Sample records for binding sites bmax

  1. [Glutamate-binding membrane proteins from human platelets].

    PubMed

    Gurevich, V S; Popov, Iu G; Gorodinskiĭ, A I; Dambinova, S A

    1991-09-01

    Solubilization of the total membrane fraction of human platelets in a 2% solution of sodium deoxycholate and subsequent affinity chromatography on glutamate agarose resulted in two protein fractions possessing a glutamate-binding activity. As can be evidenced from radioligand binding data, the first fraction contains two types of binding sites (Kd1 = 1 microM, Bmax 1 = 100 pmol/mg of protein; Kd2 = 9.3 microMm Bmax2 = 395 pmol/mg of protein). The second fraction has only one type of binding sites (Kd = 1 microM, Bmax = = 110 pmol/mg of protein). SDS-PAAG electrophoresis revealed the presence in the first fraction of proteins with Mr of 14, 24, 56 and 155 kDa, whereas the second fraction was found to contain 14, 46, 71 and 155 kDa proteins. Solid phase immunoenzymatic analysis using poly- and monoclonal specific antibodies against mammalian brain glutamate-binding proteins revealed a marked immunochemical similarity of the isolated protein fractions with human brain synaptic membrane glutamate-binding proteins.

  2. [3H]-nitrendipine binding in membranes obtained from hypoxic and reoxygenated heart.

    PubMed

    Matucci, R; Bennardini, F; Sciammarella, M L; Baccaro, C; Stendardi, I; Franconi, F; Giotti, A

    1987-04-01

    We compared the binding properties of [3H]-nitrendipine in heart membranes from normal guinea-pig heart and from hypoxic or hypoxic and reoxygenated heart. The [3H]-nitrendipine binds a single class of high capacity (Bmax 667.2 +/- 105.2) with high affinity (KD 0.14 +/- 0.02) binding sites. By contrast, in membranes of hypoxic and reoxygenated heart the Bmax decreases significantly while it remains unaffected during hypoxia. Xanthinoxidase activity is increased in hypoxic-reoxygenated hearts.

  3. Oxytocin and vasopressin: distinct receptors in myometrium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guillon, G.; Balestre, M.N.; Roberts, J.M.

    1987-06-01

    The binding characteristics of (/sup 3/H)oxytocin (( /sup 3/H)OT) and (/sup 3/H)lysine vasopressin (( /sup 3/H)LVP) to nonpregnant human myometrium were investigated. Binding of both radioligands was saturable, time dependent, and reversible. Whereas (/sup 3/H)OT was found to bind to a single class of sites with high affinity (Kd, 1.5 +/- 0.4 (+/- SEM) nM) and low capacity (maximum binding (Bmax), 34 +/- 6 fmol/mg protein), (/sup 3/H)LVP bound to two classes of sites, one with high affinity (Kd, 2.2 +/- 0.1 nM) and low capacity (Bmax, 198 +/- 7 fmol/mg protein) and another with low affinity (Kd, 655 +/-more » 209 nM) and high capacity (Bmax, 5794 +/- 1616 fmol/mg protein). The binding of the labeled peptides also displayed a marked difference in sensitivity to Mg2+ and guanine nucleotides. These differences in binding characteristics as well as the differences in potency of analogs in competing for (/sup 3/H)OT and (/sup 3/H)LVP binding indicate the presence of distinct receptors for OT and vasopressin in human myometrium. Pharmacological characterization of the high affinity binding sites for (/sup 3/H)LVP indicated that these are of the V1 subtype. Although, as suggested by others, vasopressin and OT can bind to the same sites, the presence of distinct receptors for both peptides provides an explanation for the previously reported difference in myometrial responsiveness to OT and vasopressin.« less

  4. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  5. Carbon-11-cocaine binding compared at subpharmacological and pharmacological doses: A PET study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Volkow, N.D.; Fowler, J.S.; Logan, J.

    The authors have characterized cocaine binding in the brain to a high-affinity site on the dopamine transporter using PET and tracer doses of [{sup 11}C]cocaine in the baboon in vivo. The binding pattern, however, of cocaine at tracer (subpharmacological) doses may differ from that observed when the drug is taken in behaviorally active doses, particularly since in vitro studies have shown that cocaine also binds to low affinity binding sites. PET was used to compare and characterize [{sup 11}C]cocaine binding in the baboon brain at low subpharmacological (18 {mu}g average dose) and at pharmacological (8000 {mu}g) doses. Serial studies onmore » the same day in the same baboon were used to assess the reproducibility of repeated measures and to assess the effects of drugs which inhibit the dopamine, norepinephrine and serotonin transporters. Time-activity curves from brain and the arterial plasma input function were used to calculate the steady-state distribution volume (DV). At subpharmacological doses, [{sup 11}C]cocaine had a more homogeneous distribution. Bmax/Kd for sub-pharmacological [{sup 11}C]cocaine corresponded to 0.5-0.6 and for pharmacological [{sup 11}C]cocaine it corresponded to 0.1-0.2. Two-point Scatchard analysis gave Bmax = 2300 pmole/g and Kd = 3600 nM. Bmax/Kd for sub-pharmacological doses of [{sup 11}C]cocaine was decreased by cocaine and drugs that inhibit the dopamine transporter, to 0.1-0.2, but not by drugs that inhibit the serotonin or the norepinephrine transporter. None of these drugs changed Bmax/Kd for a pharmacological dose of [{sup 11}C]cocaine. At subpharmacological doses, [{sup 11}C]cocaine binds predominantly to a high-affinity site on the dopamine transporter. 36 refs., 4 figs., 5 tabs.« less

  6. [Molecular organization of glutamate-sensitive chemoexcitatory membranes of nerve cells. Binding of L-[3H]glutamate to synaptic membranes of the rat cerebral cortex].

    PubMed

    Dambinova, S A; Gorodinskiĭ, A I

    1984-01-01

    The binding of L-[3H]glutamate to rat cerebral cortex synaptic membranes was investigated. Two types of binding sites, a Na+-independent (Kd = 140-160 nm; Bmax = 3.8-4.5 pmol-mg of protein) and a Na+-dependent (Kd = 2.0 microM; Bmax = 45-50 pmol/mg of protein) ones, were detected. The dependence of Na+-insensitive binding on time and temperature and membrane content in a sample was determined. Mono- and divalent cations (5-10 mM) potentiated specific binding by 2.1-3.3 times. The Na+-dependent binding is associated with active transport systems, while the Na+-independent one-with true receptor binding. The relationship between CNS glutamate receptors and Na+-independent binding sites is discussed.

  7. ( sup 3 H)opipramol labels a novel binding site and sigma receptors in rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferris, C.D.; Hirsch, D.J.; Brooks, B.P.

    1991-02-01

    Opipramol (OP), a clinically effective antidepressant with a tricyclic structure, is inactive as an inhibitor of biogenic amine uptake. ({sup 3}H)Opipramol binds saturably to rat brain membranes (apparent KD = 4 nM, Bmax = 3 pmol/mg of protein). ({sup 3}H)Opipramol binding can be differentiated into haloperidol-sensitive and -resistant components, with Ki values for haloperidol of 1 nM (Bmax = 1 pmol/mg of protein) and 350 nM (Bmax = 1.9 pmol/mg of protein), respectively. The drug specificity of the haloperidol-sensitive component is the same as that of sigma receptors labeled with (+)-({sup 3}H)3-(3-hydroxyphenyl)-N-(1-propyl)piperdine. The haloperidol-resistant component does not correspond to anymore » known neurotransmitter receptor or uptake recognition site. It displays high affinity for phenothiazines and related structures such as perphenazine, clopenthixol, and flupenthixol, whose potencies are comparable to that of opipramol. Because certain of these drugs are more potent at the haloperidol-resistant opipramol site than in exerting any other action, it is possible that this opipramol-selective site may mediate their therapeutic effects.« less

  8. The involvement of the sodium-potassium pump in postjunctional supersensitivity of the guinea-pig vas deferens as assessed by [3H]ouabain binding.

    PubMed

    Wong, S K; Westfall, D P; Fedan, J S; Fleming, W W

    1981-10-01

    Previous evidence has suggested that postjunctional supersensitivity of the guinea-pig vas deferens results, in part, from partial depolarization of the cell membrane. The depolarization is believed to result from a reduction in the activity of the Na-K pump. Indeed, the Na, K+ -adenosine triphosphatase activity of subcellular fractions from supersensitive vas deferens is reduced. In order to determine whether the biochemical alteration seen in subcellular fractions correlate with Na-K pump sites in intact tissues, we have studied the binding of [3H] ouabain to intact vas deferens. [3H]ouabain binds to membrane sites which have the characteristics expected of Na+, K+ - adenosine triphosphatase. Specific binding was saturable and reversible. Scatchard analysis of ouabain-binding in control tissues yielded a single class of binding sites with a dissociation constant (KD) of 156 +/- 7 nM and a maximum number of binding sites (Bmax) of 558.7 +/- 15.6 fmol/mg wet wt. [3H]Ouabain binding was displaceable by several cardiac glycosides and aglycones, but not by steroid hormones or sodium vanadate. Alteration of concentrations of Na+ and K+ markedly affected ouabain binding. Denervation (with 6-hydroxydopamine), decentralization or reserpine treatment for 1 day, which do not produce supersensitivity, did not alter the Bmax, whereas 5 to 7 days after these procedures, when supersensitivity was present, the Bmax was significantly reduced by 20 to 40%. The KD was not changed by any of the treatments. These data provide additional support for the concept that a reduction in the NaK pump sites contributes to postjunctional supersensitivity.

  9. An N-terminal fragment of substance P, substance P(1-7), down-regulates neurokinin-1 binding in the mouse spinal cord.

    PubMed

    Yukhananov RYu; Larson, A A

    1994-08-29

    Injected intrathecally, substance P (SP) down-regulates neurokinin-1 (NK-1) binding in the spinal cord and desensitizes rats to the behavioral effect of SP. N-terminal fragments of SP, such as SP(1-7), induce antinociception and play a role in desensitization to SP in mice. The goal of this study was to assess the abilities of N- and C-terminal fragments of SP to down-regulate NK-1 binding. Binding of [3H]SP to mouse spinal cord membranes was inhibited by SP, CP-96,345, and to a lesser extent by SP(5-11), but not SP(1-7), consistent with these binding sites being NK-1 receptors. Injection of SP(5-11) intrathecally did not affect the affinity (Kd) or concentration (Bmax) of [3H]SP binding. However, injection of 1 nmol of SP(1-7) decreased the Bmax of [3H]SP binding in the spinal cord at 6 h after its injection just as this dose of SP decreased the Bmax at 24 h. These data suggest that the N-terminus of SP is responsible for down-regulation of NK-1 binding. As SP(5-11) did not down-regulate NK-1 binding, activation of NK-1 sites does not appear necessary or sufficient for down-regulation of SP binding. In contrast, SP(1-7), in spite of its inability to interact with NK-1 sites, did down-regulate SP binding, suggesting an indirect mechanism dissociated from NK-1 receptors.

  10. Binding of (/sup 3/H)forskolin to platelet membranes and solubilized proteins from bovine brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nelson, C.A.; Seamon, K.B.

    1986-05-01

    (/sup 3/H)Forskolin ((/sup 3/H)FSK) bound to platelet membranes with a Kd of 20 nM and a Bmax of 125 fmol/mg protein. The Bmax was increased to 400 fmol/mg protein in the presence of GppNHp (or NaF) and MgCl/sub 2/ with no change in Kd. PGE/sub 1/ decreased the EC50 of GppNHp to increase the Bmax for (/sup 3/H)FSK binding from 600 nM to 35 nM. In contrast, PGE/sub 1/ had no effect on the EC50 of NaF to increase (/sup 3/H)FSK binding. (/sup 3/H)FSK binding increased slowly over 60 min when forskolin and GppNHp were added to membranes simultaneously atmore » 20/sup 0/C. Preincubation of membranes with GppNHp at 20/sup 5/C also caused a linear increase in adenylate cyclase specific activity over 60 minutes. (/sup 3/H)FSK bound to solubilized protein from bovine brain membrane with a Kd of 22 nM. GppNHp increased the number of binding sites in solubilized proteins only if membranes were not preincubated with GppNHp prior to solubilization. In conclusion the number of binding sites for (/sup 3/H)FSK is increased by agents that activate adenylate cyclase through the Ns protein. These sites appear to be associated with an activated complex of the Ns protein and adenylate cyclase.« less

  11. Identification of two H3-histamine receptor subtypes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    West, R.E. Jr.; Zweig, A.; Shih, N.Y.

    The H3-histamine receptor provides feedback inhibition of histamine synthesis and release as well as inhibition of other neurotransmitter release. We have characterized this receptor by radioligand binding studies with the H3 agonist N alpha-(3H)methylhistamine ((3H)NAMHA). The results of (3H)NAMHA saturation binding and NAMHA inhibition of (3H)NAMHA binding were consistent with an apparently single class of receptors (KD = 0.37 nM, Bmax = 73 fmol/mg of protein) and competition assays with other agonists and the antagonists impromidine and dimaprit disclosed only a single class of sites. In contrast, inhibition of (3H)NAMHA binding by the specific high affinity H3 antagonist thioperamide revealedmore » two classes of sites (KiA = 5 nM, BmaxA = 30 fmol/mg of protein; KiB = 68 nM, BmaxB = 48 fmol/mg of protein). Burimamide, another antagonist that, like thioperamide, contains a thiourea group, likewise discriminated between two classes of sites. In addition to differences between some antagonist potencies for the two receptors, there is a differential guanine nucleotide sensitivity of the two. The affinity of the H3A receptor for (3H) NAMHA was reduced less than 2-fold, whereas (3H)NAMHA binding to the H3B receptor was undetectable in the presence of guanosine 5'-O-(3-thiotriphosphate). The distinction between H3A and H3B receptor subtypes, the former a high affinity and the latter a low affinity thioperamide site, draws support from published in vitro data.« less

  12. Increased /sup 3/H-spiperone binding sites in mesolimbic area related to methamphetamine-induced behavioral hypersensitivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akiyama, K.; Sato, M.; Otsuki, S.

    1982-02-01

    The specific /sup 3/H-spiperone binding to membrane homogenates of the striatum, mesolimbic area, and frontal cortex was examined in two groups of rats pretreated once daily with saline or 4 mg/kg of methamphetamine (MAP) for 14 days. At 7 days following cessation of chronic pretreatment, all rats received an injection of 4 mg/kg of MAP and were decapitated 1 hr after the injection. In the chronic saline-pretreatment group, the single administration of MAP induced significant changes in the number (Bmax) of specific /sup 3/H-spiperone binding sites (a decrease in the striatum and an increase in the mesolimbic area and frontalmore » cortex), but no significant changes in the affinity (KD) in any brain area. The chronic MAP pretreatment markedly augmented the changes in Bmax in the striatum and mesolimbic area. The increase in specific /sup 3/H-spiperone binding sites in the mesolimbic area is discussed in relation to MAP-induced behavioral hypersensitivity.« less

  13. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  14. Characterization of nicotine binding in mouse brain and comparison with the binding of alpha-bungarotoxin and quinuclidinyl benzilate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marks, M.J.; Collins, A.C.

    1982-11-01

    The binding of (/sup 3/H)nicotine to mouse brain has been measured and subsequently compared with the binding of (/sup 125/I)alpha-bungarotoxin (alpha-BTX) and L-(/sup 3/H)quinuclidinyl benzilate (QNB). The binding of nicotine was saturable, reversible, and stereospecific. The average KD and Bmax were 59 nM and 88 fmoles/mg of protein, respectively. Although the rates of association and dissociation of nicotine were temperature-dependent, the incubation temperature had no effect on either KD or Bmax. When measured at 20 degrees or 37 degrees, nicotine appeared to bind to a single class of binding sites, but a second, very low-affinity, binding site was observed atmore » 4 degrees. Nicotine binding was unaffected by the addition of NaCl, KCl, CaCl/sub 2/, or MgSO/sub 4/ to the incubation medium. Nicotinic cholinergic agonists were potent inhibitors of nicotine binding; however, nicotinic antagonists were poor inhibitors. The regional distribution of binding was not uniform: midbrain and striatum contained the highest number of receptors, whereas cerebellum had the fewest. Differences in site densities, regional distribution, inhibitor potencies, and thermal denaturation indicated that nicotine binding was not the same as either QNB or alpha-BTX binding, and therefore that receptors for nicotine may represent a unique population of cholinergic receptors.« less

  15. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  16. (3H)WB4101 labels the 5-HT1A serotonin receptor subtype in rat brain. Guanine nucleotide and divalent cation sensitivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Norman, A.B.; Battaglia, G.; Creese, I.

    1985-12-01

    In the presence of a 30 nM prazosin mask, (/sup 3/H)-2-(2,6-dimethoxyphenoxyethyl) aminomethyl-1,4-benzodioxane ((/sup 3/H)WB4101) can selectively label 5-HT1 serotonin receptors. Serotonin exhibits high affinity (Ki = 2.5 nM) and monophasic competition for (/sup 3/H) WB4101 binding in cerebral cortex. We have found a significant correlation (r = 0.96) between the affinities of a number of serotonergic and nonserotonergic compounds at (/sup 3/H)WB4101-binding sites in the presence of 30 nM prazosin and (/sup 3/H) lysergic acid diethylamide ((/sup 3/H)LSD)-labeled 5-HT1 serotonin receptors in homogenates of rat cerebral cortex. Despite similar pharmacological profiles, distribution studies indicate that, in the presence of 5more » mM MgSO4, the Bmax of (/sup 3/H)WB4101 is significantly lower than the Bmax of (/sup 3/H)LSD in various brain regions. WB4101 competition for (/sup 3/H) LSD-labeled 5-HT1 receptors fits best to a computer-derived model assuming two binding sites, with the KH for WB4101 being similar to the KD of (/sup 3/H)WB4101 binding derived from saturation experiments. This suggests that (/sup 3/H)WB4101 labels only one of the subtypes of the 5-HT1 serotonin receptors labeled by (/sup 3/H)LSD. The selective 5-HT1A serotonin receptor antagonist, spiperone, and the selective 5-HT1A agonist, 8-hydroxy-2-(di-n-propylamino) tetraline, exhibit high affinity and monophasic competition for (/sup 3/H)WB4101 but compete for multiple (/sup 3/H)LSD 5-HT1 binding sites. These data indicate that (/sup 3/H)WB4101 selectively labels the 5-HT1A serotonin receptor, whereas (/sup 3/H) LSD appears to label both the 5-HT1A and the 5-HT1B serotonin receptor subtypes. The divalent cations, Mn2+, Mg2+, and Ca2+ were found to markedly increase the affinity and Bmax of (/sup 3/H)WB4101 binding in cerebral cortex. Conversely, the guanine nucleotides guanylylimidodiphosphate and GTP, but not the adenosine nucleotide ATP, markedly reduce the Bmax of (/sup 3/H)WB4101 binding.« less

  17. Aging-induced changes in brain regional serotonin receptor binding: Effect of Carnosine.

    PubMed

    Banerjee, S; Poddar, M K

    2016-04-05

    Monoamine neurotransmitter, serotonin (5-HT) has its own specific receptors in both pre- and post-synapse. In the present study the role of carnosine on aging-induced changes of [(3)H]-5-HT receptor binding in different brain regions in a rat model was studied. The results showed that during aging (18 and 24 months) the [(3)H]-5-HT receptor binding was reduced in hippocampus, hypothalamus and pons-medulla with a decrease in their both Bmax and KD but in cerebral cortex the [(3)H]-5-HT binding was increased with the increase of its only Bmax. The aging-induced changes in [(3)H]-5-HT receptor binding with carnosine (2.0 μg/kg/day, intrathecally, for 21 consecutive days) attenuated in (a) 24-month-aged rats irrespective of the brain regions with the attenuation of its Bmax except hypothalamus where both Bmax and KD were significantly attenuated, (b) hippocampus and hypothalamus of 18-month-aged rats with the attenuation of its Bmax, and restored toward the [(3)H]-5-HT receptor binding that observed in 4-month-young rats. The decrease in pons-medullary [(3)H]-5-HT binding including its Bmax of 18-month-aged rats was promoted with carnosine without any significant change in its cerebral cortex. The [(3)H]-5-HT receptor binding with the same dosages of carnosine in 4-month-young rats (a) increased in the cerebral cortex and hippocampus with the increase in their only Bmax whereas (b) decreased in hypothalamus and pons-medulla with a decrease in their both Bmax and KD. These results suggest that carnosine treatment may (a) play a preventive role in aging-induced brain region-specific changes in serotonergic activity (b) not be worthy in 4-month-young rats in relation to the brain regional serotonergic activity. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strittmatter, S.M.; Snyder, S.H.

    We demonstrate that (3H)captopril selectively labels angiotensin converting enzyme (EC 3.14.15.1) (ACE) and employ this technique to probe enzyme-inhibitor interactions. (3H)Captopril binding sites copurify with ACE activity from rat lung or rat brain. At each stage of the purification the Vmax/Bmax ratio, or kcat is 17,000 min-1 with hippuryl-L-histidyl-L-leucine as substrate. The specificity of (3H)captopril binding is apparent in the similar pharmacologic profile of inhibition in crude and pure enzyme preparations. Furthermore, binding sites and enzyme activity comigrate in gel filtration and sucrose gradient sedimentation experiments. Equilibrium analysis of (3H)captopril binding to purified ACE reveals a Bmax of 6 nmol/mgmore » of protein (KD = 2 nM), demonstrating the presence of one inhibitor binding site per polypeptide chain. The kinetics of (3H)captopril binding are characterized by monophasic association and dissociation rate constants of 0.026 nM-1 min-1 and 0.034 min-1, respectively. The affinity of ACE for both (3H) captopril and enalaprilat is greater at 37 degrees than at 0 degree, demonstrating that these interactions are entropically driven, perhaps by an isomerization of the enzyme molecule. The ionic requirements for (3H)captopril binding and substrate catalysis differ. Chloride and bromide ion, but not fluoride, are about 100-fold more potent stimulators of binding than catalysis. When the active site Zn2+ ion is replaced by Co2+, catalysis was stimulated 2-fold, whereas binding activity was decreased by 70%.« less

  19. Marked reduction in the number of platelet-tritiated imipramine binding sites in geriatric depression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemeroff, C.B.; Knight, D.L.; Krishnan, R.R.

    The number (Bmax) and affinity (Kd) of platelet-tritiated imipramine binding sites was determined in young and middle-aged controls 50 years of age and younger (n = 25), elderly normal controls over 60 years of age (n = 18), patients who fulfilled DSM-III criteria for major depression who were under 50 years of age (n = 29), patients who fulfilled DSM-III criteria for major depression who were 60 years of age and older (n = 19), and patients who fulfilled both DSM-III criteria for primary degenerative dementia and National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disordersmore » Association criteria for probable Alzheimer's disease (n = 13). Both groups of depressed patients (under 50 and over 60 years of age) exhibited significant reductions (decreases 42%) in the number of platelet-tritiated imipramine binding sites with no change in affinity, when compared with their age-matched controls. There was little overlap in Bmax values between the elderly depressed patients and their controls. The patients with probable Alzheimer's disease showed no alteration in platelet-tritiated imipramine binding. There was no statistically significant relationship between postdexamethasone plasma cortisol concentrations and tritiated imipramine binding. These results indicate that platelet-tritiated imipramine binding may have potential utility as a diagnostic adjunct in geriatric depression, and moreover that the reduction in the number of platelet-tritiated imipramine binding sites is not due to hypercortisolemia.« less

  20. Benzodiazepines: rat pinealocyte binding sites and augmentation of norepinephrine-stimulated N-acetyltransferase activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matthew, E.; Parfitt, A.G.; Sugden, D.

    1984-02-01

    Studies of (/sup 3/H)diazepam binding to intact rat pineal cells were carried out in tissue culture preparations. The binding was saturable, reversible and proportional to the number of cells used. Scatchard analysis resulted in a linear plot (Kd . 23 nM, maximum binding sites (Bmax) . 1.56 pmol/mg of protein for cells in monolayer culture; Kd . 7 nM, Bmax . 1.3 pmol/mg of protein for cells in suspension culture). Inhibition constants (Ki) for clonazepam (500 nM), flunitrazepam (38 nM) and Ro-5-4864 (5 nM) indicated that the binding sites were probably of the ''peripheral'' type. In addition, the effects ofmore » diazepam on norepinephrine-stimulated N-acetyltransferase (NAT) activity were studied in organ culture and dissociated cell culture. Diazepam (10-50 microM) both prolonged and increased the magnitude of the norepinephrine-induced increase in NAT activity but did not affect the initial rate of rise of enzyme activity. The effect was dose-dependent and was also seen with clonazepam, flunitrazepam and Ro-5-4864, but not with Ro-15-1788. Diazepam, by itself, at these concentrations, had no effect on NAT, but enzyme activity was increased by higher concentrations (0.1-1 mM). Although a relationship between the (/sup 3/H)diazepam binding sites described here and the effect of benzodiazepines on NAT cannot be established from these studies, the data suggest that the benzodiazepines may alter melatonin levels through their action on NAT.« less

  1. Receptor binding of somatostatin-14 and somatostatin-28 in rat brain: differential modulation by nucleotides and ions.

    PubMed

    Srikant, C B; Dahan, A; Craig, C

    1990-02-04

    The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2+, Mn2+, Ca2+ and Co2+ augmented the binding of both T* SS-14 and LTT* SS-28, while higher than 4 mM Co2+ inhibited binding of both ligands. LTT* SS-28 binding was reduced in the presence of high concentrations of Ba2+ and Mn2+ also. Interestingly Ca2+ at higher than 10 mM preferentially inhibited LTT* SS-28 binding and increased the affinity of SS-14 but not SS-28 for LTT* SS-28 binding sites.(ABSTRACT TRUNCATED AT 400 WORDS)

  2. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  3. Evidence of paired M2 muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potter, L.T.; Ballesteros, L.A.; Bichajian, L.H.

    Binding assays involving various antagonists, including N-(3H) methylscopolamine, (3H)quinuclidinyl benzilate, AFDX-116, pirenzepine, and propylbenzilylcholine mustard, disclosed only a single population of M2 muscarinic receptors in membranes from the rat brainstem (medulla, pons, and colliculi). However, competition curves between N-(3H)methylscopolamine and various agonists, including oxotremorine, cis-dioxolane, and acetylethylcholine mustard, showed approximately equal numbers of guanine nucleotide-sensitive high affinity (H) sites and guanine nucleotide-insensitive low affinity (L) sites. This 50% H phenomenon persisted in different buffers, at different temperatures, after the number of receptors was halved (and, thus, the remaining receptor to guanine nucleotide-binding protein ratio was doubled), after membrane solubilization withmore » digitonin, and when rabbit cardiac membranes were used instead of rat brainstem membranes. Preferential occupation of H sites with acetylethylcholine mustard, and of L sites with quinuclidinyl benzilate or either mustard, yielded residual free receptor populations showing predominantly L and H sites, respectively. Low concentrations of (3H)-oxotremorine-M labeled only H sites, and the Bmax for these sites was 49% of the Bmax found with (3H)quinuclidinyl benzilate plus guanine nucleotide. These and other results are most consistent with the idea that H and L receptor sites exist on separate but dimeric receptor molecules and with the hypothesis that only the H receptors cycle between high and low affinity, depending upon interactions between this receptor molecule and a guanine nucleotide-binding protein.« less

  4. High-Affinity Low-Capacity and Low-Affinity High-Capacity N-Acetyl-2-Aminofluorene (AAF) Macromolecular Binding Sites Are Revealed During the Growth Cycle of Adult Rat Hepatocytes in Primary Culture.

    PubMed

    Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L

    2018-05-01

    Long-term cultures of primary adult rat hepatocytes were used to study the effects of N-acetyl-2-aminofluorene (AAF) on hepatocyte proliferation during the growth cycle; on the initiation of hepatocyte DNA synthesis in quiescent cultures; and, on hepatocyte DNA replication following the initiation of DNA synthesis. Scatchard analyses were used to identify the pharmacologic properties of radiolabeled AAF metabolite binding to hepatocyte macromolecules. Two classes of growth cycle-dependent AAF metabolite binding sites-a high-affinity low-capacity site (designated Site I) and a low-affinity high-capacity site (designated Site II)-associated with two spatially distinct classes of macromolecular targets, were revealed. Based upon radiolabeled AAF metabolite binding to purified hepatocyte genomic DNA or to DNA, RNA, proteins, and lipids from isolated nuclei, Site IDAY 4 targets (KD[APPARENT] ≈ 2-4×10-6 M and BMAX[APPARENT] ≈ 6 pmol/106 cells/24 h) were consistent with genomic DNA; and with AAF metabolized by a nuclear cytochrome P450. Based upon radiolabeled AAF binding to total cellular lysates, Site IIDAY 4 targets (KD[APPARENT] ≈ 1.5×10-3 M and BMAX[APPARENT] ≈ 350 pmol/106 cells/24 h) were consistent with cytoplasmic proteins; and with AAF metabolized by cytoplasmic cytochrome P450s. DNA synthesis was not inhibited by concentrations of AAF that saturated DNA binding in the neighborhood of the Site I KD. Instead, hepatocyte DNA synthesis inhibition required higher concentrations of AAF approaching the Site II KD. These observations raise the possibility that carcinogenic DNA adducts derived from AAF metabolites form below concentrations of AAF that inhibit replicative and repair DNA synthesis.

  5. Specific strychnine binding sites on acrosome-associated membranes of golden hamster spermatozoa.

    PubMed

    Llanos, Miguel N; Ronco, Ana M; Aguirre, María C

    2003-06-27

    This study demonstrates for the first time, that membrane vesicles originated from the hamster sperm head after the occurrence of the acrosome reaction, possess specific strychnine binding sites. [3H]Strychnine binding was saturable and reversible, being displaced by unlabeled strychnine (IC(50)=26.7+/-2.3 microM). Kinetic analysis revealed one binding site with K(d)=120nM and B(max)=142fmol/10(6) spermatozoa. Glycine receptor agonists beta-alanine and taurine inhibited strychnine binding by 20-30%. Surprisingly, glycine stimulated binding by about 40-50%. Results obtained in this study strongly suggest the presence of glycine receptors-with distinctive kinetic properties on the periacrosomal plasma membrane of hamster spermatozoa. Localization of this receptor fits well with its previously proposed role in acrosomal exocytosis during mammalian fertilization.

  6. Comparison of cannabinoid binding sites in guinea-pig forebrain and small intestine

    PubMed Central

    Ross, Ruth A; Brockie, Heather C; Fernando, Susanthi R; Saha, Bijali; Razdan, Raj K; Pertwee, Roger G

    1998-01-01

    We have investigated the nature of cannabinoid receptors in guinea-pig small intestine by establishing whether this tissue contains cannabinoid receptors with similar binding properties to those of brain CB1 receptors. The cannabinoids used were the CB1-selective antagonist SR141716A, the CB2-selective antagonist SR144528, the novel cannabinoid receptor ligand, 6′-azidohex-2′-yne-Δ8-tetrahydrocannabinol (O-1184), and the agonists CP55940, which binds equally well to CB1 and CB2 receptors, and WIN55212-2, which shows marginal CB2 selectivity.[3H]-CP55940 (1 nM) underwent extensive specific binding both to forebrain membranes (76.3%) and to membranes obtained by sucrose density gradient fractionation of homogenates of myenteric plexus-longitudinal muscle of guinea-pig small intestine (65.2%).Its binding capacity (Bmax) was higher in forebrain (4281 fmol mg−1) than in intestinal membranes (2092 fmol mg−1). However, the corresponding KD values were not significantly different from each other (2.29 and 1.75 nM respectively). Nor did the Ki values for its displacement by CP55940, WIN55212-2, O-1184, SR141716A and SR144528 from forebrain membranes (0.87, 4.15, 2.85, 5.32 and 371.9 respectively) differ significantly from the corresponding Ki values determined in experiments with intestinal membranes (0.99, 5.03, 3.16, 4.95 and 361.5 nM respectively).The Bmax values of [3H]-CP55940 and [3H]-SR141716A in forebrain membranes did not differ significantly from each other (4281 and 5658 fmol mg−1) but were both greater than the Bmax of [3H]-WIN55212-2 (2032 fmol mg−1).O-1184 (10 or 100 nM) produced parallel dextral shifts in the log concentration-response curves of WIN55212-2 and CP55940 for inhibition of electrically-evoked contractions of the myenteric plexus-longitudinal muscle preparation, its KD values being 0.20 nM (against WIN55212-2) and 0.89 nM (against CP55940).We conclude that cannabinoid binding sites in guinea-pig small intestine closely resemble CB1 binding sites of guinea-pig brain and that O-1184 behaves as a cannabinoid receptor antagonist in the guinea-pig myenteric plexus-longitudinal muscle preparation. PMID:9863666

  7. The sodium channel in membranes of electroplax. Binding of batrachotoxinin-a [(3)H]benzoate to particulate preparations from electric eel (electrophorus).

    PubMed

    McNeal, E T; Daly, J W

    1986-01-01

    Batrachotoxinin-A [(3)H]benzoate ([(3)H]BTX-B) binds specifically and with high affinity (K(D) 48 nM) to sites (B(max) 2.1 pmol/mg protein) associated with voltage-dependent sodium channels in rodent brain vesicular preparations. High affinity binding requires the presence of scorpion (Leiurus) venom and a membrane potential. Local anesthetics antagonize the binding. Nonspecific binding is defined in the presence of veratridine. In particulate preparations from electroplax of the eel Electrophorus electricus, [(3)H]BTX-B binds with a K(D) of about 140 nM and a B(max) of 2.5 pmol/mg protein in the presence of scorpion venom. Higher concentrations of scorpion venom are required to enhance binding in Electrophorus preparations than in brain preparations. Local anesthetics antagonize binding in Electrophorus preparations with potencies similar to those in brain preparations. Veratridine and batrachotoxin are less potent in blocking binding in Electrophorus than in brain preparations. It appears likely that binding in Electrophorus preparations is primarily to membrane fragments rather than vesicular entities as in brain. Binding of [(3)H]BTX-B to particulate preparations from electroplax of the ray Torpedo californica and the catfish Malapterurus electricus is mainly nonspecific. Scorpion venom does not enhance total binding and local anesthetics are not effective in antagonizing binding.

  8. Muscarinic and alpha 1-adrenergic receptor binding characteristics of saw palmetto extract in rat lower urinary tract.

    PubMed

    Suzuki, Mayumi; Oki, Tomomi; Sugiyama, Tomomi; Umegaki, Keizo; Uchida, Shinya; Yamada, Shizuo

    2007-06-01

    To elucidate the in vitro and ex vivo effects of saw palmetto extract (SPE) on autonomic receptors in the rat lower urinary tract. The in vitro binding affinities for alpha 1-adrenergic, muscarinic, and purinergic receptors in the rat prostate and bladder were measured by radioligand binding assays. Rats received vehicle or SPE (0.6 to 60 mg/kg/day) orally for 4 weeks, and alpha 1-adrenergic and muscarinic receptor binding in tissues of these rats were measured. Saw palmetto extract inhibited specific binding of [3H]prazosin and [N-methyl-3H]scopolamine methyl chloride (NMS) but not alpha, beta-methylene adenosine triphosphate [2,8-(3)H]tetrasodium salt in the rat prostate and bladder. The binding activity of SPE for muscarinic receptors was four times greater than that for alpha 1-adrenergic receptors. Scatchard analysis revealed that SPE significantly reduced the maximal number of binding sites (Bmax) for each radioligand in the prostate and bladder under in vitro condition. Repeated oral administration of SPE to rats brought about significant alteration in Bmax for prostatic [3H]prazosin binding and for bladder [3H]NMS binding. Such alteration by SPE was selective to the receptors in the lower urinary tract. Saw palmetto extract exerts significant binding activity on autonomic receptors in the lower urinary tract under in vitro and in vivo conditions.

  9. Identification and quantification of human kidney atrial natriuretic peptide receptors.

    PubMed

    Kahana, L; Yechiely, H; Mecz, Y; Lurie, A

    1995-04-01

    The present study determined 125I-label atrial natriuretic peptide (ANP) binding sites in human kidney glomerular and papillary membranes. The membranes were prepared from non-malignant renal tissue obtained at nephrectomy of patients with renal carcinoma. To evaluate the proportion of ANP receptor classes ANP-R1 (ANPR-A, -B) versus ANP-R2 (ANPR-C), competitive binding studies were performed using [125I]-ANP in the presence of increasing concentrations of ANP or an internally ring-deleted analog, des(Gln116, Ser117, Gly118, Leu119, Gly120)ANP(102-121), called C-ANP, which binds selectively to ANPR-C receptors. Analysis of the competitive binding curve with ANP in glomerular membranes suggested the presence of one group of high-affinity receptors with dissociation constant Kd = 26 +/- 12 pmol/l and density Bmax = 101 +/- 47 nmol/kg protein. A decrease of 10-30% in Bmax with no change in Kd was obtained in the presence of excess (10(-6) mol/l) C-ANP, suggesting the existence of a small amount of a second class of receptors, the ANPR-C class. The densities of ANPR-A, -B versus ANPR-C receptors in human glomeruli, calculated from competitive inhibition experiments, were 75 +/- 42 and 22 +/- 16 nmol/kg protein (N = 8). Autoradiography of the sodium dodecyl sulfate polyacrylamide gel electrophoresis under reducing conditions showed two bands: a highly labeled 130kD band and a weakly labeled 66 kD band, both displaced by ANP. Only the 66-kD band was displaced by the C-ANP analog. Human papilla membrane, as shown by competition binding studies and SDS gel electrophoresis, presented only one class of receptors with Kd = 40 +/- 23 pmol/l (mean +/- SD, N = 3) and Bmax = 17 +/- 6.3 nmol/kg protein.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Receptors for luteinizing hormone-releasing hormone (LHRH) in Dunning R3327 prostate cancers and rat anterior pituitaries after treatment with a sustained delivery system of LHRH antagonist SB-75.

    PubMed

    Srkalovic, G; Bokser, L; Radulovic, S; Korkut, E; Schally, A V

    1990-12-01

    Membrane receptors for LHRH were evaluated in Dunning R3327 prostate cancers and rat anterior pituitaries. The receptors were characterized both in untreated animals and after in vivo treatment with microcapsules of the agonist D-Trp6-LHRH and a sustained delivery system releasing different doses (23.8, 47.6, 71.4 micrograms/day) of LHRH antagonist [Ac-D-Nal(2)1-D-Phe(4Cl)2-D-Pal(3)3,D-Cit6, D-Ala10]-LHRH (SB-75). The therapy, which lasted 8 weeks, strongly inhibited tumor growth. A group of normal Sprague-Dawley male rats was also treated for 6 weeks with microcapsules of SB-75 releasing 25 micrograms/day. In the Dunning tumors from the control group, ligand [125I, D-Trp6]-LHRH was bound to two classes of binding sites [dissociation constant, class a (Kda) = 1.01 +/- 0.30 x 10(-9) M; Kdb = 1.71 +/- 0.41 x 10(-6) M; maximal binding capacity of receptors, class a (Bmaxa) = 48.66 +/- 22.13 fmol/mg of protein; Bmaxb = 92.10 +/- 29.40 pmol/mg of protein] in both kinetic and equilibrium studies. Treatment with D-Trp6-LHRH produced down-regulation of membrane receptors for LHRH in Dunning tumors. Microcapsules of SB-75 resulted in dose-dependent up-regulation of binding sites for LHRH in Dunning tumors. Analysis of the binding data showed that interaction of labeled D-Trp6-LHRH with binding sites in anterior pituitaries was consistent with the presence of a single class of noncooperative receptors (Kd = 43.75 x 10(-9) M; Bmax = 5.25 pmol/mg membrane proteins). Prolonged treatment with microcapsules of D-Trp6-LHRH reduced both Bmax and Kd. Lower doses of SB-75 (23.8 and 47.6 micrograms/day) produced up-regulation, whereas the highest dose (71.4 micrograms/day) resulted in down-regulation of binding sites for LHRH in rat pituitaries. In normal Sprague-Dawley rats, treatment with microcapsules of SB-75 (25 micrograms/day) for 6 weeks produced a slight increase in the number of available binding sites (Bmax = 2.35 +/- 0.82 pmol/mg membrane protein) and a moderate decrease in affinity (Kd = 35.10 +/- 15.19 x 10(-9) M) of pituitary membrane receptors for LHRH. The findings provide additional support for the view that LHRH analogs exert direct effects on tumor cells. Our findings indicate that prolonged treatment with high doses of modern LHRH antagonists produces down-regulation of pituitary receptors. Our work in tumors also implies that some differences may exist between LHRH receptors, even in the same tissue, leading to the concept of subclassification of LHRH receptors.

  11. Evidence for a single class of somatostatin receptors in ground squirrel cerebral cortex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krantic, S.; Petrovic, V.M.; Quirion, R.

    1989-01-01

    In the present study we characterized high-affinity somatostatin (SRIF) binding sites (Kd = 2.06 +/- 0.32 nM and Bmax = 295 +/- 28 fmol/mg protein) in cerebral cortex membrane preparations of European ground squirrel using /sup 125/I-(Tyr0-D-Trp8)-SRIF14 as a radioligand. The inhibition of radioligand specific binding by SRIF14, as well as by its agonists (SRIF28, Tyr0-D-Trp8-SRIF14, SMS 201 995) was complete and monophasic, thus revealing a single population of somatostatinergic binding sites. Radioautographic analysis of /sup 125/I-(Tyr0-D-Trp8)-SRIF14 labeled brain sections confirmed the results of our biochemical study. The homogeneity of SRIF binding sites in the ground squirrel neocortex was notmore » dependent on the animal's life-cycle phase.« less

  12. Distribution and properties of GABA(B) antagonist [3H]CGP 62349 binding in the rhesus monkey thalamus and basal ganglia and the influence of lesions in the reticular thalamic nucleus.

    PubMed

    Ambardekar, A V; Ilinsky, I A; Forestl, W; Bowery, N G; Kultas-Ilinsky, K

    1999-01-01

    GABA(B) receptors are believed to be associated with the efferents of the nucleus reticularis thalami, which is implicated in the regulation of activity in the thalamocortical-corticothalamic circuit and plays a role in absence seizures. Yet, the distribution of GABA(B) receptors in the thalamus has only been studied in the rat, and there is no comparable information in primates. The potent GABA(B) receptor antagonist [3H]CGP 62349 was used to study the distribution and binding properties of the receptor in control monkeys and those with small ibotenic acid lesions in the anterodorsal segment of the nucleus reticularis thalami. Eight-micrometer-thick cryostat sections of the fresh frozen brains were incubated in the presence of varying concentrations of the ligand. Autoradiographs were analysed using a quantitative image analysis technique, and binding parameters were calculated for select thalamic nuclei as well as basal ganglia structures present in the same sections. The overall number of GABA(B) binding sites in the monkey thalamus and basal ganglia was several-fold higher than previously reported values for the rat. In the thalamus, the receptors were distributed rather uniformly and the binding densities and affinities were high (Bmax range of 245.5-437.9 fmol/ mg of tissue, Kd range of 0.136-0.604 nM). In the basal ganglia, the number of binding sites and the affinities were lower (Bmax range of 51.1-244.2 fmol/mg of tissue; K(d) range of 0.416-1.394 nM), and the differences between nuclei were more pronounced, with striatum and substantia nigra pars compacta displaying the highest binding densities. Seven days post-lesion, a 20-30% decrease in Bmax values (P < 0.05) was found in the nuclei receiving input from the lesioned nucleus reticularis thalami sector (the mediodorsal nucleus and densicellular and magnocellular parts of the ventral anterior nucleus) without changes in affinity. No significant changes were detected in any other structures. The results of the lesioning experiments suggest that a portion of thalamic GABA(B) receptors is in a presynaptic location on the nucleus reticularis thalami efferents. The overall distribution pattern in the thalamus also suggests a partial association of GABA(B) receptors with corticothalamic terminals presynaptically.

  13. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  14. 3H[2-(2-benzofuranyl)-2-imidazoline] (BFI) binding in human platelets: modulation by tranylcypromine.

    PubMed

    Wiest, S A; Steinberg, M I

    1999-08-01

    2-(2-Benzofuranyl)-2-imidazoline (BFI) is a highly selective ligand for imidazoline-type 2 (I2) binding sites that are known to be associated with monoamine oxidase (MAO). Recently we demonstrated a potentiation of 3H-BFI binding in human but not in rat brain by the nonselective MAO inhibitor tranylcypromine. In the present studies, we evaluated the effect of tranylcypromine on the binding of 3H-BFI to human platelet inner membranes. Membranes were incubated with 3H-BFI at 22 degrees C in 50 mM Tris, 1.5 mM EDTA, pH 7.5. Saturation experiments with 3H-BFI (0.5-80 nM) were analyzed using non-linear curve fitting. Addition of tranylcypromine (0.1 mM) increased the number of 3H-BFI binding sites (Bmax=0.35+/-0.06 vs. 1.87+/-0.15 pmol/mg protein for vehicle and tranylcypromine, respectively) and increased 3H-BFI affinity slightly (KD =16.0+/-4.1 vs. 6.5+/-0.3 nM for vehicle and tranylcypromine, respectively). In competitive binding experiments using the less selective I2 ligand, 3H-idazoxan, tranylcypromine only weakly inhibited binding. Preincubation of platelet membranes with tranylcypromine (1 nM-10 microM) enhanced the Bmax of 3H-BFI binding in a concentration-dependent manner peaking at 1 microM (13 x control) and returning to near baseline at 100 microM. 3H-BFI binding was displaced monophasically (in order of decreasing potency) by BFI > or = 2-(4,5-dihydroimidazol-2-yl)quinoline (BU224) > or = cirazoline >idazoxan >(1,4-benzodioxan-2-methoxy-2-yl)-2-imidazoline (RX821002)= moxonidine. Amiloride, clorgyline, guanabenz and clonidine displayed biphasic curves with nanomolar high affinity components. Tranylcypromine altered the competition curves for all ligands (except BFI) by increasing the affinities for clonidine and RX821002 and decreasing affinities for BU224, cirazoline, guanabenz, idazoxan, clorgyline, moxonidine, and amiloride. Thus, in human platelets tranylcypromine exposes a high capacity 3H-BFI binding site distinct from previously described I2 sites that retains high affintiy for BFI but not other I2 ligands. Our results suggest that 3H-BFI and 3H-idazoxan may not be considered as interchangeable probes for the I2 binding site.

  15. Synaptosomal binding of 125I-labelled daboiatoxin, a new PLA2 neurotoxin from the venom of Daboia russelli siamensis.

    PubMed

    Maung-Maung-Thwin; Gopalakrishnakone, P; Yuen, R; Tan, C H

    1996-02-01

    Daboiatoxin (DbTx), the PLA2 neurotoxin from Daboia russelli siamensis venom, was shown to bind specifically and saturably to rat cerebrocortical synaptosomes and synaptic membrane fragments. Two families of binding sites were detected by equilibrium binding analysis in the presence and absence of Ca2+. Scatchard analysis of biphasic plateaus revealed Kdl 5 nM and Bmax1, 6 pmoles/mg protein, and Kd2 80 nM and Bmax2 20 pmoles/mg protein, respectively, for the high- and low-affinity binding sites. The binding of 125I-DbTx to synaptosomes did not show marked dependence on Ca2+, Mg2+, Co2+ and Sr2+. Native DbTx was the only strong competitor to 125I-DbTx synaptosomal binding (IC50 12.5 nM, KI 5.5 nM). Two other crotalid PLA2 neurotoxins, crotoxin CB and mojave toxin basic subunit, and nontoxic C. Atrox PLA2 enzyme, were relatively weaker inhibitors, while two viperid PLA2 neurotoxins, ammodytoxin A and VRV PL V, were very weak inhibitors. Crotoxin CA was a poor inhibitor even at microM concentrations, whereas no inhibitory effect at all was observed with crotoxin CACB, ammodytoxin C, VRV PL VIIIa, taipoxin, beta-bungarotoxin, or with PLA2 enzymes from N. naja venom, E. schistosa venom, bee venom and porcine pancreas. All other pharmacologically active ligands examined (epinephrine, norepinephrine, histamine, choline, dopamine, serotonin, GABA, naloxone, WB-4101, atropine, hexamethonium and alpha-bun-garotoxin) also failed to interfere with 125I-DbTx binding. As those competitors that showed partial inhibition were effective only at microM concentration range compared to the Kd (5 nM) of 125I-DbTx synaptosomal binding, DbTx could well recognize a different neuronal binding site. Rabbit anti-DbTx polyclonal antisera completely blocked the specific binding. When a range of Ca2+ and K+ channels modulators were examined, Ca2+ channel blockers (omega-conotoxins GVIA and MVIIC, taicatoxin, calciseptine and nitrendiprene) did not affect the binding even at high concentrations, while charybdotoxin was the only K+ channel effector that could partially displace 125I-DbTx synaptosomal binding amongst the K+ channel blockers tested (apamin, dendrotoxin-I, iberiotoxin, MCD-peptide, 4-aminopyridine and tetraethylammonium), suggesting that neither K+ nor Ca2+ channels are associated with DbTx binding sites.

  16. Peripheral benzodiazepine receptors are decreased during cocaine withdrawal in humans.

    PubMed

    Javaid, J I; Notorangelo, M P; Pandey, S C; Reddy, P L; Pandey, G N; Davis, J M

    1994-07-01

    In the present study, homovanillic acid in plasma (pHVA) and benzodiazepine receptors (3H-PK11195 binding) in neutrophil membranes were determined in blood obtained from cocaine-dependent (DSM-III-R) adult male inpatients at baseline-(within 72 hr of last cocaine use) and after 3 weeks of cocaine abstinence, and normal controls. The mean (+/- SEM) pHVA at baseline (10.3 ng/ml +/- 1.1) was similar to normals and did not change after 3 weeks of cocaine abstinence. Similarly, the binding indices of benzodiazepine receptors in cocaine-dependent subjects as a group were not significantly different than in normal controls. In 10 cocaine-dependent subjects, however, where both blood samples were available, the number of 3H-PK11195 binding sites was significantly (p < 0.05) decreased after 3 weeks of cocaine abstinence (mean +/- sem: Bmax = 6371 +/- 657 fmol/mg protein) compared with baseline (Bmax = 7553 +/- 925 fmol/mg protein), although there were no differences in the binding affinity (mean +/- sem: KD = 8.6 +/- 1.2 nmol/L after 3 weeks of abstinence compared with 8.1 +/- 1.0 nmol/L at baseline). These preliminary results suggest that peripheral benzodiazepine receptors may play an important role in the pathophysiology of cocaine withdrawal in cocaine-dependent human subjects.

  17. The presence of high-affinity, low-capacity estradiol-17β binding in rainbow trout scale indicates a possible endocrine route for the regulation of scale resorption

    USGS Publications Warehouse

    Persson, Petra; Shrimpton, J.M.; McCormick, S.D.; Bjornsson, Bjorn Thrandur

    2000-01-01

    High-affinity, low-capacity estradiol-17β (E2) binding is present in rainbow trout scale. The Kd and Bmax of the scale E2 binding are similar to those of the liver E2 receptor (Kd is 1.6 ± 0.1 and 1.4 ± 0.1 nM, and Bmax is 9.1 ± 1.2 and 23.1 ± 2.2 fmol x mg protein-1, for scale and liver, respectively), but different from those of the high-affinity, low-capacity E2 binding in plasma (Kd is 4.0 ± 0.4 nM and Bmax is 625.4 ± 63.1 fmol x mg protein-1). The E2 binding in scale was displaced by testosterone, but not by diethylstilbestrol. Hence, the ligand binding specificity is different from that of the previously characterized liver E2 receptor, where E2 is displaced by diethylstilbestrol, but not by testosterone. The putative scale E2 receptor thus appears to bind both E2 and testosterone, and it is proposed that the increased scale resorption observed during sexual maturation in both sexes of several salmonid species may be mediated by this receptor. No high-affinity, low-capacity E2 binding could be detected in rainbow trout gill or skin.

  18. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  19. Pharmacological analysis of [3H]-senktide binding to NK3 tachykinin receptors in guinea-pig ileum longitudinal muscle-myenteric plexus and cerebral cortex membranes.

    PubMed Central

    Guard, S.; Watson, S. P.; Maggio, J. E.; Too, H. P.; Watling, K. J.

    1990-01-01

    1. The binding properties and pharmacological specificity of the selective NK3 tachykinin receptor agonist [3H))-senktide [( 3H]-succinyl[Asp6,MePhe8] substance P (6-11] have been examined in homogenates of guinea-pig ileum longitudinal muscle-myenteric plexus (LM/MP) and cerebral cortex. 2. Scatchard analysis of saturation binding studies in guinea-pig ileum LM/MP and cerebral cortex membranes indicated that [3H]-senktide bound to a single site with apparent high affinity, KD = 2.21 +/- 0.65 nM; Bmax = 13.49 +/- 0.04 fmol mg-1 protein in ileum and KD = 8.52 +/- 0.45 nM; Bmax = 76.3 +/- 1.6 fmol mg-1 protein in cortex (values are means +/- ranges; n = 2). 3. The pharmacological profile for tachykinins and analogues in displacing [3H]-senktide from ileum membranes was: [MePhe7] neurokinin B greater than neurokinin B (NKB) congruent to senktide greater than eledoisin greater than substance P (SP) greater than neurokinin A(NKA) greater than physalaemin greater than [Sar9,Met(O2)11]SP greater than [Nle10]NKA(4-10) = [Glp6,L-Pro9]-SP(6-11) greater than substance P methyl ester, consistent with [3H]-senktide binding to an NK3 subtype of tachykinin receptor. A similar rank order of affinity was obtained for these peptides in displacing [3H]-senktide from cortex membranes. 4. Several tachykinin receptor agonists were tested for their ability to displace [3H]-senktide from ileal and cortical NK3 binding sites and were found to be either weak displacers (pIC50 less than 5.00) or inactive.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1694464

  20. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  1. Low density and high affinity of platelet [3H]paroxetine binding in women with bulimia nervosa.

    PubMed

    Ekman, Agneta; Sundblad-Elverfors, Charlotta; Landén, Mikael; Eriksson, Tomas; Eriksson, Elias

    2006-06-15

    Impaired serotonin transmission has been suggested to be implicated in the pathophysiology of bulimia nervosa. As an indirect measure of brain serotonergic activity, the binding of tritiated ligands to platelet serotonin transporters has been studied in bulimia nervosa as well as in other putatively serotonin-related psychiatric disorders. In this study, the density and affinity of platelet serotonin transporters were assessed in 20 women meeting the DSM-IV criteria for bulimia nervosa and in 14 controls without previous or ongoing eating disorder using [(3)H]paroxetine as a ligand. In comparison to controls, women with bulimia nervosa had a significantly reduced number of platelet binding sites (B(max) = 721 +/- 313 vs. 1145 +/- 293 fmol/mg protein) and an increase in the affinity for the ligand demonstrated by a lower dissociaton constant (K(d) = 33 +/- 10 vs. 44 +/- 10 pM). A significant correlation between B(max) and K(d) values was found in patients but not in controls. Our results support the notion that bulimia nervosa is associated with a reduction in platelet serotonin transporter density. In addition, our study is the first to report that this reduced transporter density in women with bulimia nervosa is accompanied by an increase in the affinity of the transporter for the ligand.

  2. The presence of high-affinity, low-capacity estradiol-17β binding in rainbow trout scale indicates a possible endocrine route for the regulation of scale resorption

    USGS Publications Warehouse

    Persson, Petra; Shrimpton, J. Mark; McCormick, Stephen D.; Bjornsson, Bjorn Thrandur

    2000-01-01

    High-affinity, low-capacity estradiol-17β (E2) binding is present in rainbow trout scale. The Kd and Bmax of the scale E2 binding are similar to those of the liver E2 receptor (Kd is 1.6 ± 0.1 and 1.4 ± 0.1 nM, and Bmax is 9.1 ± 1.2 and 23.1 ± 2.2 fmol × mg protein-1, for scale and liver, respectively), but different from those of the high-affinity, low-capacity E2 binding in plasma (Kd is 4.0 ± 0.4 nM and Bmax is 625.4 ± 63.1 fmol × mg protein−1). The E2 binding in scale was displaced by testosterone, but not by diethylstilbestrol. Hence, the ligand binding specificity is different from that of the previously characterized liver E2 receptor, where E2 is displaced by diethylstilbestrol, but not by testosterone. The putative scale E2 receptor thus appears to bind both E2 and testosterone, and it is proposed that the increased scale resorption observed during sexual maturation in both sexes of several salmonid species may be mediated by this receptor. No high-affinity, low-capacity E2 binding could be detected in rainbow trout gill or skin.

  3. Evidence that the atypical 5-HT3 receptor ligand, [3H]-BRL46470, labels additional 5-HT3 binding sites compared to [3H]-granisetron.

    PubMed Central

    Steward, L. J.; Ge, J.; Bentley, K. R.; Barber, P. C.; Hope, A. G.; Lambert, J. J.; Peters, J. A.; Blackburn, T. P.; Barnes, N. M.

    1995-01-01

    1. The radioligand binding characteristics of the 3H-derivative of the novel 5-HT3 receptor antagonist BRL46470 were investigated and directly compared to the well characterized 5-HT3 receptor radioligand [3H]-granisetron, in tissue homogenates prepared from rat cerebral cortex/hippocampus, rat ileum, NG108-15 cells, HEK-5-HT3As cells and human putamen. 2. In rat cerebral cortex/hippocampus, rat ileum, NG108-15 cell and HEK-5-HT3As cell homogenates, [3H]-BRL46470 bound with high affinity (Kd (nM): 1.57 +/- 0.18, 2.49 +/- 0.30, 1.84 +/- 0.27, 3.46 +/- 0.36, respectively; mean +/- s.e. mean, n = 3-4) to an apparently homogeneous saturable population of sites (Bmax (fmol mg-1 protein): 102 +/- 16, 44 +/- 4, 968 +/- 32 and 2055 +/- 105, respectively; mean +/- s.e. mean, n = 3-4) but failed to display specific binding in human putamen homogenates. 3. In the same homogenates of rat cerebral cortex/hippocampus, rat ileum, NG108-15 cells, HEK-5-HT3As cells and human putamen as used for the [3H]-BRL46470 studies, [3H]-granisetron also bound with high affinity (Kd (nM): 1.55 +/- 0.61, 2.31 +/- 0.44, 1.89 +/- 0.36, 2.03 +/- 0.42 and 6.46 +/- 2.58 respectively; mean +/- s.e. mean, n = 3-4) to an apparently homogeneous saturable population of sites (Bmax (fmol mg-1 protein): 39 +/- 4, 20 +/- 2, 521 +/- 47, 870 +/- 69 and 18 +/- 2, respectively; mean +/- s.e. mean, n = 3-4).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8528560

  4. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Reid, A.; Mahboubi, A.

    1991-02-01

    Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

  6. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  7. Specific binding of (/sup 3/H-Tyr8)physalaemin to rat submaxillary gland substance P receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bahouth, S.W.; Lazaro, D.M.; Brundish, D.E.

    1985-01-01

    (/sup 3/H)Physalaemin ((/sup 3/H)PHY) binds to a single class of noninteracting sites on rat submaxillary gland membranes suspended in high ionic strength media with a KD of 2.7 nM, a Bmax of 240 fmol/mg of protein, and low nonspecific binding. The relative potencies of substance P (SP) and its fragments in competing with (/sup 3/H)PHY correlate with their relative salivation potencies. This indicates that (/sup 3/H)PHY interacts with a physiologically relevant SP receptor. In low ionic strength media, the KD of (/sup 3/H)PHY does not change, but SP and some of its fragments are more potent than PHY in competingmore » with (/sup 3/H) PHY. Computer-assisted analysis of (/sup 3/H)PHY and (/sup 3/H)SP binding in high and low ionic strength media demonstrated that both peptides are equipotent in high ionic strength but that the affinity of SP increases by 70-fold in low ionic strength. The SP fragments that contain a basic residue in positions 1 and/or 3 also display an increased affinity in low ionic strength. These findings document that (/sup 3/H)PHY binding in high ionic strength (mu . 0.6) accurately reflects the pharmacological potencies of agonists on the SP-P receptor. The binding of (/sup 3/H)PHY, like that of (/sup 3/H)SP, increases by the addition of divalent cations (Mg2+ greater than Ca2+ greater than Mn2+). Guanine nucleotides decrease (/sup 3/H)PHY binding by decreasing the Bmax to the same level (160 fmol/mg of protein), in the presence or absence of Mg2+.« less

  8. Picomolar-affinity binding and inhibition of adenylate cyclase activity by melatonin in Syrian hamster hypothalamus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niles, L.P.; Hashemi, F.

    1. The effect of melatonin on forskolin-stimulated adenylate cyclase activity was measured in homogenates of Syrian hamster hypothalamus. In addition, the saturation binding characteristics of the melatonin receptor ligand, ({sup 125}I)iodomelatonin, was examined using an incubation temperature (30{degree}C) similar to that used in enzyme assays. 2. At concentrations ranging from 10 pM to 1 nM, melatonin caused a significant decrease in stimulated adenylate cyclase activity with a maximum inhibition of approximately 22%. 3. Binding experiments utilizing ({sup 125}I)iodomelatonin in a range of approximately 5-80 pM indicated a single class of high-affinity sites: Kd = 55 +/- 9 pM, Bmax =more » 1.1 +/- 0.3 fmol/mg protein. 4. The ability of picomolar concentrations of melatonin to inhibit forskolin-stimulated adenylate cyclase activity suggests that this affect is mediated by picomolar-affinity receptor binding sites for this hormone in the hypothalamus.« less

  9. External location of sites on pig erythrocyte membranes that bind nitrobenzylthioinosine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Agbanyo, F.R.; Cass, C.E.; Paterson, A.R.

    1988-03-01

    Nucleoside transport in erythrocytes of various species is inhibited by the binding of nitrobenzylthioinosine (NBMPR) to high affinity sites associated with nucleoside transport elements of the plasma membrane. The present study examined binding of (/sup 3/H)NBMPR to unsealed ghosts and to sealed right-side-out vesicles (ROVs) and inside-out vesicles (IOVs) prepared from pig erythrocytes. Kd values for NBMPR dissociation from the ligand-site complex in unsealed ghosts, ROVs and IOVs were similar (1.6-2.4 nM), and Bmax values (mean +/- SD) were, respectively, 22.2 +/- 5.5, 25.8 +/- 6.4, and 37.3 +/- 4.0 molecules/fg of protein, reflecting differences in the protein content ofmore » the membrane preparations. When temperatures were decreased from 22 degrees to 4 degrees, NBMPR binding to erythrocyte membrane preparations was reduced in IOVs relative to that in unsealed ghosts and ROVs. At 22 degrees, the association of NBMPR molecules with IOVs was slower than with ROVs and unsealed ghosts, differences that were virtually eliminated by permeabilization of the membrane preparations with saponin. Thus, the binding sites were more accessible to external NBMPR in sealed ROVs and unsealed ghosts than in sealed IOVs, indicating that the NBMPR sites are located on the extracellular aspect of the membrane.« less

  10. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  11. Binding of /sup 3/H-acetylcholine to cholinergic receptors in bovine cerebral arteries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shimohama, S.; Tsukahara, T.; Taniguchi, T.

    Cholinergic receptor sites in bovine cerebral arteries were analyzed using radioligand binding techniques with the cholinergic agonist, /sup 3/H-acetylcholine (ACh), as the ligand. Specific binding of /sup 3/H-ACh to membrane preparations of bovine cerebral arteries was saturable, of two binding sites, with dissociation constant (K/sub D/) values of 0.32 and 23.7 nM, and maximum binding capacity (Bmax) values of 67 and 252 fmol/mg protein, respectively. Specific binding of /sup 3/H-ACh was displaced effectively by muscarinic cholinergic agents and less effectively by nicotinic cholinergic agents. IC/sub 50/ values of cholinergic drugs for /sup 3/H-ACh binding were as follows: atropine, 38.5 nM;more » ACh, 59.8 nM; oxotremorine, 293 nM; scopolamine 474 nM; carbamylcholine, 990 nM. IC/sub 50/ values of nicotinic cholinergic agents such as nicotine, cytisine and ..cap alpha..-bungarotoxin exceeded 50 ..mu..M. Choline acetyltransferase activity was 1.09 nmol/mg protein/hour in the cerebral arteries. These findings suggest that the cholinergic nerves innervate the bovine cerebral arteries and that there are at least two classes of ACh binding sites of different affinities on muscarinic reporters in these arteries. 18 references, 2 figures, 2 tables.« less

  12. ARSENITE BINDING TO SUBSETS OF THE HUMAN ESTROGEN RECEPTOR-ALPHA

    EPA Science Inventory

    Enzyme inhibition by arsenicals has been described many times, but the underlying binding of trivalent arsenicals to peptides and proteins has received little attention. The purpose of this study was to determine Kd and Bmax values for arsenite binding to nine synthetic peptides ...

  13. Photoaffinity labelling of the cardiac calcium channel. (-)-[3H]azidopine labels a 165 kDa polypeptide, and evidence against a [3H]-1,4-dihydropyridine-isothiocyanate being a calcium-channel-specific affinity ligand.

    PubMed

    Ferry, D R; Goll, A; Glossmann, H

    1987-04-01

    The arylazide 1,4-dihydropyridine (-)-[3H]azidopine binds to a saturable population of sites in guinea-pig heart membranes with a dissociation constant (KD) of 30 +/- 7 pM and a density (Bmax.) of 670 +/- 97 fmol/mg of protein. This high-affinity binding site is assumed to reside on voltage-operated calcium channels because reversible binding is blocked stereoselectively by 1,4-dihydropyridine channel blockers and by the enantiomers of Bay K 8644. A low-affinity (KD 25 +/- 7 nM) high-capacity (Bmax. 21.6 +/- 9 pmol/mg of protein) site does not bind (-)- or (+)-Bay K 8644, but is blocked by high concentrations (greater than 500 nM) of dihydro-2,6-dimethyl-4-(2-isothiocyanatophenyl)-3,5-pyridinedicarboxy lic acid dimethyl ester (1,4-DHP-isothiocyanate) or, e.g., (+/-)-nicardipine. (-)-[3H]Azidopine was photoincorporated covalently into bands of 165 +/- 8, 39 +/- 2 and 35 +/- 3 kDa, as determined by SDS/polyacrylamide-gel electrophoresis. Labelling of the 165 kDa band is protected stereoselectively by 1,4-dihydropyridine enantiomers at low (nM) concentrations and by (-)- and (+)-Bay K 8644, whereas the lower-Mr bands are not. Thus, only the 165 kDa band is the calcium-channel-linked 1,4-dihydropyridine receptor. Photolabelling of the 39 or 35 kDa bands was only blocked by 10 microM-1,4-DHP-isothiocyanate or 50 microM-(+/-)-nicardipine but not by 10 microM-(-)-Bay K 8644. [3H]-1,4-DHP-isothiocyanate binds to guinea-pig heart membranes with a KD of 0.35 nM and dissociates with a k-1 of 0.2 min-1 at 30 degrees C. [3H]-1,4 DHP-isothiocyanate irreversibly labels bands of 39 and 35 kDa which are protected by greater than 10 microM-(+/-)-nicardipine or unlabelled ligand but not by 10 microM-(-)-Bay K 8644. Thus, [3H]-1,4-DHP-isothiocyanate is not an affinity probe for the calcium channel.

  14. Characterization of angiotensin-binding sites in the bovine adrenal and the rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rogulja, I.

    1989-01-01

    The first study was designed to determine whether systemically administered MSG affects neurons in the CVOs that are potentially important in mediating angiotensin-dependent responses. Rats were pretreated with MSG and the receptors for angiotensin II were assayed by radioligand binding in brain homogenates from the septum anteroventral third ventricular region (AV3V) and the thalamus/hypothalamus region using {sup 125}I-angiotensin II as the radioligand. The results of this experiment indicate that systematically administered MSG in the rat significantly reduced the number (Bmax) of Ang II receptors in a tissue sample which contained both extra blood-brain barrier organs as well as tissue withinmore » the blood-brain barrier with no change in the affinity (Kd) of the binding sites. The second chapter reports the successful solubilization of bovine adrenal {sup 125}I Ang II and {sup 125}I Sar{sup 1},Ile{sup 8}-Ang II binding sites with the detergent CHAPS. The results of our studies indicate the presence of two angiotensin binding sites. The one site is specific for naturally occurring angiotensins as well as sarcosine-1 substituted angiotensin analogues. The other site which can be optimally stabilized be re-addition of 0.3% CHAPS into the incubation assay binds sarcosine-1 substituted angiotensins exclusively. Hydrophobic interaction chromatography experiments suggest that these sites, possibly, represent distinct proteins. The third chapter discusses the successful solubilization and partial characterization of the rat brain angiotensin receptor.« less

  15. Characterization of the increased binding of acetaldehyde to red blood cells in alcoholics.

    PubMed

    Hernández-Muñoz, R; Baraona, E; Blacksberg, I; Lieber, C S

    1989-10-01

    Using equilibrium dialysis, we found that acetaldehyde, at the levels commonly occurring after ethanol ingestion, did not bind detectably to plasma proteins, but there was significant binding to red blood cells, more in alcoholics than in nonalcoholics. The binding to red blood cells was inhibited by pyridoxal phosphate and N-ethylmaleimide, suggesting adduction to amino and thiol groups. Binding kinetics were consistent with at least two sites. The one with the highest affinity for acetaldehyde corresponded to hemoglobin. Its affinity and Bmax were not changed in alcoholics, but these binding sites accounted for only 44% of the sites available in the red blood cells of alcoholics and 80% of those in controls. Moreover, this binding was not inhibited by N-ethylmaleimide. There was no detectable binding to red cell ghosts. Nonprotein binding was then assessed by changes in NADH produced by the addition of protein-free fractions of the cells to an alcohol dehydrogenase system in equilibrium; this revealed a second binder of lower affinity, larger capacity and with sensitivity to both inhibitors. This binding (possibly due to thiazolidine formation with cysteine) was enhanced in alcoholics, whose red blood cell cysteine content was doubled. Levels of red blood cell cysteine and acetaldehyde remained high for 2 weeks after withdrawal. Because of the prolonged persistence after withdrawal, these changes may provide new markers of alcoholism.

  16. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  17. Expression of melatonin receptors in arteries involved in thermoregulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Viswanathan, M.; Laitinen, J.T.; Saavedra, J.M.

    Melatonin binding sites were localized and characterized in the vasculature of the rat by using the melatonin analogue 2-(125I)iodomelatonin (125I-melatonin) and quantitative in vitro autoradiography. The expression of these sites was restricted to the caudal artery and to the arteries that form the circle of Willis at the base of the brain. The arterial 125I-melatonin binding was stable, saturable, and reversible. Saturation studies revealed that the binding represented a single class of high-affinity binding sites with a dissociation constant (Kd) of 3.4 x 10(-11) M in the anterior cerebral artery and 1.05 x 10(-10) M in the caudal artery. Themore » binding capacities (Bmax) in these arteries were 19 and 15 fmol/mg of protein, respectively. The relative order of potency of indoles for inhibition of 125I-melatonin binding at these sites was typical of a melatonin receptor: 2-iodomelatonin greater than melatonin greater than N-acetylserotonin much much greater than 5-hydroxytryptamine. Norepinephrine-induced contraction of the caudal artery in vitro was significantly prolonged and potentiated by melatonin in a concentration-dependent manner, suggesting that these arterial binding sites are functional melatonin receptors. Neither primary steps in smooth muscle contraction (inositol phospholipid hydrolysis) nor relaxation (adenylate cyclase activation) were affected by melatonin. Melatonin, through its action on the tone of these arteries, may cause circulatory adjustments in these arteries, which are believed to be involved in thermoregulation.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  19. Use of 2-(/sup 125/I)iodomelatonin to characterize melatonin binding sites in chicken retina

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dubocovich, M.L.; Takahashi, J.S.

    2-(/sup 125/I)Iodomelatonin binds with high affinity to a site possessing the pharmacological characteristics of a melatonin receptor in chicken retinal membranes. The specific binding of 2-(/sup 125/I)iodomelatonin is stable, saturable, and reversible. Saturation experiments indicated that 2-(/sup 125/I)iodomelatonin labeled a single class of sites with an affinity constant (Kd) of 434 +/- 56 pM and a total number of binding sites (Bmax) of 74.0 +/- 13.6 fmol/mg of protein. The affinity constant obtained from kinetic analysis was in close agreement with that obtained in saturation experiments. Competition experiments showed a monophasic reduction of 2-(/sup 125/I)iodomelatonin binding with a pharmacological ordermore » of indole amine affinities characteristic of a melatonin receptor: 2-iodomelatonin greater than 6-chloromelatonin greater than or equal to melatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 6-hydroxymelatonin greater than or equal to 6-methoxymelatonin much greater than N-acetyltryptamine greater than N-acetyl-5-hydroxytryptamine greater than 5-methoxytryptamine greater than 5-hydroxytryptamine (inactive). The affinities of these melatonin analogs in competing for 2-(/sup 125/I)iodomelatonin binding sites were correlated closely with their potencies for inhibition of the calcium-dependent release of (3H)dopamine from chicken and rabbit retinas, indicating association of the binding site with a functional response regulated by melatonin. The results indicate that 2-(/sup 125/I)iodomelatonin is a selective, high-affinity radioligand for the identification and characterization of melatonin receptor sites.« less

  20. Ex vivo evaluation of the serotonin 1A receptor partial agonist [³H]CUMI-101 in awake rats.

    PubMed

    Palner, Mikael; Underwood, Mark D; Kumar, Dileep J S; Arango, Victoria; Knudsen, Gitte M; John Mann, J; Parsey, Ramin V

    2011-08-01

    [³H]CUMI-101 is a 5-HT(1A) partial agonist, which has been evaluated for use as a positron emission tracer in baboon and humans. We sought to evaluate the properties of [³H]CUMI-101 ex vivo in awake rats and determine if [³H]CUMI-101 can measure changes in synaptic levels of serotonin after different challenge paradigms. [³H]CUMI-101 shows good uptake and good specific binding ratio (SBR) in frontal cortex 5.18 and in hippocampus 3.18. Binding was inhibited in a one-binding-site fashion by WAY100635 and unlabeled CUMI-101. The ex vivo B(max) of [³H]CUMI-101 in frontal cortex (98.7 fmol/mg) and hippocampus (131 fmol/kg) agree with the ex vivo B(max) of [³H]MPPF in frontal cortex (147.1 fmol/mg) and hippocampus (72.1 fmol/mg) and with in vitro values reported with 8-OH-DPAT. Challenges with citalopram, a selective serotonin reuptake inhibitor, fenfluramine, a serotonin releaser, and 4-chloro-DL-phenylalanine, a serotonin synthesis inhibitor, did not show any effect on the standardized uptake values (SUVs) in any region. Citalopram did alter SBR, but this was due to changes in cerebellar SUVs. Our results indicate that [³H]CUMI-101 is a good radioligand for imaging 5-HT(1A) high-density regions in rats; however, the results from pharmacological challenges remain inconclusive. Copyright © 2011 Wiley-Liss, Inc.

  1. [(3)H]8-Ethyl-4-methyl-2-phenyl-(8R)-4,5,7,8-tetrahydro-1H-imidazo[2,1-i]-purin-5-one ([(3)H]PSB-11), a novel high-affinity antagonist radioligand for human A(3) adenosine receptors.

    PubMed

    Müller, Christa E; Diekmann, Martina; Thorand, Mark; Ozola, Vita

    2002-02-11

    This study describes the preparation and binding properties of [(3)H]PSB-11, a novel, potent, and selective antagonist radioligand for human A(3) adenosine receptors (ARs). [(3)H]PSB-11 binding to membranes of Chinese hamster ovary (CHO) cells expressing the human A(3) AR was saturable and reversible. Saturation experiments showed that [(3)H]PSB-11 labeled a single class of binding sites with high affinity (K(D)=4.9 nM) and limited capacity (B(max)=3500 fmol/mg of protein). PSB-11 is highly selective versus the other adenosine receptor subtypes. The new radioligand shows an extraordinarily low degree of non-specific binding rendering it a very useful tool for studying the (patho)physiological roles of A(3 )ARs.

  2. Modulation of the cytosolic androgen receptor in striated muscle by sex steroids

    NASA Technical Reports Server (NTRS)

    Rance, N. E.; Max, S. R.

    1984-01-01

    The effects of orchiectomy (GDX) and of subsequent administration of testosterone propionate (TP) or 17(beta)-estradiol (E2) on the maximum binding (Bmax) and apparent Kd of the cytosolic androgen receptor in levator ani (LA) and skeletal muscles of adult male Sprague-Dawley rats are investigated experimentally. The results are presented in graphs and discussed. In LA, BMAX is found to rise from a control level of 2.5 fmol/mg protein to 280, 600, 478, and 133 percent of control at 12 h, 14 d, 30 d, and 44 d after GDX, respectively, while Kd increased only insignificantly (from 680 to 960 fM); Bmax is held at control levels for 6 h by cycloheximide given at GDX, is unaffected by TP given at 30 d, and is further increased (by 480 percent at 44 d) by administration of E2 at 30 d. Bmax in skeletal muscles is found to increase to 139, 212, 220, and 158 percent of control at 12 h, 14 d, 30 d, and 44 d, respectively; Bmax is returned to control at 44 d by TP at 30 d but is not affected by E2. The effect of E2 in LA is attributed to either induction of the cytosolic receptor or a decreased rate of receptor degradation.

  3. Characterization of nicotine binding in mouse brain and comparison with the binding of alpha-bungarotoxin and quinuclidinyl benzilate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marks, M.J.; Collins, A.C.

    1982-11-01

    The binding of (/sup 3/H)nicotine to mouse brain has been measured and subsequently compared with the binding of (/sup 125/I)alpha-bungarotoxin (alpha-BTX) and L-(/sup 3/H)quinuclidinyl benzilate (QNB). The binding of nicotine was saturable, reversible, and stereospecific. Although the rates of association and dissociation of nicotine were temperature-dependent, the incubation temperature had no effect on either KD or Bmax. Nicotine binding was unaffected by the addition of NaCl, KCl, CaCl/sub 2/, or MgSO/sub 4/ to the incubation medium. Nicotinic cholinergic agonists were potent inhibitors of nicotine binding; however, nicotinic antagonists were poor inhibitors. The regional distribution of binding was not uniform: midbrainmore » and striatum contained the highest number of receptors, whereas cerebellum had the fewest. Differences in site densities, regional distribution, inhibitor potencies, and thermal denaturation indicated that nicotine binding was not the same as either QNB or alpha-BTX binding, and therefore that receptors for nicotine may represent a unique population of cholinergic receptors.« less

  4. Pharmacological and molecular characterization of muscarinic receptor subtypes in human esophageal smooth muscle.

    PubMed

    Preiksaitis, H G; Krysiak, P S; Chrones, T; Rajgopal, V; Laurier, L G

    2000-12-01

    Esophageal peristalsis is dependent on activation of muscarinic receptors, but little is known about the roles of specific receptor subtypes in the human esophagus. We examined muscarinic receptor expression and function in human esophageal smooth muscle obtained from patients undergoing resection for cancer. [(3)H]Quinuclidinyl benzylate (QNB)-specific binding was similar in longitudinal muscle (B(max) = 106 +/- 22 fmol/mg of protein, K(d) = 68 +/- 9 pM) and circular muscle (B(max) = 81 +/- 16 fmol/mg of protein, K(d) = 79 +/- 15 pM). Subtype-selective antagonists inhibited [(3)H]QNB similarly in muscle from both layers. Further analysis of antagonist inhibition of [(3)H]QNB binding showed a major site (60-70%) with antagonist affinity profile consistent with the M2 subtype and a second site that could not be classified. Reverse transcription-polymerase chain reaction and immunoblotting demonstrated the presence of all five known muscarinic receptor subtypes, and immunocytochemistry on acutely isolated smooth muscle cells confirmed the expression of each subtype on the muscle cells. Subtype-selective antagonists had similar inhibitory effects on carbachol-evoked contractions in longitudinal muscle and circular muscle strips with pA(2) values of 9.5 +/- 0.1 and 9.6 +/- 0.2 for 4-diphenylacetoxy-N-methylpiperidine methiodide, 7.1 +/- 0.1 and 7.0 +/- 0.2 for pirenzepine, and 6.2 +/- 0.2 and 6.4 +/- 0.2 for methoctramine, respectively. We conclude that human esophageal smooth muscle expresses muscarinic receptor subtypes M1 through M5. The antagonist sensitivity profile for muscle contraction is consistent with activation of the M3 subtype.

  5. Characterization of ( sup 3 H)alprazolam binding to central benzodiazepine receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCabe, R.T.; Mahan, D.R.; Smith, R.B.

    1990-10-01

    The binding of the triazolobenzodiazepine ({sup 3}H)alprazolam was studied to characterize the in vitro interactions with benzodiazepine receptors in membrane preparations of rat brain. Studies using nonequilibrium and equilibrium binding conditions for ({sup 3}H)alprazolam resulted in high specific to nonspecific (signal to noise) binding ratios. The binding of ({sup 3}H)alprazolam was saturable and specific with a low nanomolar affinity for benzodiazepine receptors in the rat brain. The Kd was 4.6 nM and the Bmax was 2.6 pmol/mg protein. GABA enhanced ({sup 3}H)alprazolam binding while several benzodiazepine receptor ligands were competitive inhibitors of this drug. Compounds that bind to other receptormore » sites had a very weak or negligible effect on ({sup 3}H)alprazolam binding. Alprazolam, an agent used as an anxiolytic and in the treatment of depression, acts in vitro as a selective and specific ligand for benzodiazepine receptors in the rat brain. The biochemical binding profile does not appear to account for the unique therapeutic properties which distinguish this compound from the other benzodiazepines in its class.« less

  6. Characterization and autoradiographic localization of neurotensin binding sites in human sigmoid colon.

    PubMed

    Azriel, Y; Burcher, E

    2001-06-01

    Radioiodinated neurotensin ((125)I-NT) was used to characterize and localize NT binding sites in normal human sigmoid colon. Specimens were obtained from patients (30-77 years old) undergoing resection for colon carcinoma. Specific binding of (125)I-NT to sigmoid circular muscle membranes was enhanced by o-phenanthroline (1 mM) but other peptidase inhibitors were ineffective. (125)I-NT bound to a high-affinity site of K(d) = 0.88 +/- 0.09 nM and B(max) = 4.03 +/- 0.66 fmol/mg of wet weight tissue (n = 14), although in the majority of patients another site, of low but variable affinity, could also be detected. Specific binding of 50 pM (125)I-NT was inhibited by NT(8-13) > NT > SR142948A > or = neuromedin N > or = SR48692, consistent with binding to the NT1 receptor. In autoradiographic studies, dense specific binding of (125)I-NT was seen over myenteric and submucosal ganglia, moderate binding over circular muscle, and sparse binding over longitudinal muscle and taenia coli. Levocabastine, which has affinity for the NT2 receptor, did not inhibit specific binding of (125)I-NT in membrane competition or autoradiographic studies. NT contracted sigmoid colon circular muscle strips with a pD(2) value of 6.8 +/- 0.2 nM (n = 25). The contractile responses to NT were significantly potentiated in the presence of tetrodotoxin (1 microM), indicating a neural component. Results from functional studies support actions for NT on both muscle and enteric neurons, consistent with the presence of NT receptors on circular muscle and ganglia of human sigmoid colon. The lack of inhibition by levocabastine suggests that the second binding site detected does not correspond to the NT2 receptor.

  7. Genetic studies at the receptor level: investigations in human twins and experimental animals.

    PubMed

    Propping, P; Friedl, W; Hebebrand, J; Lentes, K U

    1986-01-01

    In receptors, as in enzymes, quantitative as well as qualitative genetic variation may exist. Studies in inbred strains of mice have shown for various receptors that the receptor density as determined by Bmax values is under genetic control. In healthy adult twins we have shown that the density of alpha-adrenoceptors on platelets is also influenced by genetic factors, since monozygotic twins were much more similar to one another than dizygotic twins. However, Bmax values are up-regulated and down-regulated by endogenous neurotransmitters and pharmacologically active agents. Thus, receptor densities are under considerable regulatory influences. Bmax values therefore reflect regulatory mechanisms rather than innate characteristics of the receptor protein. In another twin study we failed to find evidence for a genetic influence on the density of imipramine-binding sites on platelets. Since qualitative variation (polymorphism) is well known in enzymes, it may also apply to receptors. Qualitative differences in the receptor protein within one species would be of particular interest because of possible functional implications. As a first approach we examined central benzodiazepine receptors by photoaffinity labelling and sodium dodecyl sulphate-polyacrylamide gel electrophoresis. A comparison of fish, frog, chicken, mouse, rat and calf led to the detection of variation between species. Investigations in five inbred mouse and rat strains have not so far revealed genetic variation in benzodiazepine receptors. Nevertheless variation may be detectable by more sensitive methods such as peptide mapping after limited proteolysis or two-dimensional electrophoresis.

  8. Involvement of serotonin system in bullimia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marazziti, D.; Macchi, E.; Rotondo, A.

    1988-01-01

    Platelet /sup 3/H-imipramine binding was investigated in 8 patients affected by bulimia according to DSM III criteria, and in 7 health volunteers. The Bmax /+ -/SD (fmol/mg protein) was 356 /+ -/ 53 in patients, and 1144 /+ -/ 134 in controls. The Kd /+ -/ SD (nM) was 1.35 /+ -/ 0.44 in patients, and 1.90 /+ -/ 0.72 in controls. There was a significant difference in Bmax values in the two groups, whereas no significant difference was observed in Kd values. This study suggests the possible involvement of the indoleamine system in bullimia.

  9. Effects of guanyl nucleotides on CCKB receptor binding in brain tissue and continuous cell lines: a comparative study.

    PubMed

    Kaufmann, R; Schöneberg, T; Henklein, P; Meyer, R; Martin, H; Ott, T

    1995-07-01

    The effects of non-hydrolyzable guanyl nucleotide analogue GTP-gamma S on CCKB receptor binding in human and guinea-pig cortex, Jurkat T-cells, rat pituitary GH3 cells, rat glioma C6 cells and human small cell lung cancer NCI-H69 cells were investigated by using [3H]CCK-8S saturation and competition binding studies. GTP-gamma S caused inhibition of specific [3H]CCK-8S binding in a concentration dependent manner with a plateau at 10-25 microM. 25 microM GTP-gamma S resulted in a small but significant increase in Kd and IC50 values with amount very similar in all CCKB receptor models tested. However, the maximal number of specific [3H]CCK-8S binding sites (Bmax) was unaffected. Results suggest that CCKB receptors are G-protein coupled in a similar way to human and guinea-pig cortex, Jurkat cells, GH3 cells, C6 cells and NCI-H69 cells.

  10. Demonstration of muscarinic and nicotinic receptor binding activities of distigmine to treat detrusor underactivity.

    PubMed

    Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo

    2010-01-01

    The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.

  11. Binding and effects of KATP channel openers in the vascular smooth muscle cell line, A10

    PubMed Central

    Russ, Ulrich; Metzger, Friedrich; Kickenweiz, Elisabeth; Hambrock, Annette; Krippeit-Drews, Peter; Quast, Ulrich

    1997-01-01

    The ATP-sensitive K+ channel (KATP channel) in A10 cells, a cell line derived from rat thoracic aorta, was characterized by binding studies with the tritiated KATP channel opener, [3H]-P1075, and by electrophysiological techniques. Saturation binding experiments gave a KD value of 9.2±5.2 nM and a binding capacity (BMax) of 140±40 fmol mg−1 protein for [3H]-P1075 binding to A10 cells; from the BMax value a density of binding sites of 5–10 per μm2 plasmalemma was estimated. KATP channel modulators such as the openers P1075, pinacidil, levcromakalim and minoxidil sulphate and the blocker glibenclamide inhibited [3H]-P1075 binding. The extent of inhibition at saturation depended on the compound, levcromakalim inhibiting specific [3H]-P1075 binding by 85%, minoxidil sulphate and glibenclamide by 70%. The inhibition constants were similar to those determined in strips of rat aorta. Resting membrane potential, recorded with microelectrodes, was −51±1 mV. P1075 and levcromakalim produced a concentration-dependent hyperpolarization by up to −25 mV with EC50 values of 170±40 nM and 870±190 nM, respectively. The hyperpolarization induced by levcromakalim (3 μM) was completely reversed by glibenclamide with an IC50 value of 86±17 nM. Voltage clamp experiments were performed in the whole cell configuration under a physiological K+ gradient. Levcromakalim (10 μM) induced a current which reversed around −80 mV; the current-voltage relationship showed considerable outward rectification. Glibenclamide (3 μM) abolished the effect of levcromakalim. Analysis of the noise of the levcromakalim (10 μM)-induced current at −40 and −20 mV yielded estimates of the channel density, the single channel conductance and the probability of the channel to be open of 0.14 μm−2, 8.8 pS and 0.39, respectively. The experiments showed that A10 cells are endowed with functional KATP channels which resemble those in vascular tissue; hence, these cells provide an easily accessible source of channels for biochemical and pharmacological studies. The density of binding sites for [3H]-P1075 was estimated to be one order of magnitude higher than the density of functional KATP channels; assuming a plasmalemmal localization of the binding sites this suggests a large receptor reserve for the openers in A10 cells. PMID:9401776

  12. Localization of serotoni (5-hydroxytryptamine, 5-HT) with partial purification and characterization of a serotonin binding protein in the intestinal tissue of the nematode Ascaris suum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, R.E.

    1989-01-01

    An intracellular 5-HT binding protein (SBP) from intestinal tissue was partially purified and characterized. Binding of ({sup 3}H) 5-HT to the protein appeared to be Fe{sup +2}-sensitive and maximal (20.8pmol/mg protein) at 5 {times} 10{sup {minus}4}M Fe{sup +2} and 10{sup {minus}7}M ({sup 3}H) 5-HT. There were two 5-HT binding sites present at optimum Fe{sup +2} concentrations. The Bmax values of these sites were more sensitive to Fe{sup +2} than Kd values. Sulfhydryl reducing agents, cation chelators, Fe{sup +3}, Ca{sup +2} and antagonists of 5-HT uptake and storage inhibited binding of 5-HT to SBP. Gel exclusion chromatography indicated the presence ofmore » a 45Kda SBP that in 5 {times} 10{sup {minus}5}M Fe{sup +2} may form aggregates ranging in size from approximately 80 to >1000Kda. The data indicate these in vitro aggregates may correspond to the electron-opaque patches observed in situ. Ascaris suum may provide a model system to further elucidate the physiological role of analogous serotonin binding proteins that have been identified in mammalian systems.« less

  13. Characterization of NK1 and NK2 tachykinin receptors in guinea-pig and rat bronchopulmonary and vascular systems.

    PubMed Central

    Floch, A.; Fardin, V.; Cavero, I.

    1994-01-01

    1. NK1 and NK2 tachykinin receptors were characterized in guinea-pig and rat bronchopulmonary systems and in the vasculature of the rat by use of radioligand binding and/or functional studies. 2. The radioligands for NK1 and NK2 receptors ([3H]-SP and [3H]-pNKA, respectively) did not label tachykinin receptors in homogenates of rat lungs or bronchi. In contrast, in the guinea-pig, [3H]-SP bound with high affinity to these tissues (KD = 0.23 +/- 0.08 nM and 0.34 +/- 0.05 nM, for lungs and bronchi, respectively). The total number of binding sites was 4.6 fold greater in bronchus (Bmax = 135 +/- 27 fmol mg-1 protein) than in lung homogenates (Bmax = 29.3 +/- 0.1 fmol mg-1 protein). Furthermore, this binding was markedly displaced by CP-96,345 (pKi = 9.5 +/- 0.1) and RP 67580 (pKi = 7.6 +/- 0.1), antagonists of NK1 receptors, slightly displaced by SR 48968 (pKi = 6.6 +/- 0.1), but not affected by actinomycin D or L-659,877, antagonists of NK2 receptors. Specific binding of [3H]-pNKA, detected in guinea-pig bronchi (KD = 5.2 +/- 0.1 nM, and Bmax = 203 +/- 19 fmol mg-1 protein) but not in lungs, was similarly (40 to 53%) displaced by RP 67580 (1 microM), CP-96,345 (10 and 100 nM) or SR 48968 (10 and 100 nM). The displacement approximately doubled (87 to 91%) when SR 48968 (10 nM) was combined with either RP 67580 (1 microM) or CP-96,345 (10 nM), but not when RP 67580 was combined with CP-96,345. 3. In urethane-anaesthetized guinea-pigs, i.v. injections of the NK1 receptor agonists SP, [Pro9]-SP, [Sar9,Met(O2)11]-SP and septide, as well as the NK2 receptor agonists NKA and [Lys5,MeLeu9,NLeu10]-NKA(4-10) (0.1-10 micrograms kg-1, i.v.), dose-dependently increased lung inflation pressure. The most potent of these peptides were septide and [Lys5, MeLeu9,NLeu10]-NKA(4-10) (EC50 = 0.38 +/- 0.07 and 0.07 +/- 0.02 microgram kg-1, respectively). Interestingly, septide was 130 fold less potent than SP in displacing [3H]-SP from its binding sites in the guinea-pig lung, whereas it was 14 fold more potent than SP as a bronchoconstrictor. RP 67580 (0.3-5 mg kg-1, i.v.) and CP-96,345 (0.01-3 mg kg-1, i.v.) dose-dependently reduced the bronchoconstriction produced by the NK1 receptor agonists.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:7517328

  14. Discrimination of putative M1 and M2 muscarinic receptor subtypes in rat brain by N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline (EEDQ)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Norman, A.B.; Creese, I.

    1986-03-01

    The EC/sub 50/ of EEDQ for the inhibition of (/sup 3/H)(-)QNB binding in vitro was approximately 3 fold lower for homogenates of hippocampus than brainstem (containing predominantly putative M/sub 1/ and M/sub 2/ muscarinic receptor subtypes respectively). Furthermore, the time-dependent loss of (/sup 3/H)(-)QNB binding produced by 100 ..mu..M EEDQ was faster in homogenates of hippocampus than brainstem. Administration of EEDQ (20 mg/kg i.p.) irreversibly reduced the Bmax of (/sup 3/H)(-)QNB binding by 56% and 34% in hippocampus and brainstem respectively. Pirenzepine competition for the remaining (/sup 3/H)(-)QNB binding sites following in vitro and in vivo treatment with EEDQ revealedmore » a significant increase in the proportion of (/sup 3/H)(-)QNB binding sites having low affinity for pirenzepine (M/sub 2/ receptors), indicating that the high affinity pirenzepine binding sites (M/sub 1/ receptors) were selectively and irreversibly lost. Thus, EEDQ discriminates the same putative M/sub 1/ and M/sub 2/ muscarinic receptor subtypes that are discriminated by pirenzepine. The reduction of (/sup 3/H)(-)QNB binding could be prevented both in vitro and in vivo by atropine or scopolamine. These data may indicate differences in the accessibility of these putative receptor subtypes to EEDQ or, alternatively, differences in the availability of carboxyl groups able to interact with EEDQ at the ligand recognition site of M/sub 1/ and M/sub 2/ muscarinic receptors.« less

  15. Identification and characterization of (/sup 3/H)-rauwolscine binding to alpha2-adrenoceptors in the canine saphenous vein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gout, B.

    1988-01-01

    The biochemical exploration of the alpha2-adrenergic receptors was investigated in the canine saphenous vein using the highly selective alpha2-adrenergic antagonist rauwolscine as a tritiated ligand. Following an enzymatic digestive pretreatment, the authors isolated a purified smooth muscle cell membranes fraction from saphenous veins in quantity sufficient to permit them to study the venous alpha2-adrenoreceptor content. The binding of tritiated rauwolscine was rapid, specific, saturable and reversible. The presence of high affinity sites with a density of binding Bmax of 125.2 /+ -/ 43.1 fmol/mg protein was demonstrated on a unique class of non interacting sites. The kinetically derived Kd wasmore » 1.28 nM, in good agreement with the value obtained from saturation isotherms. The pharmacological profile of these sites was assessed by the comparison of the potency of alpha-adrenergic agonists and antagonists to inhibit 1 nM (/sup 3/H)-rauwolscine. Their efficacy was respectively: rauwolscine > phentolamine > RX 781094 > clonidine >> prazosin > (-)-phenylephrine > (-)-noradrenaline. The results showed that (/sup 3/H)-rauwolscine bound specifically to sites in their membranal preparation, which had the pharmacological characteristics of the alpha2-adrenoceptors. The correlation between biochemical and pharmacological data revealed the usefulness of binding methods in the further study of adrenergic mechanisms in the canine saphenous vein.« less

  16. Titration calorimetry of anesthetic-protein interaction: negative enthalpy of binding and anesthetic potency.

    PubMed

    Ueda, I; Yamanaka, M

    1997-04-01

    Anesthetic potency increases at lower temperatures. In contrast, the transfer enthalpy of volatile anesthetics from water to macromolecules is usually positive. The transfer decreases at lower temperature. It was proposed that a few selective proteins bind volatile anesthetics with negative delta H, and these proteins are involved in signal transduction. There has been no report on direct estimation of binding delta H of anesthetics to proteins. This study used isothermal titration calorimetry to analyze chloroform binding to bovine serum albumin. The calorimetrically measured delta H cal was -10.37 kJ.mol-1. Thus the negative delta H of anesthetic binding is not limited to signal transduction proteins. The binding was saturable following Fermi-Dirac statistics and is characterized by the Langmuir adsorption isotherms, which is interfacial. The high-affinity association constant, K, was 2150 +/- 132 M-1 (KD = 0.47 mM) with the maximum binding number, Bmax = 3.7 +/- 0.2. The low-affinity K was 189 +/- 3.8 M-1 (KD = 5.29 mM), with a Bmax of 13.2 +/- 0.3. Anesthetic potency is a function of the activity of anesthetic molecules, not the concentration. Because the sign of delta H determines the temperature dependence of distribution of anesthetic molecules, it is irrelevant to the temperature dependence of anesthetic potency.

  17. Titration calorimetry of anesthetic-protein interaction: negative enthalpy of binding and anesthetic potency.

    PubMed Central

    Ueda, I; Yamanaka, M

    1997-01-01

    Anesthetic potency increases at lower temperatures. In contrast, the transfer enthalpy of volatile anesthetics from water to macromolecules is usually positive. The transfer decreases at lower temperature. It was proposed that a few selective proteins bind volatile anesthetics with negative delta H, and these proteins are involved in signal transduction. There has been no report on direct estimation of binding delta H of anesthetics to proteins. This study used isothermal titration calorimetry to analyze chloroform binding to bovine serum albumin. The calorimetrically measured delta H cal was -10.37 kJ.mol-1. Thus the negative delta H of anesthetic binding is not limited to signal transduction proteins. The binding was saturable following Fermi-Dirac statistics and is characterized by the Langmuir adsorption isotherms, which is interfacial. The high-affinity association constant, K, was 2150 +/- 132 M-1 (KD = 0.47 mM) with the maximum binding number, Bmax = 3.7 +/- 0.2. The low-affinity K was 189 +/- 3.8 M-1 (KD = 5.29 mM), with a Bmax of 13.2 +/- 0.3. Anesthetic potency is a function of the activity of anesthetic molecules, not the concentration. Because the sign of delta H determines the temperature dependence of distribution of anesthetic molecules, it is irrelevant to the temperature dependence of anesthetic potency. PMID:9083685

  18. Endothelin ETA receptor expression in human cerebrovascular smooth muscle cells.

    PubMed

    Yu, J C; Pickard, J D; Davenport, A P

    1995-11-01

    1. Endothelin (ET) has been implicated in cerebrovasospasm for example, following subarachnoid haemorrhage, and blocking the interaction of ET with its receptors on cerebral vessels, may be of therapeutic benefit. The aim of our study was to characterize endothelin receptor sub-types on medial smooth muscle cells of human cerebral vessels. Cultures of vascular smooth muscle cells were explanted from human cerebral resistance vessels and characterized as human brain smooth muscle cells (HBSMCs). 2. Over a 48 h incubation period, HBSMC cultures secreted comparable levels of immunoreactive (IR) big endothelin-1 (big ET-1) and IR endothelin (ET): 12.7 +/- 10.3 and 8.3 +/- 5.6 pmol/10(6) cells, respectively (mean +/- s.e. mean from three different individuals), into the culture medium. 3. Total RNA was extracted from cultures of human brain smooth muscle cells. Reverse-transcriptase polymerase chain reaction (RI-PCR) assays and subsequent product separation by agarose gel electrophoresis revealed single bands corresponding to the expected product sizes encoding cDNA for ETA (299 base pairs) and ETB (428 base pairs) (n = 3 different cultures). 4. Autoradiography demonstrated the presence of specific binding sites for [125I]-ET-1 which labels all ET receptors, and [125I]-PD151242, an ETA subtype-selective antagonist which exclusively labels ETA receptors, but no specific-binding was detected using ETB subtype-selective [125I]-BQ3020 (n = 3 different cultures, in duplicate). 5. In saturation binding assays, [123I]-ET-1 bound with high affinity: KD = 0.8 +/- 0.1 nM and Bmax = 690 +/- 108 fmol mg-1. A one-site fit was preferred and Hill slopes were close to unity over the concentration range (10(-12) to 10(-8) M). [125I]-PD151242 also bound with similar affinity: KD = 0.4 +/- 0.1 nM and Bmax = 388 +/- 68 fmol mg-1 (mean +/- s.e. mean, n = 3 different cultures). Again, a one-site fit was preferred and Hill slopes were close to unity over the concentration range. Unlabelled PD151242 competed for the binding of [125I]-ET-1 monophasically and analysis of the competition curves indicated that a one-site fit was preferred over a two-site model, implying that the cultures express mainly ETA receptors. 6. Although messenger RNA encoding both ETA and ETB receptors was detected, autoradiographical analysis, as well as binding studies indicate that human cultured brain smooth muscle cells express only ETA receptor protein. Antagonism of this sub-type may be necessary to block the actions of ET-1 in the human cerebral resistance vessels in the vasospasm observed subsequent to subarachnoid haemorrhage.

  19. N- and C-terminal substance P fragments: differential effects on striatal [3H]substance P binding and NK1 receptor internalization.

    PubMed

    Michael-Titus, A T; Blackburn, D; Connolly, Y; Priestley, J V; Whelpton, R

    1999-07-13

    N- and C-terminal substance P (SP) fragments increase striatal dopamine outflow at nanomolar concentrations. This contrasts with their low affinity for NK1 receptors. To explore this discrepancy, we investigated the interaction of SP and SP fragments with NK1 sites in fresh striatal slices, the same model used in the functional studies on dopamine outflow. [3H]SP bound specifically to one site (Kd = 6.6 +/- 0.9 nM; Bmax = 12.6 +/- 0.7 fmol/mg protein). [3H]SP binding was displaced by SP (IC50 = 11.8 nM), but not by SP(1-7) or SP(5-11), up to 10 microM. In contrast, 10 nM SP(1-7) or SP(5-11) induced significant internalization of the NK1 receptor, similar to that induced by SP. We suggest that SP fragments have high affinity for an NK1 receptor conformer which is different from that labelled by [3H]SP.

  20. Bacillus thuringiensis delta-endotoxin binding to brush border membrane vesicles of rice stem borers.

    PubMed

    Alcantara, Edwin P; Aguda, Remedios M; Curtiss, April; Dean, Donald H; Cohen, Michael B

    2004-04-01

    The receptor binding step in the molecular mode of action of five delta-endotoxins (Cry1Ab, Cry1Ac, Cry1C, Cry2A, and Cry9C) from Bacillus thuringiensis was examined to find toxins with different receptor sites in the midgut of the striped stem borer (SSB) Chilo suppressalis (Walker) and yellow stem borer (YSB) Scirpophaga incertulas (Walker) (Lepidoptera: Pyralidae). Homologous competition assays were used to estimate binding affinities (K(com)) of (125)I-labelled toxins to brush border membrane vesicles (BBMV). The SSB BBMV affinities in decreasing order was: Cry1Ab = Cry1Ac > Cry9C > Cry2A > Cry1C. In YSB, the order of decreasing affinities was: Cry1Ac > Cry1Ab > Cry9C = Cry2A > Cry1C. The number of binding sites (B(max)) estimated by homologous competition binding among the Cry toxins did not affect toxin binding affinity (K(com)) to both insect midgut BBMVs. Results of the heterologous competition binding assays suggest that Cry1Ab and Cry1Ac compete for the same binding sites in SSB and YSB. Other toxins bind with weak (Cry1C, Cry2A) or no affinity (Cry9C) to Cry1Ab and Cry1Ac binding sites in both species. Cry2A had the lowest toxicity to 10-day-old SSB and Cry1Ab and Cry1Ac were the most toxic. Taken together, the results of this study show that Cry1Ab or Cry1Ac could be combined with either Cry1C, Cry2A, or Cry9C for more durable resistance in transgenic rice. Cry1Ab should not be used together with Cry1Ac because a mutation in one receptor site could diminish binding of both toxins. Copyright 2004 Wiley-Liss, Inc.

  1. 3- and 4-O-sulfoconjugated and methylated dopamine: highly reduced binding affinity to dopamine D2 receptors in rat striatal membranes.

    PubMed

    Werle, E; Lenz, T; Strobel, G; Weicker, H

    1988-07-01

    The binding properties of 3- and 4-O-sulfo-conjugated dopamine (DA-3-O-S, DA-4-O-S) as well as 3-O-methylated dopamine (MT) to rat striatal dopamine D2 receptors were investigated. 3H-spiperone was used as a radioligand in the binding studies. In saturation binding experiments (+)butaclamol, which has been reported to bind to dopaminergic D2 and serotoninergic 5HT2 receptors, was used in conjunction with ketanserin and sulpiride, which preferentially label 5HT2 and D2 receptors, respectively, in order to discriminate between 3H-spiperone binding to D2 and to 5HT2 receptors. Under our particular membrane preparation and assay conditions, 3H-spiperone binds to D2 and 5HT2 receptors with a maximal binding capacity (Bmax) of 340 fmol/mg protein in proportions of about 75%:25% with similar dissociation constants KD (35 pmol/l; 43 pmol/l). This result was verified by the biphasic competition curve of ketanserin, which revealed about 20% high (KD = 24 nmol/l) and 80% low (KD = 420 nmol/l) affinity binding sites corresponding to 5HT2 and D2 receptors, respectively. Therefore, all further competition experiments at a tracer concentration of 50 pmol/l were performed in the presence of 0.1 mumol/l ketanserin to mask the 5HT2 receptors. DA competition curves were best fitted assuming two binding sites, with high (KH = 0.12 mumol/l) and low (KL = 18 mumol/l) affinity, present in a ratio of 3:1. The high affinity binding sites were interconvertible by 100 mumol/l guanyl-5-yl imidodiphosphate [Gpp(NH)p], resulting in a homogenous affinity state of DA receptors (KD = 2.8 mumol/l).2+ off

  2. Expression of σ receptors of human urinary bladder tumor cells (RT-4 cells) and development of a competitive receptor binding assay for the determination of ligand affinity to human σ(2) receptors.

    PubMed

    Schepmann, Dirk; Lehmkuhl, Kirstin; Brune, Stefanie; Wünsch, Bernhard

    2011-07-15

    A selective competitive binding assay for the determination of the affinity of compounds to the human σ(2) receptor using 96-well multiplates and a solid state scintillator was developed. In the assay system, [(3)H]ditolylguanidine (DTG) was used as radioligand and membrane homogenates from human RT-4 cells physiologically expressing σ(2) receptors served as receptor material. In order to block the interaction of the unselective radioligand [(3)H]DTG with σ(1) receptors, all experiments were performed in the presence of the σ(1) selective ligand (+)-pentazocine. The density of σ(2) receptors of the cells was analyzed by a saturation experiment with [(3)H]DTG. The radioligand [(3)H]DTG was bound to a single, saturable site on human σ(2) receptors, resulting in a B(max) value of 2108±162fmol/mg protein and K(d)-value of 8.3±2.0nM. The expression of competing σ(1) receptors was evaluated by performing a saturation experiment using the σ(1) selective radioligand [(3)H](+)-pentazocine, which resulted in a B(max) value of 279±40fmol/mg protein and K(d) value of 13.4±1.6nM. For validation of the σ(2) binding assay, the K(i)-values of four σ(2) ligands (ditolylguanidine, haloperidol, rimczole and BMY-14802) were determined with RT-4 cell membrane preparations. The K(i) values obtained from these experiments are in good accordance with the K(i)-values obtained with rat liver membrane preparations as receptor material and with K(i) values given in the literature. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Specific binding of [(18)F]fluoroethyl-harmol to monoamine oxidase A in rat brain cryostat sections, and compartmental analysis of binding in living brain.

    PubMed

    Maschauer, Simone; Haller, Adelina; Riss, Patrick J; Kuwert, Torsten; Prante, Olaf; Cumming, Paul

    2015-12-01

    We investigated [(18)F]fluoroethyl-harmol ([(18)F]FEH) as a reversible and selective ligand for positron emission tomography (PET) studies of monoamine oxidase A (MAO-A). Binding of [(18)F]FEH in rat brain cryostat sections indicated high affinity (KD = 3 nM), and density (Bmax; 600 pmol/g). The plasma free fraction was 45%, and untransformed parent constituted only 13% of plasma radioactivity at 10 min after injection. Compartmental analysis of PET recordings in pargyline-treated rats showed high permeability to brain (K1; 0.32 mL/g/min) and slow washout (k2; 0.024/min), resulting in a uniformly high equilibrium distribution volume (VD; 20 mL/g). Using this VD to estimate unbound ligand in brain of untreated rats, the binding potential ranged from 4.2 in cerebellum to 7.2 in thalamus. We also calculated maps of rats receiving [(18)F]FEH at a range of specific activities, and then estimated saturation binding parameters in the living brain. In thalamus, striatum and frontal cortex KD was globally close to 300 nM and Bmax was close to 1600 pmol/g; the 100-fold discrepancy in affinity suggests a very low free fraction for [(18)F]FEH in the living brain. Based on a synthesis of findings, we calculate the endogenous dopamine concentration to be 0.4 μM in the striatal compartment containing MAO-A, thus unlikely to exert competition against [(18)F]FEH binding in vivo. In summary, [(18)F]FEH has good properties for the detection of MAO-A in the rat brain by PET, and may present logistic advantages for clinical research at centers lacking a medical cyclotron. We made a compartmental analysis of [(18)F]fluoroethylharmol ([(18)F]FEH) binding to monoamine oxidase A (MAO-A) in living rat brain and estimated the saturation binding parameters from the binding potential (BPND). The Bmax was of comparable magnitude to that in vitro, but with apparent affinity (300 nM), it was 100-fold lower in vivo. PET imaging with [(18) F]FEH is well suited for quantitation of MAO-A in living brain. © 2015 International Society for Neurochemistry.

  4. Glucocorticoid sensitivity and proinflammatory cytokines pattern in pemphigus.

    PubMed

    Chriguer, Rosangela Soares; Roselino, Ana Maria; de Castro, Margaret

    2012-08-01

    Glucocorticoids (GC) represent the main treatment for pemphigus; however, some patients show GC resistance. GC sensitivity was evaluated in 19 pemphigus patients and 41 controls by the number of binding sites [B(max) (fmol/mg protein)] and the affinity of GC receptor [Kd (nM)] to dexamethasone (DEX) as well as by the pattern of cytokine by DEX-mediated inhibition of concanavalin-A (Con-A)-stimulated PBMC proliferation. The Kd (15.7 ± 2.8 vs.8.1 ± 1.3) and Bmax (6.5 ± 0.9 vs. 3.9 ± 0.3) were higher in pemphigus than controls (p = 0.002). Considering the values above the 95th percentile of normal group as a cut-off (K(d) > 24.9 nM and B(max) > 8.1 fmol/mg protein), elevated K(d) and B(max) were observed in 9.8% and 2.4% of controls and 15.8% and 36.8% of patients (p = 0.02). PBMC proliferation was stimulated by Con-A and inhibited by DEX (p < 0.001) in both pemphigus and control groups. IL-6 and TNFα (pg/mL) basal production were higher in patients than controls. There was an increment of these cytokines after Con-A stimulation, and they were inhibited by DEX (p = 0.002) in controls and remained elevated in pemphigus (p < 0.02). Patients and controls showed no difference in basal and stimulated production of IL-8 and IL-10. There is an alteration on GC sensitivity in pemphigus patients and a higher production of proinflammatory cytokines. Therefore, in pemphigus patients, proinflammatory cytokines might be involved in the mechanism of GC resistance and/or in its maintenance.

  5. Characterization of the [125I]-neurokinin A binding site in the circular muscle of human colon

    PubMed Central

    Warner, Fiona J; Comis, Alfio; Miller, Robert C; Burcher, Elizabeth

    1999-01-01

    Neurokinin A (NKA) is a potent contractile agonist of human colon circular muscle. These responses are mediated predominantly through tachykinin NK2 receptors. In the present study, the NK2 receptor radioligand [125I]-NKA has been used to characterize binding sites in this tissue, using tachykinin agonists and antagonists. 125INKA labelled a single, high affinity binding site. Specific binding (95% of total binding) of [125I]-NKA was saturable (KD 0.47±0.05 nM), of high capacity (Bmax 2.1±0.1 fmol mg−1 wet weight tissue) and reversible (kinetically derived KD 0.36±0.07 nM). The rank order of agonists competing for the [125I]-NKA binding site was neuropeptide γ (NPγ)≥NKA≥[Lys5,MeLeu9,Nle10]NKA (4–10) (NK2 agonist)>>substance P (SP)>neurokinin B (NKB)≥[Pro9]SP (NK1 agonist)>>senktide (NK3 agonist), indicating binding to an NK2 site. The nonpeptide selective NK2 antagonist SR48968 showed higher affinity for the [125I]-NKA site than selective peptide NK2 antagonists. The rank order of potency for NK2 antagonists was SR48968≥MEN11420>GR94800≥MEN10627>MEN10376≥R396. The NK1 antagonist SR140333 was a weak competitor. The competition curve for SP could be resolved into two sites. When experiments were repeated in the presence of SR140333 (0.1 μM), the curve for SP became monophasic and showed a significant shift to the right, whereas curves to NKA and NKB were unaffected. In conclusion, binding of the radioligand [125I]-NKA to membranes from circular muscle is predominantly to the NK2 receptor. There may be a small component of binding to the NK1 receptor. The NK2 receptor mediates circular muscle contraction, whereas the role of the NK1 receptor in circular muscle is unclear. PMID:10455255

  6. Binding of [3H] SR 49059, a potent nonpeptide vasopressin V1a antagonist, to rat and human liver membranes.

    PubMed

    Serradeil-Le Gal, C; Raufaste, D; Marty, E; Garcia, C; Maffrand, J P; Le Fur, G

    1994-02-28

    The new potent and selective nonpeptide vasopressin V1a antagonist, SR 49059, was tritiated and used for the characterization of rat and human liver AVP V1a receptors. Binding of [3H] SR 49059 was time-dependent, reversible and saturable. A single class of high affinity binding sites was identified with Kd values of 0.63 +/- 0.13 and 2.95 +/- 0.64 nM, in rat and human liver membranes, respectively. The maximal binding capacity (Bmax) was about 7 times higher in rat than in human liver preparations. The relative potencies of several AVP/oxytocin agonists or antagonists to inhibit [3H] SR 49059 binding confirmed that this ligand labeled a homogeneous population of sites with the expected AVP V1a profile. Furthermore, [3H] SR 49059 or unlabeled SR 49059 displayed only slight species differences between rat and human V1a receptors, whereas OPC-21268, another nonpeptide V1a antagonist, exhibited a high species-related potency with more than 500 fold higher affinity for rat than for human liver V1a receptors. Thus, [3H] SR 49059 is the first nonpeptide AVP V1a ligand reported having highly specific activity, stability, specificity and affinity. This makes it a suitable probe for labeling AVP V1a receptors in rat and also in human tissues.

  7. Harmaline competitively inhibits [3H]MK-801 binding to the NMDA receptor in rabbit brain.

    PubMed

    Du, W; Aloyo, V J; Harvey, J A

    1997-10-03

    Harmaline, a beta-carboline derivative, is known to produce tremor through a direct activation of cells in the inferior olive. However, the receptor(s) through which harmaline acts remains unknown. It was recently reported that the tremorogenic actions of harmaline could be blocked by the noncompetitive NMDA channel blocker, MK-801. This study examined whether the blockade of harmaline's action, in the rabbit, by MK-801 was due to a pharmacological antagonism at the MK-801 binding site. This was accomplished by measurement of [3H]MK-801 binding in membrane fractions derived from tissue containing the inferior olivary nucleus and from cerebral cortex. Harmaline completely displaced saturable [3H]MK-801 binding in both the inferior olive and cortex with apparent IC50 values of 60 and 170 microM, respectively. These IC50 values are consistent with the high doses of harmaline required to produce tremor, e.g., 10-30 mg/kg. Non-linear curve fitting analysis of [3H]MK-801 saturation experiments indicated that [3H]MK-801 bound to a single site and that harmaline's displacement of [3H]MK-801 binding to the NMDA receptor was competitive as indicated by a shift in Kd but not in Bmax. In addition, a Schild plot gave a slope that was not significantly different from 1 indicating that harmaline was producing a displacement of [3H]MK-801 from its binding site within the NMDA cation channel and not through an action at the glutamate or other allosteric sites on the NMDA receptor. These findings provide in vitro evidence that the competitive blockade of harmaline-induced tremor by MK-801 occurs within the calcium channel coupled to the NMDA receptor. Our hypothesis is that harmaline produces tremor by acting as an inverse agonist at the MK-801 binding site and thus opening the cation channel.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daud, A.I.; Bumpus, F.M.; Husain, A.

    Ovarian angiotensin I (Ang I)-converting enzyme (ACE), estimated by the specific binding of the ACE inhibitor (125I)iodo-MK-351A, is localized on multiple ovarian structures, including follicular granulosa cells, corpora lutea, terminal epithelium, and ovarian blood vessels, but total ovarian ACE does not display a cyclic pattern of variation during the rat estrous cycle. We have previously shown that ACE is localized on the granulosa cell layer of a subpopulation of rat ovarian follicles. Our present study shows that ovarian granulosa cells contain high affinity (binding site affinity (Kd), approximately 90 pM) and low capacity (binding site density (Bmax), approximately 12 fmol/2.5more » X 10(5) cells) (125I)iodo-MK-351A-binding sites and convert (125I)iodo-Ang I to (125I)iodo-Ang II (greater than 85% of this conversion was inhibited by the ACE inhibitor captopril). Throughout the rat estrous cycle, 94-100% of developing follicles and 89-96% of atretic follicles contained high levels of ACE; however, ACE was either not observed or its levels were very low in preovulatory follicles. These findings indicate the presence of high levels of biologically active ACE on the surface of granulosa cells and suggest a potential role for follicular ACE in early stages of follicular maturation and atresia. Although ACE is known to process a variety of peptides found within the ovary, and these peptides may have opposing effects on follicular maturation, we attempted to define the cumulative effect of ACE inhibition on follicular maturation.« less

  9. γ-secretase binding sites in aged and Alzheimer's disease human cerebrum: the choroid plexus as a putative origin of CSF Aβ.

    PubMed

    Liu, Fei; Xue, Zhi-Qin; Deng, Si-Hao; Kun, Xiong; Luo, Xue-Gang; Patrylo, Peter R; Rose, Gregory M; Cai, Huaibin; Struble, Robert G; Cai, Yan; Yan, Xiao-Xin

    2013-05-01

    Deposition of β -amyloid (Aβ) peptides, cleavage products of β-amyloid precursor protein (APP) by β-secretase-1 (BACE1) and γ-secretase, is a neuropathological hallmark of Alzheimer's disease (AD). γ-Secretase inhibition is a therapeutical anti-Aβ approach, although changes in the enzyme's activity in AD brain are unclear. Cerebrospinal fluid (CSF) Aβ peptides are thought to derive from brain parenchyma and thus may serve as biomarkers for assessing cerebral amyloidosis and anti-Aβ efficacy. The present study compared active γ-secretase binding sites with Aβ deposition in aged and AD human cerebrum, and explored the possibility of Aβ production and secretion by the choroid plexus (CP). The specific binding density of [(3) H]-L-685,458, a radiolabeled high-affinity γ-secretase inhibitor, in the temporal neocortex and hippocampal formation was similar for AD and control cases with similar ages and post-mortem delays. The CP in post-mortem samples exhibited exceptionally high [(3) H]-L-685,458 binding density, with the estimated maximal binding sites (Bmax) reduced in the AD relative to control groups. Surgically resected human CP exhibited APP, BACE1 and presenilin-1 immunoreactivity, and β-site APP cleavage enzymatic activity. In primary culture, human CP cells also expressed these amyloidogenic proteins and released Aβ40 and Aβ42 into the medium. Overall, our results suggest that γ-secretase activity appears unaltered in the cerebrum in AD and is not correlated with regional amyloid plaque pathology. The CP appears to be a previously unrecognised non-neuronal contributor to CSF Aβ, probably at reduced levels in AD. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  10. γ-Secretase binding sites in aged and Alzheimer’s disease human cerebrum: The choroid plexus as a putative origin of CSF Aβ

    PubMed Central

    Liu, Fei; Xue, Zhi-Qin; Deng, Si-Hao; Kun, Xiong; Luo, Xue-Gang; Patrylo, Peter R.; Rose, Gregory M.; Cai, Huaibin; Struble, Robert G.; Cai, Yan; Yan, Xiao-Xin

    2013-01-01

    Deposition of β-amyloid (Aβ) peptides, cleavage products of β-amyloid precursor protein (APP) by β-secretase-1 (BACE1) and γ-secretase, is a neuropathological hallmark of Alzheimer’s disease (AD). γ-Secretase inhibition is a therapeutical anti-Aβ approach, although less is clear about the change of the enzyme’s activity in AD brain. Cerebrospinal fluid (CSF) Aβ peptides are considered to derive from brain parenchyma, thus may serve as biomarkers for assessing cerebral amyloidosis and anti-Aβ efficacy. The present study compared active γ-secretase binding sites with Aβ deposition in aged and AD human cerebrum, and explored a possibility of Aβ production and secretion by the choroid plexus (CP). Specific binding density of [3H]-L-685,458, a radiolabeled high affinity γ-secretase inhibitor, in the temporal neocortex and hippocampal formation was similar for AD and control cases with comparable ages and postmortem delays. The CP in postmortem samples exhibited exceptionally high [3H]-L-685,458 binding density, with the estimated maximal binding sites (Bmax) reduced in the AD relative to control groups. Surgically resected human CP exhibited APP, BACE1 and presenilin-1 immunoreactivity, and β-site APP cleavage enzymatic activity. In primary culture, human CP cells also expressed these amyloidogenic proteins but released Aβ40 and Aβ42 into the medium. These results suggest that γ-secretase activity appears not altered in the cerebrum in AD related to aged control, nor correlated with regional amyloid plaque pathology. The choroid plexus appears to represent a novel non-neuronal source in the brain that may contribute Aβ into cerebrospinal fluid, probably at reduced levels in AD. PMID:23432732

  11. Glucose and cyclic adenosine monophosphate stimulate activities of adenylate cyclase and guanylate cyclase of Tetrahymena pyriformis infusoria.

    PubMed

    Shpakov, A O; Derkach, K V; Uspenskaya, Z I

    2012-02-01

    The sensitivities of cyclase enzymes adenylate cyclase and guanylate cyclase to glucose and extracellular cAMP were studied in Tetrahymena pyriformis infusoria. Glucose effectively stimulated activities of both cyclase enzymes, while cAMP more effectively stimulated adenylate cyclase. It was shown that [6-(14)C]glucose specifically bound to Tetrahymena pyriformis infusoria at dissociation constant (K(D)) and number of binding sites (B(max)) 43 nM and 7.53 fmol glucose per 100,000 cells and [8-(3)H]cAMP bound at 19 nM and 4.46 fmol cAMP per 100,000 cells, respectively. Hence, glucose and cAMP specifically bound to Tetrahymena pyriformis cells and stimulated activities of cyclases in these infusoria.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barnes, N.M.; Costall, B.; Egli, P.

    The angiotensin converting enzyme (ACE) inhibitor ({sup 3}H)SQ29,852 identified a single high affinity recognition site (defined by 10.0 microM captopril) in the human temporal cortex (pKD 8.62 +/- 0.03; Bmax 248 +/- 24 fmol mg-1 protein, mean +/- S.E.M., n = 4). ACE inhibitors and thiorphan competed to a similar level for the ({sup 3}H)SQ29,852 binding site in the human temporal cortex with a rank order of affinity (pKi values mean +/- S.E.M., n = 3), lisinopril (9.49 +/- 0.02), captopril (9.16 +/- 0.08), SQ29,852 (8.58 +/- 0.04), epicaptopril (7.09 +/- 0.08), fosinopril (7.08 +/- 0.05) and thiorphan (6.40 +/-more » 0.04). Since this rank order of affinity is similar to the affinity of these compounds to inhibit brain ACE activity it is concluded that ({sup 3}H)SQ29,852 selectively labels the inhibitor recognition site of ACE in the human temporal cortex.« less

  13. Identification of Critical Residues Involved in Ligand Binding and G Protein Signaling in Human Somatostatin Receptor Subtype 2

    PubMed Central

    Parry, Jesse J.; Chen, Ronald; Andrews, Rebecca; Lears, Kimberly A.

    2012-01-01

    G protein signaling through human somatostatin receptor subtype 2 (SSTR2) is well known, but the amino acids involved in stimulation of intracellular responses upon ligand binding have not been characterized. We constructed a series of point mutants in SSTR2 at amino acid positions 89, 139, and 140 in attempts to disrupt G protein signaling upon ligand binding. The aspartic acid changes at position 89 to either Ala, Leu, or Arg generated mutant receptors with varying expression profiles and a complete inability to bind somatostatin-14 (SST). Mutations to Asp 139 and Arg 140 also led to varying expression profiles with some mutants maintaining their affinity for SST. Mutation of Arg 140 to Ala resulted in a mutated receptor that had a Bmax and dissociation constant (Kd) similar to wild-type receptor but was still coupled to the G protein as determined in both a cAMP assay and a calcium-release assay. In contrast, mutation of Asp 139 to Asn resulted in a mutated receptor with Bmax and Kd values that were similar to wild type but was uncoupled from G protein-mediated cAMP signaling, but not calcium release. Thus, we identified mutations in SSTR2 that result in either receptor expression levels that are similar to wild type but is completely ablated for ligand binding or a receptor that maintains affinity for SST and is uncoupled from G protein-mediated cAMP signaling. PMID:22495673

  14. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    PubMed

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  15. Regulation of renal adenosine A(1) receptors: effect of dietary sodium chloride.

    PubMed

    Smith, J A; Whitaker, E M; Yaktubay, N; Morton, M J; Bowmer, C J; Yates, M S

    1999-11-12

    The influence of dietary NaCl on the regulation of renal adenosine A(1) receptors was investigated in the rat. Renal membranes from rats fed on a diet low (0.04%) in NaCl showed a 46% increase in B(max) for the binding of [3H]-1,3-dipropyl-8-cyclopentylxanthine ([3H]DPCPX), a selective adenosine A(1) receptor antagonist, compared to membranes from rats fed on a normal diet (0.4% NaCl). Conversely, a high NaCl diet (4.0%) resulted in a 37% decrease in B(max). Levels of renal adenosine A(1) receptor mRNA were 65% lower in rats on a high salt diet. Autoradiographic studies showed that, for the inner medullary collecting ducts, a low NaCl diet resulted in a 30% increase in [3H]DPCPX binding with a 39% decrease noted in rats maintained on a high salt diet. The results indicate that changes in adenosine A(1) receptor density may represent a novel mechanism whereby the kidneys adapt to changes in salt load.

  16. Kinetic analysis of central ( sup 11 C)raclopride binding to D2-dopamine receptors studied by PET--a comparison to the equilibrium analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farde, L.; Eriksson, L.; Blomquist, G.

    1989-10-01

    (11C)Raclopride binding to central D2-dopamine receptors in humans has previously been examined by positron emission tomography (PET). Based on the rapid occurrence of binding equilibrium, a saturation analysis has been developed for the determination of receptor density (Bmax) and affinity (Kd). For analysis of PET measurements obtained with other ligands, a kinetic three-compartment model has been used. In the present study, the brain uptake of (11C)raclopride was analyzed further by applying both a kinetic and an equilibrium analysis to data obtained from four PET experiments in each of three healthy subjects. First regional CBV was determined. In the second andmore » third experiment, (11C)-raclopride with high and low specific activity was used. In a fourth experiment, the (11C)raclopride enantiomer (11C)FLB472 was used to examine the concentration of free radioligand and nonspecific binding in brain. Radio-activity in arterial blood was measured using an automated blood sampling system. Bmax and Kd values for (11C)raclopride binding could be determined also with the kinetic analysis. As expected theoretically, those values were similar to those obtained with the equilibrium analysis. In addition, the kinetic analysis allowed separate determination of the association and dissociation rate constants, kon and koff, respectively. Examination of (11C)raclopride and (11C)FLB472 uptake in brain regions devoid of specific D2-dopamine receptor binding indicated a fourth compartment in which uptake was reversible, nonstereoselective, and nonsaturable in the dose range studied.« less

  17. Decreased striatal and enhanced thalamic dopaminergic responsivity in detoxified cocaine abusers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Volkow, N.D.; Wang, G.J.; Fowler, J.S.

    It has been hypothesized that cocaine addiction could result from decreased brain dopamine (DA) function. However, little is known about changes in (DA) neurotransmission in human cocaine addiction. We used PET and [C-11]raclopride, a DA D2 receptor ligand sensitive to competition with endogenous DA, to measure relative changes in extracellular DA induced by methylphenidate (MP) in 20 cocaine abusers (3-6 weeks after cocaine discontinuation) and 23 controls. MP did not affect the transport of [C-11]raclopride from blood to brain (K1); however it induced a significant reduction in DA D2 receptor availability (Bmax/Kd) in striatum. The magnitude of ND-induced changes inmore » striatal [C-11]raclopride binding were significantly larger in controls (21 + 13% change from baseline) than in cocaine abusers (9 {+-} 13 %) (ANOVA p < 0.005). In cocaine abusers, but not in controls, MP also decreased Bmax/Kd values in thalamus (29 {+-} 35 %) (ANOVA p < 0.005). There were no differences in plasma MP concentration between the groups. In striatum MP-induced changes in Bmax/Kd were significantly correlated with MP-induced changes in self reports of restlessness (r = 0.49, df 42, p < 0.002). In thalamus MP-induced changes in Bmax/Kd were significantly correlated with ND-induced changes in self reports of cocaine craving (r = 0.57, df 42, p < 0.0001). These results are compatible with a decrease in striatal DA brain function in cocaine abusers. They also suggest a participation of thalamic DA pathways in cocaine addiction.« less

  18. Oxytocin receptors expressed and coupled to Ca2+ signalling in a human vascular smooth muscle cell line.

    PubMed

    Yazawa, H; Hirasawa, A; Horie, K; Saita, Y; Iida, E; Honda, K; Tsujimoto, G

    1996-03-01

    1. In a human vascular smooth muscle cell line (HVSMC), binding experiments with [3H]-arginine8-vasopressin (AVP) have shown the existence of a homogeneous population of binding sites with affinity (Kd value) of 0.65 nM and a maximum number of binding sites (Bmax) of 122 fmol mg-1 protein. 2. Nonlabelled compounds compete for [3H]-AVP binding in the HVSMC membrane with an order of potency of oxytocin > lyspressin > or = AVP > Thr4, Gly7-oxytocin > (beta-mercapto-beta-beta-cyclopentamethylenepropionyl-O-Me Tyr2, Arg8) vasopressin > desmopressin > OPC21268 > OPC31260. This order was markedly different from that observed in rat vascular smooth muscle cells (A10), a well-established V1A receptor system. 3. In HVSMC both oxytocin and AVP increased inositol 1,4,5-trisphosphate (IP3) production and [Ca2+]i response, but the efficacy of the responses was greater for oxytocin than AVP. 4. Reverse transcription-polymerase chain reaction (RT-PCR) assay detected only oxytocin receptor but not V1A or V2 receptors in HVSMC, whereas only V1A receptors were found in A10 cells. 5. In conclusion, in HVSMC only oxytocin receptors are expressed among the vasopressin receptor family, and they coupled to phosphatidyl inositol (PI) turnover/Ca2+ signalling. This unexpected observation should provide new insight into the functional role of the oxytocin receptor in a human vascular smooth muscle cell line.

  19. Protoporphyrinogen oxidase: high affinity tetrahydrophthalimide radioligand for the inhibitor/herbicide-binding site in mouse liver mitochondria.

    PubMed

    Birchfield, N B; Casida, J E

    1996-01-01

    Protoporphyrinogen oxidase (protox), the last common enzyme in heme and chlorophyll biosynthesis, is the target of several classes of herbicides acting as inhibitors in both plants and mammals. N-(4-Chloro-2-fluoro-5-(propargyloxy)phenyl)-3,4,5,6-tetrahydro phthalimide (a potent protox inhibitor referred to as THP) was synthesized as a candidate radioligand ([3H]-THP) by selective catalytic reduction of 3,6-dihydrophthalic anhydride (DHPA) with tritium gas followed by condensation in 45% yield with 4-chloro-2-fluoro-5-(propargyloxy)aniline. Insertion of tritium at the 3 and 6 carbons of DHPA as well as the expected 4 and 5 carbons resulted in high specific activity [3H]THP (92 Ci/mmol). This radioligand undergoes rapid, specific, saturable, and reversible binding to the inhibitor/herbicide binding site of the protox component of cholate-solubilized mouse liver mitochondria with an apparent Kd of 0.41 nM and Bmax of 0.40 pmol/mg of protein. In the standard assay, mouse preparation (150 micrograms of protein) and [3H]THP (0.5 nM) are incubated in 500 microL of phosphate buffer at pH 7.2 for 15 min at 25 degrees C followed by addition of ammonium sulfate and filtration with glass fiber filters. The potencies of five nitrodiphenyl ethers and two other herbicides as inhibitors of [3H]THP binding correlate well with those for inhibition of protox activity (r2 = 0.97, n = 7), thus validating the binding assay as relevant to enzyme inhibition. It is also suitable to determine in vivo block as illustrated by an approximately 50% decrease in [3H]THP binding in liver mitochondria from mice treated ip with oxyfluorfen at 4 mg/kg. This is the first report of a binding assay for protox in mammals. The high affinity and specific activity of [3H]THP facilitate quantitation of protox and therefore research on a sensitive inhibition site for porphyrin biosynthesis.

  20. [125I]2-(2-chloro-4-iodo-phenylamino)-5-methyl-pyrroline (LNP 911), a high-affinity radioligand selective for I1 imidazoline receptors.

    PubMed

    Greney, Hugues; Urosevic, Dragan; Schann, Stephan; Dupuy, Laurence; Bruban, Véronique; Ehrhardt, Jean-Daniel; Bousquet, Pascal; Dontenwill, Monique

    2002-07-01

    The I1 subtype of imidazoline receptors (I1R) is a plasma membrane protein that is involved in diverse physiological functions. Available radioligands used so far to characterize the I(1)R were able to bind with similar affinities to alpha2-adrenergic receptors (alpha2-ARs) and to I1R. This feature was a major drawback for an adequate characterization of this receptor subtype. New imidazoline analogs were therefore synthesized and the present study describes one of these compounds, 2-(2-chloro-4-iodo-phenylamino)-5-methyl-pyrroline (LNP 911), which was of high affinity and selectivity for the I1R. LNP 911 was radioiodinated and its binding properties characterized in different membrane preparations. Saturation experiments with [125I]LNP 911 revealed a single high affinity binding site in PC-12 cell membranes (K(D) = 1.4 nM; B(max) = 398 fmol/mg protein) with low nonspecific binding. [125I]LNP 911 specific binding was inhibited by various imidazolines and analogs but was insensitive to guanosine-5'-O-(3-thio)triphosphate. The rank order of potency of some competing ligands [LNP 911, PIC, rilmenidine, 4-chloro-2-(imidazolin-2-ylamino)-isoindoline (BDF 6143), lofexidine, and clonidine] was consistent with the definition of [125I]LNP 911 binding sites as I1R. However, other high-affinity I1R ligands (moxonidine, efaroxan, and benazoline) exhibited low affinities for these binding sites in standard binding assays. In contrast, when [125I]LNP 911 was preincubated at 4 degrees C, competition curves of moxonidine became biphasic. In this case, moxonidine exhibited similar high affinities on [125I]LNP 911 binding sites as on I1R defined with [125I]PIC. Moxonidine proved also able to accelerate the dissociation of [125I]LNP 911 from its binding sites. These results suggest the existence of an allosteric modulation at the level of the I1R, which seems to be corroborated by the dose-dependent enhancement by LNP 911 of the agonist effects on the adenylate cyclase pathway associated to I1R. Because [125I]LNP 911 was unable to bind to the I2 binding site and alpha2AR, our data indicate that [125I]LNP 911 is the first highly selective radioiodinated probe for I1R with a nanomolar affinity. This new tool should facilitate the molecular characterization of the I1 imidazoline receptor.

  1. Modulation of the platelet serotonin transporter by thermal balneotherapy: a study in healthy subjects.

    PubMed

    Baroni, S; Marazziti, D; Consoli, G; Picchetti, M; Catena-Dell'Osso, M; Galassi, A

    2012-05-01

    Although the beneficial effects of balneotherapy have been recognized since a long time, a few information is available on the biological mechanisms underlying them and the subjective feelings of increased well-being and mood. The links between the serotonin (5-HT) system and mood prompted us to investigate the 5-HT platelet transporter (SERT), which is considered a reliable, peripheral marker of the same structure present in presynaptic neurons, in 30 healthy volunteers before (t0) and 30 minutes after (t1) thermal balneotherapy with ozonized water, as compared with a similar group who underwent a bath in non-mineral water. MATERIALS AN METHODS: The SERT was evaluated by means of the specific binding of 3H-paroxetine (3H-Par) to platelet membranes. Equilibrium-saturation binding data, the maximal binding capacity (Bmax) and the dissociation constant (Kd), were obtained by means of the Scatchard analysis. The results showed that, while Bmax values did not change in both groups, the Kd values decreased significantly at t1 only in those subjects who bathed in ozonized water. The results of this study, while showing a decrease of the dissociation constant (Kd) which is the inverse of affinity constant, of 3H-Par binding to SERT in all subjects after balneotherapy and not in those bathing in normal water, suggest that SERT modifications may be related to a specific effect of ozonized water and, perhaps, also to the increased sense of well-being.

  2. Thermal balneotherapy induces changes of the platelet serotonin transporter in healthy subjects.

    PubMed

    Marazziti, Donatella; Baroni, Stefano; Giannaccini, Gino; Catena Dell'Osso, Mario; Consoli, Giorgio; Picchetti, Michela; Carlini, Marina; Massimetti, Gabriele; Provenzano, Serafina; Galassi, Antonio

    2007-10-01

    Although the beneficial effects of balneotherapy have been recognized since a long time, a few information is available on the biological mechanisms underlying them and the subjective feelings of increased well-being and mood. The links between the serotonin (5-HT) system and mood prompted us to investigate the 5-HT platelet transporter (SERT), which is considered a reliable, peripheral marker of the same structure present in presynaptic neurons, in 20 healthy volunteers before (t0) and 30 min after (t1) thermal balneotherapy with ozonized water of Montecatini spa, as compared with a similar group who underwent a bath in non-mineral water. The SERT was evaluated by means of the specific binding of (3)H-paroxetine ((3)H-Par) to platelet membranes. Equilibrium-saturation binding data, the maximal binding capacity (Bmax) and the dissociation constant (Kd), were obtained by means of the Scatchard analysis. The results showed that, while Bmax values did not change in both groups, the Kd values decreased significantly at t1 only in those subjects who bathed in ozonized water. The results of this study, while showing a decrease of the dissociation constant (Kd) which is the inverse of affinity constant, of (3)H-Par binding to SERT in all subjects after balneotherapy and not in those bathing in normal water, suggest that SERT modifications may be related to a specific effect of ozonized water and, perhaps, also to the increased sense of well-being.

  3. Vasopressin V1 receptor in rat hippocampus is regulated by adrenocortical functions.

    PubMed

    Saito, R; Ishiharada, N; Ban, Y; Honda, K; Takano, Y; Kamiya, H

    1994-05-16

    Two subtypes of arginine vasopressin (AVP) receptors (V1 and V2) have been distinguished. In this study, we examined the characteristics of AVP binding in rat hippocampus and the effects of bilateral adrenalectomy and adrenal steroids on its [3H]AVP binding. [3H]AVP binding to rat liver and the hippocampal membranes was strongly inhibited by the V1 antagonist, OPC-21268. ADX resulted in a significant decrease in the Bmax of AVP binding in the hippocampus. Chronic treatment with aldosterone and corticosterone restored the ADX-induced reduction, but treatment with dexamethasone did not. These results suggest that the AVP V1 receptor in the hippocampus is regulated by adrenocortical neuroregulatory functions.

  4. Smooth muscle cell biglycan overexpression results in increased lipoprotein retention on extracellular matrix: implications for the retention of lipoproteins in atherosclerosis.

    PubMed

    O'Brien, Kevin D; Lewis, Katherine; Fischer, Jens W; Johnson, Pamela; Hwang, Jin-Yong; Knopp, Eleanor A; Kinsella, Michael G; Barrett, P Hugh R; Chait, Alan; Wight, Thomas N

    2004-11-01

    Lipoprotein retention on extracellular matrix (ECM) may play a central role in atherogenesis, and a specific extracellular matrix proteoglycan, biglycan, has been implicated in lipoprotein retention in human atherosclerosis. To test whether increased cellular biglycan expression results in increased retention of lipoproteins on ECM, rat aortic smooth muscle cells (SMCs) were transduced with a human biglycan cDNA-containing retroviral vector (LBSN) or with an empty retroviral vector (LXSN). To assess the importance of biglycan's glycosaminoglycan side chains in lipoprotein retention, ECM binding studies were also performed using RASMCs transduced with a retroviral vector encoding for a mutant, glycosaminoglycan-deficient biglycan (LBmutSN). Human biglycan mRNA and protein were confirmed in LBSN and LBmutSN RASMCs by Northern and Western blot analyses. HDL3+E binding to SMC ECM was increased significantly (as determined by 95% confidence intervals for binding curves) for LBSN as compared to either LXSN or LBmutSN cells; the increases for LBSN cell ECM were due primarily to an approximately 50% increase in binding sites (increased Bmax) versus LXSN cell ECM and of approximately 25% versus LBmutSN cell ECM. These results are consistent with the hypothesis that biglycan, through its glycosaminoglycan side chains, may mediate lipoprotein retention on atherosclerotic plaque ECM.

  5. Interaction of a radiolabeled agonist with cardiac muscarinic cholinergic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harden, T.K.; Meeker, R.B.; Martin, M.W.

    The interaction of a radiolabeled muscarinic cholinergic receptor agonist, (methyl-/sup 3/H)oxotremorine acetate ((/sup 3/H)OXO), with a washed membrane preparation derived from rat heart, has been studied. In binding assays at 4 degrees C, the rate constants for association and dissociation of (/sup 3/H)OXO were 2 X 10(7) M-1 min-1 and 5 X 10(-3) min-1, respectively, Saturation binding isotherms indicated that binding was to a single population of sites with a Kd of approximately 300 pM. The density of (/sup 3/H)OXO binding sites (90-100 fmol/mg of protein) was approximately 75% of that determined for the radiolabeled receptor antagonist (/sup 3/H)quinuclidinyl benzilate.more » Both muscarinic receptor agonists and antagonists inhibited the binding of (/sup 3/H)OXO with high affinity and Hill slopes of approximately one. Guanine nucleotides completely inhibited the binding of (/sup 3/H)OXO. This effect was on the maximum binding (Bmax) of (/sup 3/H)OXO with no change occurring in the Kd; the order of potency for five nucleotides was guanosine 5'-O-(3-thio-triphosphate) greater than 5'-guanylylimidodiphosphate greater than GTP greater than or equal to guanosine/diphosphate greater than GMP. The (/sup 3/H)OXO-induced interaction of muscarinic receptors with a guanine nucleotide binding protein was stable to solubilization. That is, membrane receptors that were prelabeled with (/sup 3/H)OXO could be solubilized with digitonin, and the addition of guanine nucleotides to the soluble, (/sup 3/H)OXO-labeled complex resulted in dissociation of (/sup 3/H)OXO from the receptor. Pretreatment of membranes with relatively low concentrations of N-ethylmaleimide inhibited (/sup 3/H)OXO binding by 85% with no change in the Kd of (/sup 3/H)OXO, and with no effect on (/sup 3/H)quinuclidinyl benzilate binding.« less

  6. Down-regulation of muscarinic receptors and the m3 subtype in white-footed mice by dietary exposure to parathion

    USGS Publications Warehouse

    Jett, David A.; Hill, E.F.; Fernando, J.C.; Eldefrawi, M.E.; Eldefrawi, A.T.

    1993-01-01

    The effect of ad libitum dietary exposure (as occurs in the field) to parathion for 14 d was investigated on the muscarinic acetylcholine receptor (mAChR) in brains and submaxillary glands of adults of a field species, the white-footed mouse Peromyscus leucopus. Immunoprecipitation using subtype selective antibodies revealed that the relative ratios of the m1-m5 mAChR subtypes in Peromyscus brain were similar to those in rat brain. There was little variability in acetylcholinesterase (AChE) activity in control mice brains but large variability in 39 exposed mice, resulting from differences in food ingestion and parathion metabolism. Accordingly, data on radioligand binding to mAChRs in each mouse brain were correlated with brain AChE activity in the same mouse, and AChE inhibition served as a biomarker of exposure reflecting in situ paraoxon concentrations. Exposure to parathion for 14 d reduced maximal binding (Bmax) of [3H]quinuclidinyl benzilate ([3H]QNB), [3H]-N-methylscopolamine ([3H]NMS), and [3H]-4-diphenylacetoxy-N-methylpiperidine methiodide ([3H]-4-DAMP) by up to approximately 58% without affecting receptor affinities for these ligands. Maximal reduction in Bmax of [3H]QNB and [3H]-4-DAMP binding occurred in mice with highest AChE inhibition, while equivalent maximal reduction in Bmax of [3H]NMS occurred in mice with only approximately 10% AChE inhibition, without further change at higher parathion doses. This is believed to be due to the hydrophilicity of [3H]NMS, which limits its accessibility to internalized desensitized receptors. In submaxillary glands (mAChRs are predominantly m3 subtype), there were significant dose-dependent reductions in [3H]QNB binding and m3 mRNA levels in exposed mice, revealed by Northern blot analyses. The reduction in m3 receptors is suggested to result mostly from reduced synthesis at the transcription level, rather than from translational or posttranslational events. The data suggest that down-regulation of mAChRs occurs after dietary exposure for 14 d to sublethal concentrations of parathion in a field rodent species, and that significant though incomplete recovery in AChE and mAChRs occurs in 7 d following termination of exposure.

  7. Comparison of two cross-bridged macrocyclicchelators for the evaluation of 64Cu-labeled-LLP2A, a peptidomimetic ligand targeting VLA-4-positive tumors

    PubMed Central

    Jiang, Majiong; Ferdani, Riccardo; Shokeen, Monica; Anderson, Carolyn J.

    2013-01-01

    Integrin α4β1 (also called very late antigen-4 or VLA-4) plays an important role in tumor growth, angiogenesis and metastasis, and there has been increasing interest in targeting this receptor for cancer imaging and therapy. In this study, we conjugated a peptidomimetic ligand known to have good binding affinity for α4β1 integrin to a cross-bridged macrocyclicchelator with a methane phosphonic acid pendant arm, CB-TE1A1P. CB-TE1A1P-LLP2A was labeled with 64Cu under mild conditions in high specific activity, in contrast to conjugates based on the “gold standard” di-acid cross-bridged chelator, CB-TE2A, which require high temperatures for efficient radiolabeling. Saturation binding assays demonstrated that 64Cu-CB-TE1A1P-LLP2A had comparable binding affinity(1.2 nM vs 1.6 nM) but more binding sites(Bmax = 471 fmol/mg) in B16F10 melanoma tumor cells than 64Cu-CB-TE2A-LLP2A (Bmax = 304 fmol/mg, p < 0.03). In biodistribution studies, 64Cu-CB-TE1A1P-LLP2A had less renal retention but higher uptake in tumor(11.4 ± 2.3 %ID/g versus 3.1± 0.6 %ID/g, p<0.001)and other receptor-rich tissues compared to 64Cu-CB-TE2A-LLP2A. At 2 h post-injection, 64Cu-CB-TE1A1P-LLP2A also had significantly higher tumor: blood and tumor: muscle ratios than 64Cu-CB-TE2A-LLP2A(CB-TE1A1P = 19.5 ± 3.0 and 13.0 ± 1.4, respectively, CB-TE2A = 4.2 ± 1.4 and 5.5 ± 0.9, respectively, p< 0.001). These data demonstrate that 64Cu-CB-TE1A1P-LLP2A is an excellent PET radiopharmaceutical for the imaging of α4β1 positive tumors and also has potential for imaging other α4β1 positive cells such as those of the pre-metastatic niche. PMID:23265977

  8. Unsurmountable antagonism of brain 5-hydroxytryptamine2 receptors by (+)-lysergic acid diethylamide and bromo-lysergic acid diethylamide.

    PubMed

    Burris, K D; Sanders-Bush, E

    1992-11-01

    Lysergic acid diethylamide (LSD) and its structural analogue 2-bromo-lysergic acid diethylamide (BOL) act as unsurmountable antagonists of serotonin-elicited contractions in smooth muscle preparations. Two different models, allosteric and kinetic, have been invoked to explain these findings. The present studies investigate the mechanism of antagonism of brain 5-hydroxytryptamine (5HT)2 receptors, utilizing cells transfected with 5HT2 receptor cDNA cloned from rat brain. A proximal cellular response, phosphoinositide hydrolysis, was examined in order to minimize possible postreceptor effects. Even though LSD behaved as a partial agonist and BOL as a pure antagonist, both drugs blocked the effect of serotonin in an unsurmountable manner, i.e., increasing concentrations of serotonin could not overcome the blocking effect of LSD or BOL. Radioligand binding studies showed that preincubation of membranes with either LSD or BOL reduced the density of [3H]ketanserin binding sites, suggesting that the drugs bind tightly to the 5HT2 receptor and are not displaced during the binding assay. Two additional experiments supported this hypothesis. First, the off-rate of [3H] LSD was slow (20 min), relative to that of [3H]ketanserin (approximately 4 min). Second, when the length of incubation with [3H]ketanserin was increased to 60 min, the LSD-induced decrease in Bmax was essentially eliminated. The possibility that LSD and BOL decrease [3H]ketanserin binding by interacting with an allosteric site was rejected, because neither drug altered the rate of dissociation of [3H]ketanserin. The most parsimonious interpretation of these results is that unsurmountable antagonism reflects prolonged occupancy of the receptor by slowly reversible antagonists.

  9. Radioligand binding reveals chymase as the predominant enzyme for mediating tissue conversion of angiotensin I in the normal human heart.

    PubMed

    Katugampola, Sidath D; Davenport, Anthony P

    2002-01-01

    We investigated the binding characteristics of angiotensin receptors and used this assay to determine the predominant enzyme capable of converting angiotensin I in the human left ventricle. In homogenates of human left ventricle, (125)I-[Sar(1),Ile(8)]angiotensin II bound with sub-nanomolar affinity, with a corresponding K(D) of 0.42+/-0.09 nM, a B(max) of 11.2+/-2.3 fmol.mg(-1) protein and a Hill slope of 1.04+/-0.04. The rank order of inhibitory potency of competing ligands for the (125)I-[Sar(1),Ile(8)]angiotensin II binding site was CGP42112>angiotensin II> or =angiotensin III=angiotensin I>losartan. The angiotensin type II (AT(2)) receptor predominated in the human left ventricle over the angiotensin type I (AT(1)) receptor, with an approximate AT(1)/AT(2) receptor ratio of 35:65. No specific (125)I-angiotensin IV binding sites could be detected in the human left ventricle. Using competitive radioligand binding assays, we were able to demonstrate that the chymase/cathepsin G enzyme inhibitor chymostatin was more potent than the angiotensin-converting enzyme (ACE) inhibitor captopril at inhibiting the conversion of angiotensin I in the human left ventricle. Aprotonin (an inhibitor of cathepsin G but of not chymase) had no effect on angiotensin I conversion, suggesting that the majority of the conversion was mediated by chymase. Thus, although the current therapies used for the renin-angiotensin system have focused on ACE inhibitors and AT(1) receptor antagonists, the left ventricle of the human heart expresses mainly AT(2) receptors and the tissue-specific conversion of angiotensin I occurs predominantly via chymase rather than ACE.

  10. Inhibition of GABA-gated chloride channels by 12,14-dichlorodehydroabietic acid in mammalian brain

    PubMed Central

    Nicholson, Russell A; Lees, George; Zheng, Jian; Verdon, Bernard

    1999-01-01

    12,14-dichlorodehydroabietic acid (12,14-Cl2DHA) reduced GABA-stimulated uptake of 36Cl− into mouse brain synaptoneurosomes suggesting inhibition of mammalian GABAA receptor function. 12,14-Cl2DHA did not affect the binding of [3H]-muscimol to brain membranes but displaced specifically bound [3H]-EBOB. The inhibitory effect on [3H]-EBOB binding was not reversible. 12,14-Cl2DHA reduced the availability of [3H]-EBOB binding sites (Bmax) without changing the KD of the radioligand for remaining sites. 12,14-Cl2DHA did not affect the rate of association of [3H]-EBOB with its chloride channel receptor, but increased the initial rate of [3H]-EBOB dissociation. 12,14-Cl2DHA enhanced the incidence of EPSCs when rapidly applied to cultured rat cortical neurones. Longer exposures produced block of IPSCs with marked increases in the frequency of EPSCs and min EPSCs. 12,14-Cl2DHA also irreversibly suppressed chloride currents evoked by pulses of exogenous GABA in these cells. Ultimately, 12,14-Cl2DHA inhibited all synaptic traffic and action currents in current clamped cells indicating that, in contrast to picrotoxinin (which causes paroxysmal bursting), it is not fully selective for the GABAA receptor-chloride channel complex. The depolarizing block seen with 12,14-Cl2DHA in amphotericin-perforated preparations implicates loss of Ca2+ buffering in the polarity change and this may account for inhibition of spontaneous action potentials. Our investigation demonstrates that 12,14-Cl2DHA blocks GABA-dependent chloride entry in mammalian brain and operates as a non-competitive insurmountable GABAA antagonist. The mechanism likely involves either irreversible binding of 12,14-Cl2DHA to the trioxabicyclooctane recognition site or a site that is allosterically coupled to it. We cannot exclude, however, the possibility that 12,14-Cl2DHA causes localized proteolysis or more extensive conformational change within a critical subunit of the chloride channel. PMID:10204999

  11. Characterization of the high affinity binding of epsilon toxin from Clostridium perfringens to the renal system.

    PubMed

    Dorca-Arévalo, Jonatan; Martín-Satué, Mireia; Blasi, Juan

    2012-05-25

    Epsilon toxin (ε-toxin), produced by Clostridium perfringens types B and D, causes fatal enterotoxaemia in livestock. In the renal system, the toxin binds to target cells before oligomerization, pore formation and cell death. Still, there is little information about the cellular and molecular mechanism involved in the initial steps of the cytotoxic action of ε-toxin, including the specific binding to the target sensitive cells. In the present report, the binding step of ε-toxin to the MDCK cell line is characterized by means of an ELISA-based binding assay with recombinant ε-toxin-green fluorescence protein (ε-toxin-GFP) and ε-prototoxin-GFP. In addition, different treatments with Pronase E, detergents, N-glycosidase F and beta-elimination on MDCK cells and renal cryosections have been performed to further characterize the ε-toxin binding. The ELISA assays revealed a single binding site with a similar dissociation constant (K(d)) for ε-toxin-GFP and ε-prototoxin-GFP, but a three-fold increase in B(max) levels in the case of ε-toxin-GFP. Double staining on kidney cryoslices with lectins and ε-prototoxin-GFP revealed specific binding to distal and collecting tubule cells. In addition, experiments on kidney and bladder cryoslices demonstrated the specific binding to distal tubule of a range of mammalian renal systems. Pronase E and beta-elimination treatments on kidney cryoslices and MDCK cells revealed that the binding of ε-toxin in renal system is mediated by a O-glycoprotein. Detergent treatments revealed that the integrity of the plasma membrane is required for the binding of ε-toxin to its receptor. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raffa, R.B.; Baldy, W.J. Jr.; Shank, R.P.

    Tritiated (D-Ala2,NMePhe4,Gly-ol5)-enkephalin ((3H)DAGO) was used to examine mu-opioid receptor number and mu-ligand binding in brain synaptic membranes (P2 fraction) from C57BL/6J-bgJ/bgJ (beige-J) mice, a strain with combined deficiencies in immunological function (resembling Chediak-Higashi syndrome) and analgesic response to mu-opioid agonists such as morphine and DAGO. As controls, white mice, beige-J littermates (normally responsive to mu-opioid agonists), and a known mu-deficient strain (CXBK) were also examined. Neither the KD (0.47 to 0.49 nM) nor the Bmax (153 to 168 fmol/mg protein) determined for beige-J mice was significantly different from values determined for littermates or white mice. In contrast, the Bmax ofmore » CXBK mice (66 fmol/mg protein) was clearly less than that of the other strains. The analgesic defect of beige-J mice, therefore, is not likely due to an insufficient number of mu-opioid receptors, as it presumably is in CXBK mice. Carbachol (200 micrograms/ml), which partly corrects the analgesic defect of beige-J mice, had no effect on (3H)DAGO binding either acutely in vitro or chronically ex vivo after administration to beige-J mice for three weeks. Hence, the analgesic defect of beige-J mice appears to be due to some defect in the mu-opioid receptor-effector coupling mechanism or to some endogenous substance that inhibits binding of mu-opioid ligands to otherwise functional receptors.« less

  13. Pharmacologic characterization of the oxytocin receptor in human uterine smooth muscle cells

    PubMed Central

    Tahara, Atsuo; Tsukada, Junko; Tomura, Yuichi; Wada, Koh-ichi; Kusayama, Toshiyuki; Ishii, Noe; Yatsu, Takeyuki; Uchida, Wataru; Tanaka, Akihiro

    2000-01-01

    [3H]-oxytocin was used to characterize the oxytocin receptor found in human uterine smooth muscle cells (USMC). Specific binding of [3H]-oxytocin to USMC plasma membranes was dependent upon time, temperature and membrane protein concentration. Scatchard plot analysis of equilibrium binding data revealed the existence of a single class of high-affinity binding sites with an apparent equilibrium dissociation constant (Kd) of 0.76 nM and a maximum receptor density (Bmax) of 153 fmol mg−1 protein. The Hill coefficient (nH) did not differ significantly from unity, suggesting binding to homogenous, non-interacting receptor populations. Competitive inhibition of [3H]-oxytocin binding showed that oxytocin and vasopressin (AVP) receptor agonists and antagonists displaced [3H]-oxytocin in a concentration-dependent manner. The order of potencies for peptide agonists and antagonists was: oxytocin>[Asu1,6]-oxytocin>AVP= atosiban>d(CH2)5Tyr(Me)AVP>[Thr4,Gly7]-oxytocin>dDAVP, and for nonpeptide antagonists was: L-371257>YM087>SR 49059>OPC-21268>SR 121463A>OPC-31260. Oxytocin significantly induced concentration-dependent increase in intracellular Ca2+ concentration ([Ca2+]i) and hyperplasia in USMC. The oxytocin receptor antagonists, atosiban and L-371257, potently and concentration-dependently inhibited oxytocin-induced [Ca2+]i increase and hyperplasia. In contrast, the V1A receptor selective antagonist, SR 49059, and the V2 receptor selective antagonist, SR 121463A, did not potently inhibit oxytocin-induced [Ca2+]i increase and hyperplasia. The potency order of antagonists in inhibiting oxytocin-induced [Ca2+]i increase and hyperplasia was similar to that observed in radioligand binding assays. In conclusion, these data provide evidence that the high-affinity [3H]-oxytocin binding site found in human USMC is a functional oxytocin receptor coupled to [Ca2+]i increase and cell growth. Thus human USMC may prove to be a valuable tool in further investigation of the physiologic and pathophysiologic roles of oxytocin in the uterus. PMID:10694212

  14. Both endothelin-A and endothelin-B receptors are present on adult rat cardiac ventricular myocytes.

    PubMed

    Allen, Bruce G; Phuong, Luu Lien; Farhat, Hala; Chevalier, Dominique

    2003-02-01

    Endothelin-A (ET(A)) and endothelin-B (ET(B)) receptors have been demonstrated in intact heart and cardiac membranes. ET(A) receptors have been demonstrated on adult ventricular myocytes. The aim of the present study was to determine the presence of ET(B) and the relative contribution of this receptor subtype to total endothelin-1 (ET-1) binding on adult ventricular myocytes. Saturation binding experiments indicated that ET-1 bound to a single population of receptors (Kd = 0.52 +/- 0.13 nM, n = 4) with an apparent maximum binding (Bmax) of 2.10 +/- 0.25 sites (x 10(5))/cell (n = 4). Competition experiments using 40 pM [125I]ET-1 and nonradioactive ET-1 revealed a Ki of 660 +/- 71 pM (n = 10) and a Hill coefficient (nH) of 0.99 +/- 0.10 (n = 10). A selective ET(A) antagonist, BQ610, displaced 80% of the bound [125I]ET-1. No displacement was observed by concentrations of an ET(B)-selective antagonist, BQ788, up to 1.0 microM. However, in the presence of 1.0 microM BQ610, BQ788 inhibited the remaining [125I]ET-1 binding. Similarly, in the presence of 1.0 microM BQ788, BQ610 inhibited the remaining specific [125I]ET-1 binding. Binding of an ET(B1)-selective agonist, [125I]IRL-1620, confirmed the presence of ET(B). ET(B) bound to ET-1 irreversibly, whereas binding to ET(A) demonstrated both reversible and irreversible components, and BQ610 and BQ788 bound reversibly. Reducing the incubation temperature to 0 degrees C did not alter the irreversible component of ET-1 binding. Hence, both ET(A) and ET(B) receptors are present on intact adult rat ventricular myocytes, and the ratio of ET(A):ET(B) binding sites is 4:1. Both receptor subtypes bind to ET-1 by a two-step association involving the formation of a tight receptor-ligand complex; however, the kinetics of ET-1 binding to ET(A) versus ET(B) differ.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Knapp, R.J.; Sharma, S.D.; Toth, G.

    (D-Pen2,4{prime}-125I-Phe4,D-Pen5)enkephalin ((125I)DPDPE) is a highly selective radioligand for the delta opioid receptor with a specific activity (2200 Ci/mmol) that is over 50-fold greater than that of tritium-labeled DPDPE analogs. (125I)DPDPE binds to a single site in rat brain membranes with an equilibrium dissociation constant (Kd) value of 421 {plus minus} 67 pM and a receptor density (Bmax) value of 36.4 {plus minus} 2.7 fmol/mg protein. The high affinity of this site for delta opioid receptor ligands and its low affinity for mu or kappa receptor-selective ligands are consistent with its being a delta opioid receptor. The distribution of these sitesmore » in rat brain, observed by receptor autoradiography, is also consistent with that of delta opioid receptors. Association and dissociation binding kinetics of 1.0 nM (125I) DPDPE are monophasic at 25 degrees C. The association rate (k + 1 = 5.80 {plus minus} 0.88 {times} 10(7) M-1 min-1) is about 20- and 7-fold greater than that measured for 1.0 nM (3H) DPDPE and 0.8 nM (3H) (D-Pen2,4{prime}-Cl-Phe4, D-Pen5)enkephalin, respectively. The dissociation rate of (125I)DPDPE (0.917 {plus minus} 0.117 {times} 10(-2) min-1) measured at 1.0 nM is about 3-fold faster than is observed for either of the other DPDPE analogs. The rapid binding kinetics of (125I)DPDPE is advantageous because binding equilibrium is achieved with much shorter incubation times than are required for other cyclic enkephalin analogs. This, in addition to its much higher specific activity, makes (125I)DPDPE a valuable new radioligand for studies of delta opioid receptors.« less

  16. Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.

    PubMed

    Dong, Q; Schuchman, J; Carey, G B

    1994-07-01

    The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.

  17. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  18. Measurement of density and affinity for dopamine D2 receptors by a single positron emission tomography scan with multiple injections of [11C]raclopride

    PubMed Central

    Ikoma, Yoko; Watabe, Hiroshi; Hayashi, Takuya; Miyake, Yoshinori; Teramoto, Noboru; Minato, Kotaro; Iida, Hidehiro

    2010-01-01

    Positron emission tomography (PET) with [11C]raclopride has been used to investigate the density (Bmax) and affinity (Kd) of dopamine D2 receptors related to several neurological and psychiatric disorders. However, in assessing the Bmax and Kd, multiple PET scans are necessary under variable specific activities of administered [11C]raclopride, resulting in a long study period and unexpected physiological variations. In this paper, we have developed a method of multiple-injection graphical analysis (MI-GA) that provides the Bmax and Kd values from a single PET scan with three sequential injections of [11C]raclopride, and we validated the proposed method by performing numerous simulations and PET studies on monkeys. In the simulations, the three-injection protocol was designed according to prior knowledge of the receptor kinetics, and the errors of Bmax and Kd estimated by MI-GA were analyzed. Simulations showed that our method could support the calculation of Bmax and Kd, despite a slight overestimation compared with the true magnitudes. In monkey studies, we could calculate the Bmax and Kd of diseased or normal striatum in a 150 mins scan with the three-injection protocol of [11C]raclopride. Estimated Bmax and Kd values of D2 receptors in normal or partially dopamine-depleted striatum were comparable to the previously reported values. PMID:19904285

  19. Photoaffinity labeling and partial purification of the beta cell sulfonylurea receptor using a novel, biologically active glyburide analog

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aguilar-Bryan, L.; Nelson, D.A.; Vu, Q.A.

    1990-05-15

    An iodinated analog of the sulfonylurea, glyburide, has been synthesized which can be labeled to high specific activity and used to photolabel the sulfonylurea receptor. 5-Iodo-2-hydroxy-glyburide, has an iodo group replacing the chlorine at position 5 and a methoxy residue replacing the hydroxy group at position 2 on the benzamido ring. This analog retains biologic activity stimulating insulin secretion from a hamster beta cell line (HIT cells) at the same ED50 (0.4 nM) as glyburide. Scatchard analysis demonstrated high and low affinity binding sites on HIT cell membranes (Kd values of 0.36 nM and 277 nM and Bmax values ofmore » 1.6 and 100 pmol/mg of membrane protein, respectively). Competitive binding assays with unlabeled glyburide or 5-iodo-2-hydroxyglyburide yield Ki values of 0.5 and 1.0 nM, respectively. The analog can be covalently linked by ultraviolet irradiation to a membrane protein of Mr = 140,000. The photolabeling is completely blocked by unlabeled glyburide or the analog. Two other species of Mr = 65,000 and 43,000 are also photolabeled; these may be the low affinity sites. After photolabeling, the receptor has been purified partially by chromatographic procedures and is suitable for obtaining peptide sequence. The 140,000 molecular weight protein is identified as the sulfonylurea receptor since its binding constant, 0.36 nM, is closely correlated with its ability to stimulate insulin secretion (ED50 congruent to 0.4 nM).« less

  20. Receptors for luteinizing hormone-releasing hormone (LHRH) in benign prostatic hyperplasia (BPH) as potential molecular targets for therapy with LHRH antagonist cetrorelix.

    PubMed

    Rozsa, Bernadett; Nadji, Mehrdad; Schally, Andrew V; Dezso, Balazs; Flasko, Tibor; Toth, Gyorgy; Mile, Melinda; Block, Norman L; Halmos, Gabor

    2011-04-01

    The majority of men will develop symptoms of benign prostatic hyperplasia (BPH) after 70 years of age. Various studies indicate that antagonists of LHRH, such as cetrorelix, exert direct inhibitory effects on BPH mediated by specific LHRH receptors. Our aim was to investigate the mRNA for LHRH and LHRH receptors and the expression of LHRH receptors in specimens of human BPH. The expression of mRNA for LHRH (n=35) and LHRH receptors (n=55) was investigated by RT-PCR in surgical specimens of BPH, using specific primers. The characteristics of binding sites for LHRH on 20 samples were determined by ligand competition assays. The LHRH receptor expression was also examined in 64 BPH specimens by immunohistochemistry. PCR products for LHRH were found in 18 of 35 (51%) BPH tissues and mRNA for LHRH receptors was detected in 39 of 55 (71%) BPH specimens. Eighteen of 20 (90%) samples showed a single class of high affinity binding sites for [D-Trp(6) ]LHRH with a mean K(d) of 4.04 nM and a mean B(max) of 527.6 fmol/mg membrane protein. LHRH antagonist cetrorelix showed high affinity binding to LHRH receptors in BPH. Positive immunohistochemical reaction for LHRH receptors was present in 42 of 64 (67%) BPH specimens. A high incidence of LHRH receptors in BPH supports the use of LHRH antagonists such as cetrorelix, for treatment of patients with lower urinary tract symptoms from BPH. Copyright © 2010 Wiley-Liss, Inc.

  1. Identification and pharmacological characterization of native, functional human urotensin-II receptors in rhabdomyosarcoma cell lines

    PubMed Central

    Douglas, Stephen A; Naselsky, Diane; Ao, Zhaohui; Disa, Jyoti; Herold, Christopher L; Lynch, Frank; Aiyar, Nambi V

    2004-01-01

    In an effort to identify endogenous, native mammalian urotensin-II (U-II) receptors (UT), a diverse range of human, primate and rodent cell lines (49 in total) were screened for the presence of detectable [125I]hU-II binding sites. UT mRNA (Northern blot, PCR) and protein (immunocytochemistry) were evident in human skeletal muscle tissue and cells. [125I]hU-II bound to a homogenous population of high-affinity, saturable (Kd 67.0±11.8 pM, Bmax 9687±843 sites cell−1) receptors in the skeletal muscle (rhabdomyosarcoma) cell line SJRH30. Radiolabel was characteristically slow to dissociate (⩽15% dissociation 90 min). A lower density of high-affinity U-II binding sites was also evident in the rhabdomyosarcoma cell line TE671 (1667±165 sites cell−1, Kd 74±8 pM). Consistent with the profile recorded in human recombinant UT-HEK293 cells, [125I]hU-II binding to SJRH30 cells was selectively displaced by both mammalian and fish U-II isopeptides (Kis 0.5±0.1–1.2±0.3 nM) and related analogues (hU-II[4-11]>[Cys5,10]Acm hU-II; Kis 0.4±0.1 and 864±193 nM, respectively). U-II receptor activation was functionally coupled to phospholipase C-mediated [Ca2+]i mobilization (EC50 6.9±2.2 nM) in SJRH30 cells. The present study is the first to identify the presence of ‘endogenous' U-II receptors in SJRH30 and TE671 cells. SJRH30 cells, in particular, might prove to be of utility for (a) investigating the pharmacological properties of hU-II and related small molecule antagonists at native human UT and (b) delineating the role of this neuropeptide in the (patho)physiological regulation of mammalian neuromuscular function. PMID:15210573

  2. Inhibition of GABA-gated chloride channels by 12,14-dichlorodehydroabietic acid in mammalian brain.

    PubMed

    Nicholson, R A; Lees, G; Zheng, J; Verdon, B

    1999-03-01

    1. 12,14-dichlorodehydroabietic acid (12,14-Cl2DHA) reduced GABA-stimulated uptake of 36Cl- into mouse brain synaptoneurosomes suggesting inhibition of mammalian GABA(A) receptor function. 2. 12,14-Cl2DHA did not affect the binding of [3H]-muscimol to brain membranes but displaced specifically bound [3H]-EBOB. The inhibitory effect on [3H]-EBOB binding was not reversible. 12,14-Cl2DHA reduced the availability of [3H]-EBOB binding sites (Bmax) without changing the KD of the radioligand for remaining sites. 12,14-Cl2DHA did not affect the rate of association of [3H]-EBOB with its chloride channel receptor, but increased the initial rate of [3H]-EBOB dissociation. 3. 12,14-Cl2DHA enhanced the incidence of EPSCs when rapidly applied to cultured rat cortical neurones. Longer exposures produced block of IPSCs with marked increases in the frequency of EPSCs and min EPSCs. 12,14-Cl2DHA also irreversibly suppressed chloride currents evoked by pulses of exogenous GABA in these cells. 4. Ultimately, 12,14-Cl2DHA inhibited all synaptic traffic and action currents in current clamped cells indicating that, in contrast to picrotoxinin (which causes paroxysmal bursting), it is not fully selective for the GABA(A) receptor-chloride channel complex. 5. The depolarizing block seen with 12,14-Cl2DHA in amphotericin-perforated preparations implicates loss of Ca2+ buffering in the polarity change and this may account for inhibition of spontaneous action potentials. 6. Our investigation demonstrates that 12,14-Cl2DHA blocks GABA-dependent chloride entry in mammalian brain and operates as a non-competitive insurmountable GABA(A) antagonist. The mechanism likely involves either irreversible binding of 12,14-Cl2DHA to the trioxabicyclooctane recognition site or a site that is allosterically coupled to it. We cannot exclude, however, the possibility that 12,14-Cl2DHA causes localized proteolysis or more extensive conformational change within a critical subunit of the chloride channel.

  3. Pharmacology and expression analysis of glycine transporter GlyT1 with [3H]-(N-[3-(4'-fluorophenyl)-3-(4'phenylphenoxy)propyl])sarcosine.

    PubMed

    Mallorga, Pierre J; Williams, Jacinta B; Jacobson, Marlene; Marques, Rosemary; Chaudhary, Ashok; Conn, P Jeffrey; Pettibone, Douglas J; Sur, Cyrille

    2003-10-01

    In the central nervous system, re-uptake of the neurotransmitter glycine is mediated by two different glycine transporters, GlyT1 and GlyT2. GlyT2 is found in brainstem and spinal cord, whereas GlyT1 is expressed in rat forebrain regions where it is responsible for most glycine transport activity. Initially, GlyT1 and GlyT2 were pharmacologically differentiated by sarcosine, a weak selective inhibitor of GlyT1. The recently described selective and potent GlyT1 antagonist, NFPS/ALX-5407 provided an important additional tool to further characterize GlyT1 pharmacology. In the present study, we have radiolabeled the racemic form of NFPS (N-[3-(4'-fluorophenyl)-3-(4'-phenylphenoxy)propyl])sarcosine (also known as ALX-5407) to investigate its interaction with GlyT1, as well as define GlyT1 expression in the rat central nervous system. Kinetic studies indicated that [3H]NFPS binds rapidly to rat forebrain membranes and dissociates with a t(1/2) of 28 +/- 5 min. [3H]NFPS labeled a saturable population of sites in rat forebrain with a Kd of 7.1+/-1.3 nM and a B(max) of 3.14 +/- 0.26 pmol/mg protein. Bound [3H]NFPS was fully and potently displaced by unlabeled NFPS, whereas glycine and sarcosine were weak, Na+-dependent inhibitors with IC50 of 1,008 and 190 microM, respectively. Additional saturation experiments indicated that glycine and sarcosine were non-competitive antagonists of [3H]NFPS binding. Functional studies revealed that NFPS was a non-competitive inhibitor of [3H]glycine uptake and does not interact with Na+ and Cl- binding sites of GlyT1. Overall, this work shows that [3H]NFPS is a valuable tool in studying GlyT1 expression and pharmacology and that NFPS interacts with GlyT1 at a site different from the transporter translocation and ion binding sites.

  4. Ibogaine, a noncompetitive inhibitor of serotonin transport, acts by stabilizing the cytoplasm-facing state of the transporter.

    PubMed

    Jacobs, Miriam T; Zhang, Yuan-Wei; Campbell, Scott D; Rudnick, Gary

    2007-10-05

    Ibogaine, a hallucinogenic alkaloid with purported anti-addiction properties, inhibited serotonin transporter (SERT) noncompetitively by decreasing V(max) with little change in the K(m) for serotonin (5-HT). Ibogaine also inhibited binding to SERT of the cocaine analog 2beta-2-carbomethoxy-3-(4-[(125)I]iodophenyl)tropane. However, inhibition of binding was competitive, increasing the apparent K(D) without much change in B(max). Ibogaine increased the reactivity of cysteine residues positioned in the proposed cytoplasmic permeation pathway of SERT but not at nearby positions out of that pathway. In contrast, cysteines placed at positions in the extracellular permeation pathway reacted at slower rates in the presence of ibogaine. These results are consistent with the proposal that ibogaine binds to and stabilizes the state of SERT from which 5-HT dissociates to the cytoplasm, in contrast with cocaine, which stabilizes the state that binds extracellular 5-HT.

  5. Synthesis and Preclinical Evaluation of 11C-UCB-J as a PET Tracer for Imaging the Synaptic Vesicle Glycoprotein 2A in the Brain.

    PubMed

    Nabulsi, Nabeel B; Mercier, Joël; Holden, Daniel; Carré, Stephane; Najafzadeh, Soheila; Vandergeten, Marie-Christine; Lin, Shu-Fei; Deo, Anand; Price, Nathalie; Wood, Martyn; Lara-Jaime, Teresa; Montel, Florian; Laruelle, Marc; Carson, Richard E; Hannestad, Jonas; Huang, Yiyun

    2016-05-01

    The synaptic vesicle glycoprotein 2A (SV2A) is found in secretory vesicles in neurons and endocrine cells. PET with a selective SV2A radiotracer will allow characterization of drugs that modulate SV2A (e.g., antiepileptic drugs) and potentially could be a biomarker of synaptic density (e.g., in neurodegenerative disorders). Here we describe the synthesis and characterization of the SV2A PET radiotracer (11)C-UCB-J ((R)-1-((3-((11)C-methyl-(11)C)pyridin-4-yl)methyl)-4-(3,4,5-trifluorophenyl)pyrrolidin-2-one) in nonhuman primates, including whole-body biodistribution. (11)C-UCB-J was prepared by C-(11)C-methylation of the 3-pyridyl trifluoroborate precursor with (11)C-methyl iodide via the Suzuki-Miyaura cross-coupling method. Rhesus macaques underwent multiple scans including coinjection with unlabeled UCB-J (17, 50, and 150 μg/kg) or preblocking with the antiepileptic drug levetiracetam at 10 and 30 mg/kg. Scans were acquired for 2 h with arterial sampling and metabolite analysis to measure the input function. Regional volume of distribution (VT) was estimated using the 1-tissue-compartment model. Target occupancy was assessed using the occupancy plot; the dissociation constant (Kd) was determined by fitting self-blocking occupancies to a 1-site model, and the maximum number of receptor binding sites (Bmax) values were derived from baseline VT and from the estimated Kd and the nondisplaceable distribution volume (VND). (11)C-UCB-J was synthesized with greater than 98% purity. (11)C-UCB-J exhibited high free fraction (0.46 ± 0.02) and metabolized at a moderate rate (39% ± 5% and 24% ± 3% parent remaining at 30 and 90 min) in plasma. In the monkey brain, (11)C-UCB-J displayed high uptake and fast kinetics. VT was high (∼25-55 mL/cm(3)) in all gray matter regions, consistent with the ubiquitous expression of SV2A. Preblocking with 10 and 30 mg/kg of levetiracetam resulted in approximately 60% and 90% occupancy, respectively. Analysis of the self-blocking scans yielded a Kd estimate of 3.4 nM and Bmax of 125-350 nM, in good agreement with the in vitro inhibition constant (Ki) of 6.3 nM and regional Bmax in humans. Whole-body biodistribution revealed that the liver and the brain are the dose-limiting organs for males and females, respectively. (11)C-UCB-J exhibited excellent characteristics as an SV2A PET radiotracer in nonhuman primates. The radiotracer is currently undergoing first-in-human evaluation. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sawada, Y.; Kawai, R.; McManaway, M.

    (3H)Cyclofoxy (CF: 17-cyclopropylmethyl-3,14-dihydroxy-4,5-alpha-epoxy-6-beta-fluoromorp hinan) is an opioid antagonist with affinity to both mu and kappa subtypes that was synthesized for quantitative evaluation of opioid receptor binding in vivo. Two sets of experiments in rats were analyzed. The first involved determining the metabolite-corrected blood concentration and tissue distribution of CF in brain 1 to 60 min after i.v. bolus injection. The second involved measuring brain washout for 15 to 120 s following intracarotid artery injection of CF. A physiologically based model and a classical compartmental pharmacokinetic model were compared. The models included different assumptions for transport across the blood-brain barrier (BBB);more » estimates of nonspecific tissue binding and specific binding to a single opiate receptor site were found to be essentially the same with both models. The nonspecific binding equilibrium constant varied modestly in different brain structures (Keq = 3-9), whereas the binding potential (BP) varied over a much broader range (BP = 0.6-32). In vivo estimates of the opioid receptor dissociation constant were similar for different brain structures (KD = 2.1-5.2 nM), whereas the apparent receptor density (Bmax) varied between 1 (cerebellum) and 78 (thalamus) pmol/g of brain. The receptor dissociation rate constants in cerebrum (k4 = 0.08-0.16 min-1; koff = 0.16-0.23 min-1) and brain vascular permeability (PS = 1.3-3.4 ml/min/g) are sufficiently high to achieve equilibrium conditions within a reasonable period of time. Graphical analysis of the data is inappropriate due to the high tissue-loss rate constant for CF in brain. From these findings, CF should be a very useful opioid receptor ligand for the estimation of the receptor binding parameters in human subjects using (18F)CF and positron emission tomography.« less

  7. Endothelin mechanisms in altered thyroid states in the rat.

    PubMed

    Rebello, S; Thompson, E B; Gulati, A

    1993-06-11

    Endothelin (ET) and its receptor characteristics were studied in hyper- and hypo-thyroid states in the rats. Hyperthyroidism was induced by daily administration of thyroxine (0.1 mg/kg i.p.) for 8 weeks, while hypothyrodism was induced by daily administration of methimazole (10 mg/kg i.p.) for 8 weeks. The chronic administration of thyroxine to rats decreased their rate of gain of body weight, increased serum T3 and T4 concentration, blood pressure and heart rate. The chronic administration of methimazole decreased the rate of gain of body weight, serum T3 and T4 concentration, blood pressure and heart rate as compared to vehicle-treated control. Plasma ET-1 levels were found to be similar in control and methimazole-treated rats, while the levels were found to be significantly (P < 0.002) increased in thyroxine-treated rats as compared to control rats. Binding studies showed that [125I]ET-1 bound to a single, high affinity binding site in the cerebral cortex, hypothalamus and pituitary. The density (Bmax) and the affinity (Kd) of [125I]ET-1 binding in the cerebral cortex and hypothalamus were found to be similar in control, methimazole- and thyroxine-treated rats. The pituitary of thyroxine-treated rats showed a decrease in the binding (34.3% decrease in the density) of [125I]ET-1 as compared to control rats. No difference was observed in the binding of [125I]ET-1 to pituitary membranes from control and methimazole-treated rats. Competition studies showed that the IC50 and Ki values of ET-3 for [125]ET-1 binding were about 8 to 11 times higher than ET-1 in cerebral cortex, hypothalamus and pituitary.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Pharmacologic characterization of the oxytocin receptor in human uterine smooth muscle cells.

    PubMed

    Tahara, A; Tsukada, J; Tomura, Y; Wada, K i; Kusayama, T; Ishii, N; Yatsu, T; Uchida, W; Tanaka, A

    2000-01-01

    [(3)H]-oxytocin was used to characterize the oxytocin receptor found in human uterine smooth muscle cells (USMC). Specific binding of [(3)H]-oxytocin to USMC plasma membranes was dependent upon time, temperature and membrane protein concentration. Scatchard plot analysis of equilibrium binding data revealed the existence of a single class of high-affinity binding sites with an apparent equilibrium dissociation constant (K(d)) of 0.76 nM and a maximum receptor density (B(max)) of 153 fmol mg(-1) protein. The Hill coefficient (n(H)) did not differ significantly from unity, suggesting binding to homogenous, non-interacting receptor populations. Competitive inhibition of [(3)H]-oxytocin binding showed that oxytocin and vasopressin (AVP) receptor agonists and antagonists displaced [(3)H]-oxytocin in a concentration-dependent manner. The order of potencies for peptide agonists and antagonists was: oxytocin>[Asu(1,6)]-oxytocin>AVP= atosiban>d(CH(2))(5)Tyr(Me)AVP>[Thr(4),Gly(7)]-oxytocin>dDAVP, and for nonpeptide antagonists was: L-371257>YM087>SR 49059>OPC-21268>SR 121463A>OPC-31260. Oxytocin significantly induced concentration-dependent increase in intracellular Ca(2+) concentration ([Ca(2+)](i)) and hyperplasia in USMC. The oxytocin receptor antagonists, atosiban and L-371257, potently and concentration-dependently inhibited oxytocin-induced [Ca(2+)](i) increase and hyperplasia. In contrast, the V(1A) receptor selective antagonist, SR 49059, and the V(2) receptor selective antagonist, SR 121463A, did not potently inhibit oxytocin-induced [Ca(2+)](i) increase and hyperplasia. The potency order of antagonists in inhibiting oxytocin-induced [Ca(2+)](i) increase and hyperplasia was similar to that observed in radioligand binding assays. In conclusion, these data provide evidence that the high-affinity [(3)H]-oxytocin binding site found in human USMC is a functional oxytocin receptor coupled to [Ca(2+)](i) increase and cell growth. Thus human USMC may prove to be a valuable tool in further investigation of the physiologic and pathophysiologic roles of oxytocin in the uterus. British Journal of Pharmacology (2000) 129, 131 - 139

  9. Recruitment of GABA(A) receptors and fearfulness in chicks: modulation by systemic insulin and/or epinephrine.

    PubMed

    Cid, Mariana Paula; Toledo, Carolina Maribel; Salvatierra, Nancy Alicia

    2013-02-01

    One-day-old chicks were individually assessed on their latency to peck pebbles, and categorized as low latency (LL) or high latency (HL) according to fear. Interactions between acute stress and systemic insulin and epinephrine on GABA(A) receptor density in the forebrain were studied. At 10 days of life, LL and HL chicks were intraperitoneally injected with insulin, epinephrine or saline, and immediately after stressed by partial water immersion for 15 min and killed by decapitation. Forebrains were dissected and the GABA(A) receptor density was measured ex vivo by the (3)[H]-flunitrazepam binding assay in synaptosomes. In non-stressed chicks, insulin (non-hypoglycemic dose) at 2.50 IU/kg of body weight incremented the Bmax by 40.53% in the HL chicks compared to saline group whereas no significant differences were observed between individuals in the LL subpopulation. Additionally, insulin increased the Bmax (23.48%) in the HL group with respect to the LL ones, indicating that the insulin responses were different according to the anxiety of each category. Epinephrine administration (0.25 and 0.50mg/kg) incremented the Bmax in non-stressed chicks, in the LL group by about 37% and 33%, respectively, compared to ones injected with saline. In the stressed chicks, 0.25mg/kg bw epinephrine increased the Bmax significantly in the HL group by about 24% compared to saline, suggesting that the effect of epinephrine was only observed in the HL group under acute stress conditions. Similarly, the same epinephrine doses co-administered with insulin increased the receptor density in both subpopulations and also showed that the highest dose of epinephrine did not further increase the maximum density of GABA(A)R in HL chicks. These results suggest that systemic epinephrine, perhaps by evoking central norepinephrine release, modulated the increase in the forebrain GABA(A) receptor recruitment induced by both insulin and stress in different ways depending on the subpopulation fearfulness. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Characterization of bradykinin receptors in human lung fibroblasts using the binding of 3[H][Des-Arg10,Leu9]kallidin and [3H]NPC17731.

    PubMed

    Zhang, S P; Codd, E E

    1998-01-01

    Bradykinin (BK) receptors are involved in pain and inflammation. Two BK receptor subtypes, B1 and B2, have been defined based on their pharmacological properties. Both B1 and B2 receptors are G-protein coupled membrane receptors. B1 receptors are present in smooth muscle tissue, whereas B2 receptors are found in both smooth muscle tissue and neurons. [Des-Arg10,Leu9]kallidin (DALKD) is a selective B1 receptor antagonist, and NPC17731 is a selective B2 receptor antagonist. To develop binding assays for the two known BK receptor subtypes, [3H]DALKD and [3H]NPC17731 were used as selective ligands for B1 and B2 receptors respectively. Both ligands bound to the CCD-16 human lung fibroblast membranes reaching equilibrium at 25 degrees C within 30 min. Binding was stable for at least 60 min. The Kd of [3H]DALKD was 0.33 nM and Bmax was 52 fmol/mg membrane protein. The Kd of [3H]NPC17731 was 0.39 nM and Bmax was 700 fmol/mg membrane protein. Competition for [3H]DALKD binding with BK receptor agonists was in the order: [des-Arg10]KD (DAKD) > KD > [des-Arg9]BK (DABK) > BK, and competition for [3H]DALKD binding with BK receptor antagonists was in the order: DALKD > [des-Arg10]Hoe 140 (DAHoe 140) > [des-Arg9,Leu8]BK (DALBK) > NPC17731 > Hoe 140 > DNMFBK, suggesting that [3H]DALKD bound selectively to B1 receptors. By contrast, competition for [3H]NPC17731 binding by BK agonists was in the order: BK > KD > DAKD > DABK, and competition for [3H]NPC17731 binding by BK antagonists was in the order: NPC17731 = Hoe 140 > DNMFBK > DAHoe 140 > DALBK > DALKD, indicating that [3H]NPC17731 labeled B2 receptors selectively. These results demonstrate that [3H]DALKD and [3H]NPC17731 can be used with CCD-16 human lung fibroblast membranes to provide a pair of binding assays for the simultaneous evaluation of B1 and B2 BK receptor subtypes.

  11. Binding of [3H]MSX-2 (3-(3-hydroxypropyl)-7-methyl-8-(m-methoxystyryl)-1-propargylxanthine) to rat striatal membranes--a new, selective antagonist radioligand for A(2A) adenosine receptors.

    PubMed

    Müller, C E; Maurinsh, J; Sauer, R

    2000-01-01

    The present study describes the preparation and binding properties of a new, potent, and selective A(2A) adenosine receptor (AR) antagonist radioligand, [3H]3-(3-hydroxypropyl)-7-methyl-8-(m-methoxystyryl)-1-propargy lxanth ine ([3H]MSX-2). [3H]MSX-2 binding to rat striatal membranes was saturable and reversible. Saturation experiments showed that [3H]MSX-2 labeled a single class of binding sites with high affinity (K(d)=8.0 nM) and limited capacity (B(max)=1.16 fmol.mg(-1) of protein). The presence of 100 microM GTP, or 10 mM magnesium chloride, respectively, had no effect on [3H]MSX-2 binding. AR agonists competed with the binding of 1 nM [3H]MSX-2 with the following order of potency: 5'-N-ethylcarboxamidoadenosine (NECA)>2-[4-(carboxyethyl)phenylethylamino]-5'-N-ethylcarboxami doaden osine (CGS-21680)>2-chloroadenosine (2-CADO)>N(6)-cyclopentyladenosine (CPA). AR antagonists showed the following order of potency: 8-(m-bromostyryl)-3, 7-dimethyl-1-propargylxanthine (BS-DMPX)>1, 3-dipropyl-8-cyclopentylxanthine (DPCPX)>(R)-5, 6-dimethyl-7-(1-phenylethyl)-2-(4-pyridyl)-7H-pyrrolo[2, 3-d]pyrimidine-4-amine (SH-128)>3,7-dimethyl-1-propargylxanthine (DMPX)>caffeine. The K(i) values for antagonists were in accordance with data from binding studies with the agonist radioligand [3H]CGS21680, while agonist affinities were 3-7-fold lower. [3H]MSX-2 is a highly selective A(2A) AR antagonist radioligand exhibiting a selectivity of at least two orders of magnitude versus all other AR subtypes. The new radioligand shows high specific radioactivity (85 Ci/mmol, 3150 GBq/mmol) and acceptable nonspecific binding at rat striatal membranes of 20-30%, at 1 nM.

  12. The amphiphilic peptide adenoregulin enhances agonist binding to A1-adenosine receptors and [35S]GTP gamma S to brain membranes.

    PubMed

    Moni, R W; Romero, F S; Daly, J W

    1995-08-01

    1. Adenoregulin is an amphilic peptide isolated from skin mucus of the tree frog, Phyllomedusa bicolor. Synthetic adenoregulin enhanced the binding of agonists to several G-protein-coupled receptors in rat brain membranes. 2. The maximal enhancement of agonist binding, and in parentheses, the concentration of adenoregulin affording maximal enhancement were as follows: 60% (20 microM) for A1-adenosine receptors, 30% (100 microM) for A2a-adenosine receptors, 20% (2 microM) for alpha 2-adrenergic receptors, and 30% (10 microM) for 5HT1A receptors. High affinity agonist binding for A1-, alpha 2-, and 5HT1A-receptors was virtually abolished by GTP gamma S in the presence of adenoregulin, but was only partially abolished in its absence. Magnesium ions increased the binding of agonists to receptors and reduced the enhancement elicited by adenoregulin. 3. The effect of adenoregulin on binding of N6-cyclohexyladenosine ([3H]CHA) to A1-receptors was relatively slow and was irreversible. Adenoregulin increased the Bmax value for [3H]CHA binding sites, and the proportion of high affinity states, and slowed the rate of [3H]CHA dissociation. Binding of the A1-selective antagonist, [3H]DPCPX, was maximally enhanced by only 13% at 2 microM adenoregulin. Basal and A1-adenosine receptor-stimulated binding of [35S]GTP gamma S were maximally enhanced 45% and 23%, respectively, by 50 microM adenoregulin. In CHAPS-solubilized membranes from rat cortex, the binding of both [3H]CHA and [3H]DPCPX were enhanced by adenoregulin. Binding of [3H]CHA to membranes from DDT1 MF-2 cells was maximally enhanced 17% at 20 microM adenoregulin. In intact DDT1 MF-2 cells, 20 microM adenoregulin did not potentiate the inhibition of cyclic AMP accumulation mediated via the adenosine A1 receptor. 4. It is proposed that adenoregulin enhances agonist binding through a mechanism involving enhancement of guanyl nucleotide exchange at G-proteins, resulting in a conversion of receptors into a high affinity state complexed with guanyl nucleotide-free G-protein.

  13. Investigating the mechanisms of Ni uptake and sub-lethal toxicity in the Atlantic killifish Fundulus heteroclitus in relation to salinity.

    PubMed

    Blewett, Tamzin A; Ransberry, Victoria E; McClelland, Grant B; Wood, Chris M

    2016-04-01

    The Atlantic killifish (Fundulus heteroclitus) is a resilient estuarine species that may be subjected to anthropogenic contamination of its natural habitat, by toxicants such as nickel (Ni). We investigated Ni accumulation and potential modes of Ni toxicity, in killifish, as a function of environmental salinity. Killifish were acclimated to 4 different salinities [0 freshwater (FW), 10, 30 and 100% seawater (SW)] and exposed to 5 mg/L of Ni for 96 h. Tissue Ni accumulation, whole body ions, critical swim speed and oxidative stress parameters were examined. SW was protective against Ni accumulation in the gills and kidney. Addition of Mg and Ca to FW protected against gill Ni accumulation, suggesting competition with Ni for uptake. Concentration-dependent Ni accumulation in the gill exhibited saturable relationships in both FW- and SW-acclimated fish. However SW fish displayed a lower Bmax (i.e. lower number of Ni binding sites) and a lower Km (i.e. higher affinity for Ni binding). No effect of Ni exposure was observed on critical swim speed (Ucrit) or maximum rate of oxygen consumption (MO2max). Markers of oxidative stress showed either no effect (e.g. protein carbonyl formation), or variable effects that appeared to depend more on salinity than on Ni exposure. These data indicate that the killifish is very tolerant to Ni toxicity, a characteristic that may facilitate the use of this species as a site-specific biomonitor of contaminated estuaries. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Receptors for VIP and PACAP in guinea pig cerebral cortex: effects on cyclic AMP synthesis and characterization by 125I-VIP binding.

    PubMed

    Zawilska, Jolanta B; Dejda, Agnieszka; Niewiadomski, Pawel; Gozes, Illana; Nowak, Jerzy Z

    2005-01-01

    Receptors for vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) in guinea pig cerebral cortex were characterized by (1) radioreceptor binding of 125I-labeled VIP (human/rat/porcine), and (2) cyclic AMP (cAMP) formation. Saturation analysis of 125I-VIP binding to membranes of guinea pig cerebral cortex resulted in a linear Scatchard plot, suggesting the presence of a single class of high-affinity receptor-binding sites, with a Kd of 0.63 nM and a B(max) of 77 fmol/mg protein. Various peptides from the PACAP/VIP/secretin family displaced the specific binding of 125I-VIP to guinea pig cerebrum with the relative rank order of potency: chicken VIP (cVIP) > or = PACAP38 approximately PACAP27 approximately guinea pig VIP (gpVIP) > or = mammalian (human/rat/porcine) VIP (mVIP) > peptide histidine-methionine (PHM) > peptide histidine-isoleucine (PHI) > secretin. Analysis of the competition curves revealed displacement of 125I-VIP from high- and lower-affinity binding sites, with IC50 values in the picomolar and the nanomolar range, respectively. About 70% of the specific 125I-VIP-binding sites in guinea pig cerebral cortex were sensitive to Gpp(NH)p, a nonhydrolyzable analog of GTP. Pituitary adenylate cyclase-activating polypeptide 38 (PACAP38), PACAP27, cVIP, gpVIP, mVIP, PHM, and PHI stimulated cAMP production in [3H]adenine-prelabeled slices of guinea pig cerebral cortex in a concentration-dependent manner. Of the tested peptides, the most effective were PACAP38 and PACAP27, which at a 1 microM concentration produced a 17- to 19-fold rise in cAMP synthesis, increasing the nucleotide production to approx 11% conversion above the control value. The three forms of VIP (cVIP, mVIP, and gpVIP) at the highest concentration used, i.e., 3 microM, produced net increases in cAMP production in the range of 8-9% conversion, whereas 5 microM PHM and PHI, by, respectively, 6.7% and 4.9% conversion. It is concluded that cerebral cortex of guinea pig contains VPAC- type receptors positively linked to cAMP formation. In addition, the observed stronger action of PACAP (both PACAP38 and PACAP27), when compared to any form of VIP, on cAMP production in this tissue, suggests its interaction with both PAC1 and VPAC receptors.

  15. Agonist properties of a stable hexapeptide analog of neurotensin, N alpha MeArg-Lys-Pro-Trp-tLeu-Leu (NT1).

    PubMed

    Akunne, H C; Demattos, S B; Whetzel, S Z; Wustrow, D J; Davis, D M; Wise, L D; Cody, W L; Pugsley, T A; Heffner, T G

    1995-04-18

    The major signal transduction pathway for neurotensin (NT) receptors is the G-protein-dependent stimulation of phospholipase C, leading to the mobilization of intracellular free Ca2+ ([Ca2+]i) and the stimulation of cyclic GMP. We investigated the functional actions of an analog of NT(8-13), N alpha MeArg-Lys-Pro-Trp-tLeu-Leu (NT1), and other NT related analogs by quantitative measurement of the cytosolic free Ca2+ concentration in HT-29 (human colonic adenocarcinoma) cells using the Ca(2+)-sensitive dye fura-2/AM and by effects on cyclic GMP levels in rat cerebellar slices. The NT receptor binding affinities for these analogs to HT-29 cell membranes and newborn (10-day-old) mouse brain membranes were also investigated. Data obtained from HT-29 cell and mouse brain membrane preparations showed saturable single high-affinity sites and binding densities (Bmax) of 130.2 and 87.5 fmol/mg protein, respectively. The respective KD values were 0.47 and 0.39 nM, and the Hill coefficients were 0.99 and 0.92. The low-affinity levocabastine-sensitive site was not present (K1 > 10,000) in either membrane preparation. Although the correlation of binding between HT-29 cell membranes and mouse brain membranes was quite significant (r = 0.92), some of the reference agents had lower binding affinities in the HT-29 cell membranes. The metabolically stable compound NT1 plus other NT analogs and related peptides [NT, NT(8-13), xenopsin, neuromedin N, NT(9-13), kinetensin and (D-Trp11)-NT] increased intracellular Ca2+ levels in HT-29 cells, indicating NT receptor agonist properties. The effect of NT1 in mobilizing [Ca2+]i blocked by SR 48692, a non-peptide NT antagonist. Receptor binding affinities of NT analogs to HT-29 cell membranes were positively correlated with potencies for mobilizing intracellular calcium in the same cells. In addition, NT1 increased cyclic GMP levels in rat cerebellar slices, confirming the latter findings of its NT agonist action. These results substantiate the in vitro NT agonist properties of the hexapeptide NT analog NT1.

  16. Pharmacologically relevant receptor binding characteristics and 5alpha-reductase inhibitory activity of free Fatty acids contained in saw palmetto extract.

    PubMed

    Abe, Masayuki; Ito, Yoshihiko; Oyunzul, Luvsandorj; Oki-Fujino, Tomomi; Yamada, Shizuo

    2009-04-01

    Saw palmetto extract (SPE), used widely for the treatment of benign prostatic hyperplasia (BPH) has been shown to bind alpha(1)-adrenergic, muscarinic and 1,4-dihydropyridine (1,4-DHP) calcium channel antagonist receptors. Major constituents of SPE are lauric acid, oleic acid, myristic acid, palmitic acid and linoleic acid. The aim of this study was to investigate binding affinities of these fatty acids for pharmacologically relevant (alpha(1)-adrenergic, muscarinic and 1,4-DHP) receptors. The fatty acids inhibited specific [(3)H]prazosin binding in rat brain in a concentration-dependent manner with IC(50) values of 23.8 to 136 microg/ml, and specific (+)-[(3)H]PN 200-110 binding with IC(50) values of 24.5 to 79.5 microg/ml. Also, lauric acid, oleic acid, myristic acid and linoleic acid inhibited specific [(3)H]N-methylscopolamine ([(3)H]NMS) binding in rat brain with IC(50) values of 56.4 to 169 microg/ml. Palmitic acid had no effect on specific [(3)H]NMS binding. The affinity of oleic acid, myristic acid and linoleic acid for each receptor was greater than the affinity of SPE. Scatchard analysis revealed that oleic acid and lauric acid caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]prazosin, [(3)H]NMS and (+)-[(3)H]PN 200-110. The results suggest that lauric acid and oleic acid bind noncompetitively to alpha(1)-adrenergic, muscarinic and 1,4-DHP calcium channel antagonist receptors. We developed a novel and convenient method of determining 5alpha-reductase activity using LC/MS. With this method, SPE was shown to inhibit 5alpha-reductase activity in rat liver with an IC(50) of 101 microg/ml. Similarly, all the fatty acids except palmitic acid inhibited 5alpha-reductase activity, with IC(50) values of 42.1 to 67.6 microg/ml. In conclusion, lauric acid, oleic acid, myristic acid, and linoleic acid, major constituents of SPE, exerted binding activities of alpha(1)-adrenergic, muscarinic and 1,4-DHP receptors and inhibited 5alpha-reductase activity.

  17. Agonist-dependent consequences of proline to alanine substitution in the transmembrane helices of the calcitonin receptor

    PubMed Central

    Bailey, R J; Hay, D L

    2007-01-01

    Background and purpose: Transmembrane proline (P) residues in family A G protein-coupled receptors (GPCRs) form functionally important kinks in their helices. These residues are little studied in family B GPCRs but experiments with the VPAC1 receptor and calcitonin receptor-like receptor (CL) show parallels with family A receptors. We sought to determine the function of these residues in the insert negative form of the human calcitonin receptor, a close relative of CL. Experimental approach: Proline residues within the transmembrane domains of the calcitonin receptor (P246, P249, P280, P326, P336) were individually mutated to alanine (A) using site-directed mutagenesis. Receptors were transiently transfected into Cos-7 cells using polyethylenimine and salmon and human calcitonin-induced cAMP responses measured. Salmon and human calcitonin competition binding experiments were also performed and receptor cell-surface expression assessed by whole cell ELISA. Key results: P246A, P249A and P280A were wild-type in terms of human calcitonin-induced cAMP activation. P326A and P336A had reduced function (165 and 12-fold, respectively). In membranes, human calcitonin binding was not detectable for any mutant receptor but in whole cells, binding was detected for all mutants apart from P326A. Salmon calcitonin activated mutant and wild-type receptors equally, although Bmax values were reduced for all mutants apart from P326A. Conclusions and Implications: P326 and P336 are important for the function of human calcitonin receptors and are likely to be involved in generating receptor conformations appropriate for agonist binding and receptor activation. However, agonist-specific effects were observed , implying distinct conformations of the human calcitonin receptor. PMID:17486143

  18. Generation of cell lines for drug discovery through random activation of gene expression: application to the human histamine H3 receptor.

    PubMed

    Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A

    2005-06-01

    Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.

  19. High-affinity 3H-substance P binding to longitudinal muscle membranes of the guinea pig small intestine.

    PubMed

    Buck, S H; Maurin, Y; Burks, T F; Yamamura, H I

    1984-01-30

    The binding of 3H-substance P (3H-SP) to longitudinal muscle membranes of the guinea pig small intestine has been characterized. The binding of 3H-SP exhibited a high affinity (Kd = 0.5nM). It was saturable (Bmax = 2 fmoles/mg tissue), reversible, and temperature-dependent. Kinetic studies and competition of 3H-SP binding by unlabeled SP yielded Kd and Ki values, respectively, which were in good agreement with the Kd calculated from saturation studies. The binding of 3H-SP appeared to be dependent on the presence of divalent cations in the incubation buffer. It was displaced by SP and various analogs and fragments in the rank order of SP greater than SP-(2-11) = SP-(3-11) greater than Nle11- SP = physalaemin greater than SP-(4-11) greater than SP-(5-11) greater than eledoisin much greater than SP-(7-11). Our results indicate that 3H-SP binds in longitudinal muscle of the guinea pig small intestine to a biologically relevant receptor which in many respects resembles the SP receptor characterized in the brain and the salivary gland of the rat.

  20. Inhibition of /sup 3/H-leukotriene D4 binding to guinea pig lung receptors by the novel leukotriene antagonist ICI 198,615

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aharony, D.; Falcone, R.C.; Krell, R.D.

    1987-12-01

    The specific binding of (/sup 3/H)5(S)hydroxy-6(R)-S-cysteinylglycyl -7(E),9(E),11(Z),14(Z)-eicosatetraenoic acid ((/sup 3/H)LTD4) to receptors on guinea pig lung parenchymal membranes and its inhibition by ICI 198,615, a representative example of a new class of leukotriene antagonists, was characterized by a receptor-ligand binding assay. (/sup 3/H)LTD4 bound specifically and rapidly (Kon = 0.29 +/- 0.6 nM-1.min-1) reaching equilibrium within 15 min. The rate of binding was greatly inhibited in the presence of ICI 198,615. Excess LTD4 or ICI 198,615 slowly (t1/2 = 20 min) dissociated about 70% of the receptor-bound (/sup 3/H)LTD4, whereas in combination with GTP analogs, both induced a rapid (t1/2more » less than 5 min) and full dissociation. Equilibrium saturation analysis of (/sup 3/H)LTD4 binding demonstrated a saturable (Bmax = 1014 +/- 174 fmol/mg) and high affinity (Kd = 0.43 +/- 0.09 nM) binding site. A high degree of stereoselectivity was demonstrated with inhibition of binding by the stereoisomers of LTD4: S,R much greater than R,R greater than R,S much greater than S,S. The rank order for inhibition of binding by peptide leukotriene was: LTD4 greater than 5(S)-hydroxy-6(R)-S-cysteinyl-7(E),9(E),11(Z),14(Z)-eicosatetraenoic acid much greater than 5(S)hydroxy-6(R)-S-glutathionyl-7(E),9(E),11(Z),14(Z)-eicosatetraenoic acid (potency ratios were: 1:4:590). In competition assays, ICI 198,615 competitively inhibited binding of (/sup 3/H)LTD4 (Ki = 0.27 +/- 0.16 nM) and was 2300-fold and 3100-fold more potent than LY171883 or FPL55712. These data, together with results obtained previously in functional receptor assays, illustrate that this new class of leukotriene antagonists are the most potent and selective competitive antagonists of LTD4 receptors yet described.« less

  1. Fluorescence spectroscopy studies of HEK293 cells expressing DOR-Gi1α fusion protein; the effect of cholesterol depletion.

    PubMed

    Brejchová, Jana; Sýkora, Jan; Dlouhá, Kateřina; Roubalová, Lenka; Ostašov, Pavel; Vošahlíková, Miroslava; Hof, Martin; Svoboda, Petr

    2011-12-01

    Biophysical studies of fluorescence anisotropy of DPH and Laurdan generalized polarization were performed in plasma membranes (PM) isolated from control and cholesterol-depleted HEK293 cells stably expressing pertussis toxin (PTX)-insensitive DOR-Gi1α (Cys351-Ile351) fusion protein. PM isolated from control, PTX-untreated, cells were compared with PM isolated from PTX-treated cells. Results from both types of PM indicated that i) hydrophobic membrane interior was made more accessible to water molecules and more chaotically organized in cholesterol-depleted samples, ii) cholesterol depletion resulted in an overall increase in surface area of membrane, membrane fluidity, and mobility of its constituents. Analysis of DOR-Gi1α coupling in PTX-treated and PTX-untreated cells indicated that cholesterol depletion did not alter the agonist binding site of DOR (Bmax and Kd) but the ability of DOR agonist DADLE to activate G proteins was markedly impaired. In PTX-untreated membranes, EC50 for DADLE-stimulated [35S]GTPγS binding was shifted by one order of magnitude to the right: from 4.3±1.2×10(-9) M to 2.2±1.3×10(-8) M in control and cholesterol-depleted membrane samples, respectively. In PTX-treated membranes, EC50 was shifted from 4.5±1.1×10(-9) M to 2.8±1.4×10(-8) M. In summary, the perturbation of optimum PM organization by cholesterol depletion deteriorates functional coupling of DOR to covalently bound Gi1α as well as endogenously expressed PTX-sensitive G proteins of Gi/Go family while receptor ligand binding site is unchanged. The biophysical state of hydrophobic plasma (cell) membrane interior should be regarded as regulatory factor of DOR-signaling cascade. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Brain α2-adrenoceptors in monoamine-depleted rats: increased receptor density, G coupling proteins, receptor turnover and receptor mRNA

    PubMed Central

    Ribas, Catalina; Miralles, Antonio; Busquets, Xavier; García-Sevilla, Jesús A

    2001-01-01

    This study was designed to assess the molecular and cellular events involved in the up-regulation (and receptor supersensitivity) of brain α2-adrenoceptors as a result of chronic depletion of noradrenaline (and other monoamines) by reserpine. Chronic reserpine (0.25 mg kg−1 s.c., every 48 h for 6 – 14 days) increased significantly the density (Bmax values) of cortical α2-adrenoceptor agonist sites (34 – 48% for [3H]-UK14304, 22 – 32% for [3H]-clonidine) but not that of antagonist sites (11 – 18% for [3H]-RX821002). Competition of [3H]-RX821002 binding by (−)-adrenaline further indicated that chronic reserpine was associated with up-regulation of the high-affinity state of α2-adrenoceptors. In cortical membranes of reserpine-treated rats (0.25 mg kg−1 s.c., every 48 h for 20 days), the immunoreactivities of various G proteins (Gαi1/2, Gαi3, Gαo and Gαs) were increased (25 – 34%). Because the high-affinity conformation of the α2-adrenoceptor is most probably related to the complex with Gαi2 proteins, these results suggested an increase in signal transduction through α2-adrenoceptors (and other monoamine receptors) induced by chronic reserpine. After α2-adrenoceptor alkylation, the analysis of receptor recovery (Bmax for [3H]-UK14304) indicated that the increased density of cortical α2-adrenoceptors in reserpine-treated rats was probably due to a higher appearance rate constant of the receptor (Δr=57%) and not to a decreased disappearance rate constant (Δk=7%). Northern- and dot-blot analyses of RNA extracted from the cerebral cortex of saline- and reserpine-treated rats (0.25 mg kg−1, s.c., every 48 h for 20 days) revealed that reserpine markedly increased the expression of α2a-adrenoceptor mRNA in the brain (125%). This transcriptional activation of the receptor gene expression appears to be the cellular mechanism by which reserpine induces up-regulation in the density of brain α2-adrenoceptors. PMID:11264240

  3. Actions of insecticides on the insect GABA receptor complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bermudez, I.; Hawkins, C.A.; Taylor, A.M.

    1991-01-01

    The actions of insecticides on the insect gamma-aminobutyric acid (GABA) receptor were investigated using (35S)t-butylbicyclophosphorothionate (( 35S)TBPS) binding and voltage-clamp techniques. Specific binding of (35S)TBPS to a membrane homogenate derived from the brain of Locusta migratoria locusts is characterised by a Kd value of 79.3 {plus minus} 2.9 nM and a Bmax value of 1770 {plus minus} 40 fmol/mg protein. (35S)TBPS binding is inhibited by mM concentrations of barbiturates and benzodiazepines. In contrast dieldrin, ivermectin, lindane, picrotoxin and TBPS are inhibitors of (35S)TBPS binding at the nanomolar range. Bicuculline, baclofen and pyrethroid insecticides have no effect on (35S)TBPS binding. Thesemore » results are similar to those obtained in electrophysiological studies of the current elicited by GABA in both Locusta and Periplaneta americana central neurones. Noise analysis of the effects of lindane, TBPS, dieldrin and picrotoxin on the cockroach GABA responses reveals that these compounds decrease the variance of the GABA-induced current but have no effect on its mean open time. All these compounds, with the exception of dieldrin, significantly decrease the conductance of GABA-evoked single current.« less

  4. Synthesis and preliminary evaluation of [3H]PSB-0413, a selective antagonist radioligand for platelet P2Y12 receptors.

    PubMed

    El-Tayeb, Ali; Griessmeier, Kerstin J; Müller, Christa E

    2005-12-15

    The selective antagonist radioligand [(3)H]2-propylthioadenosine-5'-adenylic acid (1,1-dichloro-1-phosphonomethyl-1-phosphonyl) anhydride ([(3)H]PSB-0413) was prepared by catalytic hydrogenation of its propargyl precursor with a high specific radioactivity of 74Ci/mmol. In preliminary saturation binding studies, [(3)H]PSB-0413 showed high affinity for platelet P2Y(12) receptors with a K(D) value of 4.57nM. Human platelets had a high density of P2Y(12) receptors exhibiting a B(max) value of 7.66pmol/mg of protein.

  5. Tactics for preclinical validation of receptor-binding radiotracers

    PubMed Central

    Lever, Susan Z.; Fan, Kuo-Hsien; Lever, John R.

    2016-01-01

    Introduction Aspects of radiopharmaceutical development are illustrated through preclinical studies of [125I]-(E)-1-(2-(2,3-dihydrobenzofuran-5-yl)ethyl)-4-(iodoallyl)piperazine ([125I]-E-IA- BF-PE-PIPZE), a radioligand for sigma-1 (σ1) receptors, coupled with examples from the recent literature. Findings are compared to those previously observed for [125I]-(E)-1-(2-(2,3-dimethoxy-5-yl)ethyl)-4-(iodoallyl)piperazine ([125I]-E-IA-DM-PE-PIPZE). Methods Syntheses of E-IA-BF-PE-PIPZE and [125I]-E-IA-BF-PE-PIPZE were accomplished by standard methods. In vitro receptor binding studies and autoradiography were performed, and binding potential was predicted. Measurements of lipophilicity and protein binding were obtained. In vivo studies were conducted in mice to evaluate radioligand stability, as well as specific binding to σ1 sites in brain, brain regions and peripheral organs in the presence and absence of potential blockers. Results E-IA-BF-PE-PIPZE exhibited high affinity and selectivity for σ1 receptors (Ki = 0.43 ± 0.03 nM, σ2 / σ1 = 173). [125I]-E-IA-BF-PE-PIPZE was prepared in good yield and purity, with high specific activity. Radioligand binding provided dissociation (koff) and association (kon) rate constants, along with a measured Kd of 0.24 ± 0.01 nM and Bmax of 472 ± 13 fmol / mg protein. The radioligand proved suitable for quantitative autoradiography in vitro using brain sections. Moderate lipophilicity, Log D7.4 2.69 ± 0.28, was determined, and protein binding was 71 ± 0.3%. In vivo, high initial whole brain uptake, > 6% injected dose / g, cleared slowly over 24 h. Specific binding represented 75% to 93% of total binding from 15 min to 24 h. Findings were confirmed and extended by regional brain biodistribution. Radiometabolites were not observed in brain (1%). Conclusions Substitution of dihydrobenzofuranylethyl for dimethoxyphenethyl increased radioligand affinity for σ1 receptors by 16-fold. While high specific binding to σ1 receptors was observed for both radioligands in vivo, [125I]-E-IA-BF-PE-PIPZE displayed much slower clearance kinetics than [125I]-E-IA-DM-PE-PIPZE. Thus, minor structural modifications of σ1 receptor radioligands lead to major differences in binding properties in vitro and in vivo. PMID:27755986

  6. Molindone compared to haloperidol in a guinea-pig model of tardive dyskinesia.

    PubMed

    Koller, W; Curtin, J; Fields, J

    1984-10-01

    Molindone was compared with haloperidol in animal models of tardive dyskinesia. Treatment with molindone for 14 days at 3, 6, 20 and 40 mg/kg, enhanced the stereotyped behavioral response induced by apomorphine and increased the numbered of D-2 dopamine receptors in the striatum (Bmax) labelled by high affinity (Kd = 40 pmol) binding or [3H] spiroperidol in the guinea-pig. Molindone at 1 mg/kg, caused no behavioral supersensitivity or change in the binding of dopamine receptors. Chronic administration of haloperidol (0.1, 0.5 and 5.0 mg/kg) also increased both the behavioral response to apomorphine and the number of dopamine receptors. Haloperidol, at 0.02 and 0.004 mg/kg, had no effect. Molindone potentiated dopaminergic activity in animal models in a similar way to other neuroleptics, suggesting that its use may also result in tardive dyskinesia.

  7. Absence of C-type natriuretic peptide receptors in hamster glomeruli.

    PubMed

    Luk, J K; Wong, E F; Wong, N L

    1994-01-01

    The distribution of atrial natriuretic peptide receptor B (ANPR-B) varies between tissues and species. The aim of this study is to determine whether ANPR-B is present in the hamster glomeruli. In vitro C-type natriuretic peptide (CNP)- and atrial natriuretic factor (ANF)-stimulated cGMP accumulation studies were performed in hamster glomeruli. Elevated cGMP accumulations were observed upon ANF addition. No cGMP response was seen with CNP. Competitive receptor-binding experiments were performed with 125I-CNP and 125I-ANF against their respective cold peptides in hamster glomeruli. Although no CNP binding was detected, positive ANF binding was found and two types of ANF receptor were demonstrated. The affinity (Kdl) and maximum binding capacity (Bmaxl) of the high-affinity ANF receptor were 0.014 +/- 0.001 nM and 60.4 +/- 10.2 fmol/mg protein, respectively. Those of the low-affinity receptor (Kd2 and Bmax2) were 45.7 +/- 6.2 nM and 28.3 +/- 6.3 pmol/mg protein, respectively. Similarly, saturation binding experiments also failed to show any CNP receptor binding in hamster glomeruli. This finding suggests that ANPR-B is not present in hamster glomeruli and CNP is not a direct physiological regulator of hamster renal function.

  8. Characterization of muscarinic and P2X receptors in the urothelium and detrusor muscle of the rat bladder.

    PubMed

    Ogoda, Masaki; Ito, Yoshihiko; Fuchihata, Yusuke; Onoue, Satomi; Yamada, Shizuo

    2016-05-01

    Muscarinic and purinergic (P2X) receptors play critical roles in bladder urothelium under physiological and pathological conditions. Aim of present study was to characterize these receptors in rat bladder urothelium and detrusor muscle using selective radioligands of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS) and αβ-methylene ATP [2,8-(3)H]tetrasodium salt ([(3)H]αβ-MeATP). Similar binding parameters for each radioligand were observed in urothelium and detrusor muscle. Pretreatment with N-(2-chloroethyl)-4-piperidinyl diphenylacetate (4-DAMP mustard) mustard revealed co-existence of M2 and M3 receptors, with the number of M2 receptors being larger in the urothelium and detrusor muscle. Intravesical administration of imidafenacin and Dpr-P-4 (N → O) (active metabolite of propiverine) displayed significant binding of muscarinic receptors in the urothelium and detrusor muscle. The treatment with cyclophosphamide (CYP) or resiniferatoxin (RTX) resulted in a significant decrease in maximal number of binding sites (Bmax) for [(3)H]NMS and/or [(3)H]αβ-MeATP in the urothelium and detrusor muscle. These results demonstrated that 1) pharmacological characteristics of muscarinic and P2X receptors in rat bladder urothelium were similar to those in the detrusor muscle, 2) that densities of these receptors were significantly altered by pretreatments with CYP and RTX, and 3) that these receptors may be pharmacologically affected by imidafenacin and Dpr-P-4 (N → O) which are excreted in the urine. Copyright © 2016 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

  9. Chronic molindone treatment: relative inability to elicit dopamine receptor supersensitivity in rats.

    PubMed

    Meller, E

    1982-01-01

    Chronic treatment of rats with the antipsychotic drug molindone (2.5 mg/kg) did not elicit behavioral supersensitivity to apomorphine (AP) (0.25 mg/kg) or increased striatal 3H-spiroperidol binding, whereas treatment with haloperidol (0.5-1.0 mg/kg) produced manifestations of dopaminergic supersensitivity in both paradigms. Chronic treatment with a high dose of molindone (20 mg/kg) elicited a small, but significant increase in behavioral sensitivity to AP (57%) which was, however, significantly less than that produced by 1 mg/kg haloperidol (126%, P less than 0.01). Apparent tolerance to elevation of striatal and frontal cortical 3,4-dihydroxyphenylacetic acid (DOPAC) levels was obtained with chronic molindone treatment (5 or 20 mg/kg). None of the molindone doses used (2.5-50 mg/kg) increased striatal dopamine receptor binding. Scatchard analyses revealed no change in either maximal binding capacity (Bmax) or dissociation constant (Kd). A significant (P less than 0.001) correlation of receptor binding activity and stereotypy score was obtained for haloperidol-, but not molindone-treated rats. These results with molindone in an animal model of tardive dyskinesia suggest that this drug may have a lower potential for eliciting this disorder in humans.

  10. Adenosine and sleep

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yanik, G.M. Jr.

    Behavioral and biochemical approaches have been used to determine the relative contribution of endogenous adenosine and adenosine receptors to the sleep-wake cycle in the rat. Adenosine concentrations in specific areas of the rat brain were not affected by 24 hours of total sleep deprivation, or by 24 or 48 hours of REM sleep deprivation. In order to assess the effect of REM sleep deprivation on adenosine A/sub 1/ receptors, /sup 3/H-L-PIA binding was measured. The Bmax values for /sup 3/H-L-PIA binding to membrane preparations of the cortices and corpus striata from 48 hour REM sleep-deprived animals were increased 14.8% andmore » 23%, respectively. These increases were not maintained following the cessation of sleep deprivation and recovered within 2 hours. The results of a 96 hour REM deprivation experiment were similar to those of the 48 hour REM sleep deprivation experiment. However, these increases were not evident in similar structures taken from stress control animals, and conclusively demonstrated that the changes in /sup 3/H-L-PIA binding resulted from REM sleep deprivation and not from stress.« less

  11. Substance P receptors: localization by light microscopic autoradiography in rat brain using [3H]SP as the radioligand.

    PubMed

    Mantyh, P W; Hunt, S P; Maggio, J E

    1984-07-30

    Substance P (SP) is a putative neurotransmitter in both the peripheral and central nervous systems. In the present report we have used a modification of the Young and Kuhar technique to investigate some of the SP receptors binding properties and the distribution of SP receptors in rat brain. Tritiated SP [( 3H]SP) absorbed extensively to glass but this adsorbtion was greatly reduced by preincubating the slide-mounted tissue sections in a solution containing the cationic polymer polyethylenimine. [3H]SP was found to bind to rat tissue in a saturable fashion with a Bmax of 14.7 fmol/mg tissue wet weight and a Kd of 1.1 nM. The rank order of potencies for displacing [3H]SP binding from rat tissue sections was SP greater than SP sulphoxide greater than DiMeC7 greater than Eledoisin greater than SP(5-11) greater than SP(COOH) greater than SP(1-9) amide. Using autoradiography coupled with LKB tritium-sensitive Ultrofilm or the dry emulsion-coated coverslip technique the distribution of [3H]SP binding sites was found to be very dense within olfactory bulb, amygdalo-hippocampal area and the nucleus of the solitary tract. Heavy concentrations of receptors were observed in the septum, diagonal band of Broca, striatum subiculum, hypothalamus, locus coeruleus, parabrachial nucleus and lobule 9 and 10 of the cerebellum. Moderate to low concentrations of receptors were observed in the cerebral cortex, globus pallidus, raphe nuclei and the trigeminal nucleus. Very low densities were observed in most aspects of the dorsal thalamus, substantia nigra and cerebellum (other than lobule 9 and 10). Comparisons of the present data with SP peptide levels indicate that in some areas of the brain there is a rough correlation between peptide and receptor levels. However, in other brain areas (olfactory bulb, globus pallidus and substantia nigra) there is little obvious correlation between the two.

  12. Ligand binding and functional characterization of muscarinic acetylcholine receptors on the TE671/RD human cell line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bencherif, M.; Lukas, R.J.

    1991-06-01

    Cells of the TE671/RD human clonal line express a finite number ((Bmax) of about 350 fmol/mg of membrane protein) of apparently noninteracting, high-affinity binding sites (KD of 0.07 nM and a Hill coefficient close to unity, nH = 0.94) for the muscarinic acetylcholine receptor (mAChR) radio antagonist, tritium-labeled quinuclidinyl benzilate ({sup 3}H-QNB). The rank order potency of selective antagonists that inhibit specific {sup 3}HQNB binding is: atropine greater than 4-DAMP (4-diphenylacetoxy-N-methylpiperidine methiodide) greater than pirenzepine greater than methoctramine greater than AFDx-116 (11-2(2-((diethylamino)methyl)-1-(piperidinyl) acetyl)-5,11-dihydro-6H-pyrido(2,3-b)(1,4)benzodiazepin-6-one). Functional studies indicate that phosphoinositide (PIns) hydrolysis in TE671/RD cells is increased by carbachol (EC50 of 10more » microM), but not by nicotine (to concentrations as high as 1 mM). Agonist-stimulated PIns metabolism is inhibited by antagonists with the same rank order potency as for inhibition of {sup 3}HQNB binding. Functional responses are augmented in the presence of a nonhydrolyzable GTP analog, are strongly inhibited after 24-hr exposure to cholera toxin, but are only slightly inhibited after long-term exposure to pertussis toxin or forskolin. These studies identify a pharmacologically-defined M3-subtype of mAChR strongly coupled via a cholera toxin-sensitive mechanism to PIns hydrolysis in these cells. Within 1 hr of treatment of TE671/RD cells with 1 mM dibutyryl cyclic AMP or with 10 microM phorbol-12-myristate-13-acetate (PMA), there is a 30 to 50% decrease in carbachol-stimulated PIns responsiveness that recovers to control values after 5 days of continued drug treatment. However, a comparable and more persistent inhibition of mAChR function is observed on cell treatment with 20 nM PMA.« less

  13. Modulation of GABAergic receptor binding by activation of calcium and calmodulin-dependent kinase II membrane phosphorylation.

    PubMed

    Churn, S B; DeLorenzo, R J

    1998-10-26

    gamma-Aminobutyric acid (GABA) is the primary inhibitory neurotransmitter in the central nervous system (CNS). Because of the important role that GABA plays in the CNS, alteration of GABAA receptor function would significantly affect neuronal excitability. Protein phosphorylation is a major mechanism for regulating receptor function in the brain and has been implicated in modulating GABAA receptor function. Therefore, this study was initiated to determine the role of calmodulin-dependent kinase II (CaM kinase II) membrane phosphorylation on GABAA receptor binding. Synaptosomal membrane fractions were tested for CaM kinase II activity towards endogenous substrates. In addition, muscimol binding was evaluated under equilibrium conditions in synaptosomal membrane fractions subjected to either basal (Mg2+ alone) or maximal CaM kinase II-dependent phosphorylation. Activation of endogenous CaM kinase II-dependent phosphorylation resulted in a significant enhancement of the apparent Bmax for muscimol binding without significantly altering the apparent binding affinity. The enhanced muscimol binding could be increased further by the addition of exogenous CaM kinase II to synaptosomal membrane fractions. Co-incubation with inhibitors of kinase activity during the phosphorylation reactions blocked the CaM kinase II-dependent increase in muscimol binding. The data support the hypothesis that activation of CaM kinase II-dependent phosphorylation caused an increased GABAA receptor binding and may play an important role in modulating the function of this inhibitory receptor/chloride ion channel complex. Copyright 1998 Elsevier Science B.V.

  14. [The dynamics of behavioral and neuroreceptor effects after acute and long-term noopept administration in C57BL/6 and BALB/c mice].

    PubMed

    Kovalev, G I; Kondrakhin, E A; Salimov, R M; Neznamov, G G

    2014-01-01

    The effect of acute, 7-fold and 14-fold noopept (1 mg/kg/day) administration on the dynamics of anxiolitic and nootropic behavioral effects in cross-maze, as well as their correlations with NMDA- and BDZ-receptor density was studied in inbred mice strains, differing in exploratory and emotional status--C57BL/6 and BALB/c. The dipeptide failed to affect the anxiety and exploration activity in C57BL/6 mice at each of 3 steps of experimental session. In this strain the B(max) values of [3H]-MK-801 and [3H]-Flunitrazepam binding changed only after single administration. In respect to BALB/c mice noopept induced both the anxiolitic and nootropic effects reaching their maximum on 7th day. In BALB/c strain the dynamics of hippocampal NMDA-receptor binding corresponds to the dynamics of exploratory efficacy whereas the dynamics of BDZ-receptors in prefrontal cortex was reciprocally to dynamics of anxiety level.

  15. Ursodeoxycholic acid increases low-density lipoprotein binding, uptake and degradation in isolated hamster hepatocytes.

    PubMed Central

    Bouscarel, B; Fromm, H; Ceryak, S; Cassidy, M M

    1991-01-01

    Ursodeoxycholic acid (UDCA), in contrast to both chenodeoxycholic acid (CDCA), its 7 alpha-epimer, and lithocholic acid, enhanced receptor-dependent low-density lipoprotein (LDL) uptake and degradation in isolated hamster hepatocytes. The increase in cell-associated LDL was time- and concentration-dependent, with a maximum effect observed at approx. 60 min with 1 mM-UDCA. This increase was not associated with a detergent effect of UDCA, as no significant modifications were observed either in the cellular release of lactate dehydrogenase or in Trypan Blue exclusion. The effect of UDCA was not due to a modification of the LDL particle, but rather was receptor-related. UDCA (1 mM) maximally increased the number of 125I-LDL-binding sites (Bmax.) by 35%, from 176 to 240 ng/mg of protein, without a significant modification of the binding affinity. Furthermore, following proteolytic degradation of the LDL receptor with Pronase, specific LDL binding decreased to the level of non-specific binding, and the effect of UDCA was abolished. Conversely, the trihydroxy 7 beta-hydroxy bile acid ursocholic acid and its 7 alpha-epimer, cholic acid, induced a significant decrease in LDL binding by approx. 15%. The C23 analogue of UDCA (nor-UDCA) and CDCA did not affect LDL binding. On the other hand, UDCA conjugated with either glycine (GUDCA) or taurine (TUDCA), increased LDL binding to the same extent as did the free bile acid. The half maximum time (t1/2) to reach the full effect was 1-2 min for UDCA and TUDCA, while GUDCA had a much slower t1/2 of 8.3 min. Ketoconazole (50 microM), an antifungal agent, increased LDL binding, but this effect was not additive when tested in the presence of 0.7 mM-UDCA. The results of the studies indicate that, in isolated hamster hepatocytes, the UDCA-induced increase in receptor-dependent LDL binding and uptake represents a direct effect of this bile acid. The action of the bile acid is closely related to its specific structural conformation, since UDCA and its conjugates are the only bile acids shown to express this ability thus far. However, certain agents other than bile acids, such as ketoconazole, have a similar effect. Finally, the studies suggest that the recruitment of LDL receptors from a latent pool in the hepatocellular membrane may be the mechanism by which UDCA exerts its direct effect. Images Fig. 6. PMID:1764022

  16. Nonpeptidic urotensin-II receptor antagonists I: in vitro pharmacological characterization of SB-706375

    PubMed Central

    Douglas, Stephen A; Behm, David J; Aiyar, Nambi V; Naselsky, Diane; Disa, Jyoti; Brooks, David P; Ohlstein, Eliot H; Gleason, John G; Sarau, Henry M; Foley, James J; Buckley, Peter T; Schmidt, Dulcie B; Wixted, William E; Widdowson, Katherine; Riley, Graham; Jin, Jian; Gallagher, Timothy F; Schmidt, Stanley J; Ridgers, Lance; Christmann, Lisa T; Keenan, Richard M; Knight, Steven D; Dhanak, Dashyant

    2005-01-01

    SB-706375 potently inhibited [125I]hU-II binding to both mammalian recombinant and ‘native' UT receptors (Ki 4.7±1.5 to 20.7±3.6 nM at rodent, feline and primate recombinant UT receptors and Ki 5.4±0.4 nM at the endogenous UT receptor in SJRH30 cells). Prior exposure to SB-706375 (1 μM, 30 min) did not alter [125I]hU-II binding affinity or density in recombinant cells (KD 3.1±0.4 vs 5.8±0.9 nM and Bmax 3.1±1.0 vs 2.8±0.8 pmol mg−1) consistent with a reversible mode of action. The novel, nonpeptidic radioligand [3H]SB-657510, a close analogue of SB-706375, bound to the monkey UT receptor (KD 2.6±0.4 nM, Bmax 0.86±0.12 pmol mg−1) in a manner that was inhibited by both U-II isopeptides and SB-706375 (Ki 4.6±1.4 to 17.6±5.4 nM) consistent with the sulphonamides and native U-II ligands sharing a common UT receptor binding domain. SB-706375 was a potent, competitive hU-II antagonist across species with pKb 7.29–8.00 in HEK293-UT receptor cells (inhibition of [Ca2+]i-mobilization) and pKb 7.47 in rat isolated aorta (inhibition of contraction). SB-706375 also reversed tone established in the rat aorta by prior exposure to hU-II (Kapp∼20 nM). SB-706375 was a selective U-II antagonist with ⩾100-fold selectivity for the human UT receptor compared to 86 distinct receptors, ion channels, enzymes, transporters and nuclear hormones (Ki/IC50>1 μM). Accordingly, the contractile responses induced in isolated aortae by KCl, phenylephrine, angiotensin II and endothelin-1 were unaltered by SB-706375 (1 μM). In summary, SB-706375 is a high-affinity, surmountable, reversible and selective nonpeptide UT receptor antagonist with cross-species activity that will assist in delineating the pathophysiological actions of U-II in mammals. PMID:15852036

  17. [18F]CFT [(18F)WIN 35,428], a radioligand to study the dopamine transporter with PET: characterization in human subjects.

    PubMed

    Laakso, A; Bergman, J; Haaparanta, M; Vilkman, H; Solin, O; Hietala, J

    1998-03-01

    We have characterized the usage of [18F]CFT (also known as [18F]WIN 35,428) as a radioligand for in vivo studies of human dopamine transporter by PET. CFT was labeled with 18F to a high specific activity, and dynamic PET scans were conducted in healthy volunteers at various time points up to 5 h from [18F]CFT injection. The regional distribution of [18F]CFT uptake correlated well with the known distribution of dopaminergic nerve terminals in the human brain and also with that of other dopamine transporter radioligands. Striatal binding peaked at 225 min after injection and declined thereafter, demonstrating the reversible nature of the binding to the dopamine transporter. Therefore, due to the relatively long half-life of 18F (109.8 min), PET scans with [18F]CFT could easily be conducted during the binding equilibrium, allowing estimation of Bmax/Kd values (i.e., binding potential). Binding potentials for putamen and caudate measured at equilibrium were 4.79+/-0.11 and 4.50+/-0.23, respectively. We were able to also visualize midbrain dopaminergic neurons (substantia nigra) with [18F]CFT in some subjects. In conclusion, the labeling of CFT with 18F allows PET scans to be conducted at binding equilibrium, and therefore a high signal-to-noise ratio and reliable quantification of binding potential can be achieved. With a high resolution 3D PET scanner, the quantification of extrastriatal dopamine transporters should become possible.

  18. Intrinsic cytosolic calcium buffering properties of single rat cardiac myocytes.

    PubMed Central

    Berlin, J R; Bassani, J W; Bers, D M

    1994-01-01

    Intracellular passive Ca2+, buffering was measured in voltage-clamped rat ventricular myocytes. Cells were loaded with indo-1 (K+ salt) to an estimated cytosolic concentration of 44 +/- 5 microM (Mean +/- SEM, n = 5), and accessible cell volume was estimated to be 24.5 +/- 3.6 pl. Ca2+ transport by the sarcoplasmic reticulum (SR) Ca-ATPase and sarcolemmal Na-Ca exchange was inhibited by treatment with thapsigargin and Na-free solutions, respectively. Extracellular [Ca2+] was maintained at 10 mM and, in some experiments, the mitochondrial uncoupler "1799" was used to assess the degree of mitochondrial Ca2+ uptake. To perform single cell titrations, intracellular Ca2+ ([Ca2+]i) was increased progressively by a train of depolarizing voltage clamp pulses from -40 to +10 mV. The total Ca2+ gain with each pulse was calculated by integration of the Ca current and then analyzed as a function of the rapid change in [Ca2+]i during the pulse. In the range of [Ca2+]i from 0.1 to 2 microM, overall cell buffering was well described as a single lumped Michaelis-Menten type species with an apparent dissociation constant, KD, of of 0.63 +/- 0.07 microM (n = 5) and a binding capacity, Bmax, of 162 +/- 15 mumol/l cell H2O. Correction for buffering attributable to cytosolic indo-1 gives intrinsic cytosolic Ca2+ buffering parameters of KD = 0.96 +/- 0.18 microM and Bmax = 123 +/- 18 mumol/l cell H2O. The fast Ca2+ buffering measured in this manner agrees reasonably with the characteristics of known rapid Ca buffers (e.g., troponin C, calmodulin, and SR Ca-ATPase), but is only about half of the total Ca2+ buffering measured at equilibrium. Inclusion of slow Ca buffers such as the Ca/Mg sites on troponin C and myosin can account for the differences between fast Ca2+ buffering in phase with the Ca current measured in the present experiments and equilibrium Ca2+ buffering. The present data indicate that a rapid rise of [Ca2+]i from 0.1 to 1 microM during a contraction requires approximately 50 microM Ca2+ to be added to the cytosol. PMID:7819510

  19. Purified ryanodine receptor from rabbit skeletal muscle is the calcium- release channel of sarcoplasmic reticulum

    PubMed Central

    1988-01-01

    The ryanodine receptor of rabbit skeletal muscle sarcoplasmic reticulum was purified as a single 450,000-dalton polypeptide from CHAPS- solubilized triads using immunoaffinity chromatography. The purified receptor had a [3H]ryanodine-binding capacity (Bmax) of 490 pmol/mg and a binding affinity (Kd) of 7.0 nM. Using planar bilayer recording techniques, we show that the purified receptor forms cationic channels selective for divalent ions. Ryanodine receptor channels were identical to the Ca-release channels described in native sarcoplasmic reticulum using the same techniques. In the present work, four criteria were used to establish this identity: (a) activation of channels by micromolar Ca and millimolar ATP and inhibition by micromolar ruthenium red, (b) a main channel conductance of 110 +/- 10 pS in 54 mM trans Ca, (c) a long- term open state of lower unitary conductance induced by ryanodine concentrations as low as 20 nM, and (d) a permeability ratio PCa/PTris approximately equal to 14. In addition, we show that the purified ryanodine receptor channel displays a saturable conductance in both monovalent and divalent cation solutions (gamma max for K and Ca = 1 nS and 172 pS, respectively). In the absence of Ca, channels had a broad selectivity for monovalent cations, but in the presence of Ca, they were selectively permeable to Ca against K by a permeability ratio PCa/PK approximately equal to 6. Receptor channels displayed several equivalent conductance levels, which suggest an oligomeric pore structure. We conclude that the 450,000-dalton polypeptide ryanodine receptor is the Ca-release channel of the sarcoplasmic reticulum and is the target site of ruthenium red and ryanodine. PMID:2459298

  20. Synthesis and preliminary evaluation of a new (99m)tc labeled substance p analogue as a potential tumor imaging agent.

    PubMed

    Mozaffari, Saeed; Erfani, Mostafa; Beiki, Davood; Johari Daha, Fariba; Kobarfard, Farzad; Balalaie, Saeed; Fallahi, Babak

    2015-01-01

    Neurokinin 1 receptors (NK1R) are overexpressed on several types of important human cancer cells. Substance P (SP) is the most specific endogenous ligand known for NK1Rs. Accordingly,a new SP analogue was synthesized and evaluated for detection of NK1R positive tumors.[6-hydrazinopyridine-3-carboxylic acid (HYNIC)-Tyr(8)-Met(O)(11)-SP] was synthesized and radiolabeled with (99m)Tc using ethylenediamine-N,N'-diacetic acid (EDDA)and Tricine as coligands. Common physicochemical properties of radioconjugate were studied and in-vitro cell line biological tests were accomplished to determine the receptor mediated characteristics. In-vivo biodistribution in normal and tumor bearingnude mice was also assessed. The cold peptide was prepared in high purity (>99%) and radiolabeled with (99m)Tc at high specific activities (84-112GBq/µmol) with an acceptable labeling yield (>95%). The radioconjugate was stable in-vitro in the presence of human serum and showed 44% protein binding to human serumalbumin. In-vitro cell line studies on U373MG cells showed an acceptable uptake up to 4.91 ± 0.22% with the ratio of 60.21 ± 1.19% for its specific fraction and increasing specific internalization during 4 h. Receptor binding assays on U373MG cells indicated a mean Kd of 2.46 ± 0.43 nM and Bmax of 128925 ± 8145 sites/cell. In-vivo investigations determined the specific tumor uptake in 3.36 percent of injected dose per gram (%ID/g) for U373MG cells and noticeable accumulations of activity in the intestines and lung. Predominant renal excretion pathway was demonstrated. Therefore, this new radiolabeled peptide could be a promising radiotracer for detection of NK1R positive primary or secondary tumors.

  1. Binding of KATP channel modulators in rat cardiac membranes

    PubMed Central

    Löffler-Walz, Cornelia; Quast, Ulrich

    1998-01-01

    The binding of [3H]-P1075, a potent opener of adenosine-5′-triphosphate-(ATP)-sensitive K+ channels, was studied in a crude heart membrane preparation of the rat, at 37°C.Binding required MgATP. In the presence of an ATP-regenerating system, MgATP supported [3H]-P1075 binding with an EC50 value of 100 μM and a Hill coefficient of 1.4.In saturation experiments [3H]-P1075 binding was homogeneous with a KD value of 6±1 nM and a binding capacity (Bmax) of 33±3 fmol mg−1 protein.Upon addition of an excess of unlabelled P1075, the [3H]-P1075-receptor complex dissociated in a mono-exponential manner with a dissociation rate constant of 0.13±0.01 min−1. If a bi-molecular association mechanism was assumed, the dependence of the association kinetics on label concentration gave an association rate constant of 0.030±0.003 nM−1 min−1. From the kinetic experiments the KD value was calculated as 4.7±0.6 nM.Openers of the ATP-sensitive K+ channel belonging to different structural classes inhibited specific [3H]-P1075 binding in a monophasic manner to completion; an exception was minoxidil sulphate where maximum inhibition was 68%. The potencies of the openers in this assay agree with published values obtained in rat cardiocytes and are on average 3.5 times lower than those determined in rat aorta.Sulphonylureas, such as glibenclamide and glibornuride and the sulphonylurea-related carboxylate, AZ-DF 265, inhibited [3H]-P1075 binding with biphasic inhibition curves. The high affinity component comprised about 60% of the curves with the IC50 value of glibenclamide being ≈amp;90 nM; affinities for the low affinity component were in the μM concentration range. The fluorescein derivative, phloxine B, showed a monophasic inhibition curve with an IC50 value of 6 μM, a maximum inhibition of 94% and a Hill coefficient of 1.5.It is concluded that binding studies with [3H]-P1075 are feasible in rat heart membranes in the presence of MgATP and of an ATP-regenerating system. The pharmacological profile of the [3H]-P1075 binding sites in the cardiac preparation, which probably contains sulphonylurea receptors (SURs) from cardiac myocytes (SUR2A) and vascular smooth muscle cells (SUR2B), differs from that expected for SUR2A and SUR2B. PMID:9579735

  2. Regulation of atrial natriuretic peptide clearance receptors in mesangial cells by growth factors.

    PubMed

    Paul, R V; Wackym, P S; Budisavljevic, M; Everett, E; Norris, J S

    1993-08-25

    Rat mesangial cells can express both 130-kDa guanylyl cyclase-coupled and 66-kDa non-coupled atrial natriuretic peptide (ANP) receptors (ANPR-A and ANPR-C, respectively). Exposure of mesangial cells, grown in 20% fetal calf serum, to 0.1% serum for 24 h increased total ANP receptor density more than 2-fold (Bmax = 87 versus 37 fmol/mg of cell protein) without changing binding affinity (Kd = 94 versus 88 pM). Radioligand binding and cross-linking studies demonstrated that up-regulation of ANP binding after serum deprivation was entirely due to an increase in ANPR-C, with little or no change in ANPR-A. Inhibition of protein synthesis with cycloheximide blocked up-regulation after serum deprivation. Steady-state ANPR-C mRNA level was increased 15-fold by serum deprivation, as judged by Northern blotting. There was no change in ANPR-A mRNA. Platelet-derived growth factor and phorbol myristate acetate, when added to low serum medium, blocked or reversed the effect of serum deprivation on ANPR-C. We conclude that synthesis and expression of ANPR-C but not ANPR-A is suppressed by serum, platelet-derived growth factor, and phorbol myristate acetate. Suppression of ANPR-C in vivo could contribute to mesangial cell proliferative responses to growth factors.

  3. GABA-B receptor activation and conflict behavior

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ketelaars, C.E.J.; Bollen, E.L.; Rigter, H.

    1988-01-01

    Baclofen and oxazepam enhance extinction of conflict behavior in the Geller-Seifter test while baclofen and diazepam release punished behavior in Vogel's conflict test. In order to investigate the possibility that the effect of the selective GABA-B receptor agonist baclofen is mediated indirectly via the GABA-A/benzodiazepine receptor complex, the effect of pretreatment of rats with baclofen on (/sup 3/H)-diazepam binding to washed and unwashed cortical and cerebellar membranes of rats has been studied. Baclofen pretreatment increase Bmax in washed cerebellar membranes when bicuculline was present in the incubation mixture. No effect was seen in cortical membranes. The present results render itmore » unlikely that the effect of baclofen on extinction of conflict behavior and punished drinking is mediated via the GABA-A/benzodiazepine receptor complex. 50 references, 1 figure, 4 tables.« less

  4. Functional recovery of supersensitive dopamine receptors after intrastriatal grafts of fetal substantia nigra

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dawson, T.M.; Dawson, V.L.; Gage, F.H.

    1991-03-01

    Interruption of the ascending dopamine neurons of the nigrostriatal pathway, by 6-hydroxydopamine (6-OHDA) lesion in rats, produced a significant loss of the dopamine transport complexes labeled with the phencyclidine derivative (3H)BTCP. This loss of dopamine innervation in the striatum was present at least 12 to 14 months after lesioning and was functionally manifested by ipsilateral rotation of the animals in response to amphetamine. In these same animals, in comparison to controls, there was a significant increase in the number (Bmax) of (3H)SCH 23390-labeled D-1 receptors in the striatum (36.7%) and the substantia nigra (35.1%) and a 54.4% increase in themore » number (Bmax) of (3H)sulpiride-labeled striatal D-2 receptors without an apparent change in affinity (Kd). Ten to twelve months after the transplantation of homologous fetal substantia nigra into the denervated striatum, there was a significant decrease in amphetamine-induced turning behavior. In these animals, there was an ingrowth of dopamine nerve terminals in the striatum as demonstrated by a return of (3H)BTCP binding. Accompanying this reinnervation was the normalization of D-1 and D-2 receptors to control values in the striatum as well as the return of D-1 receptors to prelesion densities in the substantia nigra. In a subgroup of transplanted rats, amphetamine continued to induce ipsilateral turning. In these animals both D-1 and D-2 receptors remained supersensitive. These results support the hypothesis that the functional recovery of transplanted animals is due, in part, to reinnervation of the striatum. In addition, long-term alterations in receptor density may be related to the behavioral deficits that are associated with the 6-OHDA-lesioned rat.« less

  5. The influence of combined oral contraceptives containing drospirenone on hypothalamic-pituitary-adrenocortical axis activity and glucocorticoid receptor expression and function in women with polycystic ovary syndrome.

    PubMed

    Macut, Djuro; Božić Antić, Ivana; Nestorov, Jelena; Topalović, Vladanka; Bjekić Macut, Jelica; Panidis, Dimitrios; Kastratović Kotlica, Biljana; Papadakis, Efstathios; Matić, Gordana; Vojnović Milutinović, Danijela

    2015-01-01

    Most women with PCOS have increased adrenal androgen production, enhanced peripheral metabolism of cortisol and elevation in urinary excretion of its metabolites. Increased cortisol clearance in PCOS is followed by a compensatory overdrive of the hypothalamic-pituitary-adrenocortical (HPA) axis. We hypothesized that oral contraceptives containing ethinylestradiol and drospirenone (EE-DRSP) could modulate glucocorticoid receptor (GR) expression and function and thus affect HPA axis activity in PCOS patients. We analyzed 12 women with PCOS (age 24.17±4.88 years; body mass index 22.05±3.97 kg/m²) treated for 12 months with EE-DRSP and 20 BMI matched controls. In all subjects testosterone, dehydroepiandrosterone sulfate (DHEAS), sex hormone binding globulin (SHBG), cortisol (basal and after dexamethasone), concentrations of GR protein, phospo-GR211 protein, number of GR per cell (B(max) and its equilibrium dissociation constant (K(D)) were measured. Before treatment, increased concentrations of testosterone and DHEAS (p<0.001, respectively), unaltered basal cortisol and an increased sensitivity (p<0.05) of the HPA axis to dexamethasone were observed in PCOS women in comparison to controls. After treatment, testosterone (p<0.01), DHEAS (p<0.05) and cortisol suppression after dexamethasone (p<0.01) were decreased in PCOS women. There were no changes in GR protein concentration, GR phosphorylation nor in the receptor functional parameters B(max) and K(D) in women with PCOS before and after the therapy, and in comparison to controls. Prolonged treatment with EE-DRSP in PCOS women decreased serum androgens and increased cortisol in the presence of decreased sensitivity of the HPA axis and did not exert changes in GR expression and function.

  6. Activation of Cyclic AMP Synthesis by Full and Partial Beta-Adrenergic Receptor Agonists in Chicken Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.

    2003-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Accordingly, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate CAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of CAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of CAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax concentrations were approximately 15-fold weaker than isoproterenol in stimulating the rate of CAMP synthesis. When cimaterol and clenbuterol were added to culture media at concentrations known to cause significant muscle hypertrophy in animals, there was no detectable effect on stimulation of CAMP synthesis. Finally, these same levels of cimaterol and clenbuterol did not antagonize the stimulation of CAMP by either epinephrine or isoproterenol.

  7. Interaction of xenobiotics with estrogen receptors α and β and a putative plasma sex hormone-binding globulin from channel catfish (Ictalurus punctatus)

    USGS Publications Warehouse

    Gale, William L.; Patino, Reynaldo; Maule, Alec G.

    2004-01-01

    Estrogens are important regulators of physiological functions. Although environmental contaminants (xenoestrogens) which interfere with estrogen signaling are of increasing concern, there is only limited information about their ability to interact with estrogen-binding proteins (SHBG) or receptors (ER). Recombinant ER?? and ?? were obtained after transient transfection of COS-7 cells with channel catfish ER cDNA. Plasma from adult female channel catfish was the source of SHBG. Tritiated estradiol ( 3H-E2) was used in standard radioligand-binding assays to characterize the binding properties of channel catfish SHBG (ccfSHBG) and to estimate the inhibition constants for various estrogenic compounds. Binding of 3H-E2 to ccfSHBG was saturable and of high affinity with a Kd (??SE) of 1.9??0.14nM and a Bmax of 14.3??2.4pmol/mg protein (n=3 assays). Additionally, ccfSHBG displayed binding specificity for androgens and estrogens. Endosulfan, 4-nonylphenol, and 4-octylphenol displaced 3H-E2 binding to ccfSHBG albeit only at very high concentrations, whereas dieldrin and atrazine showed little displacement activity even at the highest concentrations used. The synthetic estrogen ethynylestradiol had higher affinity than E2 for ccfSHBG. This finding differs from results with human and rainbow trout SHBG. The alkylphenolic compounds (4-octylphenol and 4-nonylphenol) displayed some ability to displace 3H-E2 binding from ER?? and ?? at high concentrations, but dieldrin and atrazine had little binding activity for both ER subtypes and endosulfan for ER??. The xenobiotics tested generally showed equivalent or greater affinity for ER?? than ER??, whereas natural estrogens had much greater affinity for ER?? than ER??. These observations suggest that results of studies using fish tissue ER extracts must be interpreted with caution, since both ER subtypes may be present, and that the binding of xenoestrogens to SHBG must be taken into account for proper assessment of endocrine disruption caused by environmental contaminants.

  8. Quantitation of benzodiazepine receptor binding with PET [11C]iomazenil and SPECT [123I]iomazenil: preliminary results of a direct comparison in healthy human subjects.

    PubMed

    Bremner, J D; Baldwin, R; Horti, A; Staib, L H; Ng, C K; Tan, P Z; Zea-Ponce, Y; Zoghbi, S; Seibyl, J P; Soufer, R; Charney, D S; Innis, R B

    1999-08-31

    Although positron emission tomography (PET) and single photon emission computed tomography (SPECT) are increasingly used for quantitation of neuroreceptor binding, almost no studies to date have involved a direct comparison of the two. One study found a high level of agreement between the two techniques, although there was a systematic 30% increase in measures of benzodiazepine receptor binding in SPECT compared with PET. The purpose of the current study was to directly compare quantitation of benzodiazepine receptor binding in the same human subjects using PET and SPECT with high specific activity [11C]iomazenil and [123I]iomazenil, respectively. All subjects were administered a single bolus of high specific activity iomazenil labeled with 11C or 123I followed by dynamic PET or SPECT imaging of the brain. Arterial blood samples were obtained for measurement of metabolite-corrected radioligand in plasma. Compartmental modeling was used to fit values for kinetic rate constants of transfer of radioligand between plasma and brain compartments. These values were used for calculation of binding potential (BP = Bmax/Kd) and product of BP and the fraction of free non-protein-bound parent compound (V3'). Mean values for V3' in PET and SPECT were as follows: temporal cortex 23+/-5 and 22+/-3 ml/g, frontal cortex23+/-6 and 22+/-3 ml/g, occipital cortex 28+/-3 and 31+/-5 ml/g, and striatum 4+/-4 and 7+/-4 ml/g. These preliminary findings indicate that PET and SPECT provide comparable results in quantitation of neuroreceptor binding in the human brain.

  9. Chimeric proteins combining phosphatase and cellulose-binding activities: proof-of-concept and application in the hydrolysis of paraoxon.

    PubMed

    Gonçalves, Larissa M; Chaimovich, Hernan; Cuccovia, Iolanda M; Marana, Sandro R

    2014-05-01

    Phosphatases for organophosphate degradation and carbohydrate-binding domains (CBMs) have potential biotechnological applications. As a proof-of-concept, a soluble chimeric protein that combines acid phosphatase (AppA) from Escherichia coli and a CBM from Xanthomonas axonopodis pv. citri (AppA-CBM) was produced in E.coli. AppACBM adsorbed in microcrystalline cellulose Avicel PH101 catalyzed the hydrolysis of p-nitrophenyl phosphate (PNPP). The binding to microcrystalline cellulose displayed saturation behavior with an apparent binding constant (Kb) of 22 ± 5 mg and a maximum binding (Bmax) of 1.500 ± 0.001 enzyme units. Binding was highest at pH 2.5 and decreased above pH 6.5, as previously observed for family 2 CBMs. The Km values for PNPP of AppA-CBM and native AppA were identical (2.7 mM). To demonstrate that this strategy for protein engineering has practical applications and is largely functional, even for phosphatases exhibiting diverse folds, a chimeric protein combining human paraoxonase 1 (hPON1) and the CBM was produced. Both PON1-CBM and hPON1 had identical Km values for paraoxon (1.3 mM). Additionally, hPON1 bound to microcrystalline cellulose with a Kb of 27 ± 3 mg, the same as that observed for AppA-CBM. These data show that the phosphatase domains are as functional in both of the chimeric proteins as they are in the native enzymes and that the CBM domain maintains the same cellulose affinity. Therefore, the engineering of chimeric proteins combining domains of phosphatases and CBMs is fully feasible, resulting in chimeric enzymes that exhibit potential for OP detoxification.

  10. Expression, purification, and refolding of active recombinant human E-selectin lectin and EGF domains in Escherichia coli.

    PubMed

    Kawano, Susumu; Iyaguchi, Daisuke; Okada, Chiaki; Sasaki, Yusuke; Toyota, Eiko

    2013-06-01

    Attempts to obtain active E-selectin from Escherichia coli (E. coli) have not yet been successful. In this study, we succeeded in expressing the recombinant lectin and epidermal growth factor domain fragments of human E-selectin (rh-ESLE) in E. coli on a large-scale. The rh-ESLE protein was expressed as an inactive form in the inclusion bodies. The inactive form of rh-ESLE was denatured and solubilized by 6 M guanidine hydrochloride and then purified by Ni(2+) affinity chromatography under denaturing conditions. Denatured rh-ESLE was then refolded by a rapid-dilution method using a large amount of refolding buffer, which contained arginine and cysteine/cystine. The refolded rh-ESLE showed binding affinity for sLe(X) (K(d) = 321 nM, B(max) = 1.9 pmol/μg protein). This result suggests that the refolded rh-ESLE recovered its native and functional structure.

  11. Activation of Cyclic AMP Synthesis by Full and Partial Beta-Adrenergic Receptor Agonists in Chicken Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Cureri, Peter A. (Technical Monitor)

    2002-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Accordingly, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax concentrations were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. When cimaterol and clenbuterol were added to culture media at concentrations known to cause significant muscle hypertrophy in animals, there was no detectable effect on stimulation of cAMP synthesis. Finally, these same levels of cimaterol and clenbuterol did not antagonize the stimulation of cAMP by either epinephrine or isoproterenol.

  12. Renal atrial natriuretic factor receptors in hamster cardiomyopathy.

    PubMed

    Mukaddam-Daher, S; Jankowski, M; Dam, T V; Quillen, E W; Gutkowska, J

    1995-12-01

    Hamsters with cardiomyopathy (CMO), an experimental model of congestive heart failure, display stimulated renin-angiotensin-aldosterone and enhanced sympathetic nervous activity, all factors that lead to sodium retention, volume expansion and subsequent elevation of plasma atrial natriuretic factor (ANF) by the cardiac atria. However, sodium and water retention persist in CMO, indicating hyporesponsiveness to endogenous ANF. These studies were undertaken to fully characterize renal ANF receptor subtypes in normal hamsters and to evaluate whether alterations in renal ANF receptors may contribute to renal resistance to ANF in cardiomyopathy. Transcripts of the guanylyl cyclase-A (GC-A) and guanylyl cyclase B (GC-B) receptors were detected by quantitative polymerase chain reaction (PCR) in renal cortex, and outer and inner medullas. Compared to normal controls, the cardiomyopathic hamster's GC-A mRNA was similar in cortex but significantly increased in outer and inner medulla. Levels of GC-B mRNA were not altered by the disease. On the other hand, competitive binding studies, autoradiography, and affinity cross-linking demonstrated the absence of functional GC-B receptors in the kidney glomeruli and inner medulla. Also, C-type natriuretic peptide (CNP), the natural ligand for the GC-B receptors, failed to stimulate glomerular production of its second messenger cGMP. In CMO, sodium and water excretion were significantly reduced despite elevated plasma ANF (50.5 +/- 11.1 vs. 309.4 +/- 32.6 pg/ml, P < 0.001). Competitive binding studies of renal glomerular ANF receptors revealed no change in total receptor density, Bmax (369.6 +/- 27.4 vs. 282.8 +/- 26.2 fmol/mg protein), nor in dissociation constant, Kd (647.4 +/- 79.4 vs. 648.5 +/- 22.9 pM). Also, ANF-C receptor density (254.3 +/- 24.8 vs. 233.8 +/- 23.5 fmol/mg protein), nor affinity were affected by heart failure. Inner medullary receptors were exclusively of the GC-A subtype with Bmax (153.2 +/- 26.4 vs. 134.5 +/- 21.2 fmol/mg protein) and Kd (395.7 +/- 148.0 vs. 285.8 +/- 45.0 pM) not altered by cardiomyopathy. The increase in ANF-stimulated glomerular cGMP production was similar in normal and CMO hamsters (94- vs. 75-fold). These results demonstrate that renal ANF receptors do not contribute to the attenuated renal responses to ANF in hamster cardiomyopathy.

  13. Involvement of sigma-1 receptors in the antidepressant-like effects of dextromethorphan.

    PubMed

    Nguyen, Linda; Robson, Matthew J; Healy, Jason R; Scandinaro, Anna L; Matsumoto, Rae R

    2014-01-01

    Dextromethorphan is an antitussive with a high margin of safety that has been hypothesized to display rapid-acting antidepressant activity based on pharmacodynamic similarities to the N-methyl-D-aspartate (NMDA) receptor antagonist ketamine. In addition to binding to NMDA receptors, dextromethorphan binds to sigma-1 (σ1) receptors, which are believed to be protein targets for a potential new class of antidepressant medications. The purpose of this study was to determine whether dextromethorphan elicits antidepressant-like effects and the involvement of σ1 receptors in mediating its antidepressant-like actions. The antidepressant-like effects of dextromethorphan were assessed in male, Swiss Webster mice using the forced swim test. Next, σ1 receptor antagonists (BD1063 and BD1047) were evaluated in conjunction with dextromethorphan to determine the involvement of σ receptors in its antidepressant-like effects. Quinidine, a cytochrome P450 (CYP) 2D6 inhibitor, was also evaluated in conjunction with dextromethorphan to increase the bioavailability of dextromethorphan and reduce exposure to additional metabolites. Finally, saturation binding assays were performed to assess the manner in which dextromethorphan interacts at the σ1 receptor. Our results revealed dextromethorphan displays antidepressant-like effects in the forced swim test that can be attenuated by pretreatment with σ1 receptor antagonists, with BD1063 causing a shift to the right in the dextromethorphan dose response curve. Concomitant administration of quinidine potentiated the antidepressant-like effects of dextromethorphan. Saturation binding assays revealed that a Ki concentration of dextromethorphan reduces both the Kd and the Bmax of [(3)H](+)-pentazocine binding to σ1 receptors. Taken together, these data suggest that dextromethorphan exerts some of its antidepressant actions through σ1 receptors.

  14. Involvement of Sigma-1 Receptors in the Antidepressant-like Effects of Dextromethorphan

    PubMed Central

    Nguyen, Linda; Robson, Matthew J.; Healy, Jason R.; Scandinaro, Anna L.; Matsumoto, Rae R.

    2014-01-01

    Dextromethorphan is an antitussive with a high margin of safety that has been hypothesized to display rapid-acting antidepressant activity based on pharmacodynamic similarities to the N-methyl-D-aspartate (NMDA) receptor antagonist ketamine. In addition to binding to NMDA receptors, dextromethorphan binds to sigma-1 (σ1) receptors, which are believed to be protein targets for a potential new class of antidepressant medications. The purpose of this study was to determine whether dextromethorphan elicits antidepressant-like effects and the involvement of σ1 receptors in mediating its antidepressant-like actions. The antidepressant-like effects of dextromethorphan were assessed in male, Swiss Webster mice using the forced swim test. Next, σ1 receptor antagonists (BD1063 and BD1047) were evaluated in conjunction with dextromethorphan to determine the involvement of σ receptors in its antidepressant-like effects. Quinidine, a cytochrome P450 (CYP) 2D6 inhibitor, was also evaluated in conjunction with dextromethorphan to increase the bioavailability of dextromethorphan and reduce exposure to additional metabolites. Finally, saturation binding assays were performed to assess the manner in which dextromethorphan interacts at the σ1 receptor. Our results revealed dextromethorphan displays antidepressant-like effects in the forced swim test that can be attenuated by pretreatment with σ1 receptor antagonists, with BD1063 causing a shift to the right in the dextromethorphan dose response curve. Concomitant administration of quinidine potentiated the antidepressant-like effects of dextromethorphan. Saturation binding assays revealed that a Ki concentration of dextromethorphan reduces both the Kd and the Bmax of [3H](+)-pentazocine binding to σ1 receptors. Taken together, these data suggest that dextromethorphan exerts some of its antidepressant actions through σ1 receptors. PMID:24587167

  15. Synthesis and Preliminary Evaluation of a New 99mTc Labeled Substance P Analogue as a Potential Tumor Imaging Agent

    PubMed Central

    Mozaffari, Saeed; Erfani, Mostafa; Beiki, Davood; Johari Daha, Fariba; Kobarfard, Farzad; Balalaie, Saeed; Fallahi, Babak

    2015-01-01

    Neurokinin 1 receptors (NK1R) are overexpressed on several types of important human cancer cells. Substance P (SP) is the most specific endogenous ligand known for NK1Rs. Accordingly,a new SP analogue was synthesized and evaluated for detection of NK1R positive tumors.[6-hydrazinopyridine-3-carboxylic acid (HYNIC)-Tyr8-Met(O)11-SP] was synthesized and radiolabeled with 99mTc using ethylenediamine-N,N'-diacetic acid (EDDA)and Tricine as coligands. Common physicochemical properties of radioconjugate were studied and in-vitro cell line biological tests were accomplished to determine the receptor mediated characteristics. In-vivo biodistribution in normal and tumor bearingnude mice was also assessed. The cold peptide was prepared in high purity (>99%) and radiolabeled with 99mTc at high specific activities (84-112GBq/µmol) with an acceptable labeling yield (>95%). The radioconjugate was stable in-vitro in the presence of human serum and showed 44% protein binding to human serumalbumin. In-vitro cell line studies on U373MG cells showed an acceptable uptake up to 4.91 ± 0.22% with the ratio of 60.21 ± 1.19% for its specific fraction and increasing specific internalization during 4 h. Receptor binding assays on U373MG cells indicated a mean Kd of 2.46 ± 0.43 nM and Bmax of 128925 ± 8145 sites/cell. In-vivo investigations determined the specific tumor uptake in 3.36 percent of injected dose per gram (%ID/g) for U373MG cells and noticeable accumulations of activity in the intestines and lung. Predominant renal excretion pathway was demonstrated. Therefore, this new radiolabeled peptide could be a promising radiotracer for detection of NK1R positive primary or secondary tumors. PMID:25561916

  16. Carbachol does not down-regulate substance P receptors in pancreatic acini.

    PubMed

    Patto, R J; Vinayek, R; Jensen, R T; Gardner, J D

    1992-01-01

    In a previous study, we found that first incubating guinea pig pancreatic acini with carbachol caused desensitization of the enzyme secretory response to cholecystokinin-octapeptide (CCK-8), bombesin, and carbachol but not that to substance P. This carbachol-induced desensitization could be accounted for by carbachol-induced down-regulation of receptors for CCK-8, bombesin, and carbachol. Although carbachol did not desensitize the enzyme secretory response to substance P, an effect of carbachol on substance P receptors was not examined. In the present study, in dispersed acini from guinea pig pancreas, substance P caused a twofold increase in amylase secretion. Stimulation was half-maximal at 0.7 nM and was maximal at 10 nM. Analysis of the ability of substance P to inhibit binding of 125I-substance P to substance P receptors indicated that acini possess a single class of receptors for substance P (Kd = 0.8 +/- 0.1 nM; Bmax = 1,037 +/- 145 fmol/mg of DNA). There was a close correlation between the relative potency with which substance P stimulated amylase secretion (0.7 nM) and the potency for inhibiting binding of 125I-substance P (Kd = 0.8 nM). First incubating pancreatic acini with carbachol did not alter either substance P-stimulated enzyme secretion or binding of 125I-substance P to substance P receptors, whereas in the same experiments, carbachol reduced binding of 125I-CCK-8 to cholecystokinin receptors by 50% and decreased in CCK-8-stimulated enzyme secretion by 50%.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Regulated expression of the rat recombinant P2X(3) receptor in stably transfected CHO-K1 tTA cells.

    PubMed

    Lachnit, W G; Oglesby, I B; Gever, J R; Gever, M; Huang, C; Li, X C; Jin, H; McGivern, J G; Ford, A P

    2000-07-03

    In this report, the regulatable expression by tetracycline of the rat recombinant P2X(3) receptor in stably transfected Chinese hamster ovary (CHO-K1) expressing the tetracycline-controlled transactivator (tTA) is described. cDNA encoding the rat P2X(3)-receptor was subcloned into pTRE (a tetracycline-repressible expression vector) which was used to transfect stably CHO-K1 tTA cells. Using whole cell patch clamp techniques, 100 microM ATP evoked inward currents of 2.9+/-1.6 nA in transfected cells grown in the absence of tetracycline (tet-). The P2X(3) receptor protein was detectable by immunoblot as early as 24 h and protein expression levels continued to increase as much as 192 h following activation of tTA by the removal of the antibiotic. Saturation binding isotherms using [35S]ATP gamma S yielded a pK(d) of 8.2+/-0.1 and a B(max) of 31.9+/-3.5 pmol/mg protein in tet- cell membranes and a pK(d) of 8.1+/-0.1 and a B(max) of 5.8+/-0.8 pmol/mg protein in tet+ cell membranes. The agonist ligands 2MeSATP and alpha beta MeATP displaced the binding of [35S]ATP gamma S in tet- cell membranes with very high affinity, yielding pIC(50) values of 9.4+/-0.2 and 7.5+/-0. 2, respectively. In tet+ cell membrane, displacement of [35S]ATP gamma S by 2MeSATP and alpha beta MeATP was of much lower affinity (pIC(50) values of 7.8 and 6.2, respectively). ATP, ADP and UTP showed similar displacement of [35S]ATP gamma S binding in tet- and tet+ cell membranes. In other experiments, cytosolic Ca(2+) was monitored using the fluorescent indicator, fluo-3. Increases in cytosolic Ca(2+) were elicited by 100 nM alpha beta MeATP in tet- cells while no increases in cytosolic Ca(2+) were detected below 100 microM alpha beta MeATP in either tet+ cells or untransfected cells. These calcium responses to alpha beta MeATP had a pEC(50) of 6.7 and were transient, returning to baseline within 120 s. Suramin produced concentration-dependent, parallel, dextral shifts of E/[A] curves to alpha beta MeATP yielding a pK(B) of 5.6. PPADS produced non-parallel, dextral shifts of E/[A] curves to alpha beta MeATP which were insurmountable. These results show for the first time, expression of a functional, homomeric recombinant rat P2X(3) receptor which is under regulated expression in a stably transfected mammalian cell line.

  18. Hypoxia modifies nuclear calcium uptake pathways in the cerebral cortex of the guinea-pig fetus.

    PubMed

    Zanelli, S A; Spandou, E; Mishra, O P; Delivoria-Papadopoulos, M

    2005-01-01

    Nuclear Ca2+ signals are thought to play a critical role in the initiation and progression of programmed cell death. The present study tests the hypothesis that hypoxia alters nuclear Ca2+ transport pathways and leads to an increase in nuclear Ca(2+)-influx in cerebral cortical neuronal nuclei. To test this hypothesis the effect of tissue hypoxia on high affinity Ca(2+)-ATPase activity and the binding characteristics of inositol 1,4,5-triphosphate (IP3) and inositol 1,3,4,5-tetrakisphosphate (IP4) receptors were studied in neuronal nuclei from the cerebral cortex of guinea-pig fetuses. Results show increased high-affinity Ca(2+)-ATPase activity (nmol/mg protein/h) in the hypoxic group 969.7+/-79 as compared with 602.4+/-90.9 in the normoxic group, P<0.05. The number of IP3 receptors (Bmax, fmol/mg protein) increased from 61+/-21 in the normoxic group to 164+/-49 in the hypoxic group, P<0.05. K(d) values did not change following hypoxia. In contrast, IP4 receptor Bmax (fmol/mg protein) and K(d) (nM) values increased from 360+/-32 in the normoxic group to 626+/-136 in the hypoxic group (P<0.001) and, from 26+/-1 in the normoxic group to 61+/-9 in the hypoxic group (P<0.001), respectively. 45Ca(2+)-influx (pmol/mg protein) significantly increased from 6.3+/-1.9 in the normoxic group to 10.9+/-1.1 the hypoxic group (P<0.001). The data show that hypoxia modifies nuclear Ca2+ transport pathways and results in increased nuclear Ca(2+)-influx. We speculate that hypoxia increases nuclear Ca2+ uptake from the cytoplasm to the nucleoplasm, resulting in increased transcription of proapoptotic genes and subsequent activation of programmed cell death pathways.

  19. Tachykinin NK2 receptor and functional mechanisms in human colon: changes with indomethacin and in diverticular disease and ulcerative colitis.

    PubMed

    Burcher, Elizabeth; Shang, Fei; Warner, Fiona J; Du, Qin; Lubowski, David Z; King, Denis W; Liu, Lu

    2008-01-01

    Neurokinin A (NKA) is an important spasmogen in human colon. We examined inflammatory disease-related changes in the tachykinin NK(2) receptor system in human sigmoid colon circular muscle, using functional, radioligand binding, and quantitative reverse transcription-polymerase chain reaction methods. In circular muscle strips, indomethacin enhanced contractile responses to NKA (p < 0.01) and to the NK(2) receptor-selective agonist [Lys(5),MeLeu(9),Nle(10)]-NKA(4-10) (p < 0.05) in both normal and acute diverticular disease (DD) specimens, indicating NK(2) receptor-mediated release of relaxant prostanoids. Contractile responses to both tachykinins were reduced in strips from DD (p < 0.001) and ulcerative colitis (UC) (p < 0.05) specimens. Responses to acetylcholine were no different in other strips from the same disease patients, demonstrating that the change in responsiveness to tachykinins in disease is specifically mediated by the NK(2) receptor. In membranes from UC specimens, receptor affinity for (125)I-NKA (median K(D) 0.91 nM, n = 16) was lower (p < 0.01) than that in age-matched control specimens (K(D) 0.55 nM, n = 40), whereas K(D) (0.65 nM, n = 28) in DD was no different from control. No disease-related changes in receptor number (B(max)) were found (mean, 2.0-2.5 fmol/mg of wet weight tissue), suggesting that the reduced contractile responses in disease are not due to a loss of receptor number. Different mechanisms may account for the reduced contractility in DD compared with UC. A gender-related difference in receptor density was seen in controls, with B(max) lower in females (1.77 fmol/mg, n = 15) than in males (2.60 fmol/mg, n = 25, p = 0.01). In contrast, no gender-related differences were seen in NK(2) receptor mRNA in control colonic muscle, indicating that the gender difference is a post-translational event.

  20. Trichuris suis and Oesophagostomum dentatum show different sensitivity and accumulation of fenbendazole, albendazole and levamisole in vitro.

    PubMed

    Hansen, Tina V A; Nejsum, Peter; Friis, Christian; Olsen, Annette; Thamsborg, Stig Milan

    2014-04-01

    The single-dose benzimidazoles used against Trichuris trichiura infections in humans are not satisfactory. Likewise, the benzimidazole, fenbendazole, has varied efficacy against Trichuris suis whereas Oesophagostomum dentatum is highly sensitive to the drug. The reasons for low treatment efficacy of Trichuris spp. infections are not known. We studied the effect of fenbendazole, albendazole and levamisole on the motility of T. suis and O. dentatum and measured concentrations of the parent drug compounds and metabolites of the benzimidazoles within worms in vitro. The motility and concentrations of drug compounds within worms were compared between species and the maximum specific binding capacity (Bmax) of T. suis and O. dentatum towards the benzimidazoles was estimated. Comparisons of drug uptake in living and killed worms were made for both species. The motility of T. suis was generally less decreased than the motility of O. dentatum when incubated in benzimidazoles, but was more decreased when incubated in levamisole. The Bmax were significantly lower for T. suis (106.6, and 612.7 pmol/mg dry worm tissue) than O. dentatum (395.2, 958.1 pmol/mg dry worm tissue) when incubated for 72 hours in fenbendazole and albendazole respectively. The total drug concentrations (pmol/mg dry worm tissue) were significantly lower within T. suis than O. dentatum whether killed or alive when incubated in all tested drugs (except in living worms exposed to fenbendazole). Relatively high proportions of the anthelmintic inactive metabolite fenbendazole sulphone was measured within T. suis (6-17.2%) as compared to O. dentatum (0.8-0.9%). The general lower sensitivity of T. suis towards BZs in vitro seems to be related to a lower drug uptake. Furthermore, the relatively high occurrence of fenbendazole sulphone suggests a higher detoxifying capacity of T. suis as compared to O. dentatum.

  1. Trichuris suis and Oesophagostomum dentatum Show Different Sensitivity and Accumulation of Fenbendazole, Albendazole and Levamisole In Vitro

    PubMed Central

    Hansen, Tina V. A.; Nejsum, Peter; Friis, Christian; Olsen, Annette; Thamsborg, Stig Milan

    2014-01-01

    Background The single-dose benzimidazoles used against Trichuris trichiura infections in humans are not satisfactory. Likewise, the benzimidazole, fenbendazole, has varied efficacy against Trichuris suis whereas Oesophagostomum dentatum is highly sensitive to the drug. The reasons for low treatment efficacy of Trichuris spp. infections are not known. Methodology We studied the effect of fenbendazole, albendazole and levamisole on the motility of T. suis and O. dentatum and measured concentrations of the parent drug compounds and metabolites of the benzimidazoles within worms in vitro. The motility and concentrations of drug compounds within worms were compared between species and the maximum specific binding capacity (Bmax) of T. suis and O. dentatum towards the benzimidazoles was estimated. Comparisons of drug uptake in living and killed worms were made for both species. Principal findings The motility of T. suis was generally less decreased than the motility of O. dentatum when incubated in benzimidazoles, but was more decreased when incubated in levamisole. The Bmax were significantly lower for T. suis (106.6, and 612.7 pmol/mg dry worm tissue) than O. dentatum (395.2, 958.1 pmol/mg dry worm tissue) when incubated for 72 hours in fenbendazole and albendazole respectively. The total drug concentrations (pmol/mg dry worm tissue) were significantly lower within T. suis than O. dentatum whether killed or alive when incubated in all tested drugs (except in living worms exposed to fenbendazole). Relatively high proportions of the anthelmintic inactive metabolite fenbendazole sulphone was measured within T. suis (6–17.2%) as compared to O. dentatum (0.8–0.9%). Conclusion/Significance The general lower sensitivity of T. suis towards BZs in vitro seems to be related to a lower drug uptake. Furthermore, the relatively high occurrence of fenbendazole sulphone suggests a higher detoxifying capacity of T. suis as compared to O. dentatum. PMID:24699263

  2. Differences in the time course of dopaminergic supersensitivity following chronic administration of haloperidol, molindone, or sulpiride.

    PubMed

    Prosser, E S; Pruthi, R; Csernansky, J G

    1989-01-01

    The onset and persistence of changes in 3H-spiroperidol binding to dopamine (DA) D2 receptors were examined in rat mesolimbic and striatal brain regions following daily administration of haloperidol, molindone, or sulpiride for 3, 7, 14, or 28 days. Neuroleptic dose equivalencies were determined by inhibition of 3H-spiroperidol in vivo binding in several rat brain regions. Changes in locomotor and stereotyped responses to the specific DA D2 agonist quinpirole were examined 3 days after the last treatment dose. Haloperidol or molindone administration increased mean stereotypy scores and striatal DA D2 receptor densities throughout the 28-day treatment period. In contrast, mesolimbic DA D2 receptor densities were transiently increased and returned to control values, after 28 days of haloperidol or molindone treatment. Sulpiride treatment increased mean stereotypy scores and striatal Bmax values, but had no effect on locomotion or mesolimbic dopamine receptor density. Additionally, the magnitude of change in the various measures of brain DA function varied among the three neuroleptic treatment groups. Results from this study suggest that mesolimbic and striatal brain regions differ in their response to long-term neuroleptic administration and that drug choice may influence the magnitude of neuroleptic-induced dopaminergic supersensitivity.

  3. Gefitinib targets EGFR dimerization and ERK1/2 phosphorylation to inhibit pleural mesothelioma cell proliferation.

    PubMed

    Favoni, Roberto E; Pattarozzi, Alessandra; Lo Casto, Michele; Barbieri, Federica; Gatti, Monica; Paleari, Laura; Bajetto, Adriana; Porcile, Carola; Gaudino, Giovanni; Mutti, Luciano; Corte, Giorgio; Florio, Tullio

    2010-03-01

    Altered EGFR activity is a causal factor for human tumor development, including malignant pleural mesotheliomas. The aim of the present study was the evaluation of the effects of Gefitinib on EGF-induced mesothelioma cell proliferation and the intracellular mechanisms involved. Cell proliferation, DNA synthesis and apoptosis were measured by MTT, thymidine incorporation and FACS analysis; EGFR, ERK1/2 and Akt expression and phosphorylation by Western blot, whereas receptor sites were analyzed by binding studies. Gefitinib inhibited EGF-induced proliferation in two mesothelioma cell lines, derived from pleural effusion (IST-Mes2) or tumor biopsy (ZL55). The treatment with Gefitinib induced cell cycle arrest in both cell lines, while apoptosis was observed only for high concentrations and prolonged drug exposure. EGF-dependent mesothelioma cell proliferation was mediated by EGFR and ERK1/2 phosphorylation, while Akt was not affected. Gefitinib inhibited both EGFR and ERK1/2 activation, being maximal at drug concentrations that induce cytostatic effects, suggesting that the proapoptotic activity of Gefitinib is independent from EGFR inhibition. Gefitinib treatment increased EGFR Bmax, possibly through membrane stabilization of inactive receptor dimers that we show to be induced by the drug also in the absence of EGF. EGFR activation of ERK1/2 represents a key pathway for pleural mesothelioma cell proliferation. Low concentrations of Gefitinib cause mesothelioma cell cycle arrest through the blockade of EGFR activity while high concentrations induce apoptosis. Finally, we propose that the formation of inactive EGFR dimers may contribute to the antitumoral activity of Gefitinib.

  4. Effect of beta-ADrenergic Agonist on Cyclic AMP Synthesis in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Because it seems logical that these agonists exert their action on muscle through stimulation of cAMP synthesis, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax levels were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. In addition, the EC50 values for isoproterenol, cimaterol, clenbuterol, epinephrine, and albuterol were 360 nM, 630 nM, 900 nM, 2,470 nM, and 3,650 nM, respectively. Finally, dose response curves show that the concentrations of cimaterol and clenbuterol in culture media at concentrations known to cause significant muscle hypertrophy in animals had no detectable effect on stimulation of CAMP accumulation in chicken skeletal muscle cells.

  5. Characterization of C-type natriuretic peptide receptors in human mesangial cells.

    PubMed

    Zhao, J; Ardaillou, N; Lu, C Y; Placier, S; Pham, P; Badre, L; Cambar, J; Ardaillou, R

    1994-09-01

    Our aim was to examine whether the human glomerulus was a target for C-type natriuretic peptide (CNP) and how A, B and C receptors of natriuretic peptides (ANPR-A, ANPR-B, ANPR-C) were distributed in glomerular mesangial and epithelial cells. CNP stimulated cyclic GMP production in cultured human mesangial and epithelial cells with similar threshold concentrations (1 nM) and maximum effects (basal value x 30 at 1 microM). In contrast, atrial natriuretic peptide (ANP) was only stimulatory in epithelial cells. [125I] CNP bound specifically to mesangial cells with a Kd of 0.47 nM and Bmax of 42 fmol/mg. Equilibrium of binding was obtained after four to five hours at +4 degrees C and nonspecific binding represented 10 to 20% of total binding. HS142-1 (100 micrograms/ml), a specific inhibitor of ANPR-A and ANPR-B, suppressed 90% of CNP-dependent cyclic GMP production whereas it had little effect on [125I]-CNP binding, suggesting that C receptors were largely predominant in mesangial cells. No biological effect of CNP on mesangial cells, including change in basal or angiotensin II-induced contractility and inhibition of basal or serum-dependent proliferation, could be demonstrated. Similar results were obtained with 8-bromo-cyclic GMP and sodium nitroprusside. Intraglomerular localization of ANPR-A, ANPR-B and ANPR-C mRNA was studied using reverse transcriptase-polymerase chain reaction with amplification of their corresponding cDNA by different primers. Amplification products were identified on gel electrophoresis by their predicted sizes and sequencing. ANPR-A, ANPR-B and ANPR-C mRNA were present in epithelial cells whereas only ANPR-B and ANPR-C mRNA were detected in mesangial cells.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. High-affinity dopamine D2/D3 PET radioligands 18F-fallypride and 11C-FLB457: A comparison of kinetics in extrastriatal regions using a multiple-injection protocol

    PubMed Central

    Vandehey, Nicholas T; Moirano, Jeffrey M; Converse, Alexander K; Holden, James E; Mukherjee, Jogesh; Murali, Dhanabalan; Nickles, R Jerry; Davidson, Richard J; Schneider, Mary L; Christian, Bradley T

    2010-01-01

    18F-Fallypride and 11C-FLB457 are commonly used PET radioligands for imaging extrastriatal dopamine D2/D3 receptors, but differences in their in vivo kinetics may affect the sensitivity for measuring subtle changes in receptor binding. Focusing on regions of low binding, a direct comparison of the kinetics of 18F-fallypride and 11C-FLB457 was made using a MI protocol. Injection protocols were designed to estimate K1, k2, fNDkon, Bmax, and koff in the midbrain and cortical regions of the rhesus monkey. 11C-FLB457 cleared from the arterial plasma faster and yielded a ND space distribution volume (K1/k2) that is three times higher than 18F-fallypride, primarily due to a slower k2 (FAL:FLB; k2=0.54 min−1:0.18 min−1). The dissociation rate constant, koff, was slower for 11C-FLB457, resulting in a lower KDapp than 18F-fallypride (FAL:FLB; 0.39 nM:0.13 nM). Specific D2/D3 binding could be detected in the cerebellum for 11C-FLB457 but not 18F-fallypride. Both radioligands can be used to image extrastriatal D2/D3 receptors, with 11C-FLB457 providing greater sensitivity to subtle changes in low-receptor-density cortical regions and 18F-fallypride being more sensitive to endogenous dopamine displacement in medium-to-high-receptor-density regions. In the presence of specific D2/D3 binding in the cerebellum, reference region analysis methods will give a greater bias in BPND with 11C-FLB457 than with 18F-fallypride. PMID:20040928

  7. The antagonistic effect of antipsychotic drugs on a HEK293 cell line stably expressing human alpha1A1-adrenoceptors.

    PubMed

    Nourian, Zahra; Mulvany, Michael J; Nielsen, Karsten Bork; Pickering, Darryl S; Kristensen, Torsten

    2008-10-31

    Antipsychotic drugs often cause orthostatic hypotension, probably through antagonist action on resistance vessel alpha(1A)-adrenoceptors. Here we have tested this possibility directly using cells transfected with a relevant human alpha(1A)-adrenoceptor splice variant. To determine a splice variant which was relevant, we used quantitative real-time polymerase chain reaction (qPCR) to determine the prevalence in human subcutaneous small arteries of three of the five splice variants ADRA1A_v1-5, which encode functional protein: alpha(1A1)-, alpha(1A3)-, alpha(1A4)-adrenoceptors. Our statistical analysis showed higher transcription levels of alpha(1A1)- than of alpha(1A3)- and alpha(1A4)-adrenoceptors (1.6 and 5.8 times, respectively). We therefore chose to study the alpha(1A1)-adrenoceptor, and the cDNA encoding it was transfected into the Flp-In-293 (modified from HEK-293) cell line to produce a cell line stably expressing a functional form of this splice variant. The expression of recombinant alpha(1A1)-adrenoceptor subtype was confirmed by Western immunoblot analysis, and its functionality demonstrated using a Fura-2 assay by a rise in intracellular calcium concentration ([Ca(2+)](i)) when challenged with phenylephrine (EC(50)=1.61x10(-8) M). From Schild analysis, prazosin, sertindole, risperidone, and haloperidol caused a concentration-dependent, rightward shift of the cumulative concentration-response curves for phenylephrine in cells expressing human recombinant alpha(1A1)-adrenoceptors to yield pK(B) values of 8.40, 8.05, 8.26 and 7.38, respectively. In [7-methoxy-(3)H]-prazosin binding experiments, high expression was seen (B(max)=48.5+/-16.7 pmol/mg protein, +/-S.E.M.) along with high affinity binding to a single site (K(d)=0.210+/-0.034 nM). The pharmacological profiles of recombinant human alpha(1A1)-adrenoceptors in competition binding studies confirmed much higher antagonist affinity of sertindole and risperidone than haloperidol for these receptors. In summary, it can be concluded that there is an approximately 10-fold higher adrenoceptor affinity of risperidone and sertindole for human alpha(1A1)-adrenoceptors compared to haloperidol. These findings are consistent with the observation that risperidone and sertindole have a higher incidence of orthostatic hypotension than haloperidol.

  8. Chronic hypoxia up-regulates expression of adenosine A1 receptors in DDT1-MF2 cells.

    PubMed

    Hammond, Lucy C; Bonnet, Claire; Kemp, Paul J; Yates, Michael S; Bowmer, Christopher J

    2004-02-01

    As the first step to understand how chronic hypoxia might regulate smooth muscle function in health and disease, we have employed an established immortalised cell model of smooth muscle, DDT1-MF2 cells, to address the hypothesis that adenosine A1 receptor density is modulated by O2 availability. Maximal specific binding (Bmax) of the selective adenosine A1 receptor antagonist, [3H]-DPCPX, to cell membranes increased 3.5-fold from 0.48 +/- 0.02 pmol/mg to 1.7 +/- 0.5 pmol/mg protein after 16 hr of hypoxia and this effect was not accompanied by any statistically significant changes in either binding affinity (0.84 +/- 0.2 nM vs. 1.2 +/- 0.3 nM) or Hill coefficient (1.1 +/- 0.1 vs. 0.99 +/- 0.03). Hypoxia-evoked increases in membrane receptor density were paralleled in intact DDT1-MF2 cells. In addition, the increase in [3H]-DPCPX binding to intact cells was inhibited by co-incubation during hypoxia with the translational inhibitor cycloheximide, the transcriptional blocker actinomycin D and the NFkappaB inhibitor sulphasalazine. Together, these data show that adenosine A1 receptor density is modulated, at least in part, by O2-dependent activation of the transcription factor NFkappaB and adds to the list of processes dynamically regulated by ambient oxygen availability. Since hypoxia is an initiating factor in acute renal failure, similar changes in transcription may account for up-regulation of adenosine A1 receptors noted previously in the renal vasculature of rats with acute renal failure.

  9. Q-Space Truncation and Sampling in Diffusion Spectrum Imaging

    PubMed Central

    Tian, Qiyuan; Rokem, Ariel; Folkerth, Rebecca D.; Nummenmaa, Aapo; Fan, Qiuyun; Edlow, Brian L.; McNab, Jennifer A.

    2015-01-01

    Purpose To characterize the q-space truncation and sampling on the spin-displacement probability density function (PDF) in diffusion spectrum imaging (DSI). Methods DSI data were acquired using the MGH-USC connectome scanner (Gmax=300mT/m) with bmax=30,000s/mm2, 17×17×17, 15×15×15 and 11×11×11 grids in ex vivo human brains and bmax=10,000s/mm2, 11×11×11 grid in vivo. An additional in vivo scan using bmax=7,000s/mm2, 11×11×11 grid was performed with a derated gradient strength of 40mT/m. PDFs and orientation distribution functions (ODFs) were reconstructed with different q-space filtering and PDF integration lengths, and from down-sampled data by factors of two and three. Results Both ex vivo and in vivo data showed Gibbs ringing in PDFs, which becomes the main source of artifact in the subsequently reconstructed ODFs. For down-sampled data, PDFs interfere with the first replicas or their ringing, leading to obscured orientations in ODFs. Conclusion The minimum required q-space sampling density corresponds to a field-of-view approximately equal to twice the mean displacement distance (MDD) of the tissue. The 11×11×11 grid is suitable for both ex vivo and in vivo DSI experiments. To minimize the effects of Gibbs ringing, ODFs should be reconstructed from unfiltered q-space data with the integration length over the PDF constrained to around the MDD. PMID:26762670

  10. Differential inhibition of [3H]-oxotremorine-M and [3H]-quinuclinidyl benzilate binding to muscarinic receptors in rat brain membranes with acetylcholinesterase inhibitors.

    PubMed

    Lockhart, B; Closier, M; Howard, K; Steward, C; Lestage, P

    2001-04-01

    The potential interaction of acetylcholinesterase inhibitors with cholinergic receptors may play a significant role in the therapeutic and/or side-effects associated with this class of compound. In the present study, the capacity of acetylcholinesterase inhibitors to interact with muscarinic receptors was assessed by their ability to displace both [3H]-oxotremorine-M and [3H]-quinuclinidyl benzilate binding in rat brain membranes. The [3H]-quinuclinidyl benzilate/[3H]-oxotremorine-M affinity ratios permitted predictions to be made of either the antagonist or agonist properties of the different compounds. A series of compounds, representative of the principal classes of acetylcholinesterase inhibitors, displaced [3H]-oxotremorine-M binding with high-to-moderate potency (ambenonium>neostigmine=pyridostigmine=tacrine>physostigmine> edrophonium=galanthamine>desoxypeganine) whereas only ambenonium and tacrine displaced [3H]-quinuclinidyl benzilate binding. Inhibitors such as desoxypeganine, parathion and gramine demonstrated negligible inhibition of the binding of both radioligands. Scatchard plots constructed from the inhibition of [3H]-oxotremorine-M binding in the absence and presence of different inhibitors showed an unaltered Bmax and a reduced affinity constant, indicative of potential competitive or allosteric mechanisms. The capacity of acetylcholinesterase inhibitors, with the exception of tacrine and ambenonium, to displace bound [3H]-oxotremorine-M in preference to [3H]quinuclinidyl benzilate predicts that the former compounds could act as potential agonists at muscarinic receptors. Moreover, the rank order for potency in inhibiting acetylcholinesterase (ambenonium>neostigmine=physostigmine =tacrine>pyridostigmine=edrophonium=galanthamine >desoxypeganine>parathion>gramine) indicated that the most effective inhibitors of acetylcholinesterase also displaced [3H]-oxotremorine-M to the greatest extent. The capacity of these inhibitors to displace [3H]-oxotremorine-M binding preclude their utilisation for the prevention of acetylcholine catabolism in rat brain membranes, the latter being required to estimate the binding of acetylcholine to [3H]-oxotremorine-M-labelled muscarinic receptors. However, fasciculin-2, a potent peptide inhibitor of acetylcholinesterase (IC50 24 nM), did prevent catabolism of acetylcholine in rat brain membranes with an atypical inhibition isotherm of [3H]-oxotremorine-M binding, thus permitting an estimation of the "global affinity" of acetylcholine (Ki 85 nM) for [3H]-oxotremorine-M-labelled muscarinic receptors in rat brain.

  11. Differential effects of simple vs. complex carbohydrates on VLDL secretion rates and HDL metabolism in the guinea pig.

    PubMed

    Fernandez, M L; Abdel-Fattah, G; McNamara, D J

    1995-04-28

    Guinea pigs were fed isocaloric diets containing 52% (w/w) carbohydrate, either sucrose or starch, to investigate effects of simple vs. complex carbohydrates on plasma VLDL and HDL metabolism. Plasma cholesterol concentrations were not different between dietary groups while plasma triacylglycerol (TAG) and VLDL cholesterol levels were significantly increased in animals fed the sucrose diet (P < 0.05). Hepatic VLDL TAG secretion rates measured following intravenous injection of Triton WR-1339 were not affected by carbohydrate type whereas the rate of apo B secretion was 1.9-fold higher in sucrose fed animals (P < 0.02). Nascent VLDL from the sucrose group contained less TAG per apo B suggesting that the higher plasma TAG in animals fed simple carbohydrates results from increased secretion of VLDL particles with lower TAG content. Sucrose fed animals exhibited higher concentrations of hepatic free cholesterol (P < 0.01) while hepatic TAG levels and acyl CoA:cholesterol acyltransferase (ACAT) activity were not different between groups. Plasma HDL cholesterol concentrations and composition, and plasma lecithin cholesterol acyltransferase (LCAT) activity were not affected by diet yet there was a positive correlation between HDL cholesteryl ester content and LCAT activities (r = 0.70, P < 0.05). Hepatic membranes from the sucrose group had a higher hepatic HDL binding protein number (Bmax) with no changes in the dissociation constant (Kd). These results suggest that at the same carbohydrate energy intake, simple sugars induce modest changes in HDL metabolism while VLDL metabolism is affected at multiple sites, as indicated by the higher concentrations of hepatic cholesterol, dissociation in the synthesis rates of VLDL components, and compositional changes in nascent and mature VLDL.

  12. Concomitant alteration in number and affinity of P2X and muscarinic receptors are associated with bladder dysfunction in early stage of diabetic rats.

    PubMed

    Yoshizawa, Tsuyoshi; Hayashi, Yukio; Yoshida, Akira; Yoshida, Shohei; Ito, Yoshihiko; Yamaguchi, Kenya; Yamada, Shizuo; Takahashi, Satoru

    2018-03-01

    To investigate time course of bladder dysfunction and concurrent changes in number and affinity of the muscarinic and P 2 X receptor in the early stage of streptozotocin (STZ)-induced diabetic rats. Diabetic rats were prepared by the intraperitoneal injection of 50 mg/kg of STZ to 7-week-old female Wistar rats. We performed recording of 24-h voiding behavior and cystometry at 1, 4, 8, and 12 weeks after the induction of diabetes. A muscle strip experiments with electrical field stimulation (EFS), carbachol, and α,β-methylene adenosine 5'-triphosphate (α,β-MeATP) were also performed at the same time-points. Additionally, concurrent changes in number and affinity of bladder muscarinic and P 2 X receptor were measured by a radioreceptor assay using [N-methyl- 3 H] scopolamine methyl chloride ([ 3 H]NMS) and α,β-methylene-ATP (2,8- 3 H) tetrasodium salt ([ 3 H]α,β-MeATP). In STZ-induced diabetic rats, polydipsic polyuric pollakiuria were noted on recording of 24-h voiding behavior from early stage. Also, the residual urine volume markedly increased in diabetic rats on cystometry. In the muscle strip experiment, the detrusor contractions induced by EFS, carbachol, and α,β-MeATP were enhanced in STZ-induced diabetic rats. Based on the radioreceptor assay, the maximum number of sites (Bmax) for the specific binding of [ 3 H]NMS and [ 3 H]α,β-MeATP was concurrently increased in the bladder from diabetic rats. Increased bladder contractility is found in early stage of diabetic rats. Then, bladder dysfunction is associated with increased number of muscarinic and P 2 X receptors in STZ-induced diabetic rats.

  13. Effects of Saw Palmetto Extract on Urodynamic Parameters, Bladder Muscarinic and Purinergic Receptors and Urinary Cytokines in Rats with Cyclophosphamide-Induced Cystitis.

    PubMed

    Nasrin, Sweety; Masuda, Eiji; Kugaya, Haruna; Osano, Ayaka; Ito, Yoshihiko; Yamada, Shizuo

    2014-01-01

    To clarify the effect of saw palmetto extract (SPE), a phytotherapeutic agent, on urodynamic parameters, bladder muscarinic and purinergic receptors, and urinary cytokines in rats with cystitis induced by cyclophosphamide (CYP). Saw palmetto extract (60 mg/kg per day) was administered orally twice a day for 7 days to rats. The urodynamic parameters in CYP (150 mg/kg i.p.)-treated rats were monitored by a cystometric method under anesthesia. The muscarinic and purinergic receptors in the bladder and submaxillary gland were measured by radioreceptor assays using [N-methyl-(3) H] scopolamine chloride([(3) H]NMS) and αβ-methylene-ATP [2,8-(3) H] tetrasodium salt ([(3) H]αβ-MeATP), respectively. Urinary cytokines (interleukin-1β [IL-1β], IL-6 and L-17) were measured with enzyme linked immunosorbent assay kits. Micturition interval and micturition volume were significantly decreased and the frequency of micturition and basal pressure were significantly increased in the CYP-treated rats compared with sham-operated rats. Orally administered SPE significantly increased the micturition interval and micturition volume and decreased the frequency of micturition and basal pressure. The maximal number of sites (Bmax ) for the specific binding of [(3) H]NMS and [(3) H]αβ-MeATP was significantly decreased in the bladder. The decrease in receptors was attenuated by repeated treatment with SPE. An elevation in urinary cytokine (IL-1β and IL-17) levels were seen, and this increase was effectively suppressed by SPE treatment. Saw palmetto extract attenuates the alteration of urodynamic parameters, pharmacologically relevant receptors, and urinary cytokines in CYP-treated rats. Therefore, SPE may be a potential therapeutic agent for improving the clinical symptoms of cystitis. © 2013 Wiley Publishing Asia Pty Ltd.

  14. The effect of prolonged treatment with imipramine on the biosynthesis and functional characteristics of D2 dopamine receptors in the rat caudate putamen

    PubMed Central

    Dziedzicka-Wasylewska, Marta; Rogoż, Renata

    1998-01-01

    The present study shows the effects of imipramine in a single dose (10 mg kg−1, p.o.) or following repeated (14 days, twice a day) treatment on the level of mRNA coding for D2 dopamine receptors in the rat caudate putamen (CP). Repeated administration of imipramine resulted in the increase of the level of mRNA coding for D2 dopamine receptors. Radioligand binding studies with the D2 receptor agonist, [3H]-N-0437, indicated, that following imipramine administration, the affinity of the agonist for the D2 dopamine receptor significantly increased, though without any alterations in the Bmax. Pharmacological manipulations (by use of forskolin, GppNHp and quinpirole) of the cyclic AMP generating system, ex vivo following administration of imipramine indicated that an up-regulation of factors inhibiting cyclic GMP formation takes place. Most probably it is the D2 dopamine receptor which undergoes functional up-regulation, resulting from the enhancement of its biosynthesis. PMID:9535010

  15. Chronic Neuropathic Pain in Mice Reduces μ-Opioid Receptor-Mediated G-protein Activity in the Thalamus

    PubMed Central

    Hoot, Michelle R.; Sim-Selley, Laura J.; Selley, Dana E.; Scoggins, Krista L.; Dewey, William L.

    2011-01-01

    Neuropathic pain is a debilitating condition that is often difficult to treat using conventional pharmacological interventions and the exact mechanisms involved in the establishment and maintenance of this type of chronic pain have yet to be fully elucidated. The present studies examined the effect of chronic nerve injury on μ-opioid receptors and receptor-mediated G-protein activity within the supraspinal brain regions involved in pain processing of mice. Chronic constriction injury (CCI) reduced paw withdrawal latency, which was maximal at 10 days post-injury. [d-Ala2,(N-Me)Phe4, Gly5-OH] enkephalin (DAMGO)-stimulated [35S]GTPγS binding was then conducted at this time point in membranes prepared from the rostral ACC (rACC), thalamus and periaqueductal grey (PAG) of CCI and sham-operated mice. Results showed reduced DAMGO-stimulated [35S]GTPγS binding in the thalamus and PAG of CCI mice, with no change in the rACC. In thalamus, this reduction was due to decreased maximal stimulation by DAMGO, with no difference in EC50 values. In PAG, however, DAMGO Emax values did not significantly differ between groups, possibly due to the small magnitude of the main effect. [3H]Naloxone binding in membranes of the thalamus showed no significant differences in Bmax values between CCI and sham-operated mice, indicating that the difference in G-protein activation did not result from differences in μ-opioid receptor levels. These results suggest that CCI induced a region-specific adaptation of μ-opioid receptor-mediated G-protein activity, with apparent desensitization of the μ-opioid receptor in the thalamus and PAG and could have implications for treatment of neuropathic pain. PMID:21762883

  16. Functional G-Protein-Coupled Receptor (GPCR) Synthesis: The Pharmacological Analysis of Human Histamine H1 Receptor (HRH1) Synthesized by a Wheat Germ Cell-Free Protein Synthesis System Combined with Asolectin Glycerosomes

    PubMed Central

    Suzuki, Yasuyuki; Ogasawara, Tomio; Tanaka, Yuki; Takeda, Hiroyuki; Sawasaki, Tatsuya; Mogi, Masaki; Liu, Shuang; Maeyama, Kazutaka

    2018-01-01

    G-protein-coupled receptors (GPCRs) are membrane proteins distributed on the cell surface, and they may be potential drug targets. However, synthesizing GPCRs in vitro can be challenging. Recently, some cell-free protein synthesis systems have been shown to produce a large amount of membrane protein combined with chemical chaperones that include liposomes and glycerol. Liposomes containing high concentrations of glycerol are known as glycerosomes, which are used in new drug delivery systems. Glycerosomes have greater morphological stability than liposomes. Proteoglycerosomes are defined as glycerosomes that contain membrane proteins. Human histamine H1 receptor (HRH1) is one of the most studied GPCRs. In this study, we synthesized wild-type HRH1 (WT-HRH1) proteoglycerosomes and D107A-HRH1, (in which Asp107 was replaced by Ala) in a wheat germ cell-free protein synthesis system combined with asolectin glycerosomes. The mutant HRH1 has been reported to have low affinity for the H1 antagonist. In this study, the amount of synthesized WT-HRH1 in one synthesis reaction was 434 ± 66.6 μg (7.75 ± 1.19 × 103pmol). The specific binding of [3H]pyrilamine to the WT-HRH1 proteoglycerosomes became saturated as the concentration of the radioligand increased. The dissociation constant (Kd) and maximum density (Bmax) of the synthesized WT-HRH1 were 9.76 ± 1.25 nM and 21.4 ± 0.936 pmol/mg protein, respectively. However, specific binding to D107A-HRH1 was reduced compared with WT-HRH1 and the binding did not become saturated. The findings of this study highlight that HRH1 synthesized using a wheat germ cell-free protein synthesis system combined with glycerosomes has the ability to bind to H1 antagonists. PMID:29467651

  17. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  18. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  19. Peripheral markers of serotonergic and noradrenergic function in post-pubertal, caucasian males with autistic disorder.

    PubMed

    Croonenberghs, J; Delmeire, L; Verkerk, R; Lin, A H; Meskal, A; Neels, H; Van der Planken, M; Scharpe, S; Deboutte, D; Pison, G; Maes, M

    2000-03-01

    Some studies have suggested that disorders in the peripheral and central metabolism of serotonin (5-HT) and noradrenaline may play a role in the pathophysiology of autistic disorder. This study examines serotonergic and noradrenergic markers in a study group of 13 male, post-pubertal, caucasian autistic patients (age 12-18 y; I.Q. > 55) and 13 matched volunteers. [3H]-paroxetine binding Kd values were significantly higher in patients with autism than in healthy volunteers. Plasma concentrations of tryptophan, the precursor of 5-HT, were significantly lower in autistic patients than in healthy volunteers. There were no significant differences between autistic and normal children in the serum concentrations of 5-HT, or the 24-hr urinary excretion of 5-hydroxy-indoleacetic acid (5-HIAA), adrenaline, noradrenaline, and dopamine. There were no significant differences in [3H]-rauwolscine binding Bmax or Kd values, or in the serum concentrations of tyrosine, the precursor of noradrenaline, between both study groups. There were highly significant positive correlations between age and 24-hr urinary excretion of 5-HIAA and serum tryptophan. The results suggest that: 1) serotonergic disturbances, such as defects in the 5-HT transporter system and lowered plasma tryptophan, may play a role in the pathophysiology of autism; 2) autism is not associated with alterations in the noradrenergic system; and 3) the metabolism of serotonin in humans undergoes significant changes between the ages of 12 and 18 years.

  20. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  1. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  2. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  3. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  4. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  5. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  6. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  7. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  8. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  9. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  10. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  12. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  13. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  14. Comparison of [(18)F]altanserin and [(18)F]deuteroaltanserin for PET imaging of serotonin(2A) receptors in baboon brain: pharmacological studies.

    PubMed

    Staley, J K; Van Dyck, C H; Tan, P Z; Al Tikriti, M; Ramsby, Q; Klump, H; Ng, C; Garg, P; Soufer, R; Baldwin, R M; Innis, R B

    2001-04-01

    The regional distribution in brain, distribution volumes, and pharmacological specificity of the PET 5-HT(2A) receptor radiotracer [(18)F]deuteroaltanserin were evaluated and compared to those of its non-deuterated derivative [(18)F]altanserin. Both radiotracers were administered to baboons by bolus plus constant infusion and PET images were acquired up to 8 h. The time-activity curves for both tracers stabilized between 4 and 6 h. The ratio of total and free parent to metabolites was not significantly different between radiotracers; nevertheless, total cortical R(T) (equilibrium ratio of specific to nondisplaceable brain uptake) was significantly higher (34-78%) for [(18)F]deuteroaltanserin than for [(18)F]altanserin. In contrast, the binding potential (Bmax/K(D)) was similar between radiotracers. [(18)F]Deuteroaltanserin cortical activity was displaced by the 5-HT(2A) receptor antagonist SR 46349B but was not altered by changes in endogenous 5-HT induced by fenfluramine. These findings suggest that [(18)F]deuteroaltanserin is essentially equivalent to [(18)F]altanserin for 5-HT(2A) receptor imaging in the baboon.

  15. Decreased GABA receptor in the cerebral cortex of epileptic rats: effect of Bacopa monnieri and Bacoside-A.

    PubMed

    Mathew, Jobin; Balakrishnan, Savitha; Antony, Sherin; Abraham, Pretty Mary; Paulose, C S

    2012-02-24

    Gamma amino butyric acid (GABA), the principal inhibitory neurotransmitter in the cerebral cortex, maintains the inhibitory tones that counter balances neuronal excitation. When this balance is perturbed, seizures may ensue. In the present study, alterations of the general GABA, GABAA and GABAB receptors in the cerebral cortex of the epileptic rat and the therapeutic application of Bacopa monnieri were investigated. Scatchard analysis of [3H]GABA, [3H]bicuculline and [3H]baclofen in the cerebral cortex of the epileptic rat showed significant decrease in Bmax (P < 0.001) compared to control. Real Time PCR amplification of GABA receptor subunits such as GABAAά1, GABAAγ, GABAAδ, GABAB and GAD where down regulated (P < 0.001) in epileptic rats. GABAAά5 subunit and Cyclic AMP responsible element binding protein were up regulated. Confocal imaging study confirmed the decreased GABA receptors in epileptic rats. Epileptic rats have deficit in radial arm and Y maze performance. Bacopa monnieri and Bacoside-A treatment reverses epilepsy associated changes to near control suggesting that decreased GABA receptors in the cerebral cortex have an important role in epileptic occurrence; Bacopa monnieri and Bacoside-A have therapeutic application in epilepsy management.

  16. Blockade of the inotropic effect of Bay K 8644 by cytochalasin-B and phloretin.

    PubMed Central

    Dresel, P. E.; Ogbaghebriel, A.

    1988-01-01

    1. The positive inotropic effect in rabbit atria and papillary muscles of Bay K 8644 is blocked by cytochalasin-B (Cyto-B) and phloretin, two compounds known to block the facilitated diffusion of glucose. These compounds do not change the concentration-response curve of calcium. 2. Cyto-B is more potent in atria than in papillary muscles, 10(-7) M having a maximal effect in atria whereas 2 x 10(-5) M was required for a maximal effect in papillary muscles. Phloretin was fully effective at 10(-4) M, the only concentration tested. 3. The inotropic effect of Bay K 8644 was virtually abolished in atria bathed in a glucose-free medium or one containing 5 mM pyruvate. The contractile response to Bay K 8644 of papillary muscles was not changed significantly in glucose-free or in pyruvate-containing medium. 4. Cyto-B (2 x 10(-5) M) caused a slight but significant increase in the KD for the binding of nitrendipine to a crude sarcolemnal preparation from rabbit ventricles. The Bmax was unchanged. 5. These results may best be explained by the hypothesis that there is a metabolic requirement for the inotropic effect of Bay K 8644. PMID:2456118

  17. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  18. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  19. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  20. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  1. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  2. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  3. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  5. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  6. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  7. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  8. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  9. Development of peptide and protein based radiopharmaceuticals.

    PubMed

    Wynendaele, Evelien; Bracke, Nathalie; Stalmans, Sofie; De Spiegeleer, Bart

    2014-01-01

    Radiolabelled peptides and proteins have recently gained great interest as theranostics, due to their numerous and considerable advantages over small (organic) molecules. Developmental procedures of these radiolabelled biomolecules start with the radiolabelling process, greatly defined by the amino acid composition of the molecule and the radionuclide used. Depending on the radionuclide selection, radiolabelling starting materials are whether or not essential for efficient radiolabelling, resulting in direct or indirect radioiodination, radiometal-chelate coupling, indirect radiofluorination or (3)H/(14)C-labelling. Before preclinical investigations are performed, quality control analyses of the synthesized radiopharmaceutical are recommended to eliminate false positive or negative functionality results, e.g. changed receptor binding properties due to (radiolabelled) impurities. Therefore, radionuclidic, radiochemical and chemical purity are investigated, next to the general peptide attributes as described in the European and the United States Pharmacopeia. Moreover, in vitro and in vivo stability characteristics of the peptides and proteins also need to be explored, seen their strong sensitivity to proteinases and peptidases, together with radiolysis and trans-chelation phenomena of the radiopharmaceuticals. In vitro biomedical characterization of the radiolabelled peptides and proteins is performed by saturation, kinetic and competition binding assays, analyzing KD, Bmax, kon, koff and internalization properties, taking into account the chemical and metabolic stability and adsorption events inherent to peptides and proteins. In vivo biodistribution can be adapted by linker, chelate or radionuclide modifications, minimizing normal tissue (e.g. kidney and liver) radiation, and resulting in favorable dosimetry analyses. Finally, clinical trials are initiated, eventually leading to the marketing of radiolabelled peptides and proteins for PET/SPECT-imaging and therapy of different clinical diseases.

  10. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  11. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  12. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  13. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  14. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  15. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  16. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  17. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  18. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  19. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  20. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  1. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  2. Binding characteristics of the ovine membrane progesterone receptor alpha and expression of the receptor during the estrous cycle

    PubMed Central

    Ashley, Ryan L; Arreguin-Arevalo, J Alejandro; Nett, Terry M

    2009-01-01

    Background Classically, progesterone has been thought to act only through the well-known genomic pathway involving hormone binding to nuclear receptors and subsequent modulation of gene expression. However, there is increasing evidence for rapid, non-genomic effects of progesterone in a variety of mammalian tissues and it is possible that a membrane PR (mPR) is causing these events. We recently isolated and characterized an ovine mPR referred to as mPR-alpha, distinct from the nuclear PR. Based on predicted structural analysis, the ovine mPR-alpha possesses seven transmembrane domains typical of G protein-coupled receptors. Despite the homology to other reported mPRs, information pertaining to the steroid binding characteristics of the ovine mPR-alpha was lacking. Additionally, the ovine mPR-alpha transcript has been identified in the hypothalamus, pituitary, uterus, ovary and corpus luteum, yet changes in expression of the ovine mPR-alpha in these tissues were not known. Consequently, the purpose of this work was to determine the steroid binding characteristics of the ovine mPR-alpha and to investigate possible changes in expression of the ovine mPR-alpha in reproductive tissues throughout the estrous cycle. Methods Binding studies were performed using crude membrane fractions from CHO cells expressing the mPR-alpha. Using quantitative Real-time PCR we determined the expression pattern of mRNA for the ovine mPR-alpha during the ovine estrous cycle in tissues known to express the mPR-alpha. Jugular blood samples were also collected and analyzed for serum concentrations of P4 to ensure ewes were at the appropriate stage of their cycle. Results Only progesterone, 20alpha-hydroxyprogesterone and 17alpha-hydroxyprogesterone were able to displace binding of 3H-P4 (P < 0.001) to membrane fractions from CHO cells expressing ovine mPR-alpha. The average B-max and Kd values for three separate experiments were 624 +/- 119 fmol/micro gram protein and 122 +/- 50 nM, respectively. Significant changes in expression of mRNA for the mPR-alpha during the estrous cycle were noted in the corpus luteum and uterus. Conclusion The mPR-alpha specifically binds progestins and its expression was correlated to progesterone secretion during the ovine estrous cycle. Results from the present studies suggest that mPR-alpha may have an important physiological role during the ovine estrous cycle. PMID:19432978

  3. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  4. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  5. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  6. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  7. How large B-factors can be in protein crystal structures.

    PubMed

    Carugo, Oliviero

    2018-02-23

    Protein crystal structures are potentially over-interpreted since they are routinely refined without any restraint on the upper limit of atomic B-factors. Consequently, some of their atoms, undetected in the electron density maps, are allowed to reach extremely large B-factors, even above 100 square Angstroms, and their final positions are purely speculative and not based on any experimental evidence. A strategy to define B-factors upper limits is described here, based on the analysis of protein crystal structures deposited in the Protein Data Bank prior 2008, when the tendency to allow B-factor to arbitrary inflate was limited. This B-factor upper limit (B_max) is determined by extrapolating the relationship between crystal structure average B-factor and percentage of crystal volume occupied by solvent (pcVol) to pcVol =100%, when, ab absurdo, the crystal contains only liquid solvent, the structure of which is, by definition, undetectable in electron density maps. It is thus possible to highlight structures with average B-factors larger than B_max, which should be considered with caution by the users of the information deposited in the Protein Data Bank, in order to avoid scientifically deleterious over-interpretations.

  8. Investigation of effective impact parameters in electron-ion temperature relaxation via Particle-Particle Coulombic molecular dynamics

    NASA Astrophysics Data System (ADS)

    Zhao, Yinjian

    2017-09-01

    Aiming at a high simulation accuracy, a Particle-Particle (PP) Coulombic molecular dynamics model is implemented to study the electron-ion temperature relaxation. In this model, the Coulomb's law is directly applied in a bounded system with two cutoffs at both short and long length scales. By increasing the range between the two cutoffs, it is found that the relaxation rate deviates from the BPS theory and approaches the LS theory and the GMS theory. Also, the effective minimum and maximum impact parameters (bmin* and bmax*) are obtained. For the simulated plasma condition, bmin* is about 6.352 times smaller than the Landau length (bC), and bmax* is about 2 times larger than the Debye length (λD), where bC and λD are used in the LS theory. Surprisingly, the effective relaxation time obtained from the PP model is very close to the LS theory and the GMS theory, even though the effective Coulomb logarithm is two times greater than the one used in the LS theory. Besides, this work shows that the PP model (commonly known as computationally expensive) is becoming practicable via GPU parallel computing techniques.

  9. Physiological measures of neurotoxicity of diazinon and malathion to larval rainbow trout (Oncorhynchus mykiss) and their correlation with behavioral measures

    USGS Publications Warehouse

    Beauvais, S.L.; Jones, S.B.; Brewer, S.K.; Little, E.E.

    2000-01-01

    Relations between neurotoxicants and changes in physiological parameters and behavior were investigated in larval rainbow trout (RBT; Oncorhynchus mykiss) exposed to sublethal concentrations of two organophosphate pesticides (OPs). Fish were exposed to diazinon and malathion in static-renewal experiments. After exposures for 24, 96, or 96 h, followed by 48 h of recovery, individual RBT were videotaped to assess locomotory behaviors. Brain tissue from the same fish was assayed for the physiological endpoints, cholinesterase (ChE) activity, muscarinic cholinergic receptor (MChR) number (Bmax), and MChR affinity (KD). Cholinesterase activity decreased significantly with increasing concentrations of both diazinon and malathion and differed significantly among exposure durations, with 24- and 96-h means less than 48-h recovery means. Decreases in Bmax with OP concentration were not significant for either chemical, and KDwas unaffected. Changes in swimming speed and distance were significantly correlated with changes in ChE activity for both chemicals; rate of turning was significantly correlated with ChE activity in malathion exposures. These results suggest that correlations between physiological and behavioral changes previously seen in mammals also occur in fish.

  10. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  11. Acetaminophen Differentially Enhances Social Behavior and Cortical Cannabinoid Levels in Inbred Mice

    PubMed Central

    Gould, Georgianna G.; Seillier, Alexandre; Weiss, Gabriela; Giuffrida, Andrea; Burke, Teresa F.; Hensler, Julie G.; Rock, Crystal; Tristan, Amanda; McMahon, Lance R.; Salazar, Alexander; O’Connor, Jason C.; Satsangi, Neera; Satsangi, Rajiv K.; Gu, Ting-Ting; Treat, Keenan; Smolik, Corey; Schultz, Stephen T.

    2012-01-01

    Supratherapeutic doses of the analgesic acetaminophen (paracetomol) are reported to promote social behavior in Swiss mice. However, we hypothesized that it might not promote sociability in other strains due to cannabinoid CB1 receptor-mediated inhibition of serotonin (5-HT) transmission in the frontal cortex. We examined the effects of acetaminophen on social and repetitive behaviors in comparison to a cannabinoid agonist, WIN 55,212-2, in two strains of socially-deficient mice, BTBR and 129S1/SvImJ (129S). Acetaminophen (100 mg/kg) enhanced social interactions in BTBR, and social novelty preference and marble burying in 129S at serum levels ≥70 ng/ml. Following acetaminophen injection or sociability testing, anandamide (AEA) increased in BTBR frontal cortex, while behavior testing increased 2-arachidonyl glycerol (2-AG) levels in 129S frontal cortex. In contrast, WIN 55,212-2 (0.1 mg/kg) did not enhance sociability. Further, we expected CB1-deficient (+/−) mice to be less social than wild-type, but instead found similar sociability. Given strain differences in endocannabinoid response to acetaminophen, we compared cortical CB1 and 5-HT1A receptor density and function relative to sociable C57BL/6 mice. CB1 receptor saturation binding (Bmax= 958±117 fmol/mg protein), and affinity for [3H]CP55,940 (KD= 3±0.8 nM) was similar in frontal cortex among strains. CP55,940-stimulated [35S]GTPγS binding in cingulate cortex was 136±12, 156±22, and 75±9% above basal in BTBR, 129S and C57BL/6 mice. The acetaminophen metabolite para-aminophenol (1μM) failed to stimulate [35S]GTPγS binding. Hence, it appears that other indirect actions of acetaminophen, including 5-HT receptor agonism, may underlie its sociability promoting properties outweighing any CB1 mediated suppression by locally-elevated endocannabinoids in these mice. PMID:22542870

  12. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  13. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  14. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  15. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  16. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  17. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  18. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  19. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  20. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  1. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  2. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  3. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  4. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  6. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  7. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  8. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  9. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  10. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  11. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  12. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  13. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  14. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  15. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  16. Specific labelling of serotonin 5-HT(1B) receptors in rat frontal cortex with the novel, phenylpiperazine derivative, [3H]GR125,743. A pharmacological characterization.

    PubMed

    Millan, M J; Newman-Tancredi, A; Lochon, S; Touzard, M; Aubry, S; Audinot, V

    2002-04-01

    Although several tritiated agonists have been used for radiolabelling serotonin (5-hydroxytryptamine, 5-HT)(1B) receptors in rats, data with a selective, radiolabelled antagonist have not been presented. Inasmuch as [3H]GR125,743 specifically labels cloned, human and native guinea pig 5-HT(1B) receptors and has been employed for characterization of cerebral 5-HT(1B) receptor in the latter species [Eur. J. Pharmacol. 327 (1997) 247.], the present study evaluated its utility for characterization of native, cerebral 5-HT(1B) sites in the rat. In homogenates of frontal cortex, [3H]GR125,743 (0.8 nM) showed rapid association (t(1/2)=3.4 min), >90% specific binding and high affinity (K(d)=0.6 nM) for a homogeneous population of receptors with a density (B(max)) of 160 fmol/mg protein. In competition binding studies, affinities were determined for 15 chemically diverse 5-HT(1B) agonists, including 2-[5-[3-(4-methylsulphonylamino)benzyl-1,2,4-oxadiazol-5-yl]-1H-indole-3-yl]ethylamine (L694,247; pK(i), 10.4), 5-carboxamidotryptamine (5-CT; 9.7), 3-[3-(2-dimethylamino-ethyl)-1H-indol-6-yl]-N-(4-methoxybenzyl)acrylamide (GR46,611; 9.6), 5-methoxy-3-(1,2,5,6-tetrahydro-4-pyridinyl)-1H-indole (RU24,969; 9.5), dihydroergotamine (DHE; 8.6), 5-H-pyrrolo[3,2-b]pyridin-5-one,1,4-dihydro-3-(1,2,3,6-tetrahydro-4-pyridinyl (CP93,129; 8.4), anpirtoline (7.9), sumatriptan (7.4), 1-[2-(3-fluorophenyl)ethyl]-4-[3-[5-(1,2,4-triazol-4-yl)-1H-indol-3-yl]propyl]piperazine (L775,606; 6.4) and (minus sign)-1(S)-[2-[4-(4-methoxyphenyl)piperazin-1-yl]ethyl]-N-methyl-3,4-dihydro-1H-2-benzopyran-6-carboxamide (PNU109,291; <5.0). Similarly, affinities were established for 13 chemically diverse antagonists, including N-[4-methoxy-3-(4-methylpiperazin-1-yl)phenyl]-3-methyl-4-(4-pyridyl)benzamide (GR125,743; pK(i), 9.1), (-)cyanopindolol (9.0), (-)-tertatolol (8.2), N-(4-methoxy-3-(4-methylpiperazin-1-yl)phenyl]-2'-methyl-4'-(5-methyl-1,2,4-oxadiozol-3-yl)biphenyl-4-carboxamide (GR127,935; 8.2), N-[3-(1,4-benzodioxan-5-yl)piperidin-4-yl]N-(indan-2yl)amine (S18127; 7.9), metergoline (7.8), (-)-pindolol (7.6), 1'-methyl-5-[2'-methyl-4'-(5-methyl-1,2,4-oxadiazol-3-yl)-biphenyl-4-ylcarbonyl]-2,3,6,7-tetrahydro-5H-spiro[furo[2,3-f]indole-3,4'-piperidine] (SB224,289; 7.5) and ketanserin (<5.0). These rank orders of affinity correspond to the binding profile of 5-HT(1B) rather than 5-HT(1D) receptors. The low affinities of L775,066 and PNU109,291 versus L694,247 should be noted, as well as the low affinity of ketanserin as compared to SB224,289. Finally, in line with species differences, the affinities of several ligands including CP93,129, RU24,969, (-)-pindolol and (-)-propanolol in rat 5-HT(1B) sites were markedly different to guinea pig 5-HT(1B) sites labelled with [3H]GR125,743. In conclusion, [3H]GR125,743 is an appropriate tool for the radiolabelling of native, rat 5-HT(1B) receptors and permitted determination of the affinities of an extensive series of ligands at these sites.

  17. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  18. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  19. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  20. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  1. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  2. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  3. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  4. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  5. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  6. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  7. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  8. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  9. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  10. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  11. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  12. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  13. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  14. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  15. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  16. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  17. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  18. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  19. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  20. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  1. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  2. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  3. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  4. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  5. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  6. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  7. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  8. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  9. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  10. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  11. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  12. Curcumin restores diabetes induced neurochemical changes in the brain stem of Wistar rats.

    PubMed

    Kumar, Peeyush T; George, Naijil; Antony, Sherin; Paulose, Cheramadathikudiyil Skaria

    2013-02-28

    Diabetes mellitus, when poorly controlled, leads to debilitating central nervous system (CNS) complications including cognitive deficits, somatosensory and motor dysfunction. The present study investigated curcumin's potential in modulating diabetes induced neurochemical changes in brainstem. Expression analysis of cholinergic, insulin receptor and GLUT-3 in the brainstem of streptozotocin (STZ) induced diabetic rats were studied. Radioreceptor binding assays, gene expression studies and immunohistochemical analysis were done in the brainstem of male Wistar rats. Our result showed that Bmax of total muscarinic and muscarinic M3 receptors were increased and muscarinic M1 receptor was decreased in diabetic rats compared to control. mRNA level of muscarinic M3, α7-nicotinic acetylcholine, insulin receptors, acetylcholine esterase, choline acetyltransferase and GLUT-3 significantly increased and M1 receptor decreased in the brainstem of diabetic rats. Curcumin and insulin treatment restored the alterations and maintained all parameters to near control. The results show that diabetes is associated with significant reduction in brainstem function coupled with altered cholinergic, insulin receptor and GLUT-3 gene expression. The present study indicates beneficial effect of curcumin in diabetic rats by regulating the cholinergic, insulin receptor and GLUT-3 in the brainstem similar to the responses obtained with insulin therapy. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Decreased GABA receptor in the cerebral cortex of epileptic rats: effect of Bacopa monnieri and Bacoside-A

    PubMed Central

    2012-01-01

    Abstact Background Gamma amino butyric acid (GABA), the principal inhibitory neurotransmitter in the cerebral cortex, maintains the inhibitory tones that counter balances neuronal excitation. When this balance is perturbed, seizures may ensue. Methods In the present study, alterations of the general GABA, GABAA and GABAB receptors in the cerebral cortex of the epileptic rat and the therapeutic application of Bacopa monnieri were investigated. Results Scatchard analysis of [3H]GABA, [3H]bicuculline and [3H]baclofen in the cerebral cortex of the epileptic rat showed significant decrease in Bmax (P < 0.001) compared to control. Real Time PCR amplification of GABA receptor subunits such as GABAAά1, GABAAγ, GABAAδ, GABAB and GAD where down regulated (P < 0.001) in epileptic rats. GABAAά5 subunit and Cyclic AMP responsible element binding protein were up regulated. Confocal imaging study confirmed the decreased GABA receptors in epileptic rats. Epileptic rats have deficit in radial arm and Y maze performance. Conclusions Bacopa monnieri and Bacoside-A treatment reverses epilepsy associated changes to near control suggesting that decreased GABA receptors in the cerebral cortex have an important role in epileptic occurrence; Bacopa monnieri and Bacoside-A have therapeutic application in epilepsy management. PMID:22364254

  14. [Specific aspects of thrombocyte system of serotonin in patients with different manifestations of schizoaffective psychosis].

    PubMed

    Brusov, O S; Dikaia, V I; Zlobina, G P; Faktor, M I; Pavlova, O A; Bologov, P V; Korenev, A N

    2000-01-01

    45 women with different manifestations of schizoaffective psychosis (SAP) were examined. The diagnosis corresponded to ICD-10 (F25). According to the classification elaborated in Mental Health Research Centre of Russian Academy of Medical Sciences, groups of patients were identified with different variants of the psychoses course: a nuclear SAP type; a borderline SAP variation with phasic-recurrent course; SAP with progredient variation (schizoaffective variation of schizophrenia). The patients were examined both during the attack and remission. A rate of serotonine uptake (Vmax) in blood platelets, a specific imipramine binding (Bmax) and the level of serotonin in blood platelets were evaluated. It was found that dynamics of both Vmax and the level of serotonin in different SAP types were different, that was related to clinical and biological SAP heterogeneity. A tendency to decreasing of serotonin system functional activity was found in progredient SAP variations, especially during the remission, which was of low quality in these cases. On the contrary, in the borderline variations the indices of the decreased function of serotonin system corresponded well to those of acute psychosis. In nuclear type--a type with the most favourable course of psychosis--any significant changes weren't revealed as compared with the normal parameters.

  15. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  17. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  18. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  19. Studies on the application of temperature-responsive ion exchange polymers with whey proteins.

    PubMed

    Maharjan, Pankaj; Campi, Eva M; De Silva, Kirthi; Woonton, Brad W; Jackson, W Roy; Hearn, Milton T W

    2016-03-18

    Several new types of temperature-responsive ion exchange resins of different polymer composition have been prepared by grafting the products from the co-polymerisation of N-phenylacrylamide, N-iso-propylacrylamide and acrylic acid derivatives onto cross-linked agarose. Analysis of the binding isotherms for these different resins obtained under batch adsorption conditions indicated that the resin based on N-iso-propylacrylamide containing 5% (w/w) N-phenylacrylamide and 5% (w/w) acrylic acid resulted in the highest adsorption capacity, Bmax, for the whey protein, bovine lactoferrin, e.g. 14 mg bovine lactoferrin/mL resin at 4 °C and 62 mg bovine lactoferrin/mL resin at 40 °C, respectively. Under dynamic loading conditions at 40 °C, 94% of the loaded bovine lactoferrin on a normalised mg protein per mL resin basis was adsorbed by this new temperature-responsive ion-exchanger, and 76% was eluted by a single cycle temperature shift to 4 °C without varying the composition of the 10mM sodium dihydrogen phosphate buffer, pH 6.5, or the flow rate. The binding characteristics of these different ion exchange resins with bovine lactoferrin were also compared to results obtained using other resins based on N-isopropylacrylamide but contained N-tert-butylacrylamide rather than N-phenylacrylamide, where the corresponding dynamic capture and release properties for bovine lactoferrin required different temperature conditions of 20 °C and 50 °C, respectively for optimal desorption/adsorption. The cationic protein, bovine lactoperoxidase, was also adsorbed and desorbed with these temperature-responsive resins under similar conditions of changing temperature, whereas the anionic protein, bovine β-lactoglobulin, was not adsorbed under this regime of temperature conditions but instead eluted in the flow-through. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  1. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  2. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  3. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  4. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  5. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  6. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  7. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  8. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  9. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  10. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  11. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  12. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  13. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  14. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  15. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  16. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  17. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  18. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  19. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  20. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  1. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  2. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  5. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  6. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  7. A compact circumstellar shell as the source of high-velocity features in SN 2011fe

    NASA Astrophysics Data System (ADS)

    Mulligan, Brian W.; Wheeler, J. Craig

    2018-05-01

    High-velocity features (HVFs), especially of Ca II, are frequently seen in Type Ia supernova observed prior to B-band maximum (Bmax). These HVFs evolve in velocity from more than 25 000 km s-1, in the days after first light, to about 18 000 km s-1 near Bmax. To recreate the evolution of the Ca II near-infrared triplet (CaNIR) HVFs in SN 2011fe, we consider the interaction between a model Type Ia supernova and compact circumstellar shells with masses between 0.003 and 0.012 M⊙. We fit the observed CaNIR feature using synthetic spectra generated from the models using SYN++. The CaNIR feature is better explained by the supernova model interacting with a shell than the model without a shell, with a shell of mass 0.005 M⊙ tending to be better fitting than the other shells. The evolution of the optical depth of CaNIR suggests that the ionization state of calcium within the ejecta and shell is not constant. We discuss the method used to measure the observed velocity of CaNIR and other features and conclude that HVFs or other components can be falsely identified. We briefly discuss the possible origin of the shells and the implications for the progenitor system of the supernova.

  8. Exploring the optical behaviour of a Type Iax supernova SN 2014dt

    NASA Astrophysics Data System (ADS)

    Singh, Mridweeka; Misra, Kuntal; Sahu, D. K.; Dastidar, Raya; Gangopadhyay, Anjasha; Bose, Subhash; Srivastav, Shubham; Anupama, G. C.; Chakradhari, N. K.; Kumar, Brajesh; Kumar, Brijesh; Pandey, S. B.

    2018-02-01

    We present optical photometric (up to ˜410 d since Bmax) and spectroscopic (up to ˜157 d since Bmax) observations of a Type Iax supernova (SN) 2014dt located in M61. SN 2014dt is one of the brightest and closest (D ˜ 20 Mpc) discovered Type Iax SN. It best matches the light-curve evolution of SN 2005hk and reaches a peak magnitude of MB ˜ -18.13 ± 0.04 mag with Δm15 ˜ 1.35 ± 0.06 mag. The early spectra of SN 2014dt are similar to other Type Iax SNe, whereas the nebular spectrum at 157 d is dominated by narrow emission features with less blending as compared to SNe 2008ge and 2012Z. The ejecta velocities are between 5000 and 1000 km s-1, which also confirms the low-energy budget of Type Iax SN 2014dt compared to normal Type Ia SNe. Using the peak bolometric luminosity of SN 2005hk, we estimate the 56Ni mass of ˜0.14 M⊙. The striking similarity between SN 2014dt and SN 2005hk implies that a comparable amount of 56Ni would have been synthesized in the explosion of SN 2014dt.

  9. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  11. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  12. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  13. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  14. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  15. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  16. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  17. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  18. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  19. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  20. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  1. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  2. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  3. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  4. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  5. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  6. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  7. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  8. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  9. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Comparison of DOTA and NODAGA as chelators for (64)Cu-labeled immunoconjugates.

    PubMed

    Ghosh, Sukhen C; Pinkston, Kenneth L; Robinson, Holly; Harvey, Barrett R; Wilganowski, Nathaniel; Gore, Karen; Sevick-Muraca, Eva M; Azhdarinia, Ali

    2015-02-01

    Bifunctional chelators have been shown to impact the biodistribution of monoclonal antibody (mAb)-based imaging agents. Recently, radiolabeled 1,4,7-triazacyclononane,1-glutaric acid-4,7-acetic acid (NODAGA)-peptide complexes have demonstrated improved in vivo stability and performance compared to their 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) counterparts. Here, we investigated if similar utility could be achieved with mAbs and compared (64)Cu-labeled DOTA and NODAGA-immunoconjugates for the detection of epithelial cell adhesion molecule (EpCAM) in a prostate cancer model. DOTA and NODAGA-immunoconjugates of an EpCAM targeting mAb (mAb7) were synthesized and radiolabeled with (64)Cu (DOTA: 40°C for 1hr; NODAGA: 25°C for 1hr). The average number of chelators per mAb was quantified by isotopic dilution, and the biological activity of the immunoconjugates was evaluated by flow cytometry and ELISA. Radioligand assays were performed to compare cellular uptake and determine the dissociation constant (Kd) and maximum number of binding sites (Bmax) for the immunoconjugates using DsRed-transfected PC3-cells. A PC3-DsRed xenograft tumor model was established in nude mice and used to perform biodistribution studies to compare organ uptake and pharmacokinetics. (64)Cu-DOTA-mAb7 and (64)Cu-NODAGA-mAb7 were prepared with chelator/protein ratios of 2-3 and obtained in comparable radiochemical yields ranging from 59 to 71%. Similar immunoreactivity was observed with both agents, and mock labeling studies indicated that incubation at room temperature or 40°C did not affect potency. (64)Cu-NODAGA-mAb7 demonstrated higher in vitro cellular uptake while (64)Cu-DOTA-mAb7 had higher Kd and Bmax values. From the biodistribution data, we found similar tumor uptake (13.44±1.21%ID/g and 13.24±4.86%ID/g for (64)Cu-DOTA-mAb7 and (64)Cu-NODAGA-mAb7, respectively) for both agents at 24hr, although normal prostate tissue was significantly lower for (64)Cu-NODAGA-mAb7. (64)Cu-NODAGA-mAb7 also had less accumulation in the liver, suggesting excellent retention of the chelation complex in vivo. This was further confirmed by the higher blood activity of (64)Cu-NODAGA-mAb7, which corresponds to increased bioavailability afforded by the enhanced in vivo stability of the agent. Although tumor/muscle ratios were comparable, tumor/prostate ratios were >2-fold and 1.5-fold higher for (64)Cu-NODAGA-mAb7 at 24 and 48hr, respectively, and suggest better ability to discriminate tumor tissue with (64)Cu-NODAGA-mAb7 in our prostate cancer model. To the best of our knowledge, this study represents the first comparison of (64)Cu-labeled DOTA and NODAGA immunoconjugates in vivo. Our results show favorable in vivo performance for (64)Cu-NODAGA-mAb7 which builds upon previous data on our hybrid mAb7 imaging agent by increasing the detection sensitivity for metastatic prostate tumors, as well as for other types of cancer that express EpCAM. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  12. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  13. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  14. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  15. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  16. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  17. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  18. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  19. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  20. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  1. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  2. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  3. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  4. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  5. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  6. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  7. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  8. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  9. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  10. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  11. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  12. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  13. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  14. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  15. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  16. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  17. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  18. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  19. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  20. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  1. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  2. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  3. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  4. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  5. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  6. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  8. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  9. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  10. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  11. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  12. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  13. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  14. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  15. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  16. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  17. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  18. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  19. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  20. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  1. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  2. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  3. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  4. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  5. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  6. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  7. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  8. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  9. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  10. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  11. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  12. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  13. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  14. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  15. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  16. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  17. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  18. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  19. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  20. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  1. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  2. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  3. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  4. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  5. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  6. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  7. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  9. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  10. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  11. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  12. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  14. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  15. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  16. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  17. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  18. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  19. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  20. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  1. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  2. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  3. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  4. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  5. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  6. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  7. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

    PubMed Central

    Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2008-01-01

    Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

  9. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  10. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  11. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  12. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  14. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  15. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  16. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  17. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  18. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  19. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  20. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  1. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  2. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  3. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

  4. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  5. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  6. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

    2015-01-01

    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  7. Mechanism of human antibody-mediated neutralization of Marburg virus.

    PubMed

    Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

    2015-02-26

    The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  9. Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, E.B.; Kuyatt, B.L.

    1987-01-01

    Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

  10. Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

    USGS Publications Warehouse

    Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

    2002-01-01

    The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

  11. Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

    NASA Astrophysics Data System (ADS)

    Dyer, Brian

    2014-03-01

    Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

  12. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  13. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  14. Selection of the simplest RNA that binds isoleucine

    PubMed Central

    LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

    2003-01-01

    We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

  15. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shima, K.; Kitayama, S.; Nakano, R.

    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

  16. Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Aalberts, Daniel P.; Garland, Jeffrey A.

    2004-03-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  17. A Peculiar Subclass of Type Ia Supernovae a.k.a. Type Iax

    NASA Astrophysics Data System (ADS)

    Singh, Mridweeka; Misra, Kuntal; Sahu, Devendra Kumar; Dastidar, Raya; Gangopadhyay, Anjasha; Bose, Subhash; Srivastav, Shubham; Anapuma, Gadiyara Chakrapani; Chakradhari, Nand Kumar; Kumar, Brajesh; Kumar, Brijesh; Pandey, Shashi Bhushan

    2018-04-01

    We present optical photometric (upto ˜ 410 days since Bmax) and spectroscopic (upto ˜ 235 days since Bmax) observations of a type Iax supernova SN 2014dt located in M61. The broad band light curves follow a linear decline up to ˜ 100 days after which a significant flattening is seen in the late-time (beyond 150 days) light curves of SN 2014dt. SN 2014dt best matches the light curve evolution of SN 2005hk and reaches a peak magnitude of MB˜ -18.12±0.04 with ?m15˜ 1.35±0.06 mag. The earliest spectrum at ˜ 23 days is dominated by FeII and CoII lines with the absence of the Si II 6150 Å line. Using the peak bolometric luminosity we estimate a 56Ni mass of 0.14 M⊙ in the case of SN 2005hk and the striking similarity between SN 2014dt and SN 2005hk implies that a comparable amount of 56Ni would have been synthesized in the explosion of SN 2014dt. There are several explosion scenarios proposed for these peculiar events. Being one of the brightest and closest SN! , SN 2014dt is an ideal candidate for long term monitoring. Late phase observations are very essential to understand the progenitor system and the actual explosion scenario for these events.

  18. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

  19. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

  20. Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

    2010-01-01

    The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

Top