site to which it binds for better and clear understanding on the interactions of adjacent fingers. The current version of ZifBASE contains 139 entries of which 89 are engineered ZFPs, containing 3-7F totaling to 296 fingers. There are 50 natural zinc finger protein entries ranging from 2-13F, totaling to 307 fingers. It has sequences and structures from literature, Protein Data Bank, ModBase and Protein Model Portal. The interface is cross linked to other public databases like UniprotKB, PDB, ModBase and Protein Model Portal and PubMed for making it more informative. A database is established to maintain the information of the sequence features, including the class, framework, number of fingers, residues, position, recognition site and physio-chemical properties (molecular weight, isoelectric point) of both natural and engineered zinc finger proteins and dissociation constant of few. ZifBASE can provide more effective and efficient way of accessing the zinc finger protein sequences and their target binding sites with the links to their three-dimensional structures. All the data and functions are available at the advanced web-based search interface http://web.iitd.ac.in/~sundar/zifbase.

  20. Characterization of the ligand-binding site of the transferrin receptor in Trypanosoma brucei demonstrates a structural relationship with the N-terminal domain of the variant surface glycoprotein.

    PubMed

    Salmon, D; Hanocq-Quertier, J; Paturiaux-Hanocq, F; Pays, A; Tebabi, P; Nolan, D P; Michel, A; Pays, E

    1997-12-15

    The Trypanosoma brucei transferrin (Tf) receptor is a heterodimer encoded by ESAG7 and ESAG6, two genes contained in the different polycistronic transcription units of the variant surface glycoprotein (VSG) gene. The sequence of ESAG7/6 differs slightly between different units, so that receptors with different affinities for Tf are expressed alternatively following transcriptional switching of VSG expression sites during antigenic variation of the parasite. Based on the sequence homology between pESAG7/6 and the N-terminal domain of VSGs, it can be predicted that the four blocks containing the major sequence differences between pESAG7 and pESAG6 form surface-exposed loops and generate the ligand-binding site. The exchange of a few amino acids in this region between pESAG6s encoded by different VSG units greatly increased the affinity for bovine Tf. Similar changes in other regions were ineffective, while mutations predicted to alter the VSG-like structure abolished the binding. Chimeric proteins containing the N-terminal dimerization domain of VSG and the C-terminal half of either pESAG7 or pESAG6, which contains the ligand-binding domain, can form heterodimers that bind Tf. Taken together, these data provided evidence that the T.brucei Tf receptor is structurally related to the N-terminal domain of the VSG and that the ligand-binding site corresponds to the exposed surface loops of the protein.

  1. Calmodulin binds to inv protein: implication for the regulation of inv function.

    PubMed

    Yasuhiko, Y; Imai, F; Ookubo, K; Takakuwa, Y; Shiokawa, K; Yokoyama, T

    2001-12-01

    Establishment of the left-right asymmetry of internal organs is essential for the normal development of vertebrates. The inv mutant in mice shows a constant reversal of left-right asymmetry and although the inv gene has been cloned, its biochemical and cell biological functions have not been defined. Here, we show that calmodulin binds to mouse inv protein at two sites (IQ1 and IQ2). The binding of calmodulin to the IQ2 site occurs in the absence of Ca(2+) and is not observed in the presence of Ca(2+). Injection of mouse inv mRNA into the right blastomere of Xenopus embryos at the two-cell stage randomized the left-right asymmetry of the embryo and altered the patterns of Xnr-1 and Pitx2 expression. Importantly, inv mRNA that lacked the region encoding the IQ2 site was unable to randomize left-right asymmetry in Xenopus embryos, implying that the IQ2 site is essential for inv to randomize left-right asymmetry in Xenopus. These results suggest that calmodulin binding may regulate inv function. Based on our findings, we propose a model for the regulation of inv function by calcium-calmodulin and discuss its implications.

  2. The investigation of the binding of 6-mercaptopurine to site I on human serum albumin.

    PubMed

    Sochacka, Jolanta; Baran, Wojciech

    2012-12-01

    6-Mercaptopurine (6-MP) is one of a large series of purine analogues which has been found active against human leukemias. The equilibrium dialysis, circular dichroism (CD) and molecular docking were employed to study the binding of 6-MP to human serum albumin (HSA). The binding of 6-MP to HSA in the equilibrium dialysis experiment was detected by measuring the displacement of 6-MP by specific markers for site I on HSA, warfarin (RWF), phenylbutazone (PhB) and n-butyl p-aminobenzoate (ABE). It was shown, according to CD data, that binding of 6-MP to HSA leads to alteration of HSA secondary structure. Based on the findings from displacement experiment and molecular docking simulation it was found that 6-MP was located within binding cavity of subdomain IIA and the space occupied by site markers overlapped with that of 6-MP. Displacement of 6-MP by the RWF or PhB was not up the level expected for a competitive mechanism, therefore displacement of 6-MP was rather by non-cooperative than that the direct competition. Instead, in case of the interaction between ABE and 6-MP, when the little enhancement of the binding of ABE by 6-MP was found, the interaction could be via a positively cooperative mechanism.

  3. Steric and thermodynamic limits of design for the incorporation of large unnatural amino acids in aminoacyl-tRNA synthetase enzymes.

    PubMed

    Armen, Roger S; Schiller, Stefan M; Brooks, Charles L

    2010-06-01

    Orthogonal aminoacyl-tRNA synthetase/tRNA pairs from archaea have been evolved to facilitate site specific in vivo incorporation of unnatural amino acids into proteins in Escherichia coli. Using this approach, unnatural amino acids have been successfully incorporated with high translational efficiency and fidelity. In this study, CHARMM-based molecular docking and free energy calculations were used to evaluate rational design of specific protein-ligand interactions for aminoacyl-tRNA synthetases. A series of novel unnatural amino acid ligands were docked into the p-benzoyl-L-phenylalanine tRNA synthetase, which revealed that the binding pocket of the enzyme does not provide sufficient space for significantly larger ligands. Specific binding site residues were mutated to alanine to create additional space to accommodate larger target ligands, and then mutations were introduced to improve binding free energy. This approach was used to redesign binding sites for several different target ligands, which were then tested against the standard 20 amino acids to verify target specificity. Only the synthetase designed to bind Man-alpha-O-Tyr was predicted to be sufficiently selective for the target ligand and also thermodynamically stable. Our study suggests that extensive redesign of the tRNA synthatase binding pocket for large bulky ligands may be quite thermodynamically unfavorable.

  4. Structural Characterization of the E2 Domain of APL-1, a C. Elegans Homolog of Human Amyloid Precursor Protein, and its Heparin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoopes, J.; Liu, X; Xu, X

    2010-01-01

    The amyloid {beta}-peptide deposit found in the brain tissue of patients with Alzheimer disease is derived from a large heparin-binding protein precursor APP. The biological function of APP and its homologs is not precisely known. Here we report the x-ray structure of the E2 domain of APL-1, an APP homolog in Caenorhabditis elegans, and compare it to the human APP structure. We also describe the structure of APL-1 E2 in complex with sucrose octasulfate, a highly negatively charged disaccharide, which reveals an unexpected binding pocket between the two halves of E2. Based on the crystal structure, we are able tomore » map, using site-directed mutagenesis, a surface groove on E2 to which heparin may bind. Our biochemical data also indicate that the affinity of E2 for heparin is influenced by pH: at pH 5, the binding appears to be much stronger than that at neutral pH. This property is likely caused by histidine residues in the vicinity of the mapped heparin binding site and could be important for the proposed adhesive function of APL-1.« less

  5. Competitive binding of (-)-epigallocatechin-3-gallate and 5-fluorouracil to human serum albumin: A fluorescence and circular dichroism study

    NASA Astrophysics Data System (ADS)

    Yuan, Lixia; Liu, Min; Liu, Guiqin; Li, Dacheng; Wang, Zhengping; Wang, Bingquan; Han, Jun; Zhang, Min

    2017-02-01

    Combination therapy with more than one therapeutic agent can improve therapeutic efficiency and decrease drug resistance. In this study, the interactions of human serum albumin (HSA) with individual or combined anticancer drugs, (-)-epigallocatechin-3-gallate (EGCG) and 5-fluorouracil (FU), were investigated by fluorescence and circular dichroism (CD) spectroscopy. The results demonstrated that the interaction of EGCG or FU with HSA is a process of static quenching and EGCG formed a more stable complex. The competitive experiments of site markers suggested that both anti-carcinogens mainly bound to site I (subdomain IIA). The interaction forces which play important roles in the binding process were discussed based on enthalpy and entropy changes. Moreover, the competition binding model for a ternary system was proposed so as to precisely calculate the binding parameters. The results demonstrated that one drug decreased the binding affinity of another drug with HSA, resulting in the increasing free drug concentration at the action sites. CD studies indicated that there was an alteration in HSA secondary structure due to the binding of EGCG and FU. It can be concluded that the combination of EGCG with FU may enhance anticancer efficacy. This finding may provide a theoretical basis for clinical treatments.

  6. Photo-isomerization and oxidation of bilirubin in mammals is dependent on albumin binding.

    PubMed

    Goncharova, Iryna; Jašprová, Jana; Vítek, Libor; Urbanová, Marie

    2015-12-01

    The bilirubin (BR) photo-conversion in the human body is a protein-dependent process; an effective photo-isomerization of the potentially neurotoxic Z,Z-BR as well as its oxidation to biliverdin in the antioxidant redox cycle is possible only when BR is bound on serum albumin. We present a novel analytical concept in the study of linear tetrapyrroles metabolic processes based on an in-depth mapping of binding sites in the structure of human serum albumin (HSA). A combination of fluorescence spectroscopy, circular dichroism (CD) spectroscopy, and molecular modeling methods was used for recognition of the binding site for BR, its derivatives (mesobilirubin and bilirubin ditaurate), and the products of the photo-isomerization and oxidation (lumirubin, biliverdin, and xanthobilirubic acid) on HSA. The CD spectra and fluorescent quenching of the Trp-HSA were used to calculate the binding constants. The results of the CD displacement experiments performed with hemin were interpreted together with the findings of molecular docking performed on the pigment-HSA complexes. We estimated that Z,Z-BR and its metabolic products bind on two independent binding sites. Our findings support the existence of a reversible antioxidant redox cycle for BR and explain an additional pathway of the photo-isomerization process (increase of HSA binding capacity; the excess free [unbound] BR can be converted and also bound to HSA). Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Binding Free Energies of Host-Guest Systems by Nonequilibrium Alchemical Simulations with Constrained Dynamics: Theoretical Framework.

    PubMed

    Giovannelli, Edoardo; Procacci, Piero; Cardini, Gianni; Pagliai, Marco; Volkov, Victor; Chelli, Riccardo

    2017-12-12

    The fast-switching decoupling method is a powerful nonequilibrium technique to compute absolute binding free energies of ligand-receptor complexes (Sandberg et al., J. Chem. Theory Comput. 2014, 11, 423-435). Inspired by the theory of noncovalent binding association of Gilson and co-workers (Biophys. J. 1997, 72, 1047-1069), we develop two approaches, termed binded-domain and single-point alchemical-path schemes (BiD-AP and SiP-AP), based on the possibility of performing alchemical trajectories during which the ligand is constrained to fixed positions relative to the receptor. The BiD-AP scheme exploits a recent generalization of nonequilibrium work theorems to estimate the free energy difference between the coupled and uncoupled states of the ligand-receptor complex. With respect to the fast-switching decoupling method without constraints, BiD-AP prevents the ligand from leaving the binding site, but still requires an estimate of the positional binding-site volume, which may not be a simple task. On the other side, the SiP-AP scheme allows avoidance of the calculation of the binding-site volume by introducing an additional equilibrium simulation of ligand and receptor in the bound state. In the companion article (DOI: 10.1021/acs.jctc.7b00595), we show that the extra computational effort required by SiP-AP leads to a significant improvement of accuracy in the free energy estimates.

  8. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  9. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  10. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  12. An Efficient Metadynamics-Based Protocol To Model the Binding Affinity and the Transition State Ensemble of G-Protein-Coupled Receptor Ligands.

    PubMed

    Saleh, Noureldin; Ibrahim, Passainte; Saladino, Giorgio; Gervasio, Francesco Luigi; Clark, Timothy

    2017-05-22

    A generally applicable metadynamics scheme for predicting the free energy profile of ligand binding to G-protein-coupled receptors (GPCRs) is described. A common and effective collective variable (CV) has been defined using the ideally placed and highly conserved Trp6.48 as a reference point for ligand-GPCR distance measurement and the common orientation of GPCRs in the cell membrane. Using this single CV together with well-tempered multiple-walker metadynamics with a funnel-like boundary allows an efficient exploration of the entire ligand binding path from the extracellular medium to the orthosteric binding site, including vestibule and intermediate sites. The protocol can be used with X-ray structures or high-quality homology models (based on a high-quality template and after thorough refinement) for the receptor and is universally applicable to agonists, antagonists, and partial and reverse agonists. The root-mean-square error (RMSE) in predicted binding free energies for 12 diverse ligands in five receptors (a total of 23 data points) is surprisingly small (less than 1 kcal mol -1 ). The RMSEs for simulations that use receptor X-ray structures and homology models are very similar.

  13. Discovery of small molecule inhibitors of ubiquitin-like poxvirus proteinase I7L using homology modeling and covalent docking approaches

    NASA Astrophysics Data System (ADS)

    Katritch, Vsevolod; Byrd, Chelsea M.; Tseitin, Vladimir; Dai, Dongcheng; Raush, Eugene; Totrov, Maxim; Abagyan, Ruben; Jordan, Robert; Hruby, Dennis E.

    2007-10-01

    Essential for viral replication and highly conserved among poxviridae, the vaccinia virus I7L ubiquitin-like proteinase (ULP) is an attractive target for development of smallpox antiviral drugs. At the same time, the I7L proteinase exemplifies several interesting challenges from the rational drug design perspective. In the absence of a published I7L X-ray structure, we have built a detailed 3D model of the I7L ligand binding site (S2-S2' pocket) based on exceptionally high structural conservation of this site in proteases of the ULP family. The accuracy and limitations of this model were assessed through comparative analysis of available X-ray structures of ULPs, as well as energy based conformational modeling. The 3D model of the I7L ligand binding site was used to perform covalent docking and VLS of a comprehensive library of about 230,000 available ketone and aldehyde compounds. Out of 456 predicted ligands, 97 inhibitors of I7L proteinase activity were confirmed in biochemical assays (˜20% overall hit rate). These experimental results both validate our I7L ligand binding model and provide initial leads for rational optimization of poxvirus I7L proteinase inhibitors. Thus, fragments predicted to bind in the prime portion of the active site can be combined with fragments on non-prime side to yield compounds with improved activity and specificity.

  14. In vivo biotinylation and incorporation of a photo-inducible unnatural amino acid to an antibody-binding domain improve site-specific labeling of antibodies.

    PubMed

    Kanje, Sara; Hober, Sophia

    2015-04-01

    Antibodies are important molecules in many research fields, where they play a key role in various assays. Antibody labeling is therefore of great importance. Currently, most labeling techniques take advantage of certain amino acid side chains that commonly appear throughout proteins. This makes it hard to control the position and exact degree of labeling of each antibody. Hence, labeling of the antibody may affect the antibody-binding site. This paper presents a novel protein domain based on the IgG-binding domain C2 of streptococcal protein G, containing the unnatural amino acid BPA, that can cross-link other molecules. This novel domain can, with improved efficiency compared to previously reported similar domains, site-specifically cross-link to IgG at the Fc region. An efficient method for simultaneous in vivo incorporation of BPA and specific biotinylation in a flask cultivation of Escherichia coli is described. In comparison to a traditionally labeled antibody sample, the C2-labeled counterpart proved to have a higher proportion of functional antibodies when immobilized on a solid surface and the same limit of detection in an ELISA. This method of labeling is, due to its efficiency and simplicity, of high interest for all antibody-based assays where it is important that labeling does not interfere with the antibody-binding site. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Neural precursor cell-expressed developmentally down-regulated protein 4-2 (Nedd4-2) regulation by 14-3-3 protein binding at canonical serum and glucocorticoid kinase 1 (SGK1) phosphorylation sites.

    PubMed

    Chandran, Sindhu; Li, Hui; Dong, Wuxing; Krasinska, Karolina; Adams, Chris; Alexandrova, Ludmila; Chien, Allis; Hallows, Kenneth R; Bhalla, Vivek

    2011-10-28

    Regulation of epithelial Na(+) channel (ENaC)-mediated transport in the distal nephron is a critical determinant of blood pressure in humans. Aldosterone via serum and glucocorticoid kinase 1 (SGK1) stimulates ENaC by phosphorylation of the E3 ubiquitin ligase Nedd4-2, which induces interaction with 14-3-3 proteins. However, the mechanisms of SGK1- and 14-3-3-mediated regulation of Nedd4-2 are unclear. There are three canonical SGK1 target sites on Nedd4-2 that overlap phosphorylation-dependent 14-3-3 interaction motifs. Two of these are termed "minor," and one is termed "major," based on weak or strong binding to 14-3-3 proteins, respectively. By mass spectrometry, we found that aldosterone significantly stimulates phosphorylation of a minor, relative to the major, 14-3-3 binding site on Nedd4-2. Phosphorylation-deficient minor site Nedd4-2 mutants bound less 14-3-3 than did wild-type (WT) Nedd4-2, and minor site Nedd4-2 mutations were sufficient to inhibit SGK1 stimulation of ENaC cell surface expression. As measured by pulse-chase and cycloheximide chase assays, a major binding site Nedd4-2 mutant had a shorter cellular half-life than WT Nedd4-2, but this property was not dependent on binding to 14-3-3. Additionally, a dimerization-deficient 14-3-3ε mutant failed to bind Nedd4-2. We conclude that whereas phosphorylation at the Nedd4-2 major site is important for interaction with 14-3-3 dimers, minor site phosphorylation by SGK1 may be the relevant molecular switch that stabilizes Nedd4-2 interaction with 14-3-3 and thus promotes ENaC cell surface expression. We also propose that major site phosphorylation promotes cellular Nedd4-2 protein stability, which potentially represents a novel form of regulation for turnover of E3 ubiquitin ligases.

  16. Prediction of enzyme binding: human thrombin inhibition study by quantum chemical and artificial intelligence methods based on X-ray structures.

    PubMed

    Mlinsek, G; Novic, M; Hodoscek, M; Solmajer, T

    2001-01-01

    Thrombin is a serine protease which plays important roles in the human body, the key one being the control of thrombus formation. The inhibition of thrombin has become a target for new antithrombotics. The aim of our work was to (i) construct a model which would enable us to predict Ki values for the binding of an inhibitor into the active site of thrombin based on a database of known X-ray structures of inhibitor-enzyme complexes and (ii) to identify the structural and electrostatic characteristics of inhibitor molecules crucially important to their effective binding. To retain as much of the 3D structural information of the bound inhibitor as possible, we implemented the quantum mechanical/molecular mechanical (QM/MM) procedure for calculating the molecular electrostatic potential (MEP) at the van der Waals surfaces of atoms in the protein's active site. The inhibitor was treated quantum mechanically, while the rest of the complex was treated by classical means. The obtained MEP values served as inputs into the counter-propagation artificial neural network (CP-ANN), and a genetic algorithm was subsequently used to search for the combination of atoms that predominantly influences the binding. The constructed CP-ANN model yielded Ki values predictions with a correlation coefficient of 0.96, with Ki values extended over 7 orders of magnitude. Our approach also shows the relative importance of the various amino acid residues present in the active site of the enzyme for inhibitor binding. The list of residues selected by our automatic procedure is in good correlation with the current consensus regarding the importance of certain crucial residues in thrombin's active site.

  17. Understanding the in vivo uptake kinetics of a phosphatidylethanolamine-binding agent 99mTc-Duramycin

    PubMed Central

    Audi, Said; Li, Zhixin; Capacete, Joseph; Liu, Yu; Fang, Wei; Shu, Laura G.; Zhao, Ming

    2013-01-01

    Introduction 99mTc-Duramycin is a peptide-based molecular probe that binds specifically to phosphatidylethanolamine (PE). The goal was to characterize the kinetics of molecular interactions between 99mTc-Duramycin and the target tissue. Methods High level of accessible PE is induced in cardiac tissues by myocardial ischemia (30 min) and reperfusion (120 min) in Sprague Dawley rats. Target binding and biodistribution of 99mTc-duramycin was captured using SPECT/CT. To quantify the binding kinetics, the presence of radioactivity in ischemic versus normal cardiac tissues was measured by gamma counting at 3, 10, 20, 60 and 180 min after injection. A partially inactivated form of 99mTc-Duramycin was analyzed in the same fashion. A compartment model was developed to quantify the uptake kinetics of 99mTc-Duramycin in normal and ischemic myocardial tissue. Results 99mTc-duramycin binds avidly to the damaged tissue with a high target-to-background radio. Compartment modeling shows that accessibility of binding sites in myocardial tissue to 99mTc-Duramycin is not a limiting factor and the rate constant of target binding in the target tissue is at 2.2 ml/nmol/min/g. The number of available binding sites for 99mTc-Duramycin in ischemic myocardium was estimated at 0.14 nmol/g. Covalent modification of D15 resulted in a 9 fold reduction in binding affinity. Conclusion 99mTc-Duramycin accumulates avidly in target tissues in a PE-dependent fashion. Model results reflect an efficient uptake mechanism, consistent with the low molecular weight of the radiopharmaceutical and the relatively high density of available binding sites. These data help better define the imaging utilities of 99mTc-Duramycin as a novel PE-binding agent. PMID:22534031

  18. Prediction of FAD binding sites in electron transport proteins according to efficient radial basis function networks and significant amino acid pairs.

    PubMed

    Le, Nguyen-Quoc-Khanh; Ou, Yu-Yen

    2016-07-30

    Cellular respiration is a catabolic pathway for producing adenosine triphosphate (ATP) and is the most efficient process through which cells harvest energy from consumed food. When cells undergo cellular respiration, they require a pathway to keep and transfer electrons (i.e., the electron transport chain). Due to oxidation-reduction reactions, the electron transport chain produces a transmembrane proton electrochemical gradient. In case protons flow back through this membrane, this mechanical energy is converted into chemical energy by ATP synthase. The convert process is involved in producing ATP which provides energy in a lot of cellular processes. In the electron transport chain process, flavin adenine dinucleotide (FAD) is one of the most vital molecules for carrying and transferring electrons. Therefore, predicting FAD binding sites in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. We used an independent data set to evaluate the performance of the proposed method, which had an accuracy of 69.84 %. We compared the performance of the proposed method in analyzing two newly discovered electron transport protein sequences with that of the general FAD binding predictor presented by Mishra and Raghava and determined that the accuracy of the proposed method improved by 9-45 % and its Matthew's correlation coefficient was 0.14-0.5. Furthermore, the proposed method enabled reducing the number of false positives significantly and can provide useful information for biologists. We developed a method that is based on PSSM profiles and SAAPs for identifying FAD binding sites in newly discovered electron transport protein sequences. This approach achieved a significant improvement after we added SAAPs to PSSM features to analyze FAD binding proteins in the electron transport chain. The proposed method can serve as an effective tool for predicting FAD binding sites in electron transport proteins and can help biologists understand the functions of the electron transport chain, particularly those of FAD binding sites. We also developed a web server which identifies FAD binding sites in electron transporters available for academics.

  19. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  1. Identification and grafting of a unique peptide-binding site in the Fab framework of monoclonal antibodies

    DOE PAGES

    Donaldson, Joshua M.; Zer, Cindy; Avery, Kendra N.; ...

    2013-10-07

    Capitalizing on their extraordinary specificity, monoclonal antibodies (mAbs) have become one of the most reengineered classes of biological molecules. A major goal in many of these engineering efforts is to add new functionality to the parental mAb, including the addition of cytotoxins and imaging agents for medical applications. Herein, we present a unique peptide-binding site within the central cavity of the fragment antigen binding framework region of the chimeric, anti-epidermal growth factor receptor mAb cetuximab. We demonstrate through diffraction methods, biophysical studies, and sequence analysis that this peptide, a meditope, has moderate affinity for the Fab, is specific to cetuximabmore » (i.e., does not bind to human IgGs), and has no significant effect on antigen binding. We further demonstrate by diffraction studies and biophysical methods that the meditope binding site can be grafted onto the anti-human epidermal growth factor receptor 2 mAb trastuzumab, and that the antigen binding affinity of the grafted trastuzumab is indistinguishable from the parental mAb. Lastly, we demonstrate a bivalent meditope variant binds specifically and stably to antigen-bearing cells only in the presence of the meditope-enabled mAbs. Collectively, this finding and the subsequent characterization and engineering efforts indicate that this unique interface could serve as a noncovalent “linker” for any meditope-enabled mAb with applications in multiple mAb-based technologies including diagnostics, imaging, and therapeutic delivery.« less

  2. Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale

    PubMed Central

    Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li

    2015-01-01

    The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143

  3. Structure of the transcriptional regulator LmrR and its mechanism of multidrug recognition.

    PubMed

    Madoori, Pramod Kumar; Agustiandari, Herfita; Driessen, Arnold J M; Thunnissen, Andy-Mark W H

    2009-01-21

    LmrR is a PadR-related transcriptional repressor that regulates the production of LmrCD, a major multidrug ABC transporter in Lactococcus lactis. Transcriptional regulation is presumed to follow a drug-sensitive induction mechanism involving the direct binding of transporter ligands to LmrR. Here, we present crystal structures of LmrR in an apo state and in two drug-bound states complexed with Hoechst 33342 and daunomycin. LmrR shows a common topology containing a typical beta-winged helix-turn-helix domain with an additional C-terminal helix involved in dimerization. Its dimeric organization is highly unusual with a flat-shaped hydrophobic pore at the dimer centre serving as a multidrug-binding site. The drugs bind in a similar manner with their aromatic rings sandwiched in between the indole groups of two dimer-related tryptophan residues. Multidrug recognition is facilitated by conformational plasticity and the absence of drug-specific hydrogen bonds. Combined analyses using site-directed mutagenesis, fluorescence-based drug binding and protein-DNA gel shift assays reveal an allosteric coupling between the multidrug- and DNA-binding sites of LmrR that most likely has a function in the induction mechanism.

  4. Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harada, Y.; Li, H.; Li, Hua

    2009-04-28

    Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of {approx}1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings,more » we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes.« less

  5. Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

    PubMed Central

    Harada, Yoichiro; Li, Hua; Li, Huilin; Lennarz, William J.

    2009-01-01

    Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of ≈1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings, we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes. PMID:19365066

  6. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus

    PubMed Central

    Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

    2015-01-01

    The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function. PMID:25333630

  8. Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus.

    PubMed

    Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

    2015-09-01

    The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function.

  9. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  10. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  11. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  12. Searching for protein binding sites from Molecular Dynamics simulations and paramagnetic fragment-based NMR studies.

    PubMed

    Bernini, Andrea; Henrici De Angelis, Lucia; Morandi, Edoardo; Spiga, Ottavia; Santucci, Annalisa; Assfalg, Michael; Molinari, Henriette; Pillozzi, Serena; Arcangeli, Annarosa; Niccolai, Neri

    2014-03-01

    Hotspot delineation on protein surfaces represents a fundamental step for targeting protein-protein interfaces. Disruptors of protein-protein interactions can be designed provided that the sterical features of binding pockets, including the transient ones, can be defined. Molecular Dynamics, MD, simulations have been used as a reliable framework for identifying transient pocket openings on the protein surface. Accessible surface area and intramolecular H-bond involvement of protein backbone amides are proposed as descriptors for characterizing binding pocket occurrence and evolution along MD trajectories. TEMPOL induced paramagnetic perturbations on (1)H-(15)N HSQC signals of protein backbone amides have been analyzed as a fragment-based search for surface hotspots, in order to validate MD predicted pockets. This procedure has been applied to CXCL12, a small chemokine responsible for tumor progression and proliferation. From combined analysis of MD data and paramagnetic profiles, two CXCL12 sites suitable for the binding of small molecules were identified. One of these sites is the already well characterized CXCL12 region involved in the binding to CXCR4 receptor. The other one is a transient pocket predicted by Molecular Dynamics simulations, which could not be observed from static analysis of CXCL12 PDB structures. The present results indicate how TEMPOL, instrumental in identifying this transient pocket, can be a powerful tool to delineate minor conformations which can be highly relevant in dynamic discovery of antitumoral drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Developing a Dynamic Pharmacophore Model for HIV-1 Integrase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carlson, Heather A.; Masukawa, Keven M.; Rubins, Kathleen

    2000-05-11

    We present the first receptor-based pharmacophore model for HIV-1 integrase. The development of ''dynamic'' pharmacophore models is a new method that accounts for the inherent flexibility of the active site and aims to reduce the entropic penalties associated with binding a ligand. Furthermore, this new drug discovery method overcomes the limitation of an incomplete crystal structure of the target protein. A molecular dynamics (MD) simulation describes the flexibility of the uncomplexed protein. Many conformational models of the protein are saved from the MD simulations and used in a series of multi-unit search for interacting conformers (MUSIC) simulations. MUSIC is amore » multiple-copy minimization method, available in the BOSS program; it is used to determine binding regions for probe molecules containing functional groups that complement the active site. All protein conformations from the MD are overlaid, and conserved binding regions for the probe molecules are identified. Those conserved binding regions define the dynamic pharmacophore model. Here, the dynamic model is compared to known inhibitors of the integrase as well as a three-point, ligand-based pharmacophore model from the literature. Also, a ''static'' pharmacophore model was determined in the standard fashion, using a single crystal structure. Inhibitors thought to bind in the active site of HIV-1 integrase fit the dynamic model but not the static model. Finally, we have identified a set of compounds from the Available Chemicals Directory that fit the dynamic pharmacophore model, and experimental testing of the compounds has confirmed several new inhibitors.« less

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leenheer, J.A.; Brown, G.K.; Cabaniss, S.E.

    Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca{sup 2+}, Cd{sup 2+}, Cu{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca{sup 2+} ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The metal binding fraction was characterized by quantitative {sup 13}C NMR, {sup 1}H NMR, and FT-IR spectrometry andmore » elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca{sup 2+} binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.« less

  15. Penicillin-binding site on the Escherichia coli cell envelope

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Amaral, L.; Lee, Y.; Schwarz, U.

    The binding of /sup 35/S-labeled penicillin to distinct penicillin-binding proteins (PBPs) of the cell envelope obtained from the sonication of Escherichia coli was studied at different pHs ranging from 4 to 11. Experiments distinguishing the effect of pH on penicillin binding by PBP 5/6 from its effect on beta-lactamase activity indicated that although substantial binding occurred at the lowest pH, the amount of binding increased with pH, reaching a maximum at pH 10. Based on earlier studies, it is proposed that the binding at high pH involves the formation of a covalent bond between the C-7 of penicillin and freemore » epsilon amino groups of the PBPs. At pHs ranging from 4 to 8, position 1 of penicillin, occupied by sulfur, is considered to be the site that establishes a covalent bond with the sulfhydryl groups of PBP 5. The use of specific blockers of free epsilon amino groups or sulfhydryl groups indicated that wherever the presence of each had little or no effect on the binding of penicillin by PBP 5, the presence of both completely prevented binding. The specific blocker of the hydroxyl group of serine did not affect the binding of penicillin.« less

  16. RNA-protein binding motifs mining with a new hybrid deep learning based cross-domain knowledge integration approach.

    PubMed

    Pan, Xiaoyong; Shen, Hong-Bin

    2017-02-28

    RNAs play key roles in cells through the interactions with proteins known as the RNA-binding proteins (RBP) and their binding motifs enable crucial understanding of the post-transcriptional regulation of RNAs. How the RBPs correctly recognize the target RNAs and why they bind specific positions is still far from clear. Machine learning-based algorithms are widely acknowledged to be capable of speeding up this process. Although many automatic tools have been developed to predict the RNA-protein binding sites from the rapidly growing multi-resource data, e.g. sequence, structure, their domain specific features and formats have posed significant computational challenges. One of current difficulties is that the cross-source shared common knowledge is at a higher abstraction level beyond the observed data, resulting in a low efficiency of direct integration of observed data across domains. The other difficulty is how to interpret the prediction results. Existing approaches tend to terminate after outputting the potential discrete binding sites on the sequences, but how to assemble them into the meaningful binding motifs is a topic worth of further investigation. In viewing of these challenges, we propose a deep learning-based framework (iDeep) by using a novel hybrid convolutional neural network and deep belief network to predict the RBP interaction sites and motifs on RNAs. This new protocol is featured by transforming the original observed data into a high-level abstraction feature space using multiple layers of learning blocks, where the shared representations across different domains are integrated. To validate our iDeep method, we performed experiments on 31 large-scale CLIP-seq datasets, and our results show that by integrating multiple sources of data, the average AUC can be improved by 8% compared to the best single-source-based predictor; and through cross-domain knowledge integration at an abstraction level, it outperforms the state-of-the-art predictors by 6%. Besides the overall enhanced prediction performance, the convolutional neural network module embedded in iDeep is also able to automatically capture the interpretable binding motifs for RBPs. Large-scale experiments demonstrate that these mined binding motifs agree well with the experimentally verified results, suggesting iDeep is a promising approach in the real-world applications. The iDeep framework not only can achieve promising performance than the state-of-the-art predictors, but also easily capture interpretable binding motifs. iDeep is available at http://www.csbio.sjtu.edu.cn/bioinf/iDeep.

  17. Enzyme activation through the utilization of intrinsic dianion binding energy.

    PubMed

    Amyes, T L; Malabanan, M M; Zhai, X; Reyes, A C; Richard, J P

    2017-03-01

    We consider 'the proposition that the intrinsic binding energy that results from the noncovalent interaction of a specific substrate with the active site of the enzyme is considerably larger than is generally believed. An important part of this binding energy may be utilized to provide the driving force for catalysis, so that the observed binding energy represents only what is left over after this utilization' [Jencks,W.P. (1975) Adv. Enzymol. Relat. Areas. Mol. Biol. , , 219-410]. The large ~12 kcal/mol intrinsic substrate phosphodianion binding energy for reactions catalyzed by triosephosphate isomerase (TIM), orotidine 5'-monophosphate decarboxylase and glycerol-3-phosphate dehydrogenase is divided into 4-6 kcal/mol binding energy that is expressed on the formation of the Michaelis complex in anchoring substrates to the respective enzyme, and 6-8 kcal/mol binding energy that is specifically expressed at the transition state in activating the respective enzymes for catalysis. A structure-based mechanism is described where the dianion binding energy drives a conformational change that activates these enzymes for catalysis. Phosphite dianion plays the active role of holding TIM in a high-energy closed active form, but acts as passive spectator in showing no effect on transition-state structure. The result of studies on mutant enzymes is presented, which support the proposal that the dianion-driven enzyme conformational change plays a role in enhancing the basicity of side chain of E167, the catalytic base, by clamping the base between a pair of hydrophobic side chains. The insight these results provide into the architecture of enzyme active sites and the development of strategies for the de novo design of protein catalysts is discussed. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  18. Carbon repression of cellobiose dehydrogenase production in the white rot fungus Trametes versicolor is mediated at the level of gene transcription.

    PubMed

    Stapleton, P C; Dobson, A D W

    2003-04-25

    Cellobiose dehydrogenase (CDH) production in Trametes versicolor is induced in the presence of cellulose, but decreases when additional carbon sources such as glucose and maltose are added to the fungal cultures. Using T. versicolor-specific cdh primers in a reverse transcription-polymerase chain reaction-based approach, it appears that this repression in CDH production is being mediated at the level of gene transcription. When a 1.6-kb upstream region of the T. versicolor cdh gene was cloned and sequenced, a number of putative CreA-like binding sites were observed. We propose that these sites may be involved in mediating this repressive effect, based on their similarity to the consensus [5'-SYGGRGG-3'] site for binding of the CreA and Cre1 repressor proteins.

  19. Genotype and phenotype correlation in von Hippel-Lindau disease based on alteration of the HIF-α binding site in VHL protein.

    PubMed

    Liu, Sheng-Jie; Wang, Jiang-Yi; Peng, Shuang-He; Li, Teng; Ning, Xiang-Hui; Hong, Bao-An; Liu, Jia-Yuan; Wu, Peng-Jie; Zhou, Bo-Wen; Zhou, Jing-Cheng; Qi, Nie-Nie; Peng, Xiang; Zhang, Jiu-Feng; Ma, Kai-Fang; Cai, Lin; Gong, Kan

    2018-03-29

    PurposeVon Hippel-Lindau (VHL) disease is a rare hereditary cancer syndrome that reduces life expectancy. We aimed to construct a more valuable genotype-phenotype correlation based on alterations in VHL protein (pVHL).MethodsVHL patients (n = 339) were recruited and grouped based on mutation types: HIF-α binding site missense (HM) mutations, non-HIF-α binding site missense (nHM) mutations, and truncating (TR) mutations. Age-related risks of VHL-associated tumors and patient survival were compared.ResultsMissense mutations conferred an increased risk of pheochromocytoma (HR = 1.854, p = 0.047) compared with truncating mutations. The risk of pheochromocytoma was lower in the HM group than in the nHM group (HR = 0.298, p = 0.003) but was similar between HM and TR groups (HR = 0.901, p = 0.810). Patients in the nHM group had a higher risk of pheochromocytoma (HR = 3.447, p < 0.001) and lower risks of central nervous system hemangioblastoma (CHB) (HR = 0.700, p = 0.045), renal cell carcinoma (HR = 0.610, p = 0.024), and pancreatic tumor (HR = 0.382, p < 0.001) than those in the combined HM and TR (HMTR) group. Moreover, nHM mutations were independently associated with better overall survival (HR = 0.345, p = 0.005) and CHB-specific survival (HR = 0.129, p = 0.005) than HMTR mutations.ConclusionThe modified genotype-phenotype correlation links VHL gene mutation, substrate binding site, and phenotypic diversity (penetrance and survival), and provides more accurate information for genetic counseling and pathogenesis studies.Genetics in Medicine advance online publication, 29 March 2018; doi:10.1038/gim.2017.261.

  20. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  1. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  2. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  3. Substrate and Substrate-Mimetic Chaperone Binding Sites in Human α-Galactosidase A Revealed by Affinity-Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Moise, Adrian; Maeser, Stefan; Rawer, Stephan; Eggers, Frederike; Murphy, Mary; Bornheim, Jeff; Przybylski, Michael

    2016-06-01

    Fabry disease (FD) is a rare metabolic disorder of a group of lysosomal storage diseases, caused by deficiency or reduced activity of the enzyme α-galactosidase. Human α-galactosidase A (hαGAL) hydrolyses the terminal α-galactosyl moiety from glycosphingolipids, predominantly globotriaosylceramide (Gb3). Enzyme deficiency leads to incomplete or blocked breakdown and progressive accumulation of Gb3, with detrimental effects on normal organ functions. FD is successfully treated by enzyme replacement therapy (ERT) with purified recombinant hαGAL. An emerging treatment strategy, pharmacologic chaperone therapy (PCT), employs small molecules that can increase and/or reconstitute the activity of lysosomal enzyme trafficking by stabilizing misfolded isoforms. One such chaperone, 1-deoxygalactonojirimycin (DGJ), is a structural galactose analogue currently validated in clinical trials. DGJ is an active-site-chaperone that binds at the same or similar location as galactose; however, the molecular determination of chaperone binding sites in lysosomal enzymes represents a considerable challenge. Here we report the identification of the galactose and DGJ binding sites in recombinant α-galactosidase through a new affinity-mass spectrometry-based approach that employs selective proteolytic digestion of the enzyme-galactose or -inhibitor complex. Binding site peptides identified by mass spectrometry, [39-49], [83-100], and [141-168], contain the essential ligand-contacting amino acids, in agreement with the known X-ray crystal structures. The inhibitory effect of DGJ on galactose recognition was directly characterized through competitive binding experiments and mass spectrometry. The methods successfully employed in this study should have high potential for the characterization of (mutated) enzyme-substrate and -chaperone interactions, and for identifying chaperones without inhibitory effects.

  4. Precise small molecule recognition of a toxic CUG RNA repeat expansion

    PubMed Central

    Rzuczek, Suzanne G; Colgan, Lesley A; Nakai, Yoshio; Cameron, Michael D; Furling, Denis; Yasuda, Ryohei; Disney, Matthew D

    2017-01-01

    Excluding the ribosome and riboswitches, developing small molecules that selectively target RNA is a longstanding problem in chemical biology. A typical cellular RNA is difficult to target because it has little tertiary, but abundant secondary structure. We designed allele-selective compounds that target such an RNA, the toxic noncoding repeat expansion (r(CUG)exp) that causes myotonic dystrophy type 1 (DM1). We developed several strategies to generate allele-selective small molecules, including non-covalent binding, covalent binding, cleavage and on-site probe synthesis. Covalent binding and cleavage enabled target profiling in cells derived from individuals with DM1, showing precise recognition of r(CUG)exp. In the on-site probe synthesis approach, small molecules bound adjacent sites in r(CUG)exp and reacted to afford picomolar inhibitors via a proximity-based click reaction only in DM1-affected cells. We expanded this approach to image r(CUG)exp in its natural context. PMID:27941760

  5. Precise small-molecule recognition of a toxic CUG RNA repeat expansion.

    PubMed

    Rzuczek, Suzanne G; Colgan, Lesley A; Nakai, Yoshio; Cameron, Michael D; Furling, Denis; Yasuda, Ryohei; Disney, Matthew D

    2017-02-01

    Excluding the ribosome and riboswitches, developing small molecules that selectively target RNA is a longstanding problem in chemical biology. A typical cellular RNA is difficult to target because it has little tertiary, but abundant secondary structure. We designed allele-selective compounds that target such an RNA, the toxic noncoding repeat expansion (r(CUG) exp ) that causes myotonic dystrophy type 1 (DM1). We developed several strategies to generate allele-selective small molecules, including non-covalent binding, covalent binding, cleavage and on-site probe synthesis. Covalent binding and cleavage enabled target profiling in cells derived from individuals with DM1, showing precise recognition of r(CUG) exp . In the on-site probe synthesis approach, small molecules bound adjacent sites in r(CUG) exp and reacted to afford picomolar inhibitors via a proximity-based click reaction only in DM1-affected cells. We expanded this approach to image r(CUG) exp in its natural context.

  6. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  7. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  8. Testing inhomogeneous solvation theory in structure-based ligand discovery.

    PubMed

    Balius, Trent E; Fischer, Marcus; Stein, Reed M; Adler, Thomas B; Nguyen, Crystal N; Cruz, Anthony; Gilson, Michael K; Kurtzman, Tom; Shoichet, Brian K

    2017-08-15

    Binding-site water is often displaced upon ligand recognition, but is commonly neglected in structure-based ligand discovery. Inhomogeneous solvation theory (IST) has become popular for treating this effect, but it has not been tested in controlled experiments at atomic resolution. To do so, we turned to a grid-based version of this method, GIST, readily implemented in molecular docking. Whereas the term only improves docking modestly in retrospective ligand enrichment, it could be added without disrupting performance. We thus turned to prospective docking of large libraries to investigate GIST's impact on ligand discovery, geometry, and water structure in a model cavity site well-suited to exploring these terms. Although top-ranked docked molecules with and without the GIST term often overlapped, many ligands were meaningfully prioritized or deprioritized; some of these were selected for testing. Experimentally, 13/14 molecules prioritized by GIST did bind, whereas none of the molecules that it deprioritized were observed to bind. Nine crystal complexes were determined. In six, the ligand geometry corresponded to that predicted by GIST, for one of these the pose without the GIST term was wrong, and three crystallographic poses differed from both predictions. Notably, in one structure, an ordered water molecule with a high GIST displacement penalty was observed to stay in place. Inclusion of this water-displacement term can substantially improve the hit rates and ligand geometries from docking screens, although the magnitude of its effects can be small and its impact in drug binding sites merits further controlled studies.

  9. Capillarity theory for the fly-casting mechanism

    PubMed Central

    Trizac, Emmanuel; Levy, Yaakov; Wolynes, Peter G.

    2010-01-01

    Biomolecular folding and function are often coupled. During molecular recognition events, one of the binding partners may transiently or partially unfold, allowing more rapid access to a binding site. We describe a simple model for this fly-casting mechanism based on the capillarity approximation and polymer chain statistics. The model shows that fly casting is most effective when the protein unfolding barrier is small and the part of the chain which extends toward the target is relatively rigid. These features are often seen in known examples of fly casting in protein–DNA binding. Simulations of protein–DNA binding based on well-funneled native-topology models with electrostatic forces confirm the trends of the analytical theory. PMID:20133683

  10. Metal stabilization of collagen and de novo designed mimetic peptides

    PubMed Central

    Parmar, Avanish S.; Xu, Fei; Pike, Douglas H.; Belure, Sandeep V.; Hasan, Nida F.; Drzewiecki, Kathryn E.; Shreiber, David I.; Nanda, Vikas

    2017-01-01

    We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacency of the carboxy-termini of the three chains makes this region an attractive target for introducing metal binding sites. We engineered His3 sites based on structural modeling constraints into a series of designed homotrimeric and heterotrimeric peptides, assessing the capacity of metal binding to improve stability and in the case of heterotrimers, affect specificity of assembly. Notable enhancements in stability for both homo and heteromeric systems were observed upon addition of zinc(II) and several other metal ions only when all three histidine ligands were present. Metal binding affinities were consistent with the expected Irving-Williams series for imidazole. Unlike other metals tested, copper(II) also bound to peptides lacking histidine ligands. Acetylation of the peptide N-termini prevented copper binding, indicating proline backbone amide metal-coordination at this site. Copper similarly stabilized animal extracted Type I collagen in a metal specific fashion, highlighting the potential importance of metal homeostasis within the extracellular matrix. PMID:26225466

  11. Docking modes of BB-3497 into the PDF active site--a comparison of the pure MM and QM/MM based docking strategies.

    PubMed

    Kumari, Tripti; Issar, Upasana; Kakkar, Rita

    2014-01-01

    Peptide deformylase (PDF) has emerged as an important antibacterial drug target. Considerable effort is being directed toward developing peptidic and non-peptidic inhibitors for this metalloprotein. In this work, the known peptidic inhibitor BB-3497 and its various ionization and tautomeric states are evaluated for their inhibition efficiency against PDF using a molecular mechanics (MM) approach as well as a mixed quantum mechanics/molecular mechanics (QM/MM) approach, with an aim to understand the interactions in the binding site. The evaluated Gibbs energies of binding with the mixed QM/MM approach are shown to have the best predictive power. The experimental pose is found to have the most negative Gibbs energy of binding, and also the smallest strain energy. A quantum mechanical evaluation of the active site reveals the requirement of strong chelation by the ligand with the metal ion. The investigated ligand chelates the metal ion through the two oxygens of its reverse hydroxamate moiety, particularly the N-O(-) oxygen, forming strong covalent bonds with the metal ion, which is penta-coordinated. In the uninhibited state, the metal ion is tetrahedrally coordinated, and hence chelation with the inhibitor is associated with an increase of the metal ion coordination. Thus, the strong binding of the ligand at the binding site is accounted for.

  12. Metal Stabilization of Collagen and de Novo Designed Mimetic Peptides.

    PubMed

    Parmar, Avanish S; Xu, Fei; Pike, Douglas H; Belure, Sandeep V; Hasan, Nida F; Drzewiecki, Kathryn E; Shreiber, David I; Nanda, Vikas

    2015-08-18

    We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacency of the carboxy-termini of the three chains makes this region an attractive target for introducing metal binding sites. We engineered His3 sites based on structural modeling constraints into a series of designed homotrimeric and heterotrimeric peptides, assessing the capacity of metal binding to improve stability and in the case of heterotrimers, affect specificity of assembly. Notable enhancements in stability for both homo- and heteromeric systems were observed upon addition of zinc(II) and several other metal ions only when all three histidine ligands were present. Metal binding affinities were consistent with the expected Irving-Williams series for imidazole. Unlike other metals tested, copper(II) also bound to peptides lacking histidine ligands. Acetylation of the peptide N-termini prevented copper binding, indicating proline backbone amide metal-coordination at this site. Copper similarly stabilized animal extracted Type I collagen in a metal-specific fashion, highlighting the potential importance of metal homeostasis within the extracellular matrix.

  13. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  14. Crystal structure and structure-based mutagenesis of actin-specific ADP-ribosylating toxin CPILE-a as novel enterotoxin

    PubMed Central

    Toniti, Waraphan; Yoshida, Toru; Tsurumura, Toshiharu; Irikura, Daisuke; Monma, Chie; Kamata, Yoichi

    2017-01-01

    Unusual outbreaks of food poisoning in Japan were reported in which Clostridium perfringens was strongly suspected to be the cause based on epidemiological information and fingerprinting of isolates. The isolated strains lack the typical C. perfringens enterotoxin (CPE) but secrete a new enterotoxin consisting of two components: C. perfringens iota-like enterotoxin-a (CPILE-a), which acts as an enzymatic ADP-ribosyltransferase, and CPILE-b, a membrane binding component. Here we present the crystal structures of apo-CPILE-a, NAD+-CPILE-a and NADH-CPILE-a. Though CPILE-a structure has high similarity with known iota toxin-a (Ia) with NAD+, it possesses two extra-long protruding loops from G262-S269 and E402-K408 that are distinct from Ia. Based on the Ia–actin complex structure, we focused on actin-binding interface regions (I-V) including two protruding loops (PT) and examined how mutations in these regions affect the ADP-ribosylation activity of CPILE-a. Though some site-directed mutagenesis studies have already been conducted on the actin binding site of Ia, in the present study, mutagenesis studies were conducted against both α- and β/γ-actin in CPILE-a and Ia. Interestingly, CPILE-a ADP-ribosylates both α- and β/γ-actin, but its sensitivity towards β/γ-actin is 36% compared with α-actin. Our results contrast to that only C2-I ADP-ribosylates β/γ-actin. We also showed that PT-I and two convex-concave interactions in CPILE-a are important for actin binding. The current study is the first detailed analysis of site-directed mutagenesis in the actin binding region of Ia and CPILE-a against both α- and β/γ-actin. PMID:28199340

  15. CYP2E1 hydroxylation of aniline involves negative cooperativity.

    PubMed

    Hartman, Jessica H; Knott, Katie; Miller, Grover P

    2014-02-01

    CYP2E1 plays a role in the metabolic activation and elimination of aniline, yet there are conflicting reports on its mechanism of action, and hence relevance, in aniline metabolism. Based on our work with similar compounds, we hypothesized that aniline binds two CYP2E1 sites during metabolism resulting in cooperative reaction kinetics and tested this hypothesis through rigorous in vitro studies. The kinetic profile for recombinant CYP2E1 demonstrated significant negative cooperativity based on a fit of data to the Hill equation (n=0.56). Mechanistically, the data were best explained through a two-binding site cooperative model in which aniline binds with high affinity (K(s)=30 μM) followed by a second weaker binding event (K(ss)=1100 uM) resulting in a threefold increase in the oxidation rate. Binding sites for aniline were confirmed by inhibition studies with 4-methylpyrazole. Inhibitor phenotyping experiments with human liver microsomes validated the central role for CYP2E1 in aniline hydroxylation and indicated minor roles for CYP2A6 and CYP2C9. Importantly, inhibition of minor metabolic pathways resulted in a kinetic profile for microsomal CYP2E1 that replicated the preferred mechanism and parameters observed with the recombinant enzyme. Scaled modeling of in vitro CYP2E1 metabolism of aniline to in vivo clearance, especially at low aniline levels, led to significant deviations from the traditional model based on non-cooperative, Michaelis-Menten kinetics. These findings provide a critical mechanistic perspective on the potential importance of CYP2E1 in the metabolic activation and elimination of aniline as well as the first experimental evidence of a negatively cooperative metabolic reaction catalyzed by CYP2E1. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages

    NASA Astrophysics Data System (ADS)

    Djordjevic, Marko

    2005-11-01

    Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely resembles temperate phages, such as lambda. It, however, encodes its own T7-like RNA polymerase (characteristic of virulent phages), whose role in gene expression was unclear. Our analysis resulted in quantitative understanding of the role of both host and phage RNA polymerase, and in the identification of the previously unknown promoter sequence for Xp10 RNA polymerase. More generally, an increasing number of phage genomes are being sequenced every year, and we expect that methods of quantitative data analysis that we introduced will provide an efficient way to study gene expression strategies of novel bacterial viruses.

  17. An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

    PubMed

    Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

    2014-01-01

    Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances ChIP-seq data analysis and allows the identification of multiple SUMOylated TF binding sites simultaneously, which can then be utilized for other functional PTM binding site prediction in future.

  18. Species B adenovirus serotypes 3, 7, 11 and 35 share similar binding sites on the membrane cofactor protein CD46 receptor.

    PubMed

    Fleischli, Christoph; Sirena, Dominique; Lesage, Guillaume; Havenga, Menzo J E; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

    2007-11-01

    We recently characterized the domains of the human cofactor protein CD46 involved in binding species B2 adenovirus (Ad) serotype 35. Here, the CD46 binding determinants are mapped for the species B1 Ad serotypes 3 and 7 and for the species B2 Ad11. Ad3, 7 and 11 bound and transduced CD46-positive rodent BHK cells at levels similar to Ad35. By using antibody-blocking experiments, hybrid CD46-CD4 receptor constructs and CD46 single point mutants, it is shown that Ad3, 7 and 11 share many of the Ad35-binding features on CD46. Both CD46 short consensus repeat domains SCR I and SCR II were necessary and sufficient for optimal binding and transgene expression, provided that they were positioned at an appropriate distance from the cell membrane. Similar to Ad35, most of the putative binding residues of Ad3, 7 and 11 were located on the same glycan-free, solvent-exposed face of the SCR I or SCR II domains, largely overlapping with the binding surface of the recently solved fiber knob Ad11-SCR I-II three-dimensional structure. Differences between species B1 and B2 Ads were documented with competition experiments based on anti-CD46 antibodies directed against epitopes flanking the putative Ad-binding sites, and with competition experiments based on soluble CD46 protein. It is concluded that the B1 and B2 species of Ad engage CD46 through similar binding surfaces.

  19. Binding of Single Walled Carbon Nanotube to WT and Mutant HIV-1 Proteases: Analysis of Flap Dynamics and Binding Mechanism

    PubMed Central

    Meher, Biswa Ranjan; Wang, Yixuan

    2012-01-01

    Most of the currently treated HIV-1 protease (HIV-PR) inhibitors have been prone to suffer from the mutations associated drug resistance. Therefore, it is necessary to search for potent alternatives against the drug resistance. In the current study we have tested the single-walled carbon nanotube (SWCNT) as an inhibitor in wild type (WT) as well as in three primary mutants (I50VPR, V82APR and I84VPR) of the HIV-1-PR through docking the SWCNT in the active site region, and then performed all-atom MD simulations for the complexes. The conformational dynamics of HIV-PR with a 20 ns trajectory reveals that the SWCNT can effectively bind to the HIV-1-PR active site and regulate the flap dynamics such as maintaining the flap-flap closed. To gain an insight into the binding affinity, we also performed the MM-PBSA based binding free energy calculations for the four HIV-PR/SWCNT complexes. It was observed that, although the binding between the SWCNT and the HIV-PR decreases due to the mutations, the SWCNTs bind to the HIV-PRs 3–5 folds stronger than the most potent HIV-1-PR inhibitor, TMC114. Remarkably, the significant interactions with binding energy higher than 1 kcal/mol focus on the flap and active regions, which favors closing flap-flap and deactivating the active residues of the HIV-PR. The flap dynamics and binding strength information for HIV-PR and SWCNTs can help design SWCNT-based HIV-1-PR inhibitors. PMID:23142620

  20. Generation of tumour-necrosis-factor-alpha-specific affibody molecules capable of blocking receptor binding in vitro.

    PubMed

    Jonsson, Andreas; Wållberg, Helena; Herne, Nina; Ståhl, Stefan; Frejd, Fredrik Y

    2009-08-17

    Affibody molecules specific for human TNF-alpha (tumour necrosis factor-alpha) were selected by phage-display technology from a library based on the 58-residue Protein A-derived Z domain. TNF-alpha is a proinflammatory cytokine involved in several inflammatory diseases and, to this day, four TNF-alpha-blocking protein pharmaceuticals have been approved for clinical use. The phage selection generated 18 unique cysteine-free affibody sequences of which 12 were chosen, after sequence cluster analysis, for characterization as proteins. Biosensor binding studies of the 12 Escherichia coli-produced and IMAC (immobilized-metal-ion affinity chromatography)-purified affibody molecules revealed three variants that demonstrated the strongest binding to human TNF-alpha. These three affibody molecules were subjected to kinetic binding analysis and also tested for their binding to mouse, rat and pig TNF-alpha. For ZTNF-alpha:185, subnanomolar affinity (KD=0.1-0.5 nM) for human TNF-alpha was demonstrated, as well as significant binding to TNF-alpha from the other species. Furthermore, the binding site was found to overlap with the binding site for the TNF-alpha receptor, since this interaction could be efficiently blocked by the ZTNF-alpha:185 affibody. When investigating six dimeric affibody constructs with different linker lengths, and one trimeric construct, it was found that the inhibition of the TNF-alpha binding to its receptor could be further improved by using dimers with extended linkers and/or a trimeric affibody construct. The potential implication of the results for the future design of affibody-based reagents for the diagnosis of inflammation is discussed.

  1. Structural basis of RND-type multidrug exporters

    PubMed Central

    Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke

    2015-01-01

    Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway. PMID:25941524

  2. Structural basis of RND-type multidrug exporters.

    PubMed

    Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke

    2015-01-01

    Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway.

  3. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  4. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

    PubMed Central

    Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

    1989-01-01

    The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

  5. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  6. Binding thermodynamics discriminates fragments from druglike compounds: a thermodynamic description of fragment-based drug discovery.

    PubMed

    Williams, Glyn; Ferenczy, György G; Ulander, Johan; Keserű, György M

    2017-04-01

    Small is beautiful - reducing the size and complexity of chemical starting points for drug design allows better sampling of chemical space, reveals the most energetically important interactions within protein-binding sites and can lead to improvements in the physicochemical properties of the final drug. The impact of fragment-based drug discovery (FBDD) on recent drug discovery projects and our improved knowledge of the structural and thermodynamic details of ligand binding has prompted us to explore the relationships between ligand-binding thermodynamics and FBDD. Information on binding thermodynamics can give insights into the contributions to protein-ligand interactions and could therefore be used to prioritise compounds with a high degree of specificity in forming key interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  8. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  9. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  10. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  11. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  12. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  13. Identifying potential selective fluorescent probes for cancer-associated protein carbonic anhydrase IX using a computational approach.

    PubMed

    Kamstra, Rhiannon L; Floriano, Wely B

    2014-11-01

    Carbonic anhydrase IX (CAIX) is a biomarker for tumor hypoxia. Fluorescent inhibitors of CAIX have been used to study hypoxic tumor cell lines. However, these inhibitor-based fluorescent probes may have a therapeutic effect that is not appropriate for monitoring treatment efficacy. In the search for novel fluorescent probes that are not based on known inhibitors, a database of 20,860 fluorescent compounds was virtually screened against CAIX using hierarchical virtual ligand screening (HierVLS). The screening database contained 14,862 compounds tagged with the ATTO680 fluorophore plus an additional 5998 intrinsically fluorescent compounds. Overall ranking of compounds to identify hit molecular probe candidates utilized a principal component analysis (PCA) approach. Four potential binding sites, including the catalytic site, were identified within the structure of the protein and targeted for virtual screening. Available sequence information for 23 carbonic anhydrase isoforms was used to prioritize the four sites based on the estimated "uniqueness" of each site in CAIX relative to the other isoforms. A database of 32 known inhibitors and 478 decoy compounds was used to validate the methodology. A receiver-operating characteristic (ROC) analysis using the first principal component (PC1) as predictive score for the validation database yielded an area under the curve (AUC) of 0.92. AUC is interpreted as the probability that a binder will have a better score than a non-binder. The use of first component analysis of binding energies for multiple sites is a novel approach for hit selection. The very high prediction power for this approach increases confidence in the outcome from the fluorescent library screening. Ten of the top scoring candidates for isoform-selective putative binding sites are suggested for future testing as fluorescent molecular probe candidates. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  15. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  16. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  17. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  18. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  19. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  20. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Top