Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
A novel substance P binding site in bovine adrenal medulla.
Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E
1990-05-04
Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Sex Differences in Serotonin 1 Receptor Binding in Rat Brain
NASA Astrophysics Data System (ADS)
Fischette, Christine T.; Biegon, Anat; McEwen, Bruce S.
1983-10-01
Male and female rats exhibit sex differences in binding by serotonin 1 receptors in discrete areas of the brain, some of which have been implicated in the control of ovulation and of gonadotropin release. The sex-specific changes in binding, which occur in response to the same hormonal (estrogenic) stimulus, are due to changes in the number of binding sites. Castration alone also affects the number of binding sites in certain areas. The results lead to the conclusion that peripheral hormones modulate binding by serotonin 1 receptors. The status of the serotonin receptor system may affect the reproductive capacity of an organism and may be related to sex-linked emotional disturbances in humans.
The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.
Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki
2017-01-01
Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Ghaedi, Hamid; Bastami, Milad; Jahani, Mohammad Mehdi; Alipoor, Behnam; Tabasinezhad, Maryam; Ghaderi, Omar; Nariman-Saleh-Fam, Ziba; Mirfakhraie, Reza; Movafagh, Abolfazl; Omrani, Mir Davood; Masotti, Andrea
2016-06-01
The present work is aimed at finding variants associated with Type 1 and Type 2 diabetes mellitus (DM) that reside in functionally validated miRNAs binding sites and that can have a functional role in determining diabetes and related pathologies. Using bioinformatics analyses we obtained a database of validated polymorphic miRNA binding sites which has been intersected with genes related to DM or to variants associated and/or in linkage disequilibrium (LD) with it and is reported in genome-wide association studies (GWAS). The workflow we followed allowed us to find variants associated with DM that also reside in functional miRNA binding sites. These data have been demonstrated to have a functional role by impairing the functions of genes implicated in biological processes linked to DM. In conclusion, our work emphasized the importance of SNPs located in miRNA binding sites. The results discussed in this work may constitute the basis of further works aimed at finding functional candidates and variants affecting protein structure and function, transcription factor binding sites, and non-coding epigenetic variants, contributing to widen the knowledge about the pathogenesis of this important disease.
Korkmaz, Elif Nihal; Nussinov, Ruth; Haliloğlu, Türkan
2012-01-01
The KIX domain of CBP is a transcriptional coactivator. Concomitant binding to the activation domain of proto-oncogene protein c-Myb and the transactivation domain of the trithorax group protein mixed lineage leukemia (MLL) transcription factor lead to the biologically active ternary MLL∶KIX∶c-Myb complex which plays a role in Pol II-mediated transcription. The binding of the activation domain of MLL to KIX enhances c-Myb binding. Here we carried out molecular dynamics (MD) simulations for the MLL∶KIX∶c-Myb ternary complex, its binary components and KIX with the goal of providing a mechanistic explanation for the experimental observations. The dynamic behavior revealed that the MLL binding site is allosterically coupled to the c-Myb binding site. MLL binding redistributes the conformational ensemble of KIX, leading to higher populations of states which favor c-Myb binding. The key element in the allosteric communication pathways is the KIX loop, which acts as a control mechanism to enhance subsequent binding events. We tested this conclusion by in silico mutations of loop residues in the KIX∶MLL complex and by comparing wild type and mutant dynamics through MD simulations. The loop assumed MLL binding conformation similar to that observed in the KIX∶c-Myb state which disfavors the allosteric network. The coupling with c-Myb binding site faded, abolishing the positive cooperativity observed in the presence of MLL. Our major conclusion is that by eliciting a loop-mediated allosteric switch between the different states following the binding events, transcriptional activation can be regulated. The KIX system presents an example how nature makes use of conformational control in higher level regulation of transcriptional activity and thus cellular events. PMID:22438798
Interaction between phloretin and the red blood cell membrane
1976-01-01
Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575
Position specific variation in the rate of evolution in transcription factor binding sites
Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B
2003-01-01
Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282
Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R
2003-01-01
Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471
Druckmann, S; Ottolenghi, M; Korenstein, R
1985-01-01
The direction of the accessibility to protons of the binding site in bacteriorhodopsin is of primary importance in elucidating the proton-pump mechanism. The problem is approached via the pH-dependent equilibrium bR560 in equilibrium bR605 in vesicles with preferentially oriented purple membranes. Fast acidification (stopped-flow) experiments with inside-out, monomeric, bR vesicles were carried out with and without a buffer enclosed in the vesicle interior. The results, showing a buffer-induced delay in the formation of bR605, indicate that the binding site is accessible to protons from the inside of the vesicles. We arrive at this conclusion also by working with inside-out trimeric vesicles in the presence and in the absence of H+ (and K+) ionophores. The results suggest that in Halobacterium halobium, the binding site and thus the retinal Schiff base are exposed to the outside of the cell. This conclusion is consistent with a pumping mechanism based on a light-induced pK change. PMID:3978185
Matthäus, Friederike; Haddjeri, Nasser; Sánchez, Connie; Martí, Yasmina; Bahri, Senda; Rovera, Renaud; Schloss, Patrick; Lau, Thorsten
2016-11-01
Citalopram is a clinically applied selective serotonin re-uptake inhibitor for antidepressant pharmacotherapy. It consists of two enantiomers, S-citalopram (escitalopram) and R-citalopram, of which escitalopram exerts the antidepressant therapeutic effect and has been shown to be one of the most efficient antidepressants, while R-citalopram antagonizes escitalopram via an unknown molecular mechanism that may depend on binding to a low-affinity allosteric binding site of the serotonin transporter. However, the precise mechanism of antidepressant regulation of the serotonin transporter by citalopram enantiomers still remains elusive. Here we investigate escitalopram׳s acute effect on (1) serotonergic neuronal firing in transgenic mice that express the human serotonin transporter without and with a mutation that disables the allosteric binding site, and (2) regulation of the serotonin transporter׳s cell surface localization in stem cell-derived serotonergic neurons. Our results demonstrate that escitalopram inhibited neuronal firing less potently in the mouse line featuring a mutation that abolishes the function of the allosteric binding site and induced serotonin transporter internalization independently of the allosteric binding site mechanism. Furthermore, citalopram enantiomers dose-dependently induced serotonin transporter internalization. In conclusion, this study provides new insight into antidepressant effects exerted by citalopram enantiomers in presence and absence of a functional allosteric binding site. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.
Characterization of the interaction between furosemide and bovine serum albumin
NASA Astrophysics Data System (ADS)
Zhou, Neng; Liang, Yi-Zeng; Wang, Ping
2008-01-01
The interaction of furosemide (FU), one kind of potent diuretic, with bovine serum albumin (BSA) has been investigated at physiological acidity (pH 7.40) by fluorescent technique. Displacement experiment with site markers and Synchronous fluorescence clearly reveal that there are non-specific binding sites of FU with BSA. This conclusion was supported by the binding studies in the presence of the hydrophobic probe 1-anilinonaphthalene-8-sulfonic acid (ANS) and in different ionic strength. The binding sites number n and binding constant K were measured. The thermodynamic parameters Δ H°, Δ G°, Δ S° at different temperatures were calculated. The effects of other four diuretics, some common metal ions and bioactive components from herbal medicine on the binding are also considered. The results show only bumetanide has strong effect on FU's binding. Moreover, several data processing methods presently used were evaluated with Data of the same set. Quite different results were obtained from these methods suggesting more attention should be paid to the data processing methods.
2011-01-01
Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852
Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène
2008-06-01
The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.
Barbariga, Marco; Curnis, Flavio; Spitaleri, Andrea; Andolfo, Annapaola; Zucchelli, Chiara; Lazzaro, Massimo; Magnani, Giuseppe; Musco, Giovanna; Corti, Angelo; Alessio, Massimo
2014-01-01
Asparagine deamidation occurs spontaneously in proteins during aging; deamidation of Asn-Gly-Arg (NGR) sites can lead to the formation of isoAsp-Gly-Arg (isoDGR), a motif that can recognize the RGD-binding site of integrins. Ceruloplasmin (Cp), a ferroxidase present in the cerebrospinal fluid (CSF), contains two NGR sites in its sequence: one exposed on the protein surface (568NGR) and the other buried in the tertiary structure (962NGR). Considering that Cp can undergo oxidative modifications in the CSF of neurodegenerative diseases, we investigated the effect of oxidation on the deamidation of both NGR motifs and, consequently, on the acquisition of integrin binding properties. We observed that the exposed 568NGR site can deamidate under conditions mimicking accelerated Asn aging. In contrast, the hidden 962NGR site can deamidate exclusively when aging occurs under oxidative conditions, suggesting that oxidation-induced structural changes foster deamidation at this site. NGR deamidation in Cp was associated with gain of integrin-binding function, intracellular signaling, and cell pro-adhesive activity. Finally, Cp aging in the CSF from Alzheimer disease patients, but not in control CSF, causes Cp deamidation with gain of integrin-binding function, suggesting that this transition might also occur in pathological conditions. In conclusion, both Cp NGR sites can deamidate during aging under oxidative conditions, likely as a consequence of oxidative-induced structural changes, thereby promoting a gain of function in integrin binding, signaling, and cell adhesion. PMID:24366863
A spectroscopic study of phenylbutazone and aspirin bound to serum albumin in rheumatoid diseases
NASA Astrophysics Data System (ADS)
Maciążek-Jurczyk, M.; Sułkowska, A.; Bojko, B.; Równicka-Zubik, J.; Sułkowski, W. W.
2011-11-01
Interaction of phenylbutazone (PBZ) and aspirin (ASA), two drugs recommended in rheumatoid diseases (RDs), when binding to human (HSA) and bovine (BSA) serum albumins, has been studied by quenching of fluorescence and proton nuclear magnetic resonance ( 1HNMR) techniques. On the basis of spectrofluorescence measurements high affinity binding sites of PBZ and ASA on albumin as well as their interaction within the binding sites were described. A low affinity binding site has been studied by proton nuclear magnetic resonance spectroscopy. Using fluorescence spectroscopy the location of binding site in serum albumin (SA) for PBZ and ASA was found. Association constants Ka were determined for binary (i.e. PBZ-SA and ASA-SA) and ternary complexes (i.e. PBZ-[ASA]-SA and ASA-[PBZ]-SA). PBZ and ASA change the affinity of each other to the binding site in serum albumin (SA). The presence of ASA causes the increase of association constants KaI of PBZ-SA complex. Similarly, PBZ influences KaI of ASA-SA complex. This phenomenon shows that the strength of binding and the stability of the complexes increase in the presence of the second drug. The decrease of KaII values suggests that the competition between PBZ and ASA in binding to serum albumin in the second class of binding sites occurs. The analysis of 1HNMR spectral parameters i.e. changes of chemical shifts and relaxation times of the drug indicate that the presence of ASA weakens the interaction of PBZ with albumin. Similarly PBZ weakens the interaction of ASA with albumin. This conclusion points to the necessity of using a monitoring therapy owning to the possible increase of uncontrolled toxic effects.
Biological role and structural mechanism of twinfilin–capping protein interaction
Falck, Sandra; Paavilainen, Ville O; Wear, Martin A; Grossmann, J Günter; Cooper, John A; Lappalainen, Pekka
2004-01-01
Twinfilin and capping protein (CP) are highly conserved actin-binding proteins that regulate cytoskeletal dynamics in organisms from yeast to mammals. Twinfilin binds actin monomer, while CP binds the barbed end of the actin filament. Remarkably, twinfilin and CP also bind directly to each other, but the mechanism and role of this interaction in actin dynamics are not defined. Here, we found that the binding of twinfilin to CP does not affect the binding of either protein to actin. Furthermore, site-directed mutagenesis studies revealed that the CP-binding site resides in the conserved C-terminal tail region of twinfilin. The solution structure of the twinfilin–CP complex supports these conclusions. In vivo, twinfilin's binding to both CP and actin monomer was found to be necessary for twinfilin's role in actin assembly dynamics, based on genetic studies with mutants that have defined biochemical functions. Our results support a novel model for how sequential interactions between actin monomers, twinfilin, CP, and actin filaments promote cytoskeletal dynamics. PMID:15282541
Insulator function and topological domain border strength scale with architectural protein occupancy
2014-01-01
Background Chromosome conformation capture studies suggest that eukaryotic genomes are organized into structures called topologically associating domains. The borders of these domains are highly enriched for architectural proteins with characterized roles in insulator function. However, a majority of architectural protein binding sites localize within topological domains, suggesting sites associated with domain borders represent a functionally different subclass of these regulatory elements. How topologically associating domains are established and what differentiates border-associated from non-border architectural protein binding sites remain unanswered questions. Results By mapping the genome-wide target sites for several Drosophila architectural proteins, including previously uncharacterized profiles for TFIIIC and SMC-containing condensin complexes, we uncover an extensive pattern of colocalization in which architectural proteins establish dense clusters at the borders of topological domains. Reporter-based enhancer-blocking insulator activity as well as endogenous domain border strength scale with the occupancy level of architectural protein binding sites, suggesting co-binding by architectural proteins underlies the functional potential of these loci. Analyses in mouse and human stem cells suggest that clustering of architectural proteins is a general feature of genome organization, and conserved architectural protein binding sites may underlie the tissue-invariant nature of topologically associating domains observed in mammals. Conclusions We identify a spectrum of architectural protein occupancy that scales with the topological structure of chromosomes and the regulatory potential of these elements. Whereas high occupancy architectural protein binding sites associate with robust partitioning of topologically associating domains and robust insulator function, low occupancy sites appear reserved for gene-specific regulation within topological domains. PMID:24981874
2013-01-01
Background Polycomb Repressive Complex 2 (PRC2) is an essential regulator of gene expression that maintains genes in a repressed state by marking chromatin with trimethylated Histone H3 lysine 27 (H3K27me3). In Arabidopsis, loss of PRC2 function leads to pleiotropic effects on growth and development thought to be due to ectopic expression of seed and embryo-specific genes. While there is some understanding of the mechanisms by which specific genes are targeted by PRC2 in animal systems, it is still not clear how PRC2 is recruited to specific regions of plant genomes. Results We used ChIP-seq to determine the genome-wide distribution of hemagglutinin (HA)-tagged FERTLIZATION INDEPENDENT ENDOSPERM (FIE-HA), the Extra Sex Combs homolog protein present in all Arabidopsis PRC2 complexes. We found that the FIE-HA binding sites co-locate with a subset of the H3K27me3 sites in the genome and that the associated genes were more likely to be de-repressed in mutants of PRC2 components. The FIE-HA binding sites are enriched for three sequence motifs including a putative GAGA factor binding site that is also found in Drosophila Polycomb Response Elements (PREs). Conclusions Our results suggest that PRC2 binding sites in plant genomes share some sequence features with Drosophila PREs. However, unlike Drosophila PREs which are located in promoters and devoid of H3K27me3, Arabidopsis FIE binding sites tend to be in gene coding regions and co-localize with H3K27me3. PMID:24001316
Searching for transcription factor binding sites in vector spaces
2012-01-01
Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.
2004-08-06
Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less
A global optimization algorithm for protein surface alignment
2010-01-01
Background A relevant problem in drug design is the comparison and recognition of protein binding sites. Binding sites recognition is generally based on geometry often combined with physico-chemical properties of the site since the conformation, size and chemical composition of the protein surface are all relevant for the interaction with a specific ligand. Several matching strategies have been designed for the recognition of protein-ligand binding sites and of protein-protein interfaces but the problem cannot be considered solved. Results In this paper we propose a new method for local structural alignment of protein surfaces based on continuous global optimization techniques. Given the three-dimensional structures of two proteins, the method finds the isometric transformation (rotation plus translation) that best superimposes active regions of two structures. We draw our inspiration from the well-known Iterative Closest Point (ICP) method for three-dimensional (3D) shapes registration. Our main contribution is in the adoption of a controlled random search as a more efficient global optimization approach along with a new dissimilarity measure. The reported computational experience and comparison show viability of the proposed approach. Conclusions Our method performs well to detect similarity in binding sites when this in fact exists. In the future we plan to do a more comprehensive evaluation of the method by considering large datasets of non-redundant proteins and applying a clustering technique to the results of all comparisons to classify binding sites. PMID:20920230
Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo
2010-01-01
The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.
2013-01-01
Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription) family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM), which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors. PMID:23324445
Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking
Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.
2012-01-01
Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968
Alcohol binding in the C1 (C1A + C1B) domain of protein kinase C epsilon
Pany, Satyabrata; Das, Joydip
2015-01-01
Background Alcohol regulates the expression and function of protein kinase C epsilon (PKCε). In a previous study we identified an alcohol binding site in the C1B, one of the twin C1 subdomains of PKCε. Methods In this study, we investigated alcohol binding in the entire C1 domain (combined C1A and C1B) of PKCε. Fluorescent phorbol ester, SAPD and fluorescent diacylglycerol (DAG) analog, dansyl-DAG were used to study the effect of ethanol, butanol, and octanol on the ligand binding using fluorescence resonance energy transfer (FRET). To identify alcohol binding site(s), PKCεC1 was photolabeled with 3-azibutanol and 3-azioctanol, and analyzed by mass spectrometry. The effects of alcohols and the azialcohols on PKCε were studied in NG108-15 cells. Results In the presence of alcohol, SAPD and dansyl-DAG showed different extent of FRET, indicating differential effects of alcohol on the C1A and C1B subdomains. Effects of alcohols and azialcohols on PKCε in NG108-15 cells were comparable. Azialcohols labeled Tyr-176 of C1A and Tyr-250 of C1B. Inspection of the model structure of PKCεC1 reveals that these residues are 40 Å apart from each other indicating that these residues form two different alcohol binding sites. Conclusions The present results provide evidence for the presence of multiple alcohol-binding sites on PKCε and underscore the importance of targeting this PKC isoform in developing alcohol antagonists. PMID:26210390
Li, Bin; Schopfer, Lawrence M.; Grigoryan, Hasmik; Thompson, Charles M.; Hinrichs, Steven H.; Masson, Patrick; Lockridge, Oksana
2009-01-01
The expectation from the literature is that organophosphorus (OP) agents bind to proteins that have an active site serine. However, transferrin, a protein with no active site serine, was covalently modified in vitro by 0.5mM 10-fluoroethoxyphosphinyl-N-biotinamido pentyldecanamide, chlorpyrifos oxon, diisopropylfluorophosphate, dichlorvos, sarin, and soman. The site of covalent attachment was identified by analyzing tryptic peptides in the mass spectrometer. Tyr 238 and Tyr 574 in human transferrin and Tyr 238, Tyr 319, Tyr 429, Tyr 491, and Tyr 518 in mouse transferrin were labeled by OP. Tyrosine in the small synthetic peptide ArgTyrThrArg made a covalent bond with diisopropylfluorophosphate, chlorpyrifos oxon, and dichlorvos at pH 8.3. These results, together with our previous demonstration that albumin and tubulin bind OP on tyrosine, lead to the conclusion that OP bind covalently to tyrosine, and that OP binding to tyrosine is a new OP-binding residue. The OP-reactive tyrosines are activated by interaction with Arg or Lys. It is suggested that many proteins in addition to those already identified may be modified by OP on tyrosine. The extent to which tyrosine modification by OP can occur in vivo and the toxicological implications of such modifications require further investigation. PMID:18930948
Kathiravan, G.; Sureban, Sripathi M.; Sree, Harsha N.; Bhuvaneshwari, V.; Kramony, Evelin
2012-01-01
Background: Extraction and investigation of TAXOL from Pestalotiopsis breviseta (Sacc.) using protein docking, which is a computational technique that samples conformations of small molecules in protein-binding sites. Scoring functions are used to assess which of these conformations best complements the protein binding site and active site prediction. Materials and Methods: Coelomycetous fungi P. breviseta (Sacc.) Steyaert was screened for the production of TAXOL, an anticancer drug. Results: TAXOL production was confirmed by the following methods: Ultraviolet (UV) spectroscopic analysis, Infrared analysis, High performance liquid chromatography analysis (HPLC), and Liquid chromatography mass spectrum (LC-MASS). TAXOL produced by the fungi was compared with authentic TAXOL, and protein docking studies were performed. Conclusion: The BCL2 protein of human origin showed a higher affinity toward the compound paclitaxel. It has the binding energy value of −13.0061 (KJ/Mol) with four hydrogen bonds. PMID:24808664
Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; ...
2015-01-22
F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here in this paper, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound tomore » an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. In conclusion, our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence.« less
Characterization of the [125I]-neurokinin A binding site in the circular muscle of human colon
Warner, Fiona J; Comis, Alfio; Miller, Robert C; Burcher, Elizabeth
1999-01-01
Neurokinin A (NKA) is a potent contractile agonist of human colon circular muscle. These responses are mediated predominantly through tachykinin NK2 receptors. In the present study, the NK2 receptor radioligand [125I]-NKA has been used to characterize binding sites in this tissue, using tachykinin agonists and antagonists. 125INKA labelled a single, high affinity binding site. Specific binding (95% of total binding) of [125I]-NKA was saturable (KD 0.47±0.05 nM), of high capacity (Bmax 2.1±0.1 fmol mg−1 wet weight tissue) and reversible (kinetically derived KD 0.36±0.07 nM). The rank order of agonists competing for the [125I]-NKA binding site was neuropeptide γ (NPγ)≥NKA≥[Lys5,MeLeu9,Nle10]NKA (4–10) (NK2 agonist)>>substance P (SP)>neurokinin B (NKB)≥[Pro9]SP (NK1 agonist)>>senktide (NK3 agonist), indicating binding to an NK2 site. The nonpeptide selective NK2 antagonist SR48968 showed higher affinity for the [125I]-NKA site than selective peptide NK2 antagonists. The rank order of potency for NK2 antagonists was SR48968≥MEN11420>GR94800≥MEN10627>MEN10376≥R396. The NK1 antagonist SR140333 was a weak competitor. The competition curve for SP could be resolved into two sites. When experiments were repeated in the presence of SR140333 (0.1 μM), the curve for SP became monophasic and showed a significant shift to the right, whereas curves to NKA and NKB were unaffected. In conclusion, binding of the radioligand [125I]-NKA to membranes from circular muscle is predominantly to the NK2 receptor. There may be a small component of binding to the NK1 receptor. The NK2 receptor mediates circular muscle contraction, whereas the role of the NK1 receptor in circular muscle is unclear. PMID:10455255
ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data
2010-01-01
Background Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) or ChIP followed by genome tiling array analysis (ChIP-chip) have become standard technologies for genome-wide identification of DNA-binding protein target sites. A number of algorithms have been developed in parallel that allow identification of binding sites from ChIP-seq or ChIP-chip datasets and subsequent visualization in the University of California Santa Cruz (UCSC) Genome Browser as custom annotation tracks. However, summarizing these tracks can be a daunting task, particularly if there are a large number of binding sites or the binding sites are distributed widely across the genome. Results We have developed ChIPpeakAnno as a Bioconductor package within the statistical programming environment R to facilitate batch annotation of enriched peaks identified from ChIP-seq, ChIP-chip, cap analysis of gene expression (CAGE) or any experiments resulting in a large number of enriched genomic regions. The binding sites annotated with ChIPpeakAnno can be viewed easily as a table, a pie chart or plotted in histogram form, i.e., the distribution of distances to the nearest genes for each set of peaks. In addition, we have implemented functionalities for determining the significance of overlap between replicates or binding sites among transcription factors within a complex, and for drawing Venn diagrams to visualize the extent of the overlap between replicates. Furthermore, the package includes functionalities to retrieve sequences flanking putative binding sites for PCR amplification, cloning, or motif discovery, and to identify Gene Ontology (GO) terms associated with adjacent genes. Conclusions ChIPpeakAnno enables batch annotation of the binding sites identified from ChIP-seq, ChIP-chip, CAGE or any technology that results in a large number of enriched genomic regions within the statistical programming environment R. Allowing users to pass their own annotation data such as a different Chromatin immunoprecipitation (ChIP) preparation and a dataset from literature, or existing annotation packages, such as GenomicFeatures and BSgenome, provides flexibility. Tight integration to the biomaRt package enables up-to-date annotation retrieval from the BioMart database. PMID:20459804
Structural basis for the binding of tryptophan-based motifs by δ-COP
Suckling, Richard J.; Poon, Pak Phi; Travis, Sophie M.; Majoul, Irina V.; Hughson, Frederick M.; Evans, Philip R.; Duden, Rainer; Owen, David J.
2015-01-01
Coatomer consists of two subcomplexes: the membrane-targeting, ADP ribosylation factor 1 (Arf1):GTP-binding βγδζ-COP F-subcomplex, which is related to the adaptor protein (AP) clathrin adaptors, and the cargo-binding αβ’ε-COP B-subcomplex. We present the structure of the C-terminal μ-homology domain of the yeast δ-COP subunit in complex with the WxW motif from its binding partner, the endoplasmic reticulum-localized Dsl1 tether. The motif binds at a site distinct from that used by the homologous AP μ subunits to bind YxxΦ cargo motifs with its two tryptophan residues sitting in compatible pockets. We also show that the Saccharomyces cerevisiae Arf GTPase-activating protein (GAP) homolog Gcs1p uses a related WxxF motif at its extreme C terminus to bind to δ-COP at the same site in the same way. Mutations designed on the basis of the structure in conjunction with isothermal titration calorimetry confirm the mode of binding and show that mammalian δ-COP binds related tryptophan-based motifs such as that from ArfGAP1 in a similar manner. We conclude that δ-COP subunits bind Wxn(1–6)[WF] motifs within unstructured regions of proteins that influence the lifecycle of COPI-coated vesicles; this conclusion is supported by the observation that, in the context of a sensitizing domain deletion in Dsl1p, mutating the tryptophan-based motif-binding site in yeast causes defects in both growth and carboxypeptidase Y trafficking/processing. PMID:26578768
Chiara, David C; Trinidad, Jonathan C; Wang, Dong; Ziebell, Michael R; Sullivan, Deirdre; Cohen, Jonathan B
2003-01-21
[(3)H]4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine (TDBzcholine) was synthesized and used as a photoaffinity probe to map the orientation of an aromatic choline ester within the agonist binding sites of the Torpedo nicotinic acetylcholine receptor (nAChR). TDBzcholine acts as a nAChR competitive antagonist that binds at equilibrium with equal affinity to both agonist sites (K(D) approximately 10 microM). Upon UV irradiation (350 nm), nAChR-rich membranes equilibrated with [(3)H]TDBzcholine incorporate (3)H into the alpha, gamma, and delta subunits in an agonist-inhibitable manner. The specific residues labeled by [(3)H]TDBzcholine were determined by N-terminal sequence analysis of subunit fragments produced by enzymatic cleavage and purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and/or reversed-phase high-performance liquid chromatography. For the alpha subunit, [(3)H]TDBzcholine photoincorporated into alphaCys-192, alphaCys-193, and alphaPro-194. For the gamma and delta subunits, [(3)H]TDBzcholine incorporated into homologous leucine residues, gammaLeu-109 and deltaLeu-111. The photolabeling of these amino acids suggests that when the antagonist TDBzcholine occupies the agonist binding sites, the Cys-192-193 disulfide and Pro-194 from the alpha subunit Segment C are oriented toward the agonist site and are in proximity to gammaLeu-109/deltaLeu-111 in Segment E, a conclusion consistent with the structure of the binding site in the molluscan acetylcholine binding protein, a soluble protein that is homologous to the nAChR extracellular domain.
The good, the bad and the dubious: VHELIBS, a validation helper for ligands and binding sites
2013-01-01
Background Many Protein Data Bank (PDB) users assume that the deposited structural models are of high quality but forget that these models are derived from the interpretation of experimental data. The accuracy of atom coordinates is not homogeneous between models or throughout the same model. To avoid basing a research project on a flawed model, we present a tool for assessing the quality of ligands and binding sites in crystallographic models from the PDB. Results The Validation HElper for LIgands and Binding Sites (VHELIBS) is software that aims to ease the validation of binding site and ligand coordinates for non-crystallographers (i.e., users with little or no crystallography knowledge). Using a convenient graphical user interface, it allows one to check how ligand and binding site coordinates fit to the electron density map. VHELIBS can use models from either the PDB or the PDB_REDO databank of re-refined and re-built crystallographic models. The user can specify threshold values for a series of properties related to the fit of coordinates to electron density (Real Space R, Real Space Correlation Coefficient and average occupancy are used by default). VHELIBS will automatically classify residues and ligands as Good, Dubious or Bad based on the specified limits. The user is also able to visually check the quality of the fit of residues and ligands to the electron density map and reclassify them if needed. Conclusions VHELIBS allows inexperienced users to examine the binding site and the ligand coordinates in relation to the experimental data. This is an important step to evaluate models for their fitness for drug discovery purposes such as structure-based pharmacophore development and protein-ligand docking experiments. PMID:23895374
In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells
Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon
2016-01-01
Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as opposed to YY1, suggesting that YY2 exerts unique contributions to gene regulation. YY2 binding was not generally associated with gene promoters. However, several YY2 binding sites are linked to long noncoding RNA (lncRNA) genes and we show that the expression levels of a few of those are Yy2-dependent. PMID:27191592
Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang
2016-01-01
Background The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Methodology/Principal Finding Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Conclusion Two rGmolGOBPs exhibit different binding characteristics for tested ligands. rGmolGOBP1 has dual functions in recognition of host plant volatiles and sex pheromone components, while rGmolGOBP2 is mainly involved in minor sex pheromone component dodecanol perception. This study also provides empirical evidence for the predicted functions of key amino acids in recombinant protein ligand-binding characteristics. PMID:27152703
Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng
2013-01-01
Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059
Vlainić, Josipa; Jembrek, Maja Jazvinšćak; Vlainić, Toni; Štrac, Dubravka Švob; Peričić, Danka
2012-01-01
Aim: Zolpidem is a non-benzodiazepine agonist at benzodiazepine binding site in GABAA receptors, which is increasingly prescribed. Recent studies suggest that prolonged zolpidem treatment induces tolerance. The aim of this study was to explore the adaptive changes in GABAA receptors following short and long-term exposure to zolpidem in vitro. Methods: Human embryonic kidney (HEK) 293 cells stably expressing recombinant α1β2γ2s GABAA receptors were exposed to zolpidem (1 and 10 μmol/L) for short-term (2 h daily for 1, 2, or 3 consecutive days) or long-term (continuously for 48 h). Radioligand binding studies were used to determine the parameters of [3H]flunitrazepam binding sites. Results: A single (2 h) or repeated (2 h daily for 2 or 3 d) short-term exposure to zolpidem affected neither the maximum number of [3H]flunitrazepam binding sites nor the affinity. In both control and short-term zolpidem treated groups, addition of GABA (1 nmol/L–1 mmol/L) enhanced [3H]flunitrazepam binding in a concentration-dependent manner. The maximum enhancement of [3H]flunitrazepam binding in short-term zolpidem treated group was not significantly different from that in the control group. In contrast, long-term exposure to zolpidem resulted in significantly increase in the maximum number of [3H]flunitrazepam binding sites without changing the affinity. Furthermore, long-term exposure to zolpidem significantly decreased the ability of GABA to stimulate [3H]flunitrazepam binding. Conclusion: The results suggest that continuous, but not intermittent and short-term, zolpidem-exposure is able to induce adaptive changes in GABAA receptors that could be related to the development of tolerance and dependence. PMID:22922343
Gillard, Michel; Chatelain, Pierre; Fuks, Bruno
2006-04-24
A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.
Ford, Nicole R; Hecht, Karen A; Hu, DeHong; Orr, Galya; Xiong, Yijia; Squier, Thomas C; Rorrer, Gregory L; Roesijadi, Guritno
2016-03-18
The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins comprising either enhanced green fluorescent protein (EGFP) or single chain antibodies engineered with a tetracysteine tagging sequence. Of interest were the site-specific binding of (1) the fluorescent biarsenical probe AsCy3 and AsCy3e to the tetracysteine tagged fusion proteins and (2) high and low molecular mass antigens, the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT), to biosilica-immobilized single chain antibodies. Analysis of biarsenical probe binding using fluorescence and structured illumination microscopy indicated differential colocalization with EGFP in nascent and mature biosilica, supporting the use of either EGFP or bound AsCy3 and AsCy3e in studying biosilica maturation. Large increases in the lifetime of a fluorescent analogue of TNT upon binding single chain antibodies provided a robust signal capable of discriminating binding to immobilized antibodies in the transformed frustule from nonspecific binding to the biosilica matrix. In conclusion, our results demonstrate an ability to engineer diatoms to create antibody-functionalized mesoporous silica able to selectively bind chemical and biological agents for the development of sensing platforms.
Audi, Said; Li, Zhixin; Capacete, Joseph; Liu, Yu; Fang, Wei; Shu, Laura G.; Zhao, Ming
2013-01-01
Introduction 99mTc-Duramycin is a peptide-based molecular probe that binds specifically to phosphatidylethanolamine (PE). The goal was to characterize the kinetics of molecular interactions between 99mTc-Duramycin and the target tissue. Methods High level of accessible PE is induced in cardiac tissues by myocardial ischemia (30 min) and reperfusion (120 min) in Sprague Dawley rats. Target binding and biodistribution of 99mTc-duramycin was captured using SPECT/CT. To quantify the binding kinetics, the presence of radioactivity in ischemic versus normal cardiac tissues was measured by gamma counting at 3, 10, 20, 60 and 180 min after injection. A partially inactivated form of 99mTc-Duramycin was analyzed in the same fashion. A compartment model was developed to quantify the uptake kinetics of 99mTc-Duramycin in normal and ischemic myocardial tissue. Results 99mTc-duramycin binds avidly to the damaged tissue with a high target-to-background radio. Compartment modeling shows that accessibility of binding sites in myocardial tissue to 99mTc-Duramycin is not a limiting factor and the rate constant of target binding in the target tissue is at 2.2 ml/nmol/min/g. The number of available binding sites for 99mTc-Duramycin in ischemic myocardium was estimated at 0.14 nmol/g. Covalent modification of D15 resulted in a 9 fold reduction in binding affinity. Conclusion 99mTc-Duramycin accumulates avidly in target tissues in a PE-dependent fashion. Model results reflect an efficient uptake mechanism, consistent with the low molecular weight of the radiopharmaceutical and the relatively high density of available binding sites. These data help better define the imaging utilities of 99mTc-Duramycin as a novel PE-binding agent. PMID:22534031
Neupane, Durga P; Avalos, Dante; Fullam, Stephanie; Roychowdhury, Hridindu; Yukl, Erik T
2017-10-20
Bacteria can acquire the essential metal zinc from extremely zinc-limited environments by using ATP-binding cassette (ABC) transporters. These transporters are critical virulence factors, relying on specific and high-affinity binding of zinc by a periplasmic solute-binding protein (SBP). As such, the mechanisms of zinc binding and release among bacterial SBPs are of considerable interest as antibacterial drug targets. Zinc SBPs are characterized by a flexible loop near the high-affinity zinc-binding site. The function of this structure is not always clear, and its flexibility has thus far prevented structural characterization by X-ray crystallography. Here, we present intact structures for the zinc-specific SBP AztC from the bacterium Paracoccus denitrificans in the zinc-bound and apo-states. A comparison of these structures revealed that zinc loss prompts significant structural rearrangements, mediated by the formation of a sodium-binding site in the apo-structure. We further show that the AztC flexible loop has no impact on zinc-binding affinity, stoichiometry, or protein structure, yet is essential for zinc transfer from the metallochaperone AztD. We also found that 3 His residues in the loop appear to temporarily coordinate zinc and then convey it to the high-affinity binding site. Thus, mutation of any of these residues to Ala abrogated zinc transfer from AztD. Our structural and mechanistic findings conclusively identify a role for the AztC flexible loop in zinc acquisition from the metallochaperone AztD, yielding critical insights into metal binding by AztC from both solution and AztD. These proteins are highly conserved in human pathogens, making this work potentially useful for the development of novel antibiotics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
BIPAD: A web server for modeling bipartite sequence elements
Bi, Chengpeng; Rogan, Peter K
2006-01-01
Background Many dimeric protein complexes bind cooperatively to families of bipartite nucleic acid sequence elements, which consist of pairs of conserved half-site sequences separated by intervening distances that vary among individual sites. Results We introduce the Bipad Server [1], a web interface to predict sequence elements embedded within unaligned sequences. Either a bipartite model, consisting of a pair of one-block position weight matrices (PWM's) with a gap distribution, or a single PWM matrix for contiguous single block motifs may be produced. The Bipad program performs multiple local alignment by entropy minimization and cyclic refinement using a stochastic greedy search strategy. The best models are refined by maximizing incremental information contents among a set of potential models with varying half site and gap lengths. Conclusion The web service generates information positional weight matrices, identifies binding site motifs, graphically represents the set of discovered elements as a sequence logo, and depicts the gap distribution as a histogram. Server performance was evaluated by generating a collection of bipartite models for distinct DNA binding proteins. PMID:16503993
Interactions of cephalexin with bovine serum albumin: displacement reaction and molecular docking.
Hamishehkar, Hamed; Hosseini, Soheila; Naseri, Abdolhossein; Safarnejad, Azam; Rasoulzadeh, Farzaneh
2016-01-01
Introduction: The drug-plasma protein interaction is a fundamental issue in guessing and checking the serious drug side effects related with other drugs. The purpose of this research was to study the interaction of cephalexin with bovine serum albumin (BSA) and displacement reaction using site probes. Methods: The interaction mechanism concerning cephalexin (CPL) with BSA was investigated using various spectroscopic methods and molecular modeling method. The binding sites number, n, apparent binding constant, K, and thermodynamic parameters, ΔG 0 , ΔH 0 , and ΔS 0 were considered at different temperatures. To evaluate the experimental results, molecular docking modeling was calculated. Results: The distance, r=1.156 nm between BSA and CPL were found in accordance with the Forster theory of non-radiation energy transfer (FRET) indicating energy transfer occurs between BSA and CPL. According to the binding parameters and ΔG 0 = negative values and ΔS 0 = 28.275 j mol -1 K -1 , a static quenching process is effective in the CPL-BSA interaction spontaneously. ΔG 0 for the CPL-BSA complex obtained from the docking simulation is -28.99 kj mol -1 , which is close to experimental ΔG of binding, -21.349 kj mol -1 that indicates a good agreement between the results of docking methods and experimental data. Conclusion: The outcomes of spectroscopic methods revealed that the conformation of BSA changed during drug-BSA interaction. The results of FRET propose that CPL quenches the fluorescence of BSA by static quenching and FRET. The displacement study showed that phenylbutazon and ketoprofen displaced CPL, indicating that its binding site on albumin is site I and Gentamicin cannot be displaced from the binding site of CPL. All results of molecular docking method agreed with the results of experimental data.
In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A
Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate
2015-01-01
A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730
In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.
Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate
2015-01-01
A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.
Structural Basis for Antifreeze Activity of Ice-binding Protein from Arctic Yeast*
Lee, Jun Hyuck; Park, Ae Kyung; Do, Hackwon; Park, Kyoung Sun; Moh, Sang Hyun; Chi, Young Min; Kim, Hak Jun
2012-01-01
Arctic yeast Leucosporidium sp. produces a glycosylated ice-binding protein (LeIBP) with a molecular mass of ∼25 kDa, which can lower the freezing point below the melting point once it binds to ice. LeIBP is a member of a large class of ice-binding proteins, the structures of which are unknown. Here, we report the crystal structures of non-glycosylated LeIBP and glycosylated LeIBP at 1.57- and 2.43-Å resolution, respectively. Structural analysis of the LeIBPs revealed a dimeric right-handed β-helix fold, which is composed of three parts: a large coiled structural domain, a long helix region (residues 96–115 form a long α-helix that packs along one face of the β-helix), and a C-terminal hydrophobic loop region (243PFVPAPEVV251). Unexpectedly, the C-terminal hydrophobic loop region has an extended conformation pointing away from the body of the coiled structural domain and forms intertwined dimer interactions. In addition, structural analysis of glycosylated LeIBP with sugar moieties attached to Asn185 provides a basis for interpreting previous biochemical analyses as well as the increased stability and secretion of glycosylated LeIBP. We also determined that the aligned Thr/Ser/Ala residues are critical for ice binding within the B face of LeIBP using site-directed mutagenesis. Although LeIBP has a common β-helical fold similar to that of canonical hyperactive antifreeze proteins, the ice-binding site is more complex and does not have a simple ice-binding motif. In conclusion, we could identify the ice-binding site of LeIBP and discuss differences in the ice-binding modes compared with other known antifreeze proteins and ice-binding proteins. PMID:22303017
Mass Spectrometric Determination of ILPR G-quadruplex Binding Sites in Insulin and IGF-2
Xiao, JunFeng
2009-01-01
The insulin-linked polymorphic region (ILPR) of the human insulin gene promoter region forms G-quadruplex structures in vitro. Previous studies show that insulin and insulin-like growth factor-2 (IGF-2) exhibit high affinity binding in vitro to 2-repeat sequences of ILPR variants a and h, but negligible binding to variant i. Two-repeat sequences of variants a and h form intramolecular G-quadruplex structures that are not evidenced for variant i. Here we report on the use of protein digestion combined with affinity capture and MALDI-MS detection to pinpoint ILPR binding sites in insulin and IGF-2. Peptides captured by ILPR variants a and h were sequenced by MALDI-MS/MS, LC-MS and in silico digestion. On-bead digestion of insulin-ILPR variant a complexes supported the conclusions. The results indicate that the sequence VCG(N)RGF is generally present in the captured peptides and is likely involved in the affinity binding interactions of the proteins with the ILPR G-quadruplexes. The significance of arginine in the interactions was studied by comparing the affinities of synthesized peptides VCGERGF and VCGEAGF with ILPR variant a. Peptides from other regions of the proteins that are connected through disulfide linkages were also detected in some capture experiments. Identification of binding sites could facilitate design of DNA binding ligands for capture and detection of insulin and IGF-2. The interactions may have biological significance as well. PMID:19747845
Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun
Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt −85 to −11 in eBHBV1 Cp was critical formore » the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt −64 to −50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt −58 to −54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt −21 to −17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. - Highlights: • Endogenous budgerigar hepadnavirus (eBHBV) core promoters (Cps) are active in cells. • NF-Y binding site exists in the Cps of eBHBVs and all the extant avihepadnaviruses. • NF-Y binding and mediated upregulation is critical for eBHBV Cp activity.« less
Zhang, Chao; Zhao, Mei; Zhang, Quan-Wu; Gao, Feng-Hou
2016-01-01
Recent research found that Tiron was an effective antioxidant that could act as the intracellular reactive oxygen species (ROS) scavenger or alleviate the acute toxic metal overload in vivo. In this study, we investigated the inhibitory effect of Tiron on matrix metalloproteinase (MMP)-1 and MMP-3 expression in human dermal fibroblast cells. Western blot and ELISA analysis revealed that Tiron inhibited ultraviolet B (UVB)-induced protein expression of MMP-1 and MMP-3. Real-time quantitative PCR confirmed that Tiron could inhibit UVB-induced mRNA expression of MMP-1 and MMP-3. Furthermore, Tiron significantly blocked UVB-induced activation of the MAPK signaling pathway and activator protein (AP)-1 in the downstream of this transduction pathway in fibroblasts. Through the AP-1 binding site mutation, it was found that Tiron could inhibit AP-1-induced upregulation of MMP-1 and MMP-3 expression through blocking AP-1 binding to the AP-1 binding sites in the MMP-1 and MMP-3 promoter region. In conclusion, Tiron may be a novel antioxidant for preventing and treating skin photoaging UV-induced. PMID:27486852
NASA Astrophysics Data System (ADS)
Maciążek-Jurczyk, M.; Sułkowska, A.; Bojko, B.; Równicka, J.; Sułkowski, W. W.
2009-04-01
Combination of several drugs is often necessary especially during long-them therapy. The competition between drugs can cause a decrease of the amount of a drug bound to albumin. This results in an increase of the free, biological active fraction of the drug. The aim of the presented study was to describe the competition between phenylbutazone (Phe) and methotrexate (MTX), two drugs recommended for the treatment of rheumatology in binding to bovine (BSA) and human (HSA) serum albumin in the high affinity binding site. Fluorescence analysis was used to estimate the effect of drugs on the protein fluorescence and to define the binding and quenching properties of drugs-serum albumin complexes. The effect of the displacement of one drug from the complex of the other with serum albumin has been described on the basis of the comparison of the quenching curves and binding constants for the binary and ternary systems. The conclusion that both Phe and MTX form a binding site in the same subdomain (IIA) points to the necessity of using a monitoring therapy owning to the possible increase of the uncontrolled toxic effects.
Mann, G; Hermans, J
2000-09-29
The complexes of phage T4 lysozyme L99A with noble gases have been studied by molecular dynamics simulation. In a long simulation of the complex with one Xe atom, the structure was found to undergo global conformation change involving a reversible opening and closing of the entrance to the substrate-binding site, during which the conformations of the N and C-terminal domains varied little. The distributions of Xe positions sampled in dynamics simulations were refined in terms of anisotropic Gaussian distributions via least-squares minimization of the difference between Fourier transforms. In addition, molecular transformation simulations have been applied in order to calculate the binding free energies of Xe, Kr and Ar relative to a standard state at a pressure of 1 bar. A single bound Xe is found to assume an equilibrium distribution over three adjacent preferred sites, while in a two-Xe complex, the two Xe atoms preferentially occupy two of these. The positions of the three sites agree closely with the positions of bound Xe determined in the refined crystal structure of a complex formed at a pressure of 8 bar Xe, and the calculated affinities agree well with the observed partial occupancies. At a pressure of 8 bar, a mixture of one-Xe and two-Xe complexes is present, and similarly for complexes with Kr and Ar, with single occupancy relatively more prevalent with Kr and Ar. (Binding of a third Xe atom is found to be quite unfavorable.) A comparison with simulation results for the binding of benzene to the same site leads to the conclusion that binding of Xe within cavities in proteins is common because of several favorable factors: (1) Xe has a large atomic polarizability; (2) Xe can be applied at a relatively high pressure, i.e. high chemical potential; (3) an unfavorable entropic term related to the need to orient the ligand in the binding site is absent. Finally, it is found that the model's binding energy of a water molecule in the cavity is insufficient to overcome the unfavorable binding entropy. Copyright 2000 Academic Press.
Jacobsen, Jacob P.R.; Plenge, Per; Sachs, Benjamin D.; Pehrson, Alan L.; Cajina, Manuel; Du, Yunzhi; Roberts, Wendy; Rudder, Meghan L.; Dalvi, Prachiti; Robinson, Taylor J.; O’Neill, Sharon P.; Khoo, King S.; Morillo, Connie Sanchez; Zhang, Xiaodong; Caron, Marc G.
2015-01-01
Rationale Escitalopram is a superior antidepressant to racemic citalopram. It has been hypothesized that binding of R-citalopram to the serotonin transporter (SERT) antagonizes escitalopram binding to and inhibition of the SERT, curtailing the elevation of extracellular 5-hydroxytryptamine (5-HTExt), and antidepressant efficacy. Further, it has been suggested that a putative allosteric binding site is important for binding of escitalopram to the primary, orthosteric, site, and for R-citalopram’s inhibition hereof. Objectives Primary: Investigate at the human (h)SERT, at clinical relevant doses, whether R-citalopram antagonizes escitalopram-induced 5-HTExt elevation. Secondary: Investigate whether abolishing the putative allosteric site affects escitalopram-induced 5-HTExt elevation and/or modulates the effect of R-citalopram. Methods Recombinant technology; in vivo microdialysis; receptor binding; pharmacokinetics; 5-HT sensitive behaviors (tail suspension, marble burying). Results We generated mice expressing either the wild-type human SERT (hSERTWT) or hSERT carrying amino acid substitutions (A505V, L506F, I507L, S574T and I575T) collectively abolishing the putative allosteric site (hSERTALI/VFL+SI/TT). One mg/kg escitalopram yielded clinical relevant plasma levels and brain levels consistent with therapeutic SERT occupancy. Importantly, escitalopram-induced 5-HTExt elevation was not decreased by R-citalopram co-treatment. Further, escitalopram-induced 5-HTExt elevation was not affected by loss of the allosteric site. The behavioral effects of the clinically relevant escitalopram dose were small, tending to be enhanced by R-citalopram co-administration. Conclusions We find no evidence that R-citalopram directly antagonizes escitalopram or that the putative allosteric site is important for hSERT inhibition by escitalopram. Our findings points to mechanisms for R-citalopram antagonism of escitalopram’s antidepressant action other than direct antagonistic binding interactions at the hSERT. PMID:24810106
Kilbourn, Michael R.; Butch, Elizabeth R.; Desmond, Timothy; Sherman, Phillip; Harris, Paul E.; Frey, Kirk A.
2009-01-01
Introduction The sensitivity of the in vivo binding of [11C]dihydrotetrabenazine ([11C]DTBZ) and [11C]methylphenidate ([11C]MPH) to their respective targets, the vesicular monoamine transporter (VMAT2) and the neuronal membrane dopamine transporter (DAT), after alterations of endogenous levels of dopamine were examined in the rat brain. Methods In vivo binding of [11C]DTBZ and [11C]MPH were determined using a bolus+infusion protocol. In vitro numbers of VMAT2 binding sites were determined by autoradiography. Results Repeated dosing with α-methyl-p-tyrosine (AMPT) at doses that significantly (−75%) depleted brain tissue dopamine levels resulted in increased (+36%) in vivo [11C]DTBZ binding to VMAT2 in the striatum. The increase in binding could be completely reversed by treatment with L-DOPA/benserazide to restore dopamine levels. There were no changes in total numbers of VMAT2 binding sites as measured using in vitro autoradiography. No changes were observed for in vivo [11C]MPH binding to the DAT in the striatum following AMPT pretreatment. Conclusion These results indicate that large reductions of dopamine concentrations in the rat brain can produce modest but significant changes in binding of radioligands to the VMAT2, which can be reversed by repleneshment of dopamine using exogenous L-DOPA. PMID:20122661
DOE Office of Scientific and Technical Information (OSTI.GOV)
Das, Amit; Gerlits, Oksana O.; Parks, Jerry M.
The catalytic subunit of the cyclic AMP-dependent protein kinase A (PKAc) catalyzes the transfer of the γ-phosphate of bound Mg 2ATP to a serine or threonine residue of a protein substrate. Here, time-lapse X-ray crystallography was used to capture a series of complexes of PKAc with an oligopeptide substrate and unreacted Mg 2ATP, including the Michaelis complex, that reveal important geometric rearrangements in and near the active site preceding the phosphoryl transfer reaction. Contrary to the prevailing view, Mg 2+ binds first to the M1 site as a complex with ATP and is followed by Mg 2+ binding to themore » M2 site. Furthermore, the target serine hydroxyl of the peptide substrate rotates away from the active site toward the bulk solvent, which breaks the hydrogen bond with D166. In conclusion, the serine hydroxyl of the substrate rotates back toward D166 to form the Michaelis complex with the active site primed for phosphoryl transfer.« less
Das, Amit; Gerlits, Oksana O.; Parks, Jerry M.; ...
2015-11-12
The catalytic subunit of the cyclic AMP-dependent protein kinase A (PKAc) catalyzes the transfer of the γ-phosphate of bound Mg 2ATP to a serine or threonine residue of a protein substrate. Here, time-lapse X-ray crystallography was used to capture a series of complexes of PKAc with an oligopeptide substrate and unreacted Mg 2ATP, including the Michaelis complex, that reveal important geometric rearrangements in and near the active site preceding the phosphoryl transfer reaction. Contrary to the prevailing view, Mg 2+ binds first to the M1 site as a complex with ATP and is followed by Mg 2+ binding to themore » M2 site. Furthermore, the target serine hydroxyl of the peptide substrate rotates away from the active site toward the bulk solvent, which breaks the hydrogen bond with D166. In conclusion, the serine hydroxyl of the substrate rotates back toward D166 to form the Michaelis complex with the active site primed for phosphoryl transfer.« less
Shuai, Jianwei; Pearson, John E.; Parker, Ian
2008-01-01
The inositol 1,4,5-trisphosphate receptor/channel (IP3R) is a major regulator of intracellular Ca2+ signaling, and liberates Ca2+ ions from the endoplasmic reticulum in response to binding at cytosolic sites for both IP3 and Ca2+. Although the steady-state gating properties of the IP3R have been extensively studied and modeled under conditions of fixed [IP3] and [Ca2+], little is known about how Ca2+ flux through a channel may modulate the gating of that same channel by feedback onto activating and inhibitory Ca2+ binding sites. We thus simulated the dynamics of Ca2+ self-feedback on monomeric and tetrameric IP3R models. A major conclusion is that self-activation depends crucially on stationary cytosolic Ca2+ buffers that slow the collapse of the local [Ca2+] microdomain after closure. This promotes burst-like reopenings by the rebinding of Ca2+ to the activating site; whereas inhibitory actions are substantially independent of stationary buffers but are strongly dependent on the location of the inhibitory Ca2+ binding site on the IP3R in relation to the channel pore. PMID:18641077
Binding of (/sup 3/H)forskolin to platelet membranes and solubilized proteins from bovine brain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nelson, C.A.; Seamon, K.B.
1986-05-01
(/sup 3/H)Forskolin ((/sup 3/H)FSK) bound to platelet membranes with a Kd of 20 nM and a Bmax of 125 fmol/mg protein. The Bmax was increased to 400 fmol/mg protein in the presence of GppNHp (or NaF) and MgCl/sub 2/ with no change in Kd. PGE/sub 1/ decreased the EC50 of GppNHp to increase the Bmax for (/sup 3/H)FSK binding from 600 nM to 35 nM. In contrast, PGE/sub 1/ had no effect on the EC50 of NaF to increase (/sup 3/H)FSK binding. (/sup 3/H)FSK binding increased slowly over 60 min when forskolin and GppNHp were added to membranes simultaneously atmore » 20/sup 0/C. Preincubation of membranes with GppNHp at 20/sup 5/C also caused a linear increase in adenylate cyclase specific activity over 60 minutes. (/sup 3/H)FSK bound to solubilized protein from bovine brain membrane with a Kd of 22 nM. GppNHp increased the number of binding sites in solubilized proteins only if membranes were not preincubated with GppNHp prior to solubilization. In conclusion the number of binding sites for (/sup 3/H)FSK is increased by agents that activate adenylate cyclase through the Ns protein. These sites appear to be associated with an activated complex of the Ns protein and adenylate cyclase.« less
Lee, Donghan; Walsh, Joseph D; Yu, Ping; Markus, Michelle A; Choli-Papadopoulou, Theodora; Schwieters, Charles D; Krueger, Susan; Draper, David E; Wang, Yun-Xing
2007-04-06
The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a "reversible switch" in facilitating the coordinated movements associated with EF-G-driven GTP hydrolysis. The reversible switch mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11 complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: first, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a beta-sheet and a 3(10)-helix-turn-helix element in the N terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N terminus, as implied by a decrease of radius of gyration from 18.5 A to 16.2 A. Second, the regions, which undergo large conformation changes, exhibit motions on milliseconds-microseconds or nanoseconds-picoseconds time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 3(10)-helix in L11.
Lee, Donghan; Walsh, Joseph D.; Yu, Ping; Markus, Michelle A.; Choli-Papadopoulou, Theodora; Schwieters, Charles D.; Krueger, Susan; Draper, David E.; Wang, Yun-Xing
2007-01-01
Summary The L11 binding site is one of the most important functional sites in the ribosome. The N-terminal domain of L11 has been implicated as a “reversible switch” in facilitating the coordinated movements associated with EF-G–driven GTP hydrolysis. The “reversible switch” mechanism has been hypothesized to require conformational flexibility involving re-orientation and re-positioning of the two L11 domains, and warrants a close examination of the structure and dynamics of L11. Here we report the solution structure of free L11, and relaxation studies of free L11, L11complexed to its 58 nt RNA recognition site, and L11 in a ternary complex with the RNA and thiostrepton antibiotic. The binding site of thiostrepton on L11 was also defined by analysis of structural and dynamics data and chemical shift mapping. The conclusions of this work are as follows: First, the binding of L11 to RNA leads to sizable conformation changes in the regions flanking the linker and in the hinge area that links a β-sheets and a 310-helix-turn-helix element in the N-terminus. Concurrently, the change in the relative orientation may lead to re-positioning of the N-terminus, as implied by a decrease of radius of gyration from 18.5 Å to 16.2 Å. Second, the regions, which undergo large conformation changes, exhibit motions on ms-μs or ns-ps time scales. Third, binding of thiostrepton results in more rigid conformations near the linker (Thr71) and near its putative binding site (Leu12). Lastly, conformational changes in the putative thiostrepton binding site are implicated by the re-emergence of cross-correlation peaks in the spectrum of the ternary complex, which were missing in that of the binary complex. Our combined analysis of both the chemical shift perturbation and dynamics data clearly indicates that thiostrepton binds to a pocket involving residues in the 310-helix in L11. PMID:17292917
Zhu, Bao Ting
2010-01-01
Background Recent studies showed that some of the dietary bioflavonoids can strongly stimulate the catalytic activity of cyclooxygenase (COX) I and II in vitro and in vivo, presumably by facilitating enzyme re-activation. In this study, we sought to understand the structural basis of COX activation by these dietary compounds. Methodology/Principal Findings A combination of molecular modeling studies, biochemical analysis and site-directed mutagenesis assay was used as research tools. Three-dimensional quantitative structure-activity relationship analysis (QSAR/CoMFA) predicted that the ability of bioflavonoids to activate COX I and II depends heavily on their B-ring structure, a moiety known to be associated with strong antioxidant ability. Using the homology modeling and docking approaches, we identified the peroxidase active site of COX I and II as the binding site for bioflavonoids. Upon binding to this site, bioflavonoid can directly interact with hematin of the COX enzyme and facilitate the electron transfer from bioflavonoid to hematin. The docking results were verified by biochemical analysis, which reveals that when the cyclooxygenase activity of COXs is inhibited by covalent modification, myricetin can still stimulate the conversion of PGG2 to PGE2, a reaction selectively catalyzed by the peroxidase activity. Using the site-directed mutagenesis analysis, we confirmed that Q189 at the peroxidase site of COX II is essential for bioflavonoids to bind and re-activate its catalytic activity. Conclusions/Significance These findings provide the structural basis for bioflavonoids to function as high-affinity reducing co-substrates of COXs through binding to the peroxidase active site, facilitating electron transfer and enzyme re-activation. PMID:20808785
Huang, Lei; Owen, Jonas K.; Xie, Anna; Navarro, Antonia; Monsivais, Diana; Coon V, John S.; Kim, J. Julie; Dai, Yang; Bulun, Serdar E.
2012-01-01
Background Progesterone, via its nuclear receptor (PR), exerts an overall tumorigenic effect on both uterine fibroid (leiomyoma) and breast cancer tissues, whereas the antiprogestin RU486 inhibits growth of these tissues through an unknown mechanism. Here, we determined the interaction between common or cell-specific genome-wide binding sites of PR and mRNA expression in RU486-treated uterine leiomyoma and breast cancer cells. Principal Findings ChIP-sequencing revealed 31,457 and 7,034 PR-binding sites in breast cancer and uterine leiomyoma cells, respectively; 1,035 sites overlapped in both cell types. Based on the chromatin-PR interaction in both cell types, we statistically refined the consensus progesterone response element to G•ACA• • •TGT•C. We identified two striking differences between uterine leiomyoma and breast cancer cells. First, the cis-regulatory elements for HSF, TEF-1, and C/EBPα and β were statistically enriched at genomic RU486/PR-targets in uterine leiomyoma, whereas E2F, FOXO1, FOXA1, and FOXF sites were preferentially enriched in breast cancer cells. Second, 51.5% of RU486-regulated genes in breast cancer cells but only 6.6% of RU486-regulated genes in uterine leiomyoma cells contained a PR-binding site within 5 kb from their transcription start sites (TSSs), whereas 75.4% of RU486-regulated genes contained a PR-binding site farther than 50 kb from their TSSs in uterine leiomyoma cells. RU486 regulated only seven mRNAs in both cell types. Among these, adipophilin (PLIN2), a pro-differentiation gene, was induced via RU486 and PR via the same regulatory region in both cell types. Conclusions Our studies have identified molecular components in a RU486/PR-controlled gene network involved in the regulation of cell growth, cell migration, and extracellular matrix function. Tissue-specific and common patterns of genome-wide PR binding and gene regulation may determine the therapeutic effects of antiprogestins in uterine fibroids and breast cancer. PMID:22272226
Validation of binding of SE-75 labeled sucralfate to sites of gastrointestinal ulceration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maurer, A.H.; Knight, L.C.; Kollman, M.
1985-05-01
This study was performed to determine if and for how long sucralfate (SU) binds selectively to sites of gastro-intestinal (GI) ulceration. Se-Su was prepared by sulfating sucrose with tracer Se-75 and precipitating it as the basic Al salt. All patients (pts) had endoscopy to confirm the presence of either: esophagitis (n=5), gastritis (GA) (n=5), gastric ulcers (GU) (n=5), duodenal ulcers (DU) (n=5), or no ulceration (NU) (n=5). Following an overnight fast the pts swallowed 1 gm with 100 ..mu..Ci of Se-SU and were imaged continuously over 24 hours or until no activity remained in the upper GI tract. Pts withmore » GU visually demonstrated focal SU binding at the ulcers for an average of 3.9 +- 1.1 hrs. with a mean GET of 68 +- 25 min. Mean GET for pts with DU was prolonged, 171 +- 63 min, however focal binding at duodenal ulcers was not seen. All pts with GA had diffuse retention of SU in the stomach with a mean GET of 118 +- 34 min. Focal binding of SU at all sites of esophagitis was seen with a T-1/2 of 65 +- 32 min at the ulcerations. In conclusion these data support the theory that the mechanism of ulcer healing with SU is related to its ability to adhere to the ulcer site forming a protective barrier. In addition Se-SU is a potential ulcer imaging agent which can be used to noninvasively assess healing.« less
Structural and Kinetic Analyses of Macrophage Migration Inhibitory Factor Active Site Interactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crichlow, G.; Lubetsky, J; Leng, L
Macrophage migration inhibitory factor (MIF) is a secreted protein expressed in numerous cell types that counters the antiinflammatory effects of glucocorticoids and has been implicated in sepsis, cancer, and certain autoimmune diseases. Interestingly, the structure of MIF contains a catalytic site resembling the tautomerase/isomerase sites of microbial enzymes. While bona fide physiological substrates remain unknown, model substrates have been identified. Selected compounds that bind in the tautomerase active site also inhibit biological functions of MIF. It had previously been shown that the acetaminophen metabolite, N-acetyl-p-benzoquinone imine (NAPQI), covalently binds to the active site of MIF. In this study, kinetic datamore » indicate that NAPQI inhibits MIF both covalently and noncovalently. The structure of MIF cocrystallized with NAPQI reveals that the NAPQI has undergone a chemical alteration forming an acetaminophen dimer (bi-APAP) and binds noncovalently to MIF at the mouth of the active site. We also find that the commonly used protease inhibitor, phenylmethylsulfonyl fluoride (PMSF), forms a covalent complex with MIF and inhibits the tautomerase activity. Crystallographic analysis reveals the formation of a stable, novel covalent bond for PMSF between the catalytic nitrogen of the N-terminal proline and the sulfur of PMSF with complete, well-defined electron density in all three active sites of the MIF homotrimer. Conclusions are drawn from the structures of these two MIF-inhibitor complexes regarding the design of novel compounds that may provide more potent reversible and irreversible inhibition of MIF.« less
The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...
Torres, Eduardo; Aburto, Jorge
2005-05-15
A sigmoidal kinetic behavior of chloroperoxidase for the oxidation of 4,6-dimethyldibenzothiophene (4,6-DMDBT) in water-miscible organic solvent is for the first time reported. Kinetics of 4,6-DMDBT oxidation showed a cooperative profile probably due to the capacity of chloroperoxidase to recognize a substrate dimer (pi-pi dimer) in its active site. Experimental evidence is given for dimer formation and its presence in the active site of chloroperoxidase. The kinetic data were adjusted for a binding site able to interact with either monomer or dimer substrates, producing a cooperative model describing a one-site binding of two related species. Determination of kinetics constants by iterative calculations of possible oxidation paths of 4,6-DMDBT suggests that kinetics oxidation of dimer substrate is preferred when compared to monomer oxidation. Steady-state fluorometry of substrate in the absence and presence of chloroperoxidase, described by the spectral center of mass, supports this last conclusion.
Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong
2007-01-01
Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291
Inhalational anaesthetics and n-alcohols share a site of action in the neuronal Shaw2 Kv channel
Bhattacharji, Aditya; Klett, Nathan; Go, Ramon Christopher V; Covarrubias, Manuel
2010-01-01
Background and purpose: Neuronal ion channels are key targets of general anaesthetics and alcohol, and binding of these drugs to pre-existing and relatively specific sites is thought to alter channel gating. However, the underlying molecular mechanisms of this action are still poorly understood. Here, we investigated the neuronal Shaw2 voltage-gated K+ (Kv) channel to ask whether the inhalational anaesthetic halothane and n-alcohols share a binding site near the activation gate of the channel. Experimental approach: Focusing on activation gate mutations that affect channel modulation by n-alcohols, we investigated n-alcohol-sensitive and n-alcohol-resistant Kv channels heterologously expressed in Xenopus oocytes to probe the functional modulation by externally applied halothane using two-electrode voltage clamping and a gas-tight perfusion system. Key results: Shaw2 Kv channels are reversibly inhibited by halothane in a dose-dependent and saturable manner (K0.5= 400 µM; nH= 1.2). Also, discrete mutations in the channel's S4S5 linker are sufficient to reduce or confer inhibition by halothane (Shaw2-T330L and Kv3.4-G371I/T378A respectively). Furthermore, a point mutation in the S6 segment of Shaw2 (P410A) converted the halothane-induced inhibition into halothane-induced potentiation. Lastly, the inhibition resulting from the co-application of n-butanol and halothane is consistent with the presence of overlapping binding sites for these drugs and weak binding cooperativity. Conclusions and implications: These observations strongly support a molecular model of a general anaesthetic binding site in the Shaw2 Kv channel. This site may involve the amphiphilic interface between the S4S5 linker and the S6 segment, which plays a pivotal role in Kv channel activation. PMID:20136839
2010-01-01
Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545
DOE Office of Scientific and Technical Information (OSTI.GOV)
Salinas, Gustavo; Gao, Wei; Wang, Yang
Aims: New drugs are needed to treat flatworm infections that cause severe human diseases such as schistosomiasis. The unique flatworm enzyme thioredoxin glutathione reductase (TGR), structurally different from the human enzyme, is a key drug target. Structural studies of the flatworm Echinococcus granulosus TGR, free and complexed with AuI-MPO, a novel gold inhibitor, together with inhibition assays were performed. Results: AuI-MPO is a potent TGR inhibitor that achieves 75% inhibition at a 1:1 TGR:Au ratio and efficiently kills E. granulosus in vitro. The structures revealed salient insights: (i) unique monomer–monomer interactions, (ii) distinct binding sites for thioredoxin and the glutaredoxinmore » (Grx) domain, (iii) a single glutathione disulfide reduction site in the Grx domain, (iv) rotation of the Grx domain toward the Sec-containing redox active site, and (v) a single gold atom bound to Cys519 and Cys573 in the AuI-TGR complex. Structural modeling suggests that these residues are involved in the stabilization of the Sec-containing C-terminus. Consistently, Cys→Ser mutations in these residues decreased TGR activities. Mass spectroscopy confirmed these cysteines are the primary binding site. Innovation: The identification of a primary site for gold binding and the structural model provide a basis for gold compound optimization through scaffold adjustments. Conclusions: The structural study revealed that TGR functions are achieved not only through a mobile Sec-containing redox center but also by rotation of the Grx domain and distinct binding sites for Grx domain and thioredoxin. The conserved Cys519 and Cys573 residues targeted by gold assist catalysis through stabilization of the Sec-containing redox center. Antioxid. Redox Signal. 27, 1491–1504.« less
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less
NASA Astrophysics Data System (ADS)
Lengyel, Iván M.; Morelli, Luis G.
2017-04-01
Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.
Synthesis and characterization of (18)F-labeled active site inhibited factor VII (ASIS).
Erlandsson, Maria; Nielsen, Carsten H; Jeppesen, Troels E; Kristensen, Jesper B; Petersen, Lars C; Madsen, Jacob; Kjaer, Andreas
2015-05-15
Activated factor VII blocked in the active site with Phe-Phe-Arg-chloromethyl ketone (active site inhibited factor VII (ASIS)) is a 50-kDa protein that binds with high affinity to its receptor, tissue factor (TF). TF is a transmembrane glycoprotein that plays an important role in, for example, thrombosis, metastasis, tumor growth, and tumor angiogenesis. The aim of this study was to develop an (18)F-labeled ASIS derivative to assess TF expression in tumors. Active site inhibited factor VII was labeled using N-succinimidyl-4-[(18)F]fluorobenzoate, and the [(18)F]ASIS was purified on a PD-10 desalting column. The radiochemical yield was 25 ± 6%, the radiochemical purity was >97%, and the pseudospecific radioactivity was 35 ± 9 GBq/µmol. The binding efficacy was evaluated in pull-down experiments, which monitored the binding of unlabeled ASIS and [(18)F]ASIS to TF and to a specific anti-factor VII antibody (F1A2-mAb). No significant difference in binding efficacy between [(18)F]ASIS and ASIS could be detected. Furthermore, [(18)F]ASIS was relatively stable in vitro and in vivo in mice. In conclusion, [(18)F]ASIS has for the first time been successfully synthesized as a possible positron emission tomography tracer to image TF expression levels. In vivo positron emission tomography studies to evaluate the full potential of [(18)F]ASIS are in progress. Copyright © 2015 John Wiley & Sons, Ltd.
In vitro and ex vivo distribution of [3H]harmane, an endogenous beta-carboline, in rat brain.
Anderson, Neil J; Tyacke, Robin J; Husbands, Stephen M; Nutt, David J; Hudson, Alan L; Robinson, Emma S J
2006-03-01
The endogenous beta-carboline, harmane, has been shown to bind to monoamine oxidase A (MAO-A) and a separate, high affinity, non-MAO site. Research in our laboratory has shown that harmane is an active component of clonidine-displacing substance (CDS), the proposed endogenous ligand for imidazoline binding sites (IBS). In the present study we have investigated the distribution of [3H]harmane in rat brain, and related the binding profile to the distribution of the MAO-A selective ligand [3H]Ro41-1049 and the I2BS ligand [3H]2-BFI. The in vivo distribution of [3H]harmane following intravenous administration was also investigated. Receptor autoradiography revealed a highly significant correlation for the distribution of [3H]harmane and [3H]Ro41-1049, and a significant correlation for [3H]harmane and the I2BS ligand [3H]2-BFI. The in vivo distribution of [3H]harmane suggests that the ligand accumulates in the adrenal gland and throughout the brain with the primary route of excretion occurring via the duodenum. In conclusion, these studies have shown that [3H]harmane labels a population of binding sites that reflect the distribution of MAO-A. Further evidence for a non-MAO, IBS [3H]harmane population has not been shown but the high level of expression of the MAO-A site is likely to have masked the much smaller population of I2BS.
Blatter, Markus; Cléry, Antoine; Damberger, Fred F.
2017-01-01
Abstract The Fox-1 RNA recognition motif (RRM) domain is an important member of the RRM protein family. We report a 1.8 Å X-ray structure of the free Fox-1 containing six distinct monomers. We use this and the nuclear magnetic resonance (NMR) structure of the Fox-1 protein/RNA complex for molecular dynamics (MD) analyses of the structured hydration. The individual monomers of the X-ray structure show diverse hydration patterns, however, MD excellently reproduces the most occupied hydration sites. Simulations of the protein/RNA complex show hydration consistent with the isolated protein complemented by hydration sites specific to the protein/RNA interface. MD predicts intricate hydration sites with water-binding times extending up to hundreds of nanoseconds. We characterize two of them using NMR spectroscopy, RNA binding with switchSENSE and free-energy calculations of mutant proteins. Both hydration sites are experimentally confirmed and their abolishment reduces the binding free-energy. A quantitative agreement between theory and experiment is achieved for the S155A substitution but not for the S122A mutant. The S155 hydration site is evolutionarily conserved within the RRM domains. In conclusion, MD is an effective tool for predicting and interpreting the hydration patterns of protein/RNA complexes. Hydration is not easily detectable in NMR experiments but can affect stability of protein/RNA complexes. PMID:28505313
Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism
Backlund, Michael; Paukku, Kirsi; Kontula, Kimmo K.; Lehtonen, Jukka Y.A.
2016-01-01
As the formation of ribonucleoprotein complexes is a major mechanism of angiotensin II type 1 receptor (AT1R) regulation, we sought to identify novel AT1R mRNA binding proteins. By affinity purification and mass spectroscopy, we identified TIA-1. This interaction was confirmed by colocalization of AT1R mRNA and TIA-1 by FISH and immunofluorescence microscopy. In immunoprecipitates of endogenous TIA- 1, reverse transcription-PCR amplified AT1R mRNA. TIA-1 has two binding sites within AT1R 3′-UTR. The binding site proximal to the coding region is glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-dependent whereas the distal binding site is not. TIA-1 functions as a part of endoplasmic reticulum (ER) stress response leading to stress granule (SG) formation and translational silencing. We and others have shown that AT1R expression is increased by ER stress-inducing factors. In unstressed cells, TIA-1 binds to AT1R mRNA and decreases AT1R protein expression. Fluorescence microscopy shows that ER stress induced by thapsigargin leads to the transfer of TIA-1 to SGs. In FISH analysis AT1R mRNA remains in the cytoplasm and no longer colocalizes with TIA-1. Thus, release of TIA-1-mediated suppression by ER stress increases AT1R protein expression. In conclusion, AT1R mRNA is regulated by TIA-1 in a ER stress-dependent manner. PMID:26681690
hnRNP L controls HPV16 RNA polyadenylation and splicing in an Akt kinase-dependent manner
Kajitani, Naoko; Glahder, Jacob; Wu, Chengjun; Yu, Haoran; Nilsson, Kersti
2017-01-01
Abstract Inhibition of the Akt kinase activates HPV16 late gene expression by reducing HPV16 early polyadenylation and by activating HPV16 late L1 mRNA splicing. We identified ‘hot spots’ for RNA binding proteins at the early polyA signal and at splice sites on HPV16 late mRNAs. We observed that hnRNP L was associated with sequences at all HPV16 late splice sites and at the early polyA signal. Akt kinase inhibition resulted in hnRNP L dephosphorylation and reduced association of hnRNP L with HPV16 mRNAs. This was accompanied by an increased binding of U2AF65 and Sam68 to HPV16 mRNAs. Furthermore, siRNA knock-down of hnRNP L or Akt induced HPV16 gene expression. Treatment of HPV16 immortalized keratinocytes with Akt kinase inhibitor reduced hnRNP L binding to HPV16 mRNAs and induced HPV16 L1 mRNA production. Finally, deletion of the hnRNP L binding sites in HPV16 subgenomic expression plasmids resulted in activation of HPV16 late gene expression. In conclusion, the Akt kinase inhibits HPV16 late gene expression at the level of RNA processing by controlling the RNA-binding protein hnRNP L. We speculate that Akt kinase activity upholds an intracellular milieu that favours HPV16 early gene expression and suppresses HPV16 late gene expression. PMID:28934469
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sloan, J.W.
1984-01-01
These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Rpn1 provides adjacent receptor sites for substrate binding and deubiquitination by the proteasome
Shi, Yuan; Chen, Xiang; Elsasser, Suzanne; Stocks, Bradley B.; Tian, Geng; Lee, Byung-Hoon; Shi, Yanhong; Zhang, Naixia; de Poot, Stefanie A. H.; Tuebing, Fabian; Sun, Shuangwu; Vannoy, Jacob; Tarasov, Sergey G.; Engen, John R.; Finley, Daniel; Walters, Kylie J.
2016-01-01
Structured Abstract INTRODUCTION The ubiquitin-proteasome system comprises hundreds of distinct pathways of degradation, which converge at the step of ubiquitin recognition by the proteasome. Five proteasomal ubiquitin receptors have been identified, two that are intrinsic to the proteasome (Rpn10 and Rpn13) and three reversibly associated proteasomal ubiquitin receptors (Rad23, Dsk2, and Ddi1). RATIONALE We found that the five known proteasomal ubiquitin receptors of yeast are collectively nonessential for ubiquitin recognition by the proteasome. We therefore screened for additional ubiquitin receptors in the proteasome and identified subunit Rpn1 as a candidate. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the structure of the binding site within Rpn1, which we term the T1 site. Mutational analysis of this site showed its functional importance within the context of intact proteasomes. T1 binds both ubiquitin and ubiquitin-like (UBL) proteins, in particular the substrate-delivering shuttle factor Rad23. A second site within the Rpn1 toroid, T2, recognizes the UBL domain of deubiquitinating enzyme Ubp6, as determined by hydrogen-deuterium exchange mass spectrometry analysis and validated by amino acid substitution and functional assays. The Rpn1 toroid thus serves a critical scaffolding role within the proteasome, helping to assemble multiple proteasome cofactors as well as substrates. RESULTS Our results indicate that proteasome subunit Rpn1 can recognize both ubiquitin and UBL domains of substrate shuttling factors that themselves bind ubiquitin and function as reversibly-associated proteasomal ubiquitin receptors. Recognition is mediated by the T1 site within the Rpn1 toroid, which supports proteasome function in vivo. We found that the capacity of T1 to recognize both ubiquitin and UBL proteins was shared with Rpn10 and Rpn13. The surprising multiplicity of ubiquitin-recognition domains within the proteasome may promote enhanced, multipoint binding of ubiquitin chains. The structures of the T1 site in its free state and complexed with monoubiquitin or K48-linked diubiquitin were solved, revealing that three neighboring outer helices from the T1 toroid engage two ubiquitins. This binding mode leads to a preference for certain ubiquitin chain types, especially K6- and K48-linked chains, in a distinct configuration that can position substrates close to the entry port of the proteasome. The fate of proteasome-docked ubiquitin conjugates is determined by a competition between deubiquitination and substrate degradation. We find that proximal to the T1 site within the Rpn1 toroid is a second UBL-binding site, T2, that does not assist in ubiquitin chain recognition, but rather in chain disassembly, by binding to the UBL domain of deubiquitinating enzyme Ubp6. Importantly, the UBL interactors at T1 and T2 are distinct, assigning substrate localization to T1 and substrate deubiquitination to T2. CONCLUSION A ligand-binding hotspot was identified in the Rpn1 toroid, consisting of two adjacent receptor sites, T1 and T2. The Rpn1 toroid represents a novel class of binding domains for ubiquitin and UBL proteins. This study thus defines a novel two-site recognition domain intrinsic to the proteasome that uses homologous ubiquitin/UBL-class ligands to assemble substrates, substrate shuttling factors, and a deubiquitinating enzyme in close proximity. A ligand-binding hotspot in the proteasome for assembling substrates and cofactors Schematic (top) and model structure (bottom, left) mapping the UBL-binding Rpn1 T1 (indigo) and T2 (orange) sites. (Bottom, right) Enlarged region of the proteasome to illustrate the Rpn1 T1 and T2 sites bound to a ubiquitin chain (yellow) and deubiquitinating enzyme Ubp6 (green), respectively. PDB 4CR2 and 2B9R were used for this figure. Hundreds of pathways for degradation converge at ubiquitin recognition by proteasome. Here we found that the five known proteasomal ubiquitin receptors are collectively nonessential for ubiquitin recognition, and identified a sixth receptor, Rpn1. A site (T1) in the Rpn1 toroid recognized ubiquitin and ubiquitin-like (UBL) domains of substrate shuttling factors. T1 structures with monoubiquitin or K48 diubiquitin show three neighboring outer helices engaging two ubiquitins. T1 contributes a distinct substrate-binding pathway with preference for K48-linked chains. Proximal to T1 within the Rpn1 toroid is a second UBL-binding site (T2) that assists in ubiquitin chain disassembly, by binding the UBL of deubiquitinating enzyme Ubp6. Thus a two-site recognition domain intrinsic to the proteasome uses homologous ubiquitin/UBL-class ligands to assemble substrates, shuttling factors, and a deubiquitinating enzyme. PMID:26912900
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
An Electrostatic Funnel in the GABA-Binding Pathway
Lightstone, Felice C.
2016-01-01
The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
2013-01-01
Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559
Xu, Liang; Hu, Yan-Xi; Li, Jin; Liu, Yu-Feng; Zhang, Li; Ai, Hai-Xin; Liu, Hong-Sheng
2017-08-01
Cytarabine is a kind of chemotherapy medication. In the present study, the molecular interaction between cytarabine and human serum albumin (HSA) was investigated via fluorescence, UV-vis absorption, circular dichroism (CD) spectroscopy and molecular docking method under simulative physiological conditions. It was found that cytarabine could effectively quench the intrinsic fluorescence of HSA through a static quenching process. The apparent binding constants between drug and HSA at 288, 293 and 298K were estimated to be in the order of 10 3 L·mol -1 . The thermodynamic parameters ΔH°, ΔG°and ΔS° were calculated, in which the negative ΔG°suggested that the binding of cytarabine to HSA was spontaneous, moreover the negative ΔS°and negative ΔH°revealed that van der Waals force and hydrogen bonds were the major forces to stabilize the protein-cytarabine (1:1) complex. The competitive binding experiments showed that the primary binding site of cytarabine was located in the site I (subdomain IIA) of HSA. In addition, the binding distance was calculated to be 3.4nm according to the Förster no-radiation energy transfer theory. The analysis of CD and three-dimensional (3D) fluorescence spectra demonstrated that the binding of drug to HSA induced some conformational changes in HSA. The molecular docking study also led to the same conclusion obtained from the spectral results. Copyright © 2017 Elsevier B.V. All rights reserved.
A tool for calculating binding-site residues on proteins from PDB structures.
Hu, Jing; Yan, Changhui
2009-08-03
In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.
The Minimal Replicator of Epstein-Barr Virus oriP
Yates, John L.; Camiolo, Sarah M.; Bashaw, Jacqueline M.
2000-01-01
oriP is a 1.7-kb region of the Epstein-Barr virus (EBV) chromosome that supports the replication and stable maintenance of plasmids in human cells. oriP contains two essential components, called the DS and the FR, both of which contain multiple binding sites for the EBV-encoded protein, EBNA-1. The DS appears to function as the replicator of oriP, while the FR acts in conjunction with EBNA-1 to prevent the loss of plasmids from proliferating cells. Because of EBNA-1's role in stabilizing plasmids through the FR, it has not been entirely clear to what extent EBNA-1 might be required for replication from oriP per se, and a recent study has questioned whether EBNA-1 has any direct role in replication. In the present study we found that plasmids carrying oriP required EBNA-1 to replicate efficiently even when assayed only 2 days after plasmids were introduced into the cell lines 143B and 293. Significantly, using 293 cells it was demonstrated that the plasmid-retention function of EBNA-1 and the FR did not contribute significantly to the accumulation of replicated plasmids, and the DS supported efficient EBNA-1-dependent replication in the absence of the FR. The DS contains two pairs of closely spaced EBNA-1 binding sites, and a previous study had shown that both sites within either pair are required for activity. However, it was unclear from previous work what additional sequences within the DS might be required. We found that each “half” of the DS, including a pair of closely spaced EBNA-1 binding sites, had significant replicator activity when the other half had been deleted. The only significant DNA sequences that the two halves of the DS share in common, other than EBNA-1 binding sites, is a 9-bp sequence that is present twice in the “left half” and once in the “right half.” These nonamer repeats, while not essential for activity, contributed significantly to the activity of each half of the DS. Two thymines occur at unique positions within EBNA-1 binding sites 1 and 4 at the DS and become sensitive to oxidation by permanganate when EBNA-1 binds, but mutation of each to the consensus base, adenine, actually improved the activity of each half of the DS slightly. In conclusion, the DS of oriP is an EBNA-1-dependent replicator, and its minimal active core appears to be simply two properly spaced EBNA-1 binding sites. PMID:10775587
Grimm, Fabian A.; Lehmler, Hans-Joachim; He, Xianran; Robertson, Larry W.
2013-01-01
Background: The displacement of l-thyroxine (T4) from binding sites on transthyretin (TTR) is considered a significant contributing mechanism in polychlorinated biphenyl (PCB)-induced thyroid disruption. Previous research has discovered hydroxylated PCB metabolites (OH-PCBs) as high-affinity ligands for TTR, but the binding potential of conjugated PCB metabolites such as PCB sulfates has not been explored. Objectives: We evaluated the binding of five lower-chlorinated PCB sulfates to human TTR and compared their binding characteristics to those determined for their OH-PCB precursors and for T4. Methods: We used fluorescence probe displacement studies and molecular docking simulations to characterize the binding of PCB sulfates to TTR. The stability of PCB sulfates and the reversibility of these interactions were characterized by HPLC analysis of PCB sulfates after their binding to TTR. The ability of OH-PCBs to serve as substrates for human cytosolic sulfotransferase 1A1 (hSULT1A1) was assessed by OH-PCB–dependent formation of adenosine-3´,5´-diphosphate, an end product of the sulfation reaction. Results: All five PCB sulfates were able to bind to the high-affinity binding site of TTR with equilibrium dissociation constants (Kd values) in the low nanomolar range (4.8–16.8 nM), similar to that observed for T4 (4.7 nM). Docking simulations provided corroborating evidence for these binding interactions and indicated multiple high-affinity modes of binding. All OH-PCB precursors for these sulfates were found to be substrates for hSULT1A1. Conclusions: Our findings show that PCB sulfates are high-affinity ligands for human TTR and therefore indicate, for the first time, a potential relevance for these metabolites in PCB-induced thyroid disruption. PMID:23584369
Ryden, T A; de Mars, M; Beemon, K
1993-01-01
Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280
The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.
Miotto, Marco C; Pavese, Mayra D; Quintanar, Liliana; Zweckstetter, Markus; Griesinger, Christian; Fernández, Claudio O
2017-09-05
Alterations in the levels of copper in brain tissue and formation of α-synuclein (αS)-copper complexes might play a key role in the amyloid aggregation of αS and the onset of Parkinson's disease (PD). Recently, we demonstrated that formation of the high-affinity Cu(I) complex with the N-terminally acetylated form of the protein αS substantially increases and stabilizes local conformations with α-helical secondary structure and restricted motility. In this work, we performed a detailed NMR-based structural characterization of the Cu(I) complexes with the full-length acetylated form of its homologue β-synuclein (βS), which is colocalized with αS in vivo and can bind copper ions. Our results show that, similarly to αS, the N-terminal region of βS constitutes the preferential binding interface for Cu(I) ions, encompassing two independent and noninteractive Cu(I) binding sites. According to these results, βS binds the metal ion with higher affinity than αS, in a coordination environment that involves the participation of Met-1, Met-5, and Met-10 residues (site 1). Compared to αS, the shift of His from position 50 to 65 in the N-terminal region of βS does not change the Cu(I) affinity features at that site (site 2). Interestingly, the formation of the high-affinity βS-Cu(I) complex at site 1 in the N-terminus promotes a short α-helix conformation that is restricted to the 1-5 segment of the AcβS sequence, which differs with the substantial increase in α-helix conformations seen for N-terminally acetylated αS upon Cu(I) complexation. Our NMR data demonstrate conclusively that the differences observed in the conformational transitions triggered by Cu(I) binding to AcαS and AcβS find a correlation at the level of their backbone dynamic properties; added to the potential biological implications of these findings, this fact opens new avenues of investigations into the bioinorganic chemistry of PD.
Murphy, Jesse R.; Donini, Stefano; Kappock, T. Joseph
2015-10-01
Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that `close' the active site play an important role in the assembly of a catalytically competent condensation active site. CS from the thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an `open'more » structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. In conclusion, as a polar but almost neutral ligand, the active site-tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS.« less
NASA Technical Reports Server (NTRS)
Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.
2000-01-01
Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase
NASA Astrophysics Data System (ADS)
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-01
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-05
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
NASA Astrophysics Data System (ADS)
D'Aquino, J. Alejandro; Ringe, Dagmar
2006-08-01
The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.
Allosteric binding sites in Rab11 for potential drug candidates
2018-01-01
Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286
Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism.
Backlund, Michael; Paukku, Kirsi; Kontula, Kimmo K; Lehtonen, Jukka Y A
2016-04-20
As the formation of ribonucleoprotein complexes is a major mechanism of angiotensin II type 1 receptor (AT1R) regulation, we sought to identify novel AT1R mRNA binding proteins. By affinity purification and mass spectroscopy, we identified TIA-1. This interaction was confirmed by colocalization of AT1R mRNA and TIA-1 by FISH and immunofluorescence microscopy. In immunoprecipitates of endogenous TIA- 1, reverse transcription-PCR amplified AT1R mRNA. TIA-1 has two binding sites within AT1R 3'-UTR. The binding site proximal to the coding region is glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-dependent whereas the distal binding site is not. TIA-1 functions as a part of endoplasmic reticulum (ER) stress response leading to stress granule (SG) formation and translational silencing. We and others have shown that AT1R expression is increased by ER stress-inducing factors. In unstressed cells, TIA-1 binds to AT1R mRNA and decreases AT1R protein expression. Fluorescence microscopy shows that ER stress induced by thapsigargin leads to the transfer of TIA-1 to SGs. In FISH analysis AT1R mRNA remains in the cytoplasm and no longer colocalizes with TIA-1. Thus, release of TIA-1-mediated suppression by ER stress increases AT1R protein expression. In conclusion, AT1R mRNA is regulated by TIA-1 in a ER stress-dependent manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, A.M.; Vandesande, F.; Orban, G.A.
1991-03-08
The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less
Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A
1999-01-01
A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
NASA Astrophysics Data System (ADS)
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Jeppesen, Troels E; Kristensen, Lotte K; Nielsen, Carsten H; Petersen, Lars C; Kristensen, Jesper B; Behrens, Carsten; Madsen, Jacob; Kjaer, Andreas
2018-01-17
A method for site-specific radiolabeling of the serine protease active site inhibited factor seven (FVIIai) with 64 Cu has been applied using a biorthogonal click reaction. FVIIai binds to tissue factor (TF), a trans-membrane protein involved in hemostasis, angiogenesis, proliferation, cell migration, and survival of cancer cells. First a single azide moiety was introduced in the active site of this 50 kDa protease. Then a NOTA moiety was introduced via a strain promoted azide-alkyne reaction and the corresponding conjugate was labeled with 64 Cu. Binding to TF and the stability was evaluated in vitro. TF targeting capability of the radiolabeled conjugate was tested in vivo by positron emission tomography (PET) imaging in pancreatic human xenograft cancer mouse models with various TF expressions. The conjugate showed good stability (>91% at 16 h), an immunoreactivity of 93.5%, and a mean tumor uptake of 2.1 ± 0.2%ID/g at 15 h post injection. In conclusion, FVIIai was radiolabeled with 64 Cu in single well-defined position of the protein. This method can be utilized to prepare conjugates from serine proteases with the label at a specific position.
Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.
2013-01-01
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386
Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian
2009-01-01
Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms. PMID:19753117
Sakkiah, Sugunadevi; Kusko, Rebecca; Pan, Bohu; Guo, Wenjing; Ge, Weigong; Tong, Weida; Hong, Huixiao
2018-01-01
When a small molecule binds to the androgen receptor (AR), a conformational change can occur which impacts subsequent binding of co-regulator proteins and DNA. In order to accurately study this mechanism, the scientific community needs a crystal structure of the Wild type AR (WT-AR) ligand binding domain, bound with antagonist. To address this open need, we leveraged molecular docking and molecular dynamics (MD) simulations to construct a structure of the WT-AR ligand binding domain bound with antagonist bicalutamide. The structure of mutant AR (Mut-AR) bound with this same antagonist informed this study. After molecular docking analysis pinpointed the suitable binding orientation of a ligand in AR, the model was further optimized through 1 μs of MD simulations. Using this approach, three molecular systems were studied: (1) WT-AR bound with agonist R1881, (2) WT-AR bound with antagonist bicalutamide, and (3) Mut-AR bound with bicalutamide. Our structures were very similar to the experimentally determined structures of both WT-AR with R1881 and Mut-AR with bicalutamide, demonstrating the trustworthiness of this approach. In our model, when WT-AR is bound with bicalutamide, Val716/Lys720/Gln733, or Met734/Gln738/Glu897 move and thus disturb the positive and negative charge clumps of the AF2 site. This disruption of the AF2 site is key for understanding the impact of antagonist binding on subsequent co-regulator binding. In conclusion, the antagonist induced structural changes in WT-AR detailed in this study will enable further AR research and will facilitate AR targeting drug discovery.
2013-01-01
Background METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. Methods We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Results Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Conclusion Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites. PMID:23937714
Vu, Long T.; Keschrumrus, Vic; Zhang, Xi; Zhong, Jiang F.; Su, Qingning; Kabeer, Mustafa H.; Loudon, William G.; Li, Shengwen Calvin
2015-01-01
Background The tumor microenvironment consists of both physical and chemical factors. Tissue elasticity is one physical factor contributing to the microenvironment of tumor cells. To test the importance of tissue elasticity in cell culture, primitive neuroectodermal tumor (PNET) stem cells were cultured on soft polyacrylamide (PAA) hydrogel plates that mimics the elasticity of brain tissue compared with PNET on standard polystyrene (PS) plates. We report the molecular profiles of PNET grown on either PAA or PS. Methodology/Principal Findings A whole-genome microarray profile of transcriptional expression between the two culture conditions was performed as a way to probe effects of substrate on cell behavior in culture. The results showed more genes downregulated on PAA compared to PS. This led us to propose microRNA (miRNA) silencing as a potential mechanism for downregulation. Bioinformatic analysis predicted a greater number of miRNA binding sites from the 3' UTR of downregulated genes and identified as specific miRNA binding sites that were enriched when cells were grown on PAA—this supports the hypothesis that tissue elasticity plays a role in influencing miRNA expression. Thus, Dicer was examined to determine if miRNA processing was affected by tissue elasticity. Dicer genes were downregulated on PAA and had multiple predicted miRNA binding sites in its 3' UTR that matched the miRNA binding sites found enriched on PAA. Many differentially regulated genes were found to be present on PS but downregulated on PAA were mapped onto intron sequences. This suggests expression of alternative polyadenylation sites within intron regions that provide alternative 3' UTRs and alternative miRNA binding sites. This results in tissue specific transcriptional downregulation of mRNA in humans by miRNA. We propose a mechanism, driven by the physical characteristics of the microenvironment by which downregulation of genes occur. We found that tissue elasticity-mediated cytokines (TGFβ2 and TNFα) signaling affect expression of ECM proteins. Conclusions Our results suggest that tissue elasticity plays important roles in miRNA expression, which, in turn, regulate tumor growth or tumorigenicity. PMID:25774514
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.
Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L
1997-03-11
We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.
Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok
2017-07-01
Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.
2005-01-01
The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less
Stigmatellin Probes the Electrostatic Potential in the QB Site of the Photosynthetic Reaction Center
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gerencsér, László; Boros, Bogáta; Derrien, Valerie
2015-01-01
The electrostatic potential in the secondary quinone (QB) binding site of the reaction center (RC) of the photosynthetic bacterium Rhodobacter sphaeroides determines the rate and free energy change (driving force) of electron transfer to QB. It is controlled by the ionization states of residues in a strongly interacting cluster around the QB site. Reduction of the QB induces change of the ionization states of residues and binding of protons from the bulk. Stigmatellin, an inhibitor of the mitochondrial and photosynthetic respiratory chain, has been proven to be a unique voltage probe of the QB binding pocket. It binds to themore » QB site with high affinity, and the pK value of its phenolic group monitors the local electrostatic potential with high sensitivity. Investigations with different types of detergent as a model system of isolated RC revealed that the pK of stigmatellin was controlled overwhelmingly by electrostatic and slightly by hydrophobic interactions. Measurements showed a high pK value (>11) of stigmatellin in the QB pocket of the dark-state wild-type RC, indicating substantial negative potential. When the local electrostatics of the QB site was modulated by a single mutation, L213Asp/Ala, or double mutations, L213Asp-L212Glu/Ala-Ala (AA), the pK of stigmatellin dropped to 7.5 and 7.4, respectively, which corresponds to a >210 mV increase in the electrostatic potential relative to the wild-type RC. This significant pK drop (DpK > 3.5) decreased dramatically to (DpK > 0.75) in the RC of the compensatory mutant (AAþM44Asn/AAþM44Asp). Our results indicate that the L213Asp is the most important actor in the control of the electrostatic potential in the QB site of the dark-state wild-type RC, in good accordance with conclusions of former studies using theoretical calculations or light-induced charge recombination assay.« less
Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*
Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei
2015-01-01
The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonez, E.; Thiyagarajan, S.; Cook, J.D.
2009-05-22
Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less
NASA Astrophysics Data System (ADS)
Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong
2013-08-01
The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Jacobson, A.E.; Rice, K.C.
1987-11-01
Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less
Denari, Daniela; Ceballos, Nora R
2006-07-01
Glucocorticoids (GC) are the hormonal mediators of stress. In mammals, high levels of GC have negative effects on reproductive physiology. For instance, GC can inhibit testicular testosterone synthesis by acting via glucocorticoid receptors (GR), the extent of the inhibition being dependent on GC levels. However, the effect of GC on testicular function and even the presence of GR in amphibians are still unclear. The purpose of this work was to characterise testicular cytosolic GR in Bufo arenarum, determining the seasonal changes in its binding parameters as well as the intratesticular localisation. The binding assays were performed in testis cytosol with [3H]dexamethasone (DEX) and [3H]corticosterone (CORT). Binding kinetics of DEX and CORT fitted to a one-site model. Results were expressed as means +/- standard error. Apparent number of binding sites (Bapp) was similar for both steroids (Bapp DEX = 352.53 +/- 72.08 fmol/mg protein; Bapp CORT = 454.24 +/- 134.97 fmol/mg protein) suggesting that both hormones bind to the same site. Competition studies with different steroids showed that the order of displacement of [3H]DEX and [3H]CORT specific binding is: DEX approximately RU486 approximately deoxycorticosterone (DOC) > CORT > aldosterone > RU28362 > progesterone > 11-dehydroCORT. The affinity of GR for DEX (Kd = 11.2 +/- 1.5 nM) remained constant throughout the year while circulating CORT clearly increased during the reproductive season. Therefore, testis sensitivity to GC action would depend mainly on inactivating mechanisms (11beta-hydroxysteroid dehydrogenase type 2) and CORT plasma levels. Since total and free CORT are higher in the reproductive than in the non-reproductive period, the magnitude of GC actions could be higher during the breeding season. The intratesticular localisation of the GR was determined after separation of cells by a Percoll density gradient followed by binding assays in each fraction. DEX binds to two different fractions corresponding to Leydig and Sertoli cells. In conclusion, in the testis of B. arenarum GC could regulate the function of both cellular types particularly during breeding when CORT reaches the highest plasma concentration.
2011-01-01
Background The hepatitis B virus (HBV) is a major etiological factor of inflammation and damage to the liver resulting in hepatocellular carcinoma. Transcription factors play important roles in the disordered gene expression and liver injury caused by HBV. However, the molecular mechanisms behind this observation have not been defined. Results In this study, we observed that circulating prostaglandin (PGE) 2 synthesis was increased in patients with chronic hepatitis B infection, and detected elevated cyclooxygenase (COX)-2 expression in HBV- and HBx-expressing liver cells. Likewise, the association of HBx with C/EBPβ contributed to the induction of COX-2. The COX-2 promoter was hypomethylated in HBV-positive cells, and specific demethylation of CpG dinucleotides within each of the two NF-AT sites in the COX-2 promoter resulted in the increased binding affinity of NF-AT to the cognate sites in the promoter, followed by increased COX-2 expression and PGE2 accumulation. The DNA methylatransferase DNMT3B played a key role in the methylation of the COX-2 promoter, and its decreased binding to the promoter was responsible for the regional demethylation of CpG sites, and for the increased binding of transcription factors in HBV-positive cells. Conclusion Our results indicate that upregulation of COX-2 by HBV and HBx is mediated by both demethylation events and recruitment of multiple transcription factors binding to the promoter. PMID:21401943
Structural basis of glycan specificity in neonate-specific bovine-human reassortant rotavirus
Hu, Liya; Ramani, Sasirekha; Czako, Rita; ...
2015-09-30
We report that strain-dependent variation of glycan recognition during initial cell attachment of viruses is a critical determinant of host specificity, tissue-tropism and zoonosis. Rotaviruses (RVs), which cause life-threatening gastroenteritis in infants and children, display significant genotype-dependent variations in glycan recognition resulting from sequence alterations in the VP8* domain of the spike protein VP4. The structural basis of this genotype-dependent glycan specificity, particularly in human RVs, remains poorly understood. Here, from crystallographic studies, we show how genotypic variations configure a novel binding site in the VP8* of a neonate-specific bovine-human reassortant to uniquely recognize either type I or type IImore » precursor glycans, and to restrict type II glycan binding in the bovine counterpart. In conclusion, such a distinct glycan-binding site that allows differential recognition of the precursor glycans, which are developmentally regulated in the neonate gut and abundant in bovine and human milk provides a basis for age-restricted tropism and zoonotic transmission of G10P[11] rotaviruses.« less
Structural basis of glycan specificity in neonate-specific bovine-human reassortant rotavirus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Liya; Ramani, Sasirekha; Czako, Rita
We report that strain-dependent variation of glycan recognition during initial cell attachment of viruses is a critical determinant of host specificity, tissue-tropism and zoonosis. Rotaviruses (RVs), which cause life-threatening gastroenteritis in infants and children, display significant genotype-dependent variations in glycan recognition resulting from sequence alterations in the VP8* domain of the spike protein VP4. The structural basis of this genotype-dependent glycan specificity, particularly in human RVs, remains poorly understood. Here, from crystallographic studies, we show how genotypic variations configure a novel binding site in the VP8* of a neonate-specific bovine-human reassortant to uniquely recognize either type I or type IImore » precursor glycans, and to restrict type II glycan binding in the bovine counterpart. In conclusion, such a distinct glycan-binding site that allows differential recognition of the precursor glycans, which are developmentally regulated in the neonate gut and abundant in bovine and human milk provides a basis for age-restricted tropism and zoonotic transmission of G10P[11] rotaviruses.« less
Abou-Zied, Osama K
2015-01-01
Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.
Pikler, G M; Webster, R A; Spelsberg, T C
1976-01-01
Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147
Interaction of CSFV E2 Protein with Swine Host Factors as Detected by Yeast Two-Hybrid System
Gladue, Douglas P.; Baker-Bransetter, Ryan; Holinka, Lauren G.; Fernandez-Sainz, Ignacio J.; O’Donnell, Vivian; Fletcher, Paige; Lu, Zhiqiang; Borca, Manuel V.
2014-01-01
E2 is one of the envelope glycoproteins of pestiviruses, including classical swine fever virus (CSFV) and bovine viral diarrhea virus (BVDV). E2 is involved in several critical functions, including virus entry into target cells, induction of a protective immune response and virulence in swine. However, there is no information regarding any host binding partners for the E2 proteins. Here, we utilized the yeast two-hybrid system and identified fifty-seven host proteins as positive binding partners which bound E2 from both CSFV and BVDV with the exception of two proteins that were found to be positive for binding only to CSFV E2. Alanine scanning of CSFV E2 demonstrated that the binding sites for these cellular proteins on E2 are likely non-linear binding sites. The possible roles of the identified host proteins are discussed as the results presented here will be important for future studies to elucidate mechanisms of host protein-virus interactions during pestivirus infection. However, due to the limitations of the yeast two hybrid system, the proteins identified is not exhaustive and each interaction identified needs to be confirmed by independent experimental approaches in the context of virus-infected cells before any definitive conclusion can be drawn on relevance for the virus life cycle. PMID:24416391
Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo
NASA Astrophysics Data System (ADS)
Schwartz, Rochelle D.; Kellar, Kenneth J.
1983-04-01
Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.
Substance P binding sites in the nucleus tractus solitarius of the cat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maley, B.E.; Sasek, C.A.; Seybold, V.S.
1988-11-01
Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less
Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun
2018-06-16
Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.
Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.
1991-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985
Li, Xianting; Wang, Qing Jun; Pan, Nina; Lee, Sangkyu; Zhao, Yingming; Chait, Brian T.; Yue, Zhenyu
2011-01-01
Background Recent studies show that mutations in Leucine Rich Repeat Kinase 2 (LRRK2) are the cause of the most common inherited and some sporadic forms of Parkinson's disease (PD). The molecular mechanism underlying the pathogenic role of LRRK2 mutations in PD remains unknown. Methodology/Principal Findings Using affinity purification and mass spectrometric analysis, we investigated phosphorylation sites and binding proteins of LRRK2 purified from mouse brain. We identified multiple phosphorylation sites at N-terminus of LRRK2 including S910, S912, S935 and S973. Focusing on the high stoichiometry S935 phosphorylation site, we developed an anti-pS935 specific antibody and showed that LRRK2 is constitutively phosphorylated at S935 in various tissues (including brain) and at different ages in mice. We find that 14-3-3 proteins (especially isoforms γ and η) bind LRRK2 and this binding depends on phosphorylation of S935. The binding of 14-3-3, with little effect on dimer formation of LRRK2, confers protection of the phosphorylation status of S935. Furthermore, we show that protein kinase A (PKA), but not LRRK2 kinase itself, can cause the phosphorylation of LRRK2 at S935 in vitro and in cell culture, suggesting that PKA is a potential upstream kinase that regulates LRRK2 function. Finally, our study indicates that the common PD-related mutations of LRRK2, R1441G, Y1699C and G2019S, decrease homeostatic phosphorylation levels of S935 and impair 14-3-3 binding of LRRK2. Conclusions/Significance LRRK2 is extensively phosphorylated in vivo, and the phosphorylation of specific sites (e.g. S935) determines 14-3-3 binding of LRRK2. We propose that 14-3-3 is an important regulator of LRRK2-mediated cellular functions. Our study suggests that PKA, a cAMP-dependent kinase involved in regulating dopamine physiology, is a potential upstream kinase that phosphorylates LRRK2 at S935. Furthermore, the reduction of phosphorylation/14-3-3 binding of LRRK2 due to the common familial PD-related mutations provides novel insight into the pathogenic mechanism of LRRK2-linked PD. PMID:21390248
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Detoxification of cancerogenic compounds by lactic acid bacteria strains.
Lili, Zhao; Junyan, Wei; Hongfei, Zhao; Baoqing, Zhu; Bolin, Zhang
2017-10-20
Carcinogens in food are an important issue that threat people's health right now. Lactic acid bacteria (LAB) strains as well-known probiotics have shown numerous perspectives in being used as a good food additive to confront cancerogenic compounds in recent years. Some LAB strains can remove cancerogenic compounds from medium environment via direct physical binding and avoid re-pollution of poisonous secondary metabolites which are generated from degradation of cancerogenic compounds. This article presents a whole overview of the physical-binding of LAB strains to such common cancerogenic compounds existed in food and feed environments as mycotoxins, polycyclic aromatic hydrocarbons (PAHs), heterocyclic amines (HAs) and pthalic acid esters (PAEs).In most cases, summaries of these published researches show that the binding of LAB strains to cancerogenic compounds is a physical process. Binding sites generally take place in cell wall, and peptidoglycan from LAB cells is the chief binding site. The adsorption of lactic acid bacteria to cancerogenic compounds is strain-specific. Specially, the strains from the two genera Lactobacillus and Bifidobacterium show a better potential in binding cancerogenic compounds. Moreover, we firstly used molecular dynamic computer model as a highly potential tool to simulate the binding behavior of peptidoglycan from Lactobacillus acidophilus to DBP, one of pthalic acid esters with genetic toxicity. It was seen that the theoretical data were quite consistent with the experimental results in terms of the ability of this bacterium to bind DBP. Also, the toxicity reduction of cancerogenic compounds by LAB strains could be achieved either in gastrointestinal model or animal tests and clinical researches as well. In conclusion, carefully selected LAB strains should be a good solution as one of safety strategies to reduce potential risk of cancerogenic compounds from food-based products.
Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G
1992-05-05
Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.
Kawasaki, Kazuyoshi; Ogawa, Seturou
2003-01-01
NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.
Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor
2016-01-01
Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702
Liu, Sheng-Jie; Wang, Jiang-Yi; Peng, Shuang-He; Li, Teng; Ning, Xiang-Hui; Hong, Bao-An; Liu, Jia-Yuan; Wu, Peng-Jie; Zhou, Bo-Wen; Zhou, Jing-Cheng; Qi, Nie-Nie; Peng, Xiang; Zhang, Jiu-Feng; Ma, Kai-Fang; Cai, Lin; Gong, Kan
2018-03-29
PurposeVon Hippel-Lindau (VHL) disease is a rare hereditary cancer syndrome that reduces life expectancy. We aimed to construct a more valuable genotype-phenotype correlation based on alterations in VHL protein (pVHL).MethodsVHL patients (n = 339) were recruited and grouped based on mutation types: HIF-α binding site missense (HM) mutations, non-HIF-α binding site missense (nHM) mutations, and truncating (TR) mutations. Age-related risks of VHL-associated tumors and patient survival were compared.ResultsMissense mutations conferred an increased risk of pheochromocytoma (HR = 1.854, p = 0.047) compared with truncating mutations. The risk of pheochromocytoma was lower in the HM group than in the nHM group (HR = 0.298, p = 0.003) but was similar between HM and TR groups (HR = 0.901, p = 0.810). Patients in the nHM group had a higher risk of pheochromocytoma (HR = 3.447, p < 0.001) and lower risks of central nervous system hemangioblastoma (CHB) (HR = 0.700, p = 0.045), renal cell carcinoma (HR = 0.610, p = 0.024), and pancreatic tumor (HR = 0.382, p < 0.001) than those in the combined HM and TR (HMTR) group. Moreover, nHM mutations were independently associated with better overall survival (HR = 0.345, p = 0.005) and CHB-specific survival (HR = 0.129, p = 0.005) than HMTR mutations.ConclusionThe modified genotype-phenotype correlation links VHL gene mutation, substrate binding site, and phenotypic diversity (penetrance and survival), and provides more accurate information for genetic counseling and pathogenesis studies.Genetics in Medicine advance online publication, 29 March 2018; doi:10.1038/gim.2017.261.
CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.
Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar
2017-09-01
Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.
Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P
2007-01-01
Background and Purpose: The P2X7 receptor exhibits complex pharmacological properties. In this study, binding of a [3H]-labelled P2X7 receptor antagonist to human P2X7 receptors has been examined to further understand ligand interactions with this receptor. Experimental Approach: The P2X7 receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.13,7]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X7 receptors. Key Results: Binding of [3H]-compound-17 was higher in membranes prepared from cells expressing P2X7 receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X7 receptors. Binding was reversible, saturable and modulated by P2X7 receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. Conclusions: These data demonstrate that human P2X7 receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X7 receptor complex enhances subsequent binding to other P2X7 subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X7 receptor. PMID:17339830
Mohd Rehan
2015-11-01
The PI3K/AKT/mTOR signaling pathway has been identified as an important target for cancer therapy. Attempts are increasingly made to design the inhibitors against the key proteins of this pathway for anti-cancer therapy. The PI3K/mTOR dual inhibitors have proved more effective than the inhibitors against only single protein targets. Recently discovered PKI-179, an orally effective compound, is one such dual inhibitor targeting both PI3K and mTOR. This anti-cancer compound is efficacious both in vitro and in vivo. However, the binding mechanisms and the molecular interactions of PKI-179 with PI3K and mTOR are not yet available. The current study investigated the exact binding mode and the molecular interactions of PKI-179 with PI3Kγ and mTOR using molecular docking and (un)binding simulation analyses. The study identified PKI-179 interacting residues of both the proteins and their importance in binding was ranked by the loss in accessible surface area, number of molecular interactions of the residue, and consistent appearance of the residue in (un)binding simulation analysis. The key residues involved in binding of PKI-179 were Ala-805 in PI3Kγ and Ile-2163 in mTOR as they have lost maximum accessible surface area due to binding. In addition, the residues which played a role in binding of the drug but were away from the catalytic site were also identified using (un)binding simulation analyses. Finally, comparison of the interacting residues in the respective catalytic sites was done for the difference in the binding of the drug to the two proteins. Thus, the pairs of the residues falling at the similar location with respect to the docked drug were identified. The striking similarity in the interacting residues of the catalytic site explains the concomitant inhibition of both proteins by a number of inhibitors. In conclusion, the docking and (un)binding simulation analyses of dual inhibitor PKI-179 with PI3K and mTOR will provide a suitable multi-target model for studying drug-protein interactions and thus help in designing the novel drugs with higher potency. Copyright © 2015 Elsevier Inc. All rights reserved.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Nuclear factor I-A represses expression of the cell adhesion molecule L1
2009-01-01
Background The neural cell adhesion molecule L1 plays a crucial role in development and plasticity of the nervous system. Neural cells thus require precise control of L1 expression. Results We identified a full binding site for nuclear factor I (NFI) transcription factors in the regulatory region of the mouse L1 gene. Electrophoretic mobility shift assay (EMSA) showed binding of nuclear factor I-A (NFI-A) to this site. Moreover, for a brain-specific isoform of NFI-A (NFI-A bs), we confirmed the interaction in vivo using chromatin immunoprecipitation (ChIP). Reporter gene assays showed that in neuroblastoma cells, overexpression of NFI-A bs repressed L1 expression threefold. Conclusion Our findings suggest that NFI-A, in particular its brain-specific isoform, represses L1 gene expression, and might act as a second silencer of L1 in addition to the neural restrictive silencer factor (NRSF). PMID:20003413
Kulén, Martina; Lindgren, Marie; Hansen, Sabine; Cairns, Andrew G; Grundström, Christin; Begum, Afshan; van der Lingen, Ingeborg; Brännström, Kristoffer; Hall, Michael; Sauer, Uwe H; Johansson, Jörgen; Sauer-Eriksson, A Elisabeth; Almqvist, Fredrik
2018-05-10
Listeria monocytogenes is a bacterial pathogen that controls much of its virulence through the transcriptional regulator PrfA. In this study, we describe structure-guided design and synthesis of a set of PrfA inhibitors based on ring-fused 2-pyridone heterocycles. Our most effective compound decreased virulence factor expression, reduced bacterial uptake into eukaryotic cells, and improved survival of chicken embryos infected with L. monocytogenes compared to previously identified compounds. Crystal structures identified an intraprotein "tunnel" as the main inhibitor binding site (A I ), where the compounds participate in an extensive hydrophobic network that restricts the protein's ability to form functional DNA-binding helix-turn-helix (HTH) motifs. Our studies also revealed a hitherto unsuspected structural plasticity of the HTH motif. In conclusion, we have designed 2-pyridone analogues that function as site-A I selective PrfA inhibitors with potent antivirulence properties.
Jørgensen, Casper Møller; Fields, Christopher J.; Chander, Preethi; Watt, Desmond; Burgner, John W.; Smith, Janet L.; Switzer, Robert L.
2011-01-01
Summary The PyrR protein regulates expression of pyrimidine biosynthetic (pyr) genes in many bacteria. PyrR binds to specific sites in the 5’ leader RNA of target operons and favors attenuation of transcription. Filter binding and gel mobility assays were used to characterize the binding of PyrR from Bacillus caldolyticus to RNA sequences (binding loops) from the three attenuation regions of the B. caldolyticus pyr operon. Binding of PyrR to the three binding loops and modulation of RNA binding by nucleotides was similar for all three RNAs. Apparent dissociation constants at 0° C ranged from 0.13 to 0.87 nM in the absence of effectors; dissociation constants were decreased by 3 to 12 fold by uridine nucleotides and increased by 40 to 200 fold by guanosine nucleotides. The binding data suggest that pyr operon expression is regulated by the ratio of intracellular uridine nucleotides to guanosine nucleotides; the effects of nucleoside addition to the growth medium on aspartate transcarbamylase (pyrB) levels in B. subtilis cells in vivo supported this conclusion. Analytical ultracentrifugation established that RNA binds to dimeric PyrR, even though the tetrameric form of unbound PyrR predominates in solution at the concentrations studied. PMID:18190533
Welsch, Christoph; Shimakami, Tetsuro; Hartmann, Christoph; Yang, Yan; Domingues, Francisco S.; Lengauer, Thomas; Zeuzem, Stefan; Lemon, Stanley M.
2011-01-01
Background & Aims It is a challenge to develop direct-acting antiviral agents (DAAs) that target the NS3/4A protease of hepatitis C virus (HCV) because resistant variants develop. Ketoamide compounds, designed to mimic the natural protease substrate, have been developed as inhibitors. However, clinical trials have revealed rapid selection of resistant mutants, most of which are considered to be pre-existing variants. Methods We identified residues near the ketoamide-binding site in X-ray structures of the genotype 1a protease, co-crystallized with boceprevir or a telaprevir-like ligand, and then identified variants at these positions in 219 genotype 1 sequences from a public database. We used side-chain modeling to assess the potential effects of these variants on the interaction between ketoamide and the protease, and compared these results with the phenotypic effects on ketoamide resistance, RNA replication capacity, and infectious virus yields in a cell culture model of infection. Results Thirteen natural binding-site variants with potential for ketoamide resistance were identified at 10 residues in the protease, near the ketoamide binding site. Rotamer analysis of amino acid side-chain conformations indicated that 2 variants (R155K and D168G) could affect binding of telaprevir more than boceprevir. Measurements of antiviral susceptibility in cell culture studies were consistent with this observation. Four variants (Q41H, I132V, R155K, and D168G) caused low-to-moderate levels of ketoamide resistance; 3 of these were highly fit (Q41H, I132V, and R155K). Conclusions Using a comprehensive sequence and structure-based analysis, we showed how natural variation in the HCV protease NS3/4A sequences might affect susceptibility to first-generation DAAs. These findings increase our understanding of the molecular basis of ketoamide resistance among naturally existing viral variants. PMID:22155364
Molderings, G J; Menzel, S; Kathmann, M; Schlicker, E; Göthert, M
2000-01-01
In segments of rat vena cava preincubated with [3H]-noradrenaline and superfused with physiological salt solution, the influence of agmatine on the electrically evoked [3H]-noradrenaline release, the EP3 prostaglandin receptor-mediated and the α2D-adrenoceptor-mediated inhibition of evoked [3H]-noradrenaline release was investigated. Agmatine (0.1–10 μM) by itself was without effect on evoked [3H]-noradrenaline release. In the presence of 10 μM agmatine, the prostaglandin E2(PGE2)-induced EP3-receptor-mediated inhibition of [3H]-noradrenaline release was not modified, whereas the α2D-adrenoceptor-mediated inhibition of [3H]-noradrenaline release induced by noradrenaline, moxonidine or clonidine was more pronounced than in the absence of agmatine. However, 1 mM agmatine antagonized the moxonidine-induced inhibition of [3H]-noradrenaline release. Agmatine concentration-dependently inhibited the binding of [3H]-clonidine and [3H]-rauwolscine to rat brain cortex membranes (Ki values 6 μM and 12 μM, respectively). In addition, 30 and 100 μM agmatine increased the rate of association and decreased the rate of dissociation of [3H]-clonidine resulting in an increased affinity of the radioligand for the α2D-adrenoceptors. [14C]-agmatine labelled specific binding sites on rat brain cortex membranes. In competition experiments. [14C]-agmatine was inhibited from binding to its specific recognition sites by unlabelled agmatine, but not by rauwolscine and moxonidine. In conclusion, the present data indicate that agmatine both acts as an antagonist at the ligand recognition site of the α2D-adrenoceptor and enhances the effects of α2-adrenoceptor agonists probably by binding to an allosteric binding site of the α2D-adrenoceptor which seems to be labelled by [14C]-agmatine. PMID:10928978
Nahar, Musammat F.; Buckle, Ashley M.; Roujeinikova, Anna
2011-01-01
Background The C-terminal domain of MotB (MotB-C) shows high sequence similarity to outer membrane protein A and related peptidoglycan (PG)-binding proteins. It is believed to anchor the power-generating MotA/MotB stator unit of the bacterial flagellar motor to the peptidoglycan layer of the cell wall. We previously reported the first crystal structure of this domain and made a puzzling observation that all conserved residues that are thought to be essential for PG recognition are buried and inaccessible in the crystal structure. In this study, we tested a hypothesis that peptidoglycan binding is preceded by, or accompanied by, some structural reorganization that exposes the key conserved residues. Methodology/Principal Findings We determined the structure of a new crystalline form (Form B) of Helicobacter pylori MotB-C. Comparisons with the existing Form A revealed conformational variations in the petal-like loops around the carbohydrate binding site near one end of the β-sheet. These variations are thought to reflect natural flexibility at this site required for insertion into the peptidoglycan mesh. In order to understand the nature of this flexibility we have performed molecular dynamics simulations of the MotB-C dimer. The results are consistent with the crystallographic data and provide evidence that the three loops move in a concerted fashion, exposing conserved MotB residues that have previously been implicated in binding of the peptide moiety of peptidoglycan. Conclusion/Significance Our structural analysis provides a new insight into the mechanism by which MotB inserts into the peptidoglycan mesh, thus anchoring the power-generating complex to the cell wall. PMID:21533052
A molecular characterization of the agonist binding site of a nematode cys-loop GABA receptor
Kaji, Mark D; Kwaka, Ariel; Callanan, Micah K; Nusrat, Humza; Desaulniers, Jean-Paul; Forrester, Sean G
2015-01-01
Background and Purpose Cys-loop GABA receptors represent important targets for human chemotherapeutics and insecticides and are potential targets for novel anthelmintics (nematicides). However, compared with insect and mammalian receptors, little is known regarding the pharmacological characteristics of nematode Cys-loop GABA receptors. Here we have investigated the agonist binding site of the Cys-loop GABA receptor UNC-49 (Hco-UNC-49) from the parasitic nematode Haemonchus contortus. Experimental Approach We used two-electrode voltage-clamp electrophysiology to measure channel activation by classical GABA receptor agonists on Hco-UNC-49 expressed in Xenopus laevis oocytes, along with site-directed mutagenesis and in silico homology modelling. Key Results The sulphonated molecules P4S and taurine had no effect on Hco-UNC-49. Other classical Cys-loop GABAA receptor agonists tested on the Hco-UNC-49B/C heteromeric channel had a rank order efficacy of GABA > trans-4-aminocrotonic acid > isoguvacine > imidazole-4-acetic acid (IMA) > (R)-(−)-4-amino-3-hydroxybutyric acid [R(−)-GABOB] > (S)-(+)-4-amino-3-hydroxybutyric acid [S(+)-GABOB] > guanidinoacetic acid > isonipecotic acid > 5-aminovaleric acid (DAVA) (partial agonist) > β-alanine (partial agonist). In silico ligand docking revealed some variation in binding between agonists. Mutagenesis of a key serine residue in binding loop C to threonine had minimal effects on GABA and IMA but significantly increased the maximal response to DAVA and decreased twofold the EC50 for R(−)- and S(+)-GABOB. Conclusions and Implications The pharmacological profile of Hco-UNC-49 differed from that of vertebrate Cys-loop GABA receptors and insect resistance to dieldrin receptors, suggesting differences in the agonist binding pocket. These findings could be exploited to develop new drugs that specifically target GABA receptors of parasitic nematodes. PMID:25850584
Fujiwara, Yuichiro; Arrigoni, Cristina; Domigan, Courtney; Ferrara, Giuseppina; Pantoja, Carlos; Thiel, Gerhard; Moroni, Anna; Minor, Daniel L.
2009-01-01
Background Understanding the interactions between ion channels and blockers remains an important goal that has implications for delineating the basic mechanisms of ion channel function and for the discovery and development of ion channel directed drugs. Methodology/Principal Findings We used genetic selection methods to probe the interaction of two ion channel blockers, barium and amantadine, with the miniature viral potassium channel Kcv. Selection for Kcv mutants that were resistant to either blocker identified a mutant bearing multiple changes that was resistant to both. Implementation of a PCR shuffling and backcrossing procedure uncovered that the blocker resistance could be attributed to a single change, T63S, at a position that is likely to form the binding site for the inner ion in the selectivity filter (site 4). A combination of electrophysiological and biochemical assays revealed a distinct difference in the ability of the mutant channel to interact with the blockers. Studies of the analogous mutation in the mammalian inward rectifier Kir2.1 show that the T→S mutation affects barium block as well as the stability of the conductive state. Comparison of the effects of similar barium resistant mutations in Kcv and Kir2.1 shows that neighboring amino acids in the Kcv selectivity filter affect blocker binding. Conclusions/Significance The data support the idea that permeant ions have an integral role in stabilizing potassium channel structure, suggest that both barium and amantadine act at a similar site, and demonstrate how genetic selections can be used to map blocker binding sites and reveal mechanistic features. PMID:19834614
Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine
Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.
2015-01-01
Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-05-01
Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less
Phakthanakanok, Krongsakda; Ratanakhanokchai, Khanok; Kyu, Khin Lay; Sompornpisut, Pornthep; Watts, Aaron; Pinitglang, Surapong
2009-01-01
Background SARS coronavirus main proteinase (SARS CoVMpro) is an important enzyme for the replication of Severe Acute Respiratory Syndrome virus. The active site region of SARS CoVMpro is divided into 8 subsites. Understanding the binding mode of SARS CoVMpro with a specific substrate is useful and contributes to structural-based drug design. The purpose of this research is to investigate the binding mode between the SARS CoVMpro and two octapeptides, especially in the region of the S3 subsite, through a molecular docking and molecular dynamics (MD) simulation approach. Results The one turn α-helix chain (residues 47–54) of the SARS CoVMpro was directly involved in the induced-fit model of the enzyme-substrate complex. The S3 subsite of the enzyme had a negatively charged region due to the presence of Glu47. During MD simulations, Glu47 of the enzyme was shown to play a key role in electrostatic bonding with the P3Lys of the octapeptide. Conclusion MD simulations were carried out on the SARS CoVMpro-octapeptide complex. The hypothesis proposed that Glu47 of SARS CoVMpro is an important residue in the S3 subsite and is involved in binding with P3Lys of the octapeptide. PMID:19208150
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCann, D.J.; Su, T.P.
1991-05-01
The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less
Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.
Suzuki, N; Mihashi, K
1991-01-01
The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luthin, G.R.; Wolfe, B.B.
The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less
Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H
1997-02-28
The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Conservation of CD44 exon v3 functional elements in mammals
Vela, Elena; Hilari, Josep M; Delclaux, María; Fernández-Bellon, Hugo; Isamat, Marcos
2008-01-01
Background The human CD44 gene contains 10 variable exons (v1 to v10) that can be alternatively spliced to generate hundreds of different CD44 protein isoforms. Human CD44 variable exon v3 inclusion in the final mRNA depends on a multisite bipartite splicing enhancer located within the exon itself, which we have recently described, and provides the protein domain responsible for growth factor binding to CD44. Findings We have analyzed the sequence of CD44v3 in 95 mammalian species to report high conservation levels for both its splicing regulatory elements (the 3' splice site and the exonic splicing enhancer), and the functional glycosaminglycan binding site coded by v3. We also report the functional expression of CD44v3 isoforms in peripheral blood cells of different mammalian taxa with both consensus and variant v3 sequences. Conclusion CD44v3 mammalian sequences maintain all functional splicing regulatory elements as well as the GAG binding site with the same relative positions and sequence identity previously described during alternative splicing of human CD44. The sequence within the GAG attachment site, which in turn contains the Y motif of the exonic splicing enhancer, is more conserved relative to the rest of exon. Amplification of CD44v3 sequence from mammalian species but not from birds, fish or reptiles, may lead to classify CD44v3 as an exclusive mammalian gene trait. PMID:18710510
Existence of three subtypes of bradykinin B2 receptors in guinea pig.
Seguin, L; Widdowson, P S; Giesen-Crouse, E
1992-12-01
We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)
Nguyen, T V; Juorio, A V
1989-10-01
The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.
Walsh, Ann W.; Langley, David R.; Colonno, Richard J.; Tenney, Daniel J.
2010-01-01
Background Entecavir (ETV) is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV) polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr) is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT) domain involve lamivudine-resistance (LVDr) substitutions in the conserved YMDD motif (M204V/I ± L180M), plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. Methods/Principal Findings To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M) and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (Ki) for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (kcat) in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP) binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of comprehensive substitutions of each ETVr position. Conclusions Altogether, ETVr occurred through exclusion of ETV-TP from the dNTP-binding site, through different, novel mechanisms that involved lamivudine-resistance, ETV-specific substitutions, and the primer-template. PMID:20169198
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.
Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A
2011-05-31
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C.
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
McCorkle, Sean R; McCombie, WR; Dunn, John J
2011-01-01
Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205
Ethylene binding site affinity in ripening apples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blankenship, S.M.; Sisler, E.C.
1993-09-01
Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less
NASA Technical Reports Server (NTRS)
D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.
2002-01-01
Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.
Functional identification and characterization of sodium binding sites in Na symporters
Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.
2013-01-01
Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006
Navé, Jean-François; Benveniste, Pierre
1984-01-01
The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499
Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats
Botcheva, Krassimira; McCorkle, Sean R.
2014-11-21
The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less
A genome-wide structure-based survey of nucleotide binding proteins in M. tuberculosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhagavat, Raghu; Kim, Heung -Bok; Kim, Chang -Yub
Nucleoside tri-phosphates (NTP) form an important class of small molecule ligands that participate in, and are essential to a large number of biological processes. Here, we seek to identify the NTP binding proteome (NTPome) in M. tuberculosis (M.tb), a deadly pathogen. Identifying the NTPome is useful not only for gaining functional insights of the individual proteins but also for identifying useful drug targets. From an earlier study, we had structural models of M.tb at a proteome scale from which a set of 13,858 small molecule binding pockets were identified. We use a set of NTP binding sub-structural motifs derived frommore » a previous study and scan the M.tb pocketome, and find that 1,768 proteins or 43% of the proteome can theoretically bind NTP ligands. Using an experimental proteomics approach involving dye-ligand affinity chromatography, we confirm NTP binding to 47 different proteins, of which 4 are hypothetical proteins. Our analysis also provides the precise list of binding site residues in each case, and the probable ligand binding pose. In conclusion, as the list includes a number of known and potential drug targets, the identification of NTP binding can directly facilitate structure-based drug design of these targets.« less
A genome-wide structure-based survey of nucleotide binding proteins in M. tuberculosis
Bhagavat, Raghu; Kim, Heung -Bok; Kim, Chang -Yub; ...
2017-10-02
Nucleoside tri-phosphates (NTP) form an important class of small molecule ligands that participate in, and are essential to a large number of biological processes. Here, we seek to identify the NTP binding proteome (NTPome) in M. tuberculosis (M.tb), a deadly pathogen. Identifying the NTPome is useful not only for gaining functional insights of the individual proteins but also for identifying useful drug targets. From an earlier study, we had structural models of M.tb at a proteome scale from which a set of 13,858 small molecule binding pockets were identified. We use a set of NTP binding sub-structural motifs derived frommore » a previous study and scan the M.tb pocketome, and find that 1,768 proteins or 43% of the proteome can theoretically bind NTP ligands. Using an experimental proteomics approach involving dye-ligand affinity chromatography, we confirm NTP binding to 47 different proteins, of which 4 are hypothetical proteins. Our analysis also provides the precise list of binding site residues in each case, and the probable ligand binding pose. In conclusion, as the list includes a number of known and potential drug targets, the identification of NTP binding can directly facilitate structure-based drug design of these targets.« less
Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris
2015-01-01
The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415
Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.
The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less
Autoradiographic localization of endothelin-1 binding sites in porcine skin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Y.D.; Springall, D.R.; Wharton, J.
Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Rajasekaran, M.; Abirami, Santhanam; Chen, Chinpan
2011-01-01
Background Arylamine N-acetyltransferase 2 (NAT2) is an important catalytic enzyme that metabolizes the carcinogenic arylamines, hydrazine drugs and chemicals. This enzyme is highly polymorphic in different human populations. Several polymorphisms of NAT2, including the single amino acid substitutions R64Q, I114T, D122N, L137F, Q145P, R197Q, and G286E, are classified as slow acetylators, whereas the wild-type NAT2 is classified as a fast acetylator. The slow acetylators are often associated with drug toxicity and efficacy as well as cancer susceptibility. The biological functions of these 7 mutations have previously been characterized, but the structural basis behind the reduced catalytic activity and reduced protein level is not clear. Methodology/Principal Findings We performed multiple molecular dynamics simulations of these mutants as well as NAT2 to investigate the structural and dynamical effects throughout the protein structure, specifically the catalytic triad, cofactor binding site, and the substrate binding pocket. None of these mutations induced unfolding; instead, their effects were confined to the inter-domain, domain 3 and 17-residue insert region, where the flexibility was significantly reduced relative to the wild-type. Structural effects of these mutations propagate through space and cause a change in catalytic triad conformation, cofactor binding site, substrate binding pocket size/shape and electrostatic potential. Conclusions/Significance Our results showed that the dynamical properties of all the mutant structures, especially in inter-domain, domain 3 and 17-residue insert region were affected in the same manner. Similarly, the electrostatic potential of all the mutants were altered and also the functionally important regions such as catalytic triad, cofactor binding site, and substrate binding pocket adopted different orientation and/or conformation relative to the wild-type that may affect the functions of the mutants. Overall, our study may provide the structural basis for reduced catalytic activity and protein level, as was experimentally observed for these polymorphisms. PMID:21980537
Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei
2012-01-01
Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Amato, R.J.; Largent, B.L.; Snowman, A.M.
1987-07-01
Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less
Jiang, Peng; Singh, Mona; Coller, Hilary A
2013-01-01
Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.
Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M
2013-03-19
Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.
Tam, S W; Cook, L
1984-01-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851
Exopolysaccharides regulate calcium flow in cariogenic biofilms
Varenganayil, Muth M.; Decho, Alan W.
2017-01-01
Caries-associated biofilms induce loss of calcium from tooth surfaces in the presence of dietary carbohydrates. Exopolysaccharides (EPS) provide a matrix scaffold and an abundance of primary binding sites within biofilms. The role of EPS in binding calcium in cariogenic biofilms is only partially understood. Thus, the aim of the present study is to investigate the relationship between the calcium dissolution rates and calcium tolerance of caries-associated bacteria and yeast as well as to examine the properties of EPS to quantify its binding affinity for dissolved calcium. Calcium dissolution was measured by dissolution zones on Pikovskaya’s agar. Calcium tolerance was assessed by isothermal microcalorimetry (IMC) by adding CaCl2 to the bacterial cultures. Acid-base titration and Fourier transform infrared (FTIR) spectroscopy were used to identify possible functional groups responsible for calcium binding, which was assessed by isothermal titration calorimetry (ITC). Lactobacillus spp. and mutans streptococci demonstrated calcium dissolution in the presence of different carbohydrates. All strains that demonstrated high dissolution rates also revealed higher rates of calcium tolerance by IMC. In addition, acidic functional groups were predominantly identified as possible binding sites for calcium ions by acid-base titration and FTIR. Finally, ITC revealed EPS to have a higher binding affinity for calcium compared, for example, to lactic acid. In conclusion, this study illustrates the role of EPS in terms of the calcium tolerance of cariogenic microbiota by determining the ability of EPS to control free calcium concentrations within the biofilms as a self-regulating mode of action in the pathogenesis of dental caries. PMID:29023506
2011-01-01
Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability. PMID:22013910
2014-01-01
Background Polycomb group proteins form multicomponent complexes that are important for establishing lineage-specific patterns of gene expression. Mammalian cells encode multiple permutations of the prototypic Polycomb repressive complex 1 (PRC1) with little evidence for functional specialization. An aim of this study is to determine whether the multiple orthologs that are co-expressed in human fibroblasts act on different target genes and whether their genomic location changes during cellular senescence. Results Deep sequencing of chromatin immunoprecipitated with antibodies against CBX6, CBX7, CBX8, RING1 and RING2 reveals that the orthologs co-localize at multiple sites. PCR-based validation at representative loci suggests that a further six PRC1 proteins have similar binding patterns. Importantly, sequential chromatin immunoprecipitation with antibodies against different orthologs implies that multiple variants of PRC1 associate with the same DNA. At many loci, the binding profiles have a distinctive architecture that is preserved in two different types of fibroblast. Conversely, there are several hundred loci at which PRC1 binding is cell type-specific and, contrary to expectations, the presence of PRC1 does not necessarily equate with transcriptional silencing. Interestingly, the PRC1 binding profiles are preserved in senescent cells despite changes in gene expression. Conclusions The multiple permutations of PRC1 in human fibroblasts congregate at common rather than specific sites in the genome and with overlapping but distinctive binding profiles in different fibroblasts. The data imply that the effects of PRC1 complexes on gene expression are more subtle than simply repressing the loci at which they bind. PMID:24485159
Handa, James T.; Tagami, Mizuki; Ebrahimi, Katayoon; Leibundgut, Gregor; Janiak, Anna; Witztum, Joseph L.; Tsimikas, Sotirios
2015-01-01
Purpose: To test the hypothesis that the accumulation of oxidized phospholipids (OxPL) in the macula is toxic to the retina unless neutralized by a variety of mechanisms, including binding by lipoprotein(a) [Lp(a)], which is composed of apolipoprotein(a) [apo(a)] and apolipoprotein B-100 (apoB). Methods: Human maculas and eyes from two Lp(a) transgenic murine models were subjected to morphologic, ultrastructural, and immunohistochemical analysis. “Wild-type Lp(a)” mice, which express human apoB-100 and apo(a) that contains oxidized phospholipid, and “mutant LBS− Lp(a)” mice with a defective apo(a) lysine binding site (LBS) for oxidized phospholipid binding, were fed a chow or high-fat diet for 2 to 12 months. Oxidized phospholipid–containing lipoproteins were detected by immunoreactivity to E06, a murine monoclonal antibody binding to the phosphocholine headgroup of oxidized, but not native, phospholipids. Results: Oxidized phospholipids, apo(a), and apoB accumulate in maculas, including drusen, of age-related macular degeneration (AMD) samples and age-matched controls. Lp(a) mice fed a high-fat diet developed age-related changes. However, mutant LBS− Lp(a) mice fed a high-fat diet developed retinal pigment epithelial cell degeneration and drusen. These changes were associated with increased OxPL, decreased antioxidant defenses, increased complement, and decreased complement regulators. Conclusions: Human maculas accumulate Lp(a) and OxPL. Mutant LBS− Lp(a) mice, lacking the ability to bind E06-detectable oxidized phospholipid, develop AMD-like changes. The ability of Lp(a) to bind E06-detectable OxPL may play a protective role in AMD. PMID:26538774
Stanley, Ashley; Yadav, Lumbani; Sudhakar, Akulapalli; Varma, Ashok K.
2010-01-01
Background Weak intermolecular interactions such as hydrogen bonding and hydrophobic interactions are key players in stabilizing energetically-favored ligands, in an open conformational environment of protein structures. However, it is still poorly understood how the binding parameters associated with these interactions facilitate a drug-lead to recognize a specific target and improve drugs efficacy. To understand this, comprehensive analysis of hydrophobic interactions, hydrogen bonding and binding affinity have been analyzed at the interface of c-Src and c-Abl kinases and 4-amino substituted 1H-pyrazolo [3, 4-d] pyrimidine compounds. Methodology In-silico docking studies were performed, using Discovery Studio software modules LigandFit, CDOCKER and ZDOCK, to investigate the role of ligand binding affinity at the hydrophobic pocket of c-Src and c-Abl kinase. Hydrophobic and hydrogen bonding interactions of docked molecules were compared using LigPlot program. Furthermore, 3D-QSAR and MFA calculations were scrutinized to quantify the role of weak interactions in binding affinity and drug efficacy. Conclusions The in-silico method has enabled us to reveal that a multi-targeted small molecule binds with low affinity to its respective targets. But its binding affinity can be altered by integrating the conformationally favored functional groups at the active site of the ligand-target interface. Docking studies of 4-amino-substituted molecules at the bioactive cascade of the c-Src and c-Abl have concluded that 3D structural folding at the protein-ligand groove is also a hallmark for molecular recognition of multi-targeted compounds and for predicting their biological activity. The results presented here demonstrate that hydrogen bonding and optimized hydrophobic interactions both stabilize the ligands at the target site, and help alter binding affinity and drug efficacy. PMID:20808434
Lo, Hsin-Yi; Ho, Tin-Yun; Li, Chia-Cheng; Chen, Jaw-Chyun; Liu, Jau-Jin; Hsiang, Chien-Yun
2014-09-10
Diabetes, a common metabolic disorder, is characterized by hyperglycemia. Insulin is the principal mediator of glucose homeostasis. In a previous study, we identified a trypsin inhibitor, named Momordica charantia insulin receptor (IR)-binding protein (mcIRBP) in this study, that might interact with IR. The physical and functional interactions between mcIRBP and IR were clearly analyzed in the present study. Photo-cross-linking coupled with mass spectrometry showed that three regions (17-21, 34-40, and 59-66 residues) located on mcIRBP physically interacted with leucine-rich repeat domain and cysteine-rich region of IR. IR-binding assay showed that the binding behavior of mcIRBP and insulin displayed a cooperative manner. After binding to IR, mcIRBP activated the kinase activity of IR by (5.87 ± 0.45)-fold, increased the amount of phospho-IR protein by (1.31 ± 0.03)-fold, affected phosphoinositide-3-kinase/Akt pathways, and consequently stimulated the uptake of glucose in 3T3-L1 cells by (1.36 ± 0.12)-fold. Intraperitoneal injection of 2.5 nmol/kg mcIRBP significantly decreased the blood glucose levels by 20.9 ± 3.2% and 10.8 ± 3.6% in normal and diabetic mice, respectively. Microarray analysis showed that mcIRBP affected genes involved in insulin signaling transduction pathway in mice. In conclusion, our findings suggest that mcIRBP is a novel IRBP that binds to sites different from the insulin-binding sites on IR and stimulates both the glucose uptake in cells and the glucose clearance in mice.
Ultrasensitivity and sharp threshold theorems for multisite systems
NASA Astrophysics Data System (ADS)
Dougoud, M.; Mazza, C.; Vinckenbosch, L.
2017-02-01
This work studies the ultrasensitivity of multisite binding processes where ligand molecules can bind to several binding sites. It considers more particularly recent models involving complex chemical reactions in allosteric phosphorylation processes and for transcription factors and nucleosomes competing for binding on DNA. New statistics-based formulas for the Hill coefficient and the effective Hill coefficient are provided and necessary conditions for a system to be ultrasensitive are exhibited. It is first shown that the ultrasensitivity of binding processes can be approached using sharp-threshold theorems which have been developed in applied probability theory and statistical mechanics for studying sharp threshold phenomena in reliability theory, random graph theory and percolation theory. Special classes of binding process are then introduced and are described as density dependent birth and death process. New precise large deviation results for the steady state distribution of the process are obtained, which permits to show that switch-like ultrasensitive responses are strongly related to the multi-modality of the steady state distribution. Ultrasensitivity occurs if and only if the entropy of the dynamical system has more than one global minimum for some critical ligand concentration. In this case, the Hill coefficient is proportional to the number of binding sites, and the system is highly ultrasensitive. The classical effective Hill coefficient I is extended to a new cooperativity index I q , for which we recommend the computation of a broad range of values of q instead of just the standard one I = I 0.9 corresponding to the 10%-90% variation in the dose-response. It is shown that this single choice can sometimes mislead the conclusion by not detecting ultrasensitivity. This new approach allows a better understanding of multisite ultrasensitive systems and provides new tools for the design of such systems.
Lejal, Nathalie; Tarus, Bogdan; Bouguyon, Edwige; Chenavas, Sylvie; Bertho, Nicolas; Delmas, Bernard; Ruigrok, Rob W. H.; Di Primo, Carmelo
2013-01-01
The nucleoprotein (NP) binds the viral RNA genome and associates with the polymerase in a ribonucleoprotein complex (RNP) required for transcription and replication of influenza A virus. NP has no cellular counterpart, and the NP sequence is highly conserved, which led to considering NP a hot target in the search for antivirals. We report here that monomeric nucleoprotein can be inhibited by a small molecule binding in its RNA binding groove, resulting in a novel antiviral against influenza A virus. We identified naproxen, an anti-inflammatory drug that targeted the nucleoprotein to inhibit NP-RNA association required for NP function, by virtual screening. Further docking and molecular dynamics (MD) simulations identified in the RNA groove two NP-naproxen complexes of similar levels of interaction energy. The predicted naproxen binding sites were tested using the Y148A, R152A, R355A, and R361A proteins carrying single-point mutations. Surface plasmon resonance, fluorescence, and other in vitro experiments supported the notion that naproxen binds at a site identified by MD simulations and showed that naproxen competed with RNA binding to wild-type (WT) NP and protected active monomers of the nucleoprotein against proteolytic cleavage. Naproxen protected Madin-Darby canine kidney (MDCK) cells against viral challenges with the H1N1 and H3N2 viral strains and was much more effective than other cyclooxygenase inhibitors in decreasing viral titers of MDCK cells. In a mouse model of intranasal infection, naproxen treatment decreased the viral titers in mice lungs. In conclusion, naproxen is a promising lead compound for novel antivirals against influenza A virus that targets the nucleoprotein in its RNA binding groove. PMID:23459490
Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.
Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M
2007-05-01
The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu
2012-02-05
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S.
2012-05-24
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Location of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.
Locations of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.
Discovering amino acid patterns on binding sites in protein complexes
Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng
2011-01-01
Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838
Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P
2005-04-01
Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
2013-01-01
Background Herpes viruses are important human pathogens that can cause mild to severe lifelong infections with high morbidity. They remain latent in the host cells and can cause recurrent infections that might prove fatal. These viruses are known to infect the host cells by causing the fusion of viral and host cell membrane proteins. Fusion is achieved with the help of conserved fusion machinery components, glycoproteins gB, heterodimer gH-gL complex along with other non-conserved components. Whereas, another important glycoprotein gD without which viral entry to the cell is not possible, acts as a co-activator for the gB-gH-gL complex formation. Thus, this complex formation interface is the most promising drug target for the development of novel anti-herpes drug candidates. In the present study, we propose a model for binding of gH-gL to gB glycoprotein leading from pre to post conformational changes during gB-gH-gL complex formation and reported the key residues involved in this binding activity along with possible binding site locations. To validate the drug targetability of our proposed binding site, we have repositioned some of the most promising in vitro, in vivo validated anti-herpes molecules onto the proposed binding site of gH-gL complex in a computational approach. Methods Hex 6.3 standalone software was used for protein-protein docking studies. Arguslab 4.0.1 and Accelrys® Discovery Studio 3.1 Visualizer softwares were used for semi-flexible docking studies and visualizing the interactions respectively. Protein receptors and ethno compounds were retrieved from Protein Data Bank (PDB) and Pubchem databases respectively. Lipinski’s Filter, Osiris Property Explorer and Lazar online servers were used to check the pharmaceutical fidelity of the drug candidates. Results Through protein-protein docking studies, it was identified that the amino acid residues VAL342, GLU347, SER349, TYR355, SER388, ASN395, HIS398 and ALA387 of gH-gL complex play an active role in its binding activity with gB. Semi flexible docking analysis of the most promising in vitro, in vivo validated anti-herpes molecules targeting the above mentioned key residues of gH-gL complex showed that all the analyzed ethno medicinal compounds have successfully docked into the proposed binding site of gH-gL glycoprotein with binding energy range between -10.4 to -6.4 K.cal./mol. Conclusions Successful repositioning of the analyzed compounds onto the proposed binding site confirms the drug targetability of gH-gL complex. Based on the free binding energy and pharmacological properties, we propose (3-chloro phenyl) methyl-3,4,5 trihydroxybenzoate as worth a small ethno medicinal lead molecule for further development as potent anti-herpes drug candidate targeting gB-gH-gL complex formation interface. PMID:23587166
Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa
2013-01-01
Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin
Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.
2011-01-01
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.
Dubois, B W; Cherian, S F; Evers, A S
1993-01-01
There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biegon, A.; Rainbow, T.C.
1983-05-01
The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less
Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael
2017-01-01
The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023
Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
NASA Astrophysics Data System (ADS)
Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír
2017-01-01
Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.
STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY
Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.
2008-01-01
The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867
Dschietzig, Thomas; Bartsch, Cornelia; Wessler, Silja; Baumann, Gert; Stangl, Karl
2009-06-05
Relaxin peptides act in brain, reproductive and cardiovascular systems, kidneys, and connective tissue through different G protein-coupled receptors. We reported that human relaxin-2 and porcine relaxin are both agonists at the human glucocorticoid receptor (GR). Here, we investigated the possible auto-regulation of relaxin-2 gene expression via recently discovered GR-binding sites in the relaxin-2 promoter. We found that porcine relaxin increased the secretion of human relaxin-like immunoreactivity in HeLa and THP-1 cells. Silencing of GR gene expression completely abolished this effect whereas transfection of wild-type GR into naturally GR-devoid HT-29 cells established relaxin sensitivity. Relaxin was shown to stimulate CAT expression driven by different deletion constructs of the 5'-flanking region of the relaxin-2 promoter. In chromatin immunoprecipitation assays, we detected both GR and relaxin binding to the relaxin-2 promoter. Gel shift assays indicated binding of relaxin-activated GR to half-GREs located between 160 and 200 bp upstream of transcription start but not to the GRE at -900 bp. Relaxin bound to human GR and displaced established GR agonists. Immunofluorescence experiments visualized nuclear co-localization of relaxin and GR in response to relaxin. In conclusion, we have identified a positive auto-regulatory loop of human relaxin-2 expression which involves GR and relaxin/GR binding to half-GREs in the relaxin-2 promoter.
Ebselen: Mechanisms of Glutamate Dehydrogenase and Glutaminase Enzyme Inhibition.
Yu, Yan; Jin, Yanhong; Zhou, Jie; Ruan, Haoqiang; Zhao, Han; Lu, Shiying; Zhang, Yue; Li, Di; Ji, Xiaoyun; Ruan, Benfang Helen
2017-12-15
Ebselen modulates target proteins through redox reactions with selenocysteine/cysteine residues, or through binding to the zinc finger domains. However, a recent contradiction in ebselen inhibition of kidney type glutaminase (KGA) stimulated our interest in investigating its inhibition mechanism with glutamate dehydrogenase (GDH), KGA, thioredoxin reductase (TrxR), and glutathione S-transferase. Fluorescein- or biotin-labeled ebselen derivatives were synthesized for mechanistic analyses. Biomolecular interaction analyses showed that only GDH, KGA, and TrxR proteins can bind to the ebselen derivative, and the binding to GDH and KGA could be competed off by glutamine or glutamate. From the gel shift assays, the fluorescein-labeled ebselen derivative could co-migrate with hexameric GDH and monomeric/dimeric TrxR in a dose-dependent manner; it also co-migrated with KGA but disrupted the tetrameric form of the KGA enzyme at a high compound concentration. Further proteomic analysis demonstrated that the ebselen derivative could cross-link with proteins through a specific cysteine at the active site of GDH and TrxR proteins, but for KGA protein, the binding site is at the N-terminal appendix domain outside of the catalytic domain, which might explain why ebselen is not a potent KGA enzyme inhibitor in functional assays. In conclusion, ebselen could inhibit enzyme activity by binding to the catalytic domain or disruption of the protein complex. In addition, ebselen is a relatively potent selective GDH inhibitor that might provide potential therapeutic opportunities for hyperinsulinism-hyperammonemia syndrome patients who have the mutational loss of GTP inhibition.
Predicting a small molecule-kinase interaction map: A machine learning approach
2011-01-01
Background We present a machine learning approach to the problem of protein ligand interaction prediction. We focus on a set of binding data obtained from 113 different protein kinases and 20 inhibitors. It was attained through ATP site-dependent binding competition assays and constitutes the first available dataset of this kind. We extract information about the investigated molecules from various data sources to obtain an informative set of features. Results A Support Vector Machine (SVM) as well as a decision tree algorithm (C5/See5) is used to learn models based on the available features which in turn can be used for the classification of new kinase-inhibitor pair test instances. We evaluate our approach using different feature sets and parameter settings for the employed classifiers. Moreover, the paper introduces a new way of evaluating predictions in such a setting, where different amounts of information about the binding partners can be assumed to be available for training. Results on an external test set are also provided. Conclusions In most of the cases, the presented approach clearly outperforms the baseline methods used for comparison. Experimental results indicate that the applied machine learning methods are able to detect a signal in the data and predict binding affinity to some extent. For SVMs, the binding prediction can be improved significantly by using features that describe the active site of a kinase. For C5, besides diversity in the feature set, alignment scores of conserved regions turned out to be very useful. PMID:21708012
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palacios, J.M.; Chinaglia, G.; Rigo, M.
1991-02-01
Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less
Prediction of TF target sites based on atomistic models of protein-DNA complexes
Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno
2008-01-01
Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190
Effects of cytosine methylation on transcription factor binding sites
2014-01-01
Background DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important. Results We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines “traffic lights”. We observed a strong selection against CpG “traffic lights” within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions. Conclusions Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. PMID:24669864
n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.
Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu
2014-01-01
We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R
1996-10-11
In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Binding Leverage as a Molecular Basis for Allosteric Regulation
Mitternacht, Simon; Berezovsky, Igor N.
2011-01-01
Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347
Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi
2016-12-15
The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Granoff, Dan M.; Costa, Isabella; Konar, Monica; Giuntini, Serena; Van Rompay, Koen K. A.; Beernink, Peter T.
2015-01-01
Background. The meningococcal vaccine antigen, factor H (FH)–binding protein (FHbp), binds human complement FH. In human FH transgenic mice, binding decreased protective antibody responses. Methods. To investigate the effect of primate FH binding, we immunized rhesus macaques with a 4-component serogroup B vaccine (4CMenB). Serum FH in 6 animals bound strongly to FHbp (FHbp-FHhigh) and, in 6 animals, bound weakly to FHbp (FHbp-FHlow). Results. There were no significant differences between the respective serum bactericidal responses of the 2 groups against meningococcal strains susceptible to antibody to the NadA or PorA vaccine antigens. In contrast, anti-FHbp bactericidal titers were 2-fold lower in FHbp-FHhigh macaques against a strain with an exact FHbp match to the vaccine (P = .08) and were ≥4-fold lower against 4 mutants with other FHbp sequence variants (P ≤ .005, compared with FHbp-FHlow macaques). Unexpectedly, postimmunization sera from all 12 macaques enhanced FH binding to meningococci. In contrast, serum anti-FHbp antibodies elicited by 4CMenB in mice whose mouse FH did not bind to the vaccine antigen inhibited FH binding. Conclusions. Binding of FH to FHbp decreases protective anti-FHbp antibody responses of macaques to 4CMenB. Even low levels of FH binding skew the antibody repertoire to FHbp epitopes outside of the FH-binding site, which enhance FH binding. PMID:25676468
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
NASA Astrophysics Data System (ADS)
Bhakat, Soumendranath; Söderhjelm, Pär
2017-01-01
The funnel metadynamics method enables rigorous calculation of the potential of mean force along an arbitrary binding path and thereby evaluation of the absolute binding free energy. A problem of such physical paths is that the mechanism characterizing the binding process is not always obvious. In particular, it might involve reorganization of the solvent in the binding site, which is not easily captured with a few geometrically defined collective variables that can be used for biasing. In this paper, we propose and test a simple method to resolve this trapped-water problem by dividing the process into an artificial host-desolvation step and an actual binding step. We show that, under certain circumstances, the contribution from the desolvation step can be calculated without introducing further statistical errors. We apply the method to the problem of predicting host-guest binding free energies in the SAMPL5 blind challenge, using two octa-acid hosts and six guest molecules. For one of the hosts, well-converged results are obtained and the prediction of relative binding free energies is the best among all the SAMPL5 submissions. For the other host, which has a narrower binding pocket, the statistical uncertainties are slightly higher; longer simulations would therefore be needed to obtain conclusive results.
Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.
Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F
1986-08-15
The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.
Holewinski, Adam; Sakwa-Novak, Miles A.; Jones, Christopher W.
2015-08-26
Composites of poly(ethylenimine) (PEI) and mesoporous silica are effective, reversible adsorbents for CO 2, both from flue gas and in direct air-capture applications. The morphology of the PEI within the silica can strongly impact the overall carbon capture efficiency and rate of saturation. Here, we directly probe the spatial distribution of the supported polymer through small-angle neutron scattering (SANS). Combined with textural characterization from physisorption analysis, the data indicate that PEI first forms a thin conformal coating on the pore walls, but all additional polymer aggregates into plug(s) that grow along the pore axis. This model is consistent with observedmore » trends in amine-efficiency (CO 2/N binding ratio) and pore size distributions, and points to a trade-off between achieving high chemical accessibility of the amine binding sites, which are inaccessible when they strongly interact with the silica, and high accessibility for mass transport, which can be hampered by diffusion through PEI plugs. In conclusion, we illustrate this design principle by demonstrating higher CO 2 capacity and uptake rate for PEI supported in a hydrophobically modified silica, which exhibits repulsive interactions with the PEI, freeing up binding sites.« less
Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude
2017-10-01
While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
RBind: computational network method to predict RNA binding sites.
Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie
2018-04-26
Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.
Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten
2017-04-01
BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tam, S.W.; Cook, L.
1984-09-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less
Stratmann, Thomas; Madhusudan, S.; Schnetz, Karin
2008-01-01
The yjjQ and bglJ genes encode LuxR-type transcription factors conserved in several enterobacterial species. YjjQ is a potential virulence factor in avian pathogenic Escherichia coli. BglJ counteracts the silencing of the bgl (β-glucoside) operon by H-NS in E. coli K-12. Here we show that yjjQ and bglJ form an operon carried by E. coli K-12, whose expression is repressed by the histone-like nucleoid structuring (H-NS) protein. The LysR-type transcription factor LeuO counteracts this repression. Furthermore, the yjjP gene, encoding a membrane protein of unknown function and located upstream in divergent orientation to the yjjQ-bglJ operon, is likewise repressed by H-NS. Mapping of the promoters as well as the H-NS and LeuO binding sites within the 555-bp intergenic region revealed that H-NS binds to the center of the AT-rich regulatory region and distal to the divergent promoters. LeuO sites map to the center and to positions distal to the yjjQ promoters, while one LeuO binding site overlaps with the divergent yjjP promoter. This latter LeuO site is required for full derepression of the yjjQ promoters. The arrangement of regulatory sites suggests that LeuO restructures the nucleoprotein complex formed by H-NS. Furthermore, the data support the conclusion that LeuO, whose expression is likewise repressed by H-NS and which is a virulence factor in Salmonella enterica, is a master regulator that among other loci, also controls the yjjQ-bglJ operon and thus indirectly the presumptive targets of YjjQ and BglJ. PMID:18055596
Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A
1996-01-04
In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul
2012-01-01
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259
Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U
2014-06-02
The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.
A stochastic context free grammar based framework for analysis of protein sequences
Dyrka, Witold; Nebel, Jean-Christophe
2009-01-01
Background In the last decade, there have been many applications of formal language theory in bioinformatics such as RNA structure prediction and detection of patterns in DNA. However, in the field of proteomics, the size of the protein alphabet and the complexity of relationship between amino acids have mainly limited the application of formal language theory to the production of grammars whose expressive power is not higher than stochastic regular grammars. However, these grammars, like other state of the art methods, cannot cover any higher-order dependencies such as nested and crossing relationships that are common in proteins. In order to overcome some of these limitations, we propose a Stochastic Context Free Grammar based framework for the analysis of protein sequences where grammars are induced using a genetic algorithm. Results This framework was implemented in a system aiming at the production of binding site descriptors. These descriptors not only allow detection of protein regions that are involved in these sites, but also provide insight in their structure. Grammars were induced using quantitative properties of amino acids to deal with the size of the protein alphabet. Moreover, we imposed some structural constraints on grammars to reduce the extent of the rule search space. Finally, grammars based on different properties were combined to convey as much information as possible. Evaluation was performed on sites of various sizes and complexity described either by PROSITE patterns, domain profiles or a set of patterns. Results show the produced binding site descriptors are human-readable and, hence, highlight biologically meaningful features. Moreover, they achieve good accuracy in both annotation and detection. In addition, findings suggest that, unlike current state-of-the-art methods, our system may be particularly suited to deal with patterns shared by non-homologous proteins. Conclusion A new Stochastic Context Free Grammar based framework has been introduced allowing the production of binding site descriptors for analysis of protein sequences. Experiments have shown that not only is this new approach valid, but produces human-readable descriptors for binding sites which have been beyond the capability of current machine learning techniques. PMID:19814800
Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu
2014-01-01
Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422
Lee, Yujean; Kim, Hyori; Chung, Junho
2014-01-01
The N-terminal fragment of prohormone brain natriuretic peptide (NT-proBNP) is a commonly used biomarker for the diagnosis of congestive heart failure, although its biological function is not well known. NT-proBNP exhibits heavy O-linked glycosylation, and it is quite difficult to develop an antibody that exhibits glycosylation-independent binding. We developed an antibody that binds to the recombinant NT-proBNP protein and its deglycosylated form with similar affinities in an enzyme immunoassay. The epitope was defined as Gly63–Lys68 based on mimetic peptide screening, site-directed mutagenesis and a competition assay with a peptide mimotope. The nearest O-glycosylation residues are Thr58 and Thr71; therefore, four amino acid residues intervene between the epitope and those residues in both directions. In conclusion, we report that an antibody reactive to Gly63–Lys68 of NT-proBNP exhibits O-glycosylation-independent binding. PMID:25236766
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less
Warfield, Becka M.
2017-01-01
RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473
Case, S S; Huber, P; Lloyd, J A
1999-11-01
A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.
Exploiting protein flexibility to predict the location of allosteric sites
2012-01-01
Background Allostery is one of the most powerful and common ways of regulation of protein activity. However, for most allosteric proteins identified to date the mechanistic details of allosteric modulation are not yet well understood. Uncovering common mechanistic patterns underlying allostery would allow not only a better academic understanding of the phenomena, but it would also streamline the design of novel therapeutic solutions. This relatively unexplored therapeutic potential and the putative advantages of allosteric drugs over classical active-site inhibitors fuel the attention allosteric-drug research is receiving at present. A first step to harness the regulatory potential and versatility of allosteric sites, in the context of drug-discovery and design, would be to detect or predict their presence and location. In this article, we describe a simple computational approach, based on the effect allosteric ligands exert on protein flexibility upon binding, to predict the existence and position of allosteric sites on a given protein structure. Results By querying the literature and a recently available database of allosteric sites, we gathered 213 allosteric proteins with structural information that we further filtered into a non-redundant set of 91 proteins. We performed normal-mode analysis and observed significant changes in protein flexibility upon allosteric-ligand binding in 70% of the cases. These results agree with the current view that allosteric mechanisms are in many cases governed by changes in protein dynamics caused by ligand binding. Furthermore, we implemented an approach that achieves 65% positive predictive value in identifying allosteric sites within the set of predicted cavities of a protein (stricter parameters set, 0.22 sensitivity), by combining the current analysis on dynamics with previous results on structural conservation of allosteric sites. We also analyzed four biological examples in detail, revealing that this simple coarse-grained methodology is able to capture the effects triggered by allosteric ligands already described in the literature. Conclusions We introduce a simple computational approach to predict the presence and position of allosteric sites in a protein based on the analysis of changes in protein normal modes upon the binding of a coarse-grained ligand at predicted cavities. Its performance has been demonstrated using a newly curated non-redundant set of 91 proteins with reported allosteric properties. The software developed in this work is available upon request from the authors. PMID:23095452
Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A
2013-01-01
Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
Computational Optimization and Characterization of Molecularly Imprinted Polymers
NASA Astrophysics Data System (ADS)
Terracina, Jacob J.
Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.
NASA Astrophysics Data System (ADS)
Poornima, C. S.; Dean, P. M.
1995-12-01
Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sultatos, L.G.; Kaushik, R.
2008-08-01
The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boyd, S.K.
1987-01-01
Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less
Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther
2011-05-01
The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cosman, M; Zeller, L; Lightstone, F C
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Influence of sulfhydryl sites on metal binding by bacteria
NASA Astrophysics Data System (ADS)
Nell, Ryan M.; Fein, Jeremy B.
2017-02-01
The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.
Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.
Liaw, S. H.; Kuo, I.; Eisenberg, D.
1995-01-01
Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen P.
2006-10-17
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen
2000-01-01
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Yuan, Libin; Morales, Carlos R.
2010-01-01
Prosaposin, the precursor of four lysosomal cofactors required for the hydrolysis of sphingolipids, is transported to the lysosomes via the alternative receptor, sortilin. In this study, we identified a specific domain of 17 amino acids within the C terminus of prosaposin involved in binding to this sorting receptor. We generated six prosaposin deletion constructs and examined the effect of truncation by coimmunoprecipitation and confocal microscopy. The experiments revealed that the first half of the prosaposin C terminus (aa 524–540), containing a saposin-like motif, was required and necessary to bind sortilin and to transport it to the lysosomes. Based on this result, we introduced twelve site-directed point mutations within the first half of the C terminus. Although the interaction of prosaposin with sortilin was pH dependent, the mutation of hydrophilic amino acids that usually modulate pH-dependent protein interactions did not affect the binding of prosaposin to sortilin. Conversely, a tryptophan (W530) and two cysteines (C528 and C536) were essential for its interaction with sortilin and for its transport to the lysosomes. In conclusion, our investigation demonstrates that a saposin-like motif within the first half of the prosaposin C terminus contains the sortilin recognition site. (J Histochem Cytochem 58:287–300, 2010) PMID:19934382
Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen
2018-05-05
Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.
Al-Aboudi, Amal; Al-Qawasmeh, Raed A; Shahwan, Alaa; Mahmood, Uzma; Khalid, Asaad; Ul-Haq, Zaheer
2015-01-01
Aim: To investigate the binding mode of synthesized adamantly derivatives inside of cholinesterase enzymes using molecular docking simulations. Methods: A series of hybrid compounds containing adamantane and hydrazide moieties was designed and synthesized. Their inhibitory activities against acetylcholinesterase (AChE) and (butyrylcholinesterase) BChE were assessed in vitro. The binding mode of the compounds inside cholinesterase enzymes was investigated using Surflex-Dock package of Sybyl7.3 software. Results: A total of 26 adamantyl derivatives were synthesized. Among them, adamantane-1-carboxylic acid hydrazide had an almost equal inhibitory activity towards both enzymes, whereas 10 other compounds exhibited moderate inhibitory activity against BChE. The molecular docking studies demonstrated that hydrophobic interactions between the compounds and their surrounding residues in the active site played predominant roles, while hydrophilic interactions were also found. When the compounds were docked inside each enzyme, they exhibited stronger interactions with BChE over AChE, possibly due to the larger active site of BChE. The binding affinities of the compounds for BChE and AChE estimated were in agreement with the experimental data. Conclusion: The new adamantly derivatives selectively inhibit BChE with respect to AChE, thus making them good candidates for testing the hypothesis that BChE inhibitors would be more efficient and better tolerated than AChE inhibitors in the treatment of Alzheimer's disease. PMID:25937631
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirvan, M.H.; Pollard, H.B.; Heldman, E.
Acetylcholine evokes release from cultured bovine chromaffin cells by a mechanism that is believed to be classically nicotinic. However, the authors found that the full muscarinic agonist oxotremorine-M (Oxo-M) induced a robust catecholamine (CA) secretion. By contrast, muscarine, pilocarpine, bethanechol, and McN-A-343 did not elicit any secretory response. Desensitization of the response to nicotine by Oxo-M and desensitization of the response to Oxo-M by nicotine suggest that both nicotine and Oxo-M were acting at the same receptor. Additional experiments supporting this conclusion show that nicotine-induced secretion and Oxo-M-induced secretion were similarly blocked by various muscarinic and nicotinic antagonists. Moreover, secretionmore » induced by nicotine and Oxo-M were Ca{sup 2+} dependent, and both agonists induced {sup 45}Ca{sup 2+} uptake. Equilibrium binding studies showed that ({sup 3}H)Oxo-M bound to chromaffin cell membranes with a K{sub d} value of 3.08 {times} 10{sup {minus}8}M and a Hill coefficient of 1.00, suggesting one binding site for this ligand. Nicotine inhibited Oxo-M binding in a noncompetitive manner, suggesting that both ligands bind at two different sites on the same receptor. They propose that the receptor on bovine chromaffin cells that is coupled to secretion represents an unusual cholinergic receptor that has both nicotinic and muscarinic features.« less
A Single Rainbow Trout Cobalamin-binding Protein Stands in for Three Human Binders
Greibe, Eva; Fedosov, Sergey; Sorensen, Boe S.; Højrup, Peter; Poulsen, Steen S.; Nexo, Ebba
2012-01-01
Cobalamin uptake and transport in mammals are mediated by three cobalamin-binding proteins: haptocorrin, intrinsic factor, and transcobalamin. The nature of cobalamin-binding proteins in lower vertebrates remains to be elucidated. The aim of this study was to characterize the cobalamin-binding proteins of the rainbow trout (Oncorhynchus mykiss) and to compare their properties with those of the three human cobalamin-binding proteins. High cobalamin-binding capacity was found in trout stomach (210 pmol/g), roe (400 pmol/g), roe fluid (390 nmol/liter), and plasma (2500 nmol/liter). In all cases, it appeared to be the same protein based on analysis of partial sequences and immunological responses. The trout cobalamin-binding protein was purified from roe fluid, sequenced, and further characterized. Like haptocorrin, the trout cobalamin-binding protein was stable at low pH and had a high binding affinity for the cobalamin analog cobinamide. Like haptocorrin and transcobalamin, the trout cobalamin-binding protein was present in plasma and recognized ligands with altered nucleotide moiety. Like intrinsic factors, the trout cobalamin-binding protein was present in the stomach and resisted degradation by trypsin and chymotrypsin. It also resembled intrinsic factor in the composition of conserved residues in the primary cobalamin-binding site in the C terminus. The trout cobalamin-binding protein was glycosylated and displayed spectral properties comparable with those of haptocorrin and intrinsic factor. In conclusion, only one soluble cobalamin-binding protein was identified in the rainbow trout, a protein that structurally behaves like an intermediate between the three human cobalamin-binding proteins. PMID:22872637
Acceleration of Binding Site Comparisons by Graph Partitioning.
Krotzky, Timo; Klebe, Gerhard
2015-08-01
The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
McCusker, Kevin P; Klinman, Judith P
2010-04-14
Enzymes that cleave C-H bonds are often found to depend on well-packed hydrophobic cores that influence the distance between the hydrogen donor and acceptor. Residue F159 in taurine alpha-ketoglutarate dioxygenase (TauD) is demonstrated to play an important role in the binding and orientation of its substrate, which undergoes a hydrogen atom transfer to the active site Fe(IV)=O. Mutation of F159 to smaller hydrophobic side chains (L, V, A) leads to substantially reduced rates for substrate binding and for C-H bond cleavage, as well as increased contribution of the chemical step to k(cat) under steady-state turnover conditions. The greater sensitivity of these substrate-dependent processes to mutation at position 159 than observed for the oxygen activation process supports a previous conclusion of modularity of function within the active site of TauD (McCusker, K. P.; Klinman, J. P. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 19791-19795). Extraction of intrinsic deuterium kinetic isotope effects (KIEs) using single turnover transients shows 2- to 4-fold increase in the size of the KIE for F159V in relation to wild-type and F159L. It appears that there is a break in behavior following removal of a single methylene from the side chain of F159L to generate F159V, whereby the protein active site loses its ability to restore the internuclear distance between substrate and Fe(IV)=O that supports optimal hydrogenic wave function overlap.
GenProBiS: web server for mapping of sequence variants to protein binding sites.
Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka
2017-07-03
Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe
2011-01-01
Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967
A peek into tropomyosin binding and unfolding on the actin filament.
Singh, Abhishek; Hitchcock-Degregori, Sarah E
2009-07-24
Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.
sc-PDB: a 3D-database of ligandable binding sites--10 years on.
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ahmed, Ahmed H; Oswald, Robert E
2010-03-11
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.
Ahmed, Ahmed H.; Oswald, Robert E.
2010-01-01
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115
Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.
Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta
2013-07-01
Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.
Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.
Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin
2017-09-14
U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.
Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng
2018-05-10
CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Active Site and Remote Contributions to Catalysis in Methylthioadenosine Nucleosidases
Thomas, Keisha; Cameron, Scott A.; Almo, Steven C.; ...
2015-03-25
5'-Methylthioadenosine/S-adenosyl-l-homocysteine nucleosidases (MTANs) catalyze the hydrolysis of 5'-methylthioadenosine to adenine and 5-methylthioribose. The amino acid sequences of the MTANs from Vibrio cholerae (VcMTAN) and Escherichia coli (EcMTAN) are 60% identical and 75% similar. Protein structure folds and kinetic properties are similar. However, binding of transition-state analogues is dominated by favorable entropy in VcMTAN and by enthalpy in EcMTAN. Catalytic sites of VcMTAN and EcMTAN in contact with reactants differ by two residues; Ala113 and Val153 in VcMTAN are Pro113 and Ile152, respectively, in EcMTAN. Here, we mutated the VcMTAN catalytic site residues to match those of EcMTAN in anticipation ofmore » altering its properties toward EcMTAN. Inhibition of VcMTAN by transition-state analogues required filling both active sites of the homodimer. However, in the Val153Ile mutant or double mutants, transition-state analogue binding at one site caused complete inhibition. Therefore, a single amino acid, Val153, alters the catalytic site cooperativity in VcMTAN. The transition-state analogue affinity and thermodynamics in mutant VcMTAN became even more unlike those of EcMTAN, the opposite of expectations from catalytic site similarity; thus, catalytic site contacts in VcMTAN are unable to recapitulate the properties of EcMTAN. X-ray crystal structures of EcMTAN, VcMTAN, and a multiple-site mutant of VcMTAN most closely resembling EcMTAN in catalytic site contacts show no major protein conformational differences. In conclusion, the overall protein architectures of these closely related proteins are implicated in contributing to the catalytic site differences.« less
Active Site and Remote Contributions to Catalysis in Methylthioadenosine Nucleosidases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thomas, Keisha; Cameron, Scott A.; Almo, Steven C.
5'-Methylthioadenosine/S-adenosyl-l-homocysteine nucleosidases (MTANs) catalyze the hydrolysis of 5'-methylthioadenosine to adenine and 5-methylthioribose. The amino acid sequences of the MTANs from Vibrio cholerae (VcMTAN) and Escherichia coli (EcMTAN) are 60% identical and 75% similar. Protein structure folds and kinetic properties are similar. However, binding of transition-state analogues is dominated by favorable entropy in VcMTAN and by enthalpy in EcMTAN. Catalytic sites of VcMTAN and EcMTAN in contact with reactants differ by two residues; Ala113 and Val153 in VcMTAN are Pro113 and Ile152, respectively, in EcMTAN. Here, we mutated the VcMTAN catalytic site residues to match those of EcMTAN in anticipation ofmore » altering its properties toward EcMTAN. Inhibition of VcMTAN by transition-state analogues required filling both active sites of the homodimer. However, in the Val153Ile mutant or double mutants, transition-state analogue binding at one site caused complete inhibition. Therefore, a single amino acid, Val153, alters the catalytic site cooperativity in VcMTAN. The transition-state analogue affinity and thermodynamics in mutant VcMTAN became even more unlike those of EcMTAN, the opposite of expectations from catalytic site similarity; thus, catalytic site contacts in VcMTAN are unable to recapitulate the properties of EcMTAN. X-ray crystal structures of EcMTAN, VcMTAN, and a multiple-site mutant of VcMTAN most closely resembling EcMTAN in catalytic site contacts show no major protein conformational differences. In conclusion, the overall protein architectures of these closely related proteins are implicated in contributing to the catalytic site differences.« less
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.
Marshall, J C; Shakespear, R A; Odell, W D
1976-11-01
Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less
An alternate binding site for PPARγ ligands
Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2014-01-01
PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew
2015-11-01
Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.
Oligomycin frames a common drug-binding site in the ATP synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less
Nisius, Britta; Gohlke, Holger
2012-09-24
Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.
Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L
2008-12-09
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.
Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.
2009-01-01
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330
Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.
Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael
2013-01-01
Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
[3H]MK-801 binding sites in post-mortem human frontal cortex.
Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P
1989-03-29
The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.
Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J
1999-09-24
We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.
Pauly, Thorsten; Ratliff, Miriam; Pietrowski, Eweline; Neugebauer, Rainer; Schlicksupp, Andrea; Kirsch, Joachim; Kuhse, Jochen
2008-07-16
Functional and structural alterations of clustered postsynaptic ligand gated ion channels in neuronal cells are thought to contribute to synaptic plasticity and memory formation in the human brain. Here, we describe a novel molecular mechanism for structural alterations of NR1 subunits of the NMDA receptor. In cultured rat spinal cord neurons, chronic NMDA receptor stimulation induces disappearance of extracellular epitopes of NMDA receptor NR1 subunits, which was prevented by inhibiting matrix metalloproteinases (MMPs). Immunoblotting revealed the digestion of solubilized NR1 subunits by MMP-3 and identified a fragment of about 60 kDa as MMPs-activity-dependent cleavage product of the NR1 subunit in cultured neurons. The expression of MMP-3 in the spinal cord culture was shown by immunoblotting and immunofluorescence microscopy. Recombinant NR1 glycine binding protein was used to identify MMP-3 cleavage sites within the extracellular S1 and S2-domains. N-terminal sequencing and site-directed mutagenesis revealed S542 and L790 as two putative major MMP-3 cleavage sites of the NR1 subunit. In conclusion, our data indicate that MMPs, and in particular MMP-3, are involved in the activity dependent alteration of NMDA receptor structure at postsynaptic membrane specializations in the CNS.
Pietrowski, Eweline; Neugebauer, Rainer; Schlicksupp, Andrea; Kirsch, Joachim; Kuhse, Jochen
2008-01-01
Functional and structural alterations of clustered postsynaptic ligand gated ion channels in neuronal cells are thought to contribute to synaptic plasticity and memory formation in the human brain. Here, we describe a novel molecular mechanism for structural alterations of NR1 subunits of the NMDA receptor. In cultured rat spinal cord neurons, chronic NMDA receptor stimulation induces disappearance of extracellular epitopes of NMDA receptor NR1 subunits, which was prevented by inhibiting matrix metalloproteinases (MMPs). Immunoblotting revealed the digestion of solubilized NR1 subunits by MMP-3 and identified a fragment of about 60 kDa as MMPs-activity-dependent cleavage product of the NR1 subunit in cultured neurons. The expression of MMP-3 in the spinal cord culture was shown by immunoblotting and immunofluorescence microscopy. Recombinant NR1 glycine binding protein was used to identify MMP-3 cleavage sites within the extracellular S1 and S2-domains. N-terminal sequencing and site-directed mutagenesis revealed S542 and L790 as two putative major MMP-3 cleavage sites of the NR1 subunit. In conclusion, our data indicate that MMPs, and in particular MMP-3, are involved in the activity dependent alteration of NMDA receptor structure at postsynaptic membrane specializations in the CNS. PMID:18629001
Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T
2018-09-01
Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.
Arvizu-Flores, Aldo A.; Sugich-Miranda, Rocio; Arreola, Rodrigo; Garcia-Orozco, Karina D.; Velazquez-Contreras, Enrique F.; Montfort, William R.; Maley, Frank; Sotelo-Mundo, Rogerio R.
2008-01-01
Thymidylate synthase (TS) catalyzes the reductive methylation of deoxyuridine monophosphate (dUMP) using methylene tetrahydrofolate (CH2THF) as cofactor, the glutamate tail of which forms a water-mediated hydrogen-bond with an invariant lysine residue of this enzyme. To understand the role of this interaction, we studied the K48Q mutant of Escherichia coli TS using structural and biophysical methods. The kcat of the K48Q mutant was 430 fold lower than wild-type TS in activity, while the the Km for the (R)-stereoisomer of CH2THF was 300 µM, about 30 fold larger than Km from the wild-type TS. Affinity constants were determined using isothermal titration calorimetry, which showed that binding was reduced by one order of magnitude for folate-like TS inhibitors, such as propargyl-dideaza folate (PDDF) or compounds that distort the TS active site like BW1843U89 (U89). The crystal structure of the K48Q-dUMP complex revealed that dUMP binding is not impaired in the mutamt, and that U89 in a ternary complex of K48Q-nucleotide-U89 was bound in the active site with subtle differences relative to comparable wild type complexes. PDDF failed to form ternary complexes with K48Q and dUMP. Thermodynamic data correlated with the structural determinations, since PDDF binding was dominated by enthalpic effects while U89 had an important entropic component. In conclusion, K48 is critical for catalysis since it leads to a productive CH2THF binding, while mutation at this residue does not affect much the binding of inhibitors that do not make contact with this group. PMID:18403248
Mbanefo, Evaristus Chibunna; Kikuchi, Mihoko; Huy, Nguyen Tien; Shuaibu, Mohammed Nasir; Cherif, Mahamoud Sama; Yu, Chuanxin; Wakao, Masahiro; Suda, Yasuo; Hirayama, Kenji
2014-01-01
Background We previously identified a novel gene family dispersed in the genome of Schistosoma japonicum by retrotransposon-mediated gene duplication mechanism. Although many transcripts were identified, no homolog was readily identifiable from sequence information. Methodology/Principal Findings Here, we utilized structural homology modeling and biochemical methods to identify remote homologs, and characterized the gene products as SEA (sea-urchin sperm protein, enterokinase and agrin)-domain containing proteins. A common extracellular domain in this family was structurally similar to SEA-domain. SEA-domain is primarily a structural domain, known to assist or regulate binding to glycans. Recombinant proteins from three members of this gene family specifically interacted with glycosaminoglycans with high affinity, with potential implication in ligand acquisition and immune evasion. Similar approach was used to identify a heme-binding site on the SEA-domain. The heme-binding mode showed heme molecule inserted into a hydrophobic pocket, with heme iron putatively coordinated to two histidine axial ligands. Heme-binding properties were confirmed using biochemical assays and UV-visible absorption spectroscopy, which showed high affinity heme-binding (K D = 1.605×10−6 M) and cognate spectroscopic attributes of hexa-coordinated heme iron. The native proteins were oligomers, antigenic, and are localized on adult worm teguments and gastrodermis; major host-parasite interfaces and site for heme detoxification and acquisition. Conclusions The results suggest potential role, at least in the nucleation step of heme crystallization (hemozoin formation), and as receptors for heme uptake. Survival strategies exploited by parasites, including heme homeostasis mechanism in hemoparasites, are paramount for successful parasitism. Thus, assessing prospects for application in disease intervention is warranted. PMID:24416467
Daniels, V; Wood, M; Leclercq, K; Kaminski, R M; Gillard, M
2013-01-01
Background and Purpose Synaptic vesicle protein 2A (SV2A) is the specific binding site of the anti-epileptic drug levetiracetam (LEV) and its higher affinity analogue UCB30889. Moreover, the protein has been well validated as a target for anticonvulsant therapy. Here, we report the identification of UCB1244283 acting as a SV2A positive allosteric modulator of UCB30889. Experimental Approach UCB1244283 was characterized in vitro using radioligand binding assays with [3H]UCB30889 on recombinant SV2A expressed in HEK cells and on rat cortex. In vivo, the compound was tested in sound-sensitive mice. Key Results Saturation binding experiments in the presence of UCB1244283 demonstrated a fivefold increase in the affinity of [3H]UCB30889 for human recombinant SV2A, combined with a twofold increase of the total number of binding sites. Similar results were obtained on rat cortex. In competition binding experiments, UCB1244283 potentiated the affinity of UCB30889 while the affinity of LEV remained unchanged. UCB1244283 significantly slowed down both the association and dissociation kinetics of [3H]UCB30889. Following i.c.v. administration in sound-sensitive mice, UCB1244283 showed a clear protective effect against both tonic and clonic convulsions. Conclusions and Implications These results indicate that UCB1244283 can modulate the conformation of SV2A, thereby inducing a higher affinity state for UCB30889. Our results also suggest that the conformation of SV2A per se might be an important determinant of its functioning, especially during epileptic seizures. Therefore, agents that act on the conformation of SV2A might hold great potential in the search for new SV2A-based anticonvulsant therapies. PMID:23530581
Localization of TFIIB binding regions using serial analysis of chromatin occupancy
Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon
2007-01-01
Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-03-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-01-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513
sc-PDB: a 3D-database of ligandable binding sites—10 years on
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483
Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A
2018-05-29
Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.
2008-01-01
The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.
Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry
2014-01-01
We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.
Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando
2018-03-23
The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.
Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay
2018-02-01
Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.
Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M
2011-01-01
Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less
NASA Astrophysics Data System (ADS)
Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh
2017-06-01
In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.
A deep learning framework for modeling structural features of RNA-binding protein targets
Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang
2016-01-01
RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480
Hoffmann, Jana; Altenbuchner, Josef
2015-01-01
A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762
Middendorf, Thomas R.
2017-01-01
A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951
Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.
Mizuno, S; Ogawa, N; Mori, A
1982-12-01
Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.
Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.
Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda
2008-05-01
The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.
Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng
2014-03-01
Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.
Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.
Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry
2006-07-01
High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.
Long non-coding RNA H19 suppresses retinoblastoma progression via counteracting miR-17-92 cluster.
Zhang, Aihui; Shang, Weiwei; Nie, Qiaoli; Li, Ting; Li, Suhui
2018-04-01
Long non-coding RNAs (lncRNAs) are frequently dysregulated and play important roles in many cancers. lncRNA H19 is one of the earliest discovered lncRNAs which has diverse roles in different cancers. However, the expression, roles, and action mechanisms of H19 in retinoblastoma are still largely unknown. In this study, we found that H19 is downregulated in retinoblastoma tissues and cell lines. Gain-of-function and loss-of-function assays showed that H19 inhibits retinoblastoma cell proliferation, induces retinoblastoma cell cycle arrest and cell apoptosis. Mechanistically, we identified seven miR-17-92 cluster binding sites on H19, and found that H19 directly bound to miR-17-92 cluster via these seven binding sites. Through binding to miR-17-92 cluster, H19 relieves the suppressing roles of miR-17-92 cluster on p21. Furthermore, H19 represses STAT3 activation induced by miR-17-92 cluster. Hence, our results revealed that H19 upregulates p21 expression, inhibits STAT3 phosphorylation, and downregulates the expression of STAT3 target genes BCL2, BCL2L1, and BIRC5. In addition, functional assays demonstrated that the mutation of miR-17-92 cluster binding sites on H19 abolished the proliferation inhibiting, cell cycle arrest and cell apoptosis inducing roles of H19 in retinoblastoma. In conclusion, our data suggested that H19 inhibits retinoblastoma progression via counteracting the roles of miR-17-92 cluster, and implied that enhancing the action of H19 may be a promising therapeutic strategy for retinoblastoma. © 2017 Wiley Periodicals, Inc.
Garcia, Fernando; Lopez, Francisco J; Cano, Carlos; Blanco, Armando
2009-01-01
Background Regulatory motifs describe sets of related transcription factor binding sites (TFBSs) and can be represented as position frequency matrices (PFMs). De novo identification of TFBSs is a crucial problem in computational biology which includes the issue of comparing putative motifs with one another and with motifs that are already known. The relative importance of each nucleotide within a given position in the PFMs should be considered in order to compute PFM similarities. Furthermore, biological data are inherently noisy and imprecise. Fuzzy set theory is particularly suitable for modeling imprecise data, whereas fuzzy integrals are highly appropriate for representing the interaction among different information sources. Results We propose FISim, a new similarity measure between PFMs, based on the fuzzy integral of the distance of the nucleotides with respect to the information content of the positions. Unlike existing methods, FISim is designed to consider the higher contribution of better conserved positions to the binding affinity. FISim provides excellent results when dealing with sets of randomly generated motifs, and outperforms the remaining methods when handling real datasets of related motifs. Furthermore, we propose a new cluster methodology based on kernel theory together with FISim to obtain groups of related motifs potentially bound by the same TFs, providing more robust results than existing approaches. Conclusion FISim corrects a design flaw of the most popular methods, whose measures favour similarity of low information content positions. We use our measure to successfully identify motifs that describe binding sites for the same TF and to solve real-life problems. In this study the reliability of fuzzy technology for motif comparison tasks is proven. PMID:19615102
Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-01-01
The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860
Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard
2017-07-05
Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.
Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.
Streiff, John H; Jones, Keith A
2008-10-01
The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
Analysis of functional importance of binding sites in the Drosophila gap gene network model.
Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria
2015-01-01
The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.
Dudev, Todor; Chang, Li-Ying; Lim, Carmay
2005-03-23
Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.
Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M
2005-04-19
The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.
Identification of an Inhibitory Alcohol Binding Site in GABAA ρ1 Receptors
Borghese, Cecilia M.; Ruiz, Carlos I.; Lee, Ui S.; Cullins, Madeline A.; Bertaccini, Edward J.; Trudell, James R.; Harris, R. Adron
2016-01-01
Alcohols inhibit γ-aminobutyric acid type A ρ1 receptor function. After introducing mutations in several positions of the second transmembrane helix in ρ1, we studied the effects of ethanol and hexanol on GABA responses using two-electrode voltage clamp electrophysiology in Xenopus laevis oocytes. The 6′ mutations produced the following effects on ethanol and hexanol responses: small increase or no change (T6′M), increased inhibition (T6′V) and small potentiation (T6′Y and T6′F). The 5′ mutations produced mainly increases in hexanol inhibition. Other mutations produced small (3′ and 9′) or no changes (2′ and L277 in the first transmembrane domain) in alcohol effects. These results suggest an inhibitory alcohol binding site near the 6′ position. Homology models of ρ1 receptors based on the X-ray structure of GluCl showed that the 2′, 5′, 6’ and 9′ residues were easily accessible from the ion pore, with 5′ and 6′ residues from neighboring subunits facing each other; L3′ and L277 also faced the neighboring subunit. We tested ethanol through octanol on single and double mutated ρ1 receptors [ρ1(I15′S), ρ1(T6′Y) and ρ1(T6′Y,I15′S)] to further characterize the inhibitory alcohol pocket in the wild-type ρ1 receptor. The pocket can only bind relatively short-chain alcohols and is eliminated by introducing Y in the 6’ position. Replacing the bulky 15′ residue with a smaller side chain introduced a potentiating binding site, more sensitive to long-chain than to short-chain alcohols. In conclusion, the net alcohol effect on the ρ1 receptor is determined by the sum of its actions on inhibitory and potentiating sites. PMID:26571107
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
McInnes, C; Hoyt, D W; Harkins, R N; Pagila, R N; Debanne, M T; O'Connor-McCourt, M; Sykes, B D
1996-12-13
The study of human transforming growth factor-alpha (TGF-alpha) in complex with the epidermal growth factor (EGF) receptor extracellular domain has been undertaken in order to generate information on the interactions of these molecules. Analysis of 1H NMR transferred nuclear Overhauser enhancement data for titration of the ligand with the receptor has yielded specific data on the residues of the growth factor involved in contact with the larger protein. Significant increases and decreases in nuclear Overhauser enhancement cross-peak intensity occur upon complexation, and interpretation of these changes indicates that residues of the A- and C-loops of TGF-alpha form the major binding interface, while the B-loop provides a structural scaffold for this site. These results corroborate the conclusions from NMR relaxation studies (Hoyt, D. W., Harkins, R. N., Debanne, M. T., O'Connor-McCourt, M., and Sykes, B. D. (1994) Biochemistry 33, 15283-15292), which suggest that the C-terminal residues of the polypeptide are immobilized upon receptor binding, while the N terminus of the molecule retains considerable flexibility, and are consistent with structure-function studies of the TGF-alpha/EGF system indicating a multidomain binding model. These results give a visualization, for the first time, of native TGF-alpha in complex with the EGF receptor and generate a picture of the ligand-binding site based upon the intact molecule. This will undoubtedly be of utility in the structure-based design of TGF-alpha/EGF agonists and/or antagonists.
The binding of analogs of porphyrins and chlorins with elongated side chains to albumin
Ben Dror, Shimshon; Bronshtein, Irena; Weitman, Hana; Smith, Kevin M.; O’Neal, William G.; Jacobi, Peter A.; Ehrenberg, Benjamin
2012-01-01
In previous studies, we demonstrated that elongation of side chains of several sensitizers endowed them with higher affinity for artificial and natural membranes and caused their deeper localization in membranes. In the present study, we employed eight hematoporphyrin and protoporphyrin analogs and four groups containing three chlorin analogs each, all synthesized with variable numbers of methylenes in their alkyl carboxylic chains. We show that these tetrapyrroles’ affinity for bovine serum albumin (BSA) and their localization in the binding site are also modulated by chain lengths. The binding constants of the hematoporphyrins and protoporphyrins to BSA increased as the number of methylenes was increased. The binding of the chlorins depended on the substitution at the meso position opposite to the chains. The quenching of the sensitizers’ florescence by external iodide ions decreased as the side chains became longer, indicating to deeper insertion of the molecules into the BSA binding pocket. To corroborate this conclusion, we studied the efficiency of photodamage caused to tryptophan in BSA upon illumination of the bound sensitizers. The efficiency was found to depend on the side-chain lengths of the photosensitizer. We conclude that the protein site that hosts these sensitizers accommodates different analogs at positions that differ slightly from each other. These differences are manifested in the ease of access of iodide from the external aqueous phase, and in the proximity of the photosensitizers to the tryptophan. In the course of this study, we developed the kinetic equations that have to be employed when the sensitizer itself is being destroyed. PMID:19330323
Homing peptide guiding optical molecular imaging for the diagnosis of bladder cancer
NASA Astrophysics Data System (ADS)
Yang, Xiao-feng; Pang, Jian-zhi; Liu, Jie-hao; Zhao, Yang; Jia, Xing-you; Li, Jun; Liu, Reng-xin; Wang, Wei; Fan, Zhen-wei; Zhang, Zi-qiang; Yan, San-hua; Luo, Jun-qian; Zhang, Xiao-lei
2014-11-01
Background: The limitations of primary transurethral resection of bladder tumor (TURBt) have led the residual tumors rates as high as 75%. The intraoperative fluorescence imaging offers a great potential for improving TURBt have been confirmed. So we aim to distinguish the residual tumors and normal mucosa using fluorescence molecular imaging formed by conjugated molecule of the CSNRDARRC bladder cancer homing peptide with fluorescent dye. The conjugated molecule was abbreviated FIuo-ACP. In our study, we will research the image features of FIuo-ACP probe targeted bladder cancer for fluorescence molecular imaging diagnosis for bladder cancer in vivo and ex vivo. Methods: After the FIuo-ACP probe was synthetized, the binding sites, factors affecting binding rates, the specificity and the targeting of Fluo-ACP labeled with bladder cancer cells were studied respectively by laser scanning confocal microscope (LSCM), immunofluorescence and multispectral fluorescence ex vivo optical molecular imaging system. Results: The binding sites were located in nucleus and the binding rates were correlated linearly with the dose of probe and the grade of pathology. Moreover, the probe has a binding specificity with bladder cancer in vivo and ex vivo. Tumor cells being labeled by the Fluo-ACP, bright green spots were observed under LSCM. The tissue samples and tumor cells can be labeled and identified by fluorescence microscope. Optical molecular imaging of xenograft tumor tissues was exhibited as fluorescent spots under EMCCD. Conclusion: The CSNRDARRC peptides might be a useful bladder cancer targeting vector. The FIuo-ACP molecular probe was suitable for fluorescence molecular imaging diagnosis for bladder cancer in vivo and ex vivo.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giannopoulos, G.; Jackson, K.; Kredentser, J.
The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less
Thyroid hormones upregulate apolipoprotein E gene expression in astrocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roman, Corina; Fuior, Elena V.; Trusca, Violeta G.
Apolipoprotein E (apoE), a protein mainly involved in lipid metabolism, is associated with several neurodegenerative disorders including Alzheimer's disease. Despite numerous attempts to elucidate apoE gene regulation in the brain, the exact mechanism is still uncovered. The mechanism of apoE gene regulation in the brain involves the proximal promoter and multienhancers ME.1 and ME.2, which evolved by gene duplication. Herein we questioned whether thyroid hormones and their nuclear receptors have a role in apoE gene regulation in astrocytes. Our data showed that thyroid hormones increase apoE gene expression in HTB14 astrocytes in a dose-dependent manner. This effect can be intermediatedmore » by the thyroid receptor β (TRβ) which is expressed in these cells. In the presence of triiodothyronine (T3) and 9-cis retinoic acid, in astrocytes transfected to overexpress TRβ and retinoid X receptor α (RXRα), apoE promoter was indirectly activated through the interaction with ME.2. To determine the location of TRβ/RXRα binding site on ME.2, we performed DNA pull down assays and found that TRβ/RXRα complex bound to the region 341–488 of ME.2. This result was confirmed by transient transfection experiments in which a series of 5′- and 3′-deletion mutants of ME.2 were used. These data support the existence of a biologically active TRβ binding site starting at 409 in ME.2. In conclusion, our data revealed that ligand-activated TRβ/RXRα heterodimers bind with high efficiency on tissue-specific distal regulatory element ME.2 and thus modulate apoE gene expression in the brain. - Highlights: • T3 induce a dose-dependent increase of apoE expression in astrocytes. • Thyroid hormones activate apoE promoter in a cell specific manner. • Ligand activated TRβ/RXRα bind on the distal regulatory element ME.2 to modulate apoE. • The binding site of TRβ/RXRα heterodimer is located at 409 bp on ME.2.« less
Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.
Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain
2014-11-18
Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.
Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies
NASA Astrophysics Data System (ADS)
Pang, Yuan-Ping; Kozikowski, Alan P.
1994-12-01
We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.
The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less
Energetics and kinetics of cooperative cofilin-actin filament interactions.
Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M
2006-08-11
We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.
Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.
2008-08-19
Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less
Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC
Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei
2010-01-01
Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424
2010-01-01
Background Variola virus (VARV) the causative agent of smallpox, eradicated in 1980, have wide spectrum of immunomodulatory proteins to evade host immunity. Recently additional biological activity was discovered for VARV CrmB protein, known to bind and inhibit tumour necrosis factor (TNF) through its N-terminal domain homologous to cellular TNF receptors. Besides binding TNF, this protein was also shown to bind with high affinity several chemokines which recruit B- and T-lymphocytes and dendritic cells to sites of viral entry and replication. Ability to bind chemokines was shown to be associated with unique C-terminal domain of CrmB protein. This domain named SECRET (Smallpox virus-Encoded Chemokine Receptor) is unrelated to the host proteins and lacks significant homology with other known viral chemokine-binding proteins or any other known protein. Findings De novo modelling of VARV-CrmB SECRET domain spatial structure revealed its apparent structural homology with cowpox virus CC-chemokine binding protein (vCCI) and vaccinia virus A41 protein, despite low sequence identity between these three proteins. Potential ligand-binding surface of modelled VARV-CrmB SECRET domain was also predicted to bear prominent electronegative charge which is characteristic to known orthopoxviral chemokine-binding proteins. Conclusions Our results suggest that SECRET should be included into the family of poxviral type II chemokine-binding proteins and that it might have been evolved from the vCCI-like predecessor protein. PMID:20979600
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trong, I.Le; Stenkamp, R.E.; Ibarra, C.
2005-08-22
Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less
Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing
Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav
2007-01-01
In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418
Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.
Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F
1994-10-27
Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.
Anisotropic energy flow and allosteric ligand binding in albumin
NASA Astrophysics Data System (ADS)
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin.
Li, Guifeng; Magana, Donny; Dyer, R Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265
Msn2 Coordinates a Stoichiometric Gene Expression Program
Stewart-Ornstein, Jacob; Nelson, Christopher; DeRisi, Joe; Weissman, Jonathan S.; El-Samad, Hana
2014-01-01
Summary Background Many cellular processes operate in an “analog” regime in which the magnitude of the response is precisely tailored to the intensity of the stimulus. In order to maintain the coherence of such responses, the cell must provide for proportional expression of multiple target genes across a wide dynamic range of induction states. Our understanding of the strategies used to achieve graded gene regulation is limited. Results In this work, we document a relationship between stress responsive gene expression and the transcription factor Msn2 that is graded over a large range of Msn2 cocnentrations. We use computational modeling, in vivo, and in vitro analysis to dissect the roots of this relationship. Our studies reveal a simple and general strategy based on non-cooperative low-affinity interactions between Msn2 and its cognate binding sites, as well as competition over a large number of Msn2 binding sites in the genome relative to the number of Msn2 molecules. Conclusions In addition to enabling precise tuning of gene expression to the state of the environment, this strategy ensures co-linear activation of target genes, allowing for stoichiometric expression of large groups of genes without extensive promoter tuning. Furthermore, such a strategy enables precise modulation of the activity of any given promoter by addition of binding sites without altering the qualitative relationship between different genes in a regulon. This feature renders a given regulon highly ‘evolvable’. PMID:24210615
Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.
2012-01-01
An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049
Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E
2017-01-01
Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.
Hossain, Maidul; Haq, Lucy; Suresh Kumar, Gopinatha
2012-01-01
Background Binding of two 9-O-(ω-amino) alkyl ether berberine analogs BC1 and BC2 to the RNA triplex poly(U)•poly(A)*poly(U) was studied by various biophysical techniques. Methodology/Principal Findings Berberine analogs bind to the RNA triplex non-cooperatively. The affinity of binding was remarkably high by about 5 and 15 times, respectively, for BC1 and BC2 compared to berberine. The site size for the binding was around 4.3 for all. Based on ferrocyanide quenching, fluorescence polarization, quantum yield values and viscosity results a strong intercalative binding of BC1 and BC2 to the RNA triplex has been demonstrated. BC1 and BC2 stabilized the Hoogsteen base paired third strand by about 18.1 and 20.5°C compared to a 17.5°C stabilization by berberine. The binding was entropy driven compared to the enthalpy driven binding of berbeine, most likely due to additional contacts within the grooves of the triplex and disruption of the water structure by the alkyl side chain. Conclusions/Significance Remarkably higher binding affinity and stabilization effect of the RNA triplex by the amino alkyl berberine analogs was achieved compared to berberine. The length of the alkyl side chain influence in the triplex stabilization phenomena. PMID:22666416
Morley, B J; Garner, L L
1990-06-11
Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.
NASA Astrophysics Data System (ADS)
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.
Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose
Jalak, Jürgen; Väljamäe, Priit
2014-01-01
Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511
Gibbons, R. J.; Moreno, E. C.; Etherden, I.
1983-01-01
The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416
DOE Office of Scientific and Technical Information (OSTI.GOV)
Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.
1990-01-01
Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less
The Structural Basis of ATP as an Allosteric Modulator
Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian
2014-01-01
Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773
Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy
Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming
2014-01-01
A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.
Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E
2018-02-01
Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.
Elimination of a ligand gating site generates a supersensitive olfactory receptor.
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I
2016-06-21
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.
Elimination of a ligand gating site generates a supersensitive olfactory receptor
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.
2016-01-01
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less
Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart
1999-01-01
Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456
Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants
Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander
2013-01-01
Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254
The Innate Immune Database (IIDB)
Korb, Martin; Rust, Aistair G; Thorsson, Vesteinn; Battail, Christophe; Li, Bin; Hwang, Daehee; Kennedy, Kathleen A; Roach, Jared C; Rosenberger, Carrie M; Gilchrist, Mark; Zak, Daniel; Johnson, Carrie; Marzolf, Bruz; Aderem, Alan; Shmulevich, Ilya; Bolouri, Hamid
2008-01-01
Background As part of a National Institute of Allergy and Infectious Diseases funded collaborative project, we have performed over 150 microarray experiments measuring the response of C57/BL6 mouse bone marrow macrophages to toll-like receptor stimuli. These microarray expression profiles are available freely from our project web site . Here, we report the development of a database of computationally predicted transcription factor binding sites and related genomic features for a set of over 2000 murine immune genes of interest. Our database, which includes microarray co-expression clusters and a host of web-based query, analysis and visualization facilities, is available freely via the internet. It provides a broad resource to the research community, and a stepping stone towards the delineation of the network of transcriptional regulatory interactions underlying the integrated response of macrophages to pathogens. Description We constructed a database indexed on genes and annotations of the immediate surrounding genomic regions. To facilitate both gene-specific and systems biology oriented research, our database provides the means to analyze individual genes or an entire genomic locus. Although our focus to-date has been on mammalian toll-like receptor signaling pathways, our database structure is not limited to this subject, and is intended to be broadly applicable to immunology. By focusing on selected immune-active genes, we were able to perform computationally intensive expression and sequence analyses that would currently be prohibitive if applied to the entire genome. Using six complementary computational algorithms and methodologies, we identified transcription factor binding sites based on the Position Weight Matrices available in TRANSFAC. For one example transcription factor (ATF3) for which experimental data is available, over 50% of our predicted binding sites coincide with genome-wide chromatin immnuopreciptation (ChIP-chip) results. Our database can be interrogated via a web interface. Genomic annotations and binding site predictions can be automatically viewed with a customized version of the Argo genome browser. Conclusion We present the Innate Immune Database (IIDB) as a community resource for immunologists interested in gene regulatory systems underlying innate responses to pathogens. The database website can be freely accessed at . PMID:18321385
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.
1988-05-01
Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less
Purification of L-( sup 3 H) Nicotine eliminates low affinity binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romm, E.; Marks, M.J.; Collins, A.C.
1990-01-01
Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
Biophysical Fitness Landscapes for Transcription Factor Binding Sites
Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.
2014-01-01
Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228
Yokoyama, Ken Daigoro; Pollock, David D
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
Nucleotide-dependent bisANS binding to tubulin.
Chakraborty, S; Sarkar, N; Bhattacharyya, B
1999-07-13
Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldman, M.E.; Mallorga, P.; Pettibone, D.J.
1988-01-01
(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less
Impact of disruption of secondary binding site S2 on dopamine transporter function.
Zhen, Juan; Reith, Maarten E A
2016-09-01
The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.
Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis
2011-11-14
The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.
Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter
2001-01-01
Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nye, J.S.
The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less
The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.
positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP
Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas
2010-01-01
Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca
2011-01-01
The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714
Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis
2017-03-16
Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gundlach, A.L.; Largent, B.L.; Snyder, S.H.
1986-06-01
(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less
DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P
2008-06-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.
Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.
Salter, Jason D; Smith, Harold C
2018-05-23
The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Role of Dlx6 in regulation of an endothelin-1-dependent, dHAND branchial arch enhancer
Charité, Jeroen; McFadden, David G.; Merlo, Giorgio; Levi, Giovanni; Clouthier, David E.; Yanagisawa, Masashi; Richardson, James A.; Olson, Eric N.
2001-01-01
Neural crest cells play a key role in craniofacial development. The endothelin family of secreted polypeptides regulates development of several neural crest sublineages, including the branchial arch neural crest. The basic helix–loop–helix transcription factor dHAND is also required for craniofacial development, and in endothelin-1 (ET-1) mutant embryos, dHAND expression in the branchial arches is down-regulated, implicating it as a transcriptional effector of ET-1 action. To determine the mechanism that links ET-1 signaling to dHAND transcription, we analyzed the dHAND gene for cis-regulatory elements that control transcription in the branchial arches. We describe an evolutionarily conserved dHAND enhancer that requires ET-1 signaling for activity. This enhancer contains four homeodomain binding sites that are required for branchial arch expression. By comparing protein binding to these sites in branchial arch extracts from endothelin receptor A (EdnrA) mutant and wild-type mouse embryos, we identified Dlx6, a member of the Distal-less family of homeodomain proteins, as an ET-1-dependent binding factor. Consistent with this conclusion, Dlx6 was down-regulated in branchial arches from EdnrA mutant mice. These results suggest that Dlx6 acts as an intermediary between ET-1 signaling and dHAND transcription during craniofacial morphogenesis. PMID:11711438
Darnell, James E.
2013-01-01
Several strong conclusions emerge concerning pre-mRNA processing from both old and newer experiments. The RNAPII complex is involved with pre-mRNA processing through binding of processing proteins to the CTD (carboxyl terminal domain) of the largest RNAPII subunit. These interactions are necessary for efficient processing, but whether factor binding to the CTD and delivery to splicing sites is obligatory or facilitatory is unsettled. Capping, addition of an m7Gppp residue (cap) to the initial transcribed residue of a pre-mRNA, occurs within seconds. Splicing of pre-mRNA by spliceosomes at particular sites is most likely committed during transcription by the binding of initiating processing factors and ∼50% of the time is completed in mammalian cells before completion of the primary transcript. This fact has led to an outpouring in the literature about “cotranscriptional splicing.” However splicing requires several minutes for completion and can take longer. The RNAPII complex moves through very long introns and also through regions dense with alternating exons and introns at an average rate of ∼3 kb per min and is, therefore, not likely detained at each splice site for more than a few seconds, if at all. Cleavage of the primary transcript at the 3′ end and polyadenylation occurs within 30 sec or less at recognized polyA sites, and the majority of newly polyadenylated pre-mRNA molecules are much larger than the average mRNA. Finally, it seems quite likely that the nascent RNA most often remains associated with the chromosomal locus being transcribed until processing is complete, possibly acquiring factors related to the transport of the new mRNA to the cytoplasm. PMID:23440351
Jananie, R. K.; Priya, V.; Vijayalakshmi, K.
2012-01-01
Objectives: To study the ability of the secondary metabolites of Cynodon dactylon to serve as an antagonist to angiotensin II type 1 receptor (AT1); activation of this receptor plays a vital role in diabetic retinopathy (DR). Materials and Methods: In silico methods are mainly harnessed to reduce time, cost and risk associated with drug discovery. Twenty-four compounds were identified as the secondary metabolites of hydroalcoholic extract of C. dactylon using the GCMS technique. These were considered as the ligands or inhibitors that would serve as an antagonist to the AT1. The ACD/Chemsketch tool was used to generate 3D structures of the ligands. A molecular file format converter tool was used to convert the generated data to the PDB format (Protein Data Bank) and was used for docking studies. The AT1 structure was retrieved from the Swissprot data base and PDB and visualized using the Rasmol tool. Domain analysis was carried from the Pfam data base; following this, the active site of the target protein was identified using a Q-site finder tool. The ability of the ligands to bind with the active site of AT1 was studied using the Autodocking tool. The docking results were analyzed using the WebLab viewer tool. Results: Sixteen ligands showed effective binding with the target protein; diazoprogesteron, didodecyl phthalate, and 9,12-octadecadienoyl chloride (z,z) may be considered as compounds that could be used to bind with the active site sequence of AT1. Conclusions: The present study shows that the metabolites of C. dactylon could serve as a natural antagonist to AT1 that could be used to treat diabetic retinopathy. PMID:22368412
Williams, Larry R.; Aroniadou-Anderjaska, Vassiliki; Qashu, Felicia; Finne, Huckelberry; Pidoplichko, Volodymyr; Bannon, Desmond I.; Braga, Maria F. M.
2011-01-01
Background Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) is a high-energy, trinitrated cyclic compound that has been used worldwide since World War II as an explosive in both military and civilian applications. RDX can be released in the environment by way of waste streams generated during the manufacture, use, and disposal of RDX-containing munitions and can leach into groundwater from unexploded munitions found on training ranges. For > 60 years, it has been known that exposure to high doses of RDX causes generalized seizures, but the mechanism has remained unknown. Objective We investigated the mechanism by which RDX induces seizures. Methods and results By screening the affinity of RDX for a number of neurotransmitter receptors, we found that RDX binds exclusively to the picrotoxin convulsant site of the γ-aminobutyric acid type A (GABAA) ionophore. Whole-cell in vitro recordings in the rat basolateral amygdala (BLA) showed that RDX reduces the frequency and amplitude of spontaneous GABAA receptor–mediated inhibitory postsynaptic currents and the amplitude of GABA-evoked postsynaptic currents. In extracellular field recordings from the BLA, RDX induced prolonged, seizure-like neuronal discharges. Conclusions These results suggest that binding to the GABAA receptor convulsant site is the primary mechanism of seizure induction by RDX and that reduction of GABAergic inhibitory transmission in the amygdala is involved in the generation of RDX-induced seizures. Knowledge of the molecular site and the mechanism of RDX action with respect to seizure induction can guide therapeutic strategies, allow more accurate development of safe thresholds for exposures, and help prevent the development of new explosives or other munitions that could pose similar health risks. PMID:21362589
Boj, Sylvia F.; Servitja, Joan Marc; Martin, David; Rios, Martin; Talianidis, Iannis; Guigo, Roderic; Ferrer, Jorge
2009-01-01
OBJECTIVE The evolutionary conservation of transcriptional mechanisms has been widely exploited to understand human biology and disease. Recent findings, however, unexpectedly showed that the transcriptional regulators hepatocyte nuclear factor (HNF)-1α and -4α rarely bind to the same genes in mice and humans, leading to the proposal that tissue-specific transcriptional regulation has undergone extensive divergence in the two species. Such observations have major implications for the use of mouse models to understand HNF-1α– and HNF-4α–deficient diabetes. However, the significance of studies that assess binding without considering regulatory function is poorly understood. RESEARCH DESIGN AND METHODS We compared previously reported mouse and human HNF-1α and HNF-4α binding studies with independent binding experiments. We also integrated binding studies with mouse and human loss-of-function gene expression datasets. RESULTS First, we confirmed the existence of species-specific HNF-1α and -4α binding, yet observed incomplete detection of binding in the different datasets, causing an underestimation of binding conservation. Second, only a minor fraction of HNF-1α– and HNF-4α–bound genes were downregulated in the absence of these regulators. This subset of functional targets did not show evidence for evolutionary divergence of binding or binding sequence motifs. Finally, we observed differences between conserved and species-specific binding properties. For example, conserved binding was more frequently located near transcriptional start sites and was more likely to involve multiple binding events in the same gene. CONCLUSIONS Despite evolutionary changes in binding, essential direct transcriptional functions of HNF-1α and -4α are largely conserved between mice and humans. PMID:19188435
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.
The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, M.W.; Chen, J.P.; Wallis, C.
1992-02-26
({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less
Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.
2015-01-01
Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613
Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M
1998-01-01
The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514
Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N
1991-11-01
The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.
Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua
2016-07-19
The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.
Barnert, R H; Zeichhardt, H; Habermehl, K O
1992-02-01
Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.
Cooperative interplay of let-7 mimic and HuR with MYC RNA.
Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A
2015-01-01
Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.
Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen
2018-06-06
Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary
2015-12-01
CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.
FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1
Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.
2007-01-01
Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863
Investigation of glucose binding sites on insulin.
Zoete, Vincent; Meuwly, Markus; Karplus, Martin
2004-05-15
Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.
James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha
2015-01-01
Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488
Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen
2017-01-01
Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946
Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.
Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J
1988-01-01
The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.
Yazawa, H; Hirasawa, A; Horie, K; Saita, Y; Iida, E; Honda, K; Tsujimoto, G
1996-03-01
1. In a human vascular smooth muscle cell line (HVSMC), binding experiments with [3H]-arginine8-vasopressin (AVP) have shown the existence of a homogeneous population of binding sites with affinity (Kd value) of 0.65 nM and a maximum number of binding sites (Bmax) of 122 fmol mg-1 protein. 2. Nonlabelled compounds compete for [3H]-AVP binding in the HVSMC membrane with an order of potency of oxytocin > lyspressin > or = AVP > Thr4, Gly7-oxytocin > (beta-mercapto-beta-beta-cyclopentamethylenepropionyl-O-Me Tyr2, Arg8) vasopressin > desmopressin > OPC21268 > OPC31260. This order was markedly different from that observed in rat vascular smooth muscle cells (A10), a well-established V1A receptor system. 3. In HVSMC both oxytocin and AVP increased inositol 1,4,5-trisphosphate (IP3) production and [Ca2+]i response, but the efficacy of the responses was greater for oxytocin than AVP. 4. Reverse transcription-polymerase chain reaction (RT-PCR) assay detected only oxytocin receptor but not V1A or V2 receptors in HVSMC, whereas only V1A receptors were found in A10 cells. 5. In conclusion, in HVSMC only oxytocin receptors are expressed among the vasopressin receptor family, and they coupled to phosphatidyl inositol (PI) turnover/Ca2+ signalling. This unexpected observation should provide new insight into the functional role of the oxytocin receptor in a human vascular smooth muscle cell line.
Hu, Sen-Lin; Cui, Guang-Lin; Huang, Jin; Jiang, Jian-Gang; Wang, Dao-Wen
2016-01-01
Apolipoprotein C-III (APOC3) is a key regulator of plasma triglycerides levels. Increasing evidence has shown that loss-of-function mutations in APOC3 is associated with reduction in plasma triglycerides levels and will confer a benefit in patients at high risk for cardiovascular disease. However, these favorable mutations were extremely distribution discrepant among different ethnics. In this study, the APOC3 gene was resequenced and we identified a common variant which located in the microRNA-binding site in APOC3 and would affect its expression and the risk of coronary heart disease (CHD). The molecular mechanism was explored. We found that the T allele of rs4225 suppressed APOC3 translation by facilitating miR-4271 binding, but not the G allele. Subjects carrying the GG genotype had higher plasma APOC3 levels (p for trend = 0.03) than those with the TT genotype. Furthermore, the T allele was significantly associated with decreased triglyceride levels [Beta (SE): −0.024 (0.020), P = 0.03]. Finally, the case-control study suggested that the TT genotype resulted in a significant reduction in overall CHD risk [OR, 0.89 (95% confidence interval, 0.77–0.98), P = 0.009]. In conclusion, our results provide evidence that the rs4225 in the 3′-UTR of APOC3 might contribute to the risk of CHD by interfering with miR-4271 binding. PMID:27624799
Hu, Sen-Lin; Cui, Guang-Lin; Huang, Jin; Jiang, Jian-Gang; Wang, Dao-Wen
2016-09-14
Apolipoprotein C-III (APOC3) is a key regulator of plasma triglycerides levels. Increasing evidence has shown that loss-of-function mutations in APOC3 is associated with reduction in plasma triglycerides levels and will confer a benefit in patients at high risk for cardiovascular disease. However, these favorable mutations were extremely distribution discrepant among different ethnics. In this study, the APOC3 gene was resequenced and we identified a common variant which located in the microRNA-binding site in APOC3 and would affect its expression and the risk of coronary heart disease (CHD). The molecular mechanism was explored. We found that the T allele of rs4225 suppressed APOC3 translation by facilitating miR-4271 binding, but not the G allele. Subjects carrying the GG genotype had higher plasma APOC3 levels (p for trend = 0.03) than those with the TT genotype. Furthermore, the T allele was significantly associated with decreased triglyceride levels [Beta (SE): -0.024 (0.020), P = 0.03]. Finally, the case-control study suggested that the TT genotype resulted in a significant reduction in overall CHD risk [OR, 0.89 (95% confidence interval, 0.77-0.98), P = 0.009]. In conclusion, our results provide evidence that the rs4225 in the 3'-UTR of APOC3 might contribute to the risk of CHD by interfering with miR-4271 binding.
Pharmacologic characterization of the oxytocin receptor in human uterine smooth muscle cells
Tahara, Atsuo; Tsukada, Junko; Tomura, Yuichi; Wada, Koh-ichi; Kusayama, Toshiyuki; Ishii, Noe; Yatsu, Takeyuki; Uchida, Wataru; Tanaka, Akihiro
2000-01-01
[3H]-oxytocin was used to characterize the oxytocin receptor found in human uterine smooth muscle cells (USMC). Specific binding of [3H]-oxytocin to USMC plasma membranes was dependent upon time, temperature and membrane protein concentration. Scatchard plot analysis of equilibrium binding data revealed the existence of a single class of high-affinity binding sites with an apparent equilibrium dissociation constant (Kd) of 0.76 nM and a maximum receptor density (Bmax) of 153 fmol mg−1 protein. The Hill coefficient (nH) did not differ significantly from unity, suggesting binding to homogenous, non-interacting receptor populations. Competitive inhibition of [3H]-oxytocin binding showed that oxytocin and vasopressin (AVP) receptor agonists and antagonists displaced [3H]-oxytocin in a concentration-dependent manner. The order of potencies for peptide agonists and antagonists was: oxytocin>[Asu1,6]-oxytocin>AVP= atosiban>d(CH2)5Tyr(Me)AVP>[Thr4,Gly7]-oxytocin>dDAVP, and for nonpeptide antagonists was: L-371257>YM087>SR 49059>OPC-21268>SR 121463A>OPC-31260. Oxytocin significantly induced concentration-dependent increase in intracellular Ca2+ concentration ([Ca2+]i) and hyperplasia in USMC. The oxytocin receptor antagonists, atosiban and L-371257, potently and concentration-dependently inhibited oxytocin-induced [Ca2+]i increase and hyperplasia. In contrast, the V1A receptor selective antagonist, SR 49059, and the V2 receptor selective antagonist, SR 121463A, did not potently inhibit oxytocin-induced [Ca2+]i increase and hyperplasia. The potency order of antagonists in inhibiting oxytocin-induced [Ca2+]i increase and hyperplasia was similar to that observed in radioligand binding assays. In conclusion, these data provide evidence that the high-affinity [3H]-oxytocin binding site found in human USMC is a functional oxytocin receptor coupled to [Ca2+]i increase and cell growth. Thus human USMC may prove to be a valuable tool in further investigation of the physiologic and pathophysiologic roles of oxytocin in the uterus. PMID:10694212
Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K
2017-03-17
Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.
2008-01-01
Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991
An additional substrate binding site in a bacterial phenylalanine hydroxylase
Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan
2014-01-01
Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686
2011-01-01
Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060
NASA Astrophysics Data System (ADS)
Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.
2018-03-01
To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.
Keck, P C; Huston, J S
1996-01-01
Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174
Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma
2017-09-01
Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Catalytic site interactions in yeast OMP synthase.
Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R
2014-01-15
The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.
Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min
2006-01-01
Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).
Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muccioli, G.; Guardabassi, A.; Pattono, P.
1990-03-01
The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less
Study of DNA binding sites using the Rényi parametric entropy measure.
Krishnamachari, A; moy Mandal, Vijnan; Karmeshu
2004-04-07
Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.
SITEHOUND-web: a server for ligand binding site identification in protein structures.
Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto
2009-07-01
SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.
Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.
Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei
2016-03-01
Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.
Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H
1994-01-01
Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896
Binding site and affinity prediction of general anesthetics to protein targets using docking.
Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G
2012-05-01
The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.
Ravindranath, Pradeep Anand; Sanner, Michel F.
2016-01-01
Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702
Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1
Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.
2008-01-01
Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268
Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter
2006-04-15
We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.
Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C
1992-01-01
Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867
Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site
Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.
2015-01-01
Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702
Mechanism of human antibody-mediated neutralization of Marburg virus.
Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E
2015-02-26
The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.
Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans
2013-02-21
Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.
Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Souza, E.B.; Kuyatt, B.L.
1987-01-01
Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less
Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.
2002-01-01
The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.
Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin
NASA Astrophysics Data System (ADS)
Dyer, Brian
2014-03-01
Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.
The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen
2010-04-26
Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less
Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli
2016-12-21
Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.
Selection of the simplest RNA that binds isoleucine
LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL
2003-01-01
We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881
Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shima, K.; Kitayama, S.; Nakano, R.
Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less
Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA
NASA Astrophysics Data System (ADS)
Aalberts, Daniel P.; Garland, Jeffrey A.
2004-03-01
When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Reid, A.; Mahboubi, A.
1991-02-01
Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less
Brierley, I; Hoggett, J G
1992-07-01
The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.
Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.
1988-09-01
To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less
NASA Astrophysics Data System (ADS)
Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.
2010-01-01
The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.
Cooperative interplay of let-7 mimic and HuR with MYC RNA
Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A
2015-01-01
Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105
Two classes of binding sites for [3H]substance P in rat cerebral cortex.
Geraghty, D P; Burcher, E
1993-01-22
The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)
A web server for analysis, comparison and prediction of protein ligand binding sites.
Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S
2016-03-25
One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .
Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh
Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar
2011-01-01
Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736
Meng, Xiangzhi; Leman, Michael; Xiang, Yan
2007-01-01
Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683
Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi
2018-05-16
Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.
Subrahmanyam, S; Cronan, J E
1999-01-21
We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.
NASA Astrophysics Data System (ADS)
Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John
1986-07-01
The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.
Marsh, Lorraine
2015-01-01
Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.
Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.
Fehr, Marcus; Wolf, Antje; Stammler, Gerd
2016-03-01
Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.
NASA Astrophysics Data System (ADS)
Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai
1985-05-01
The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).
DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P
2003-07-08
Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.
Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A
1997-10-28
Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.
Jayasena, S D; Johnston, B H
1992-01-01
tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648
Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G
2010-04-01
Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.
Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050
Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.
Joiner, C H; Lauf, P K
1978-01-01
1. [3H]Ouabain binding to human and sheep red blood cells was shown to be specific for receptors associated with Na/K transport. Virtually all tritium binding was abolished by dilution with unlabelled drug. Saturation levels of binding were independent of glycoside concentration and were identical to those associated with 100% inhibition of K pumping. 2. [3H]Ouabain binding and 42K influx were measured simultaneously in order to correlate the degree of K pump inhibition with the amount of glycoside bound. Results by this method agreed exactly with those obtained by pre-exposing cells to drug, followed by washing and then measuring K influx. 3. Plots of [3H]oubain binding vs. K pump inhibition were rectilinear for human and low K (LK) sheep red cells, indicating one glycoside receptor per K pump site and functional homogeneity of pump sites. High K (HK) sheep red cells exhibited curved plots of binding versus inhibition, which were best explained in terms of one receptor per pump, but a heterogeneous population of pump sites. 4. External K reduced the rate of glycoside binding, but did not alter the relationship between binding and inhibition. 5. The number of K pump sites was estimated as 450--500 per human cell and 30--50 per LK sheep cell. HK sheep cells had 90--130 sites per cell, of which eighty to ninety were functionally dominant. The number of K pump sites on LK sheep cells was not changed by anti-L, although the maximum velocity of pump turnover was increased. PMID:722573
Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G
2009-01-01
Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.
Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses
Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa
2018-01-01
Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196
Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G
2010-01-01
Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beaumont, K.; Vaughn, D.A.; Fanestil, D.D.
Thiazides and related diuretics inhibit NaCl reabsorption in the distal tubule through an unknown mechanism. The authors report here that ({sup 3}H)metolazone, a diuretic with a thiazide-like mechanism of action, labels a site in rat kidney membranes that has characteristics of the thiazide-sensitive ion transporter. ({sup 3}H)Metolazone bound with high affinity to a site with a density of 0.717 pmol/mg of protein in kidney membranes. The binding site was localized to the renal cortex, with little or not binding in other kidney regions and 11 other tissues. The affinities of thiazide-type diuretics for this binding site were significantly correlated withmore » their clinical potency. Halide anions specifically inhibited high-affinity binding of ({sup 3}H)metolazone to this site. ({sup 3})Metolazone also bound with lower affinity to sites present in kidney as well as in liver, testis, lung, brain, heart, and other tissues. Calcium antagonists and certain smooth muscle relaxants had K{sub i} values of 0.6-10 {mu}M for these low-affinity sites, which were not inhibited by most of the thiazide diuretics tested. Properties of the high-affinity ({sup 3}H)metolazone binding site are consistent with its identity as the receptor for thiazide-type diuretics.« less
Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.
Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R
2007-08-15
In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.
Rao, Devavratha H; Gowda, Lalitha R
2012-08-15
The field bean (Dolichos lablab) lectin designated as PPO-haemagglutinin (DLL-II) is bifunctional, exhibiting both polyphenol oxidase and haemagglutinating activity. The lectin is unusual in that it binds galactose (Gal), lactose (Lac) and N-acetylgalactosamine (GalNAc) only in the presence of (NH₄)₂SO₄ and exhibits negative cooperativity and half-of-the-sites binding. Circular dichroism, isothermal titration calorimetry and fluorescence quenching were used to assess the sugar binding in the presence of (NH₄)₂O₄. Comparison of the near-UV CD spectra with and without bound sugar revealed ligand induced conformational changes. The intrinsic fluorescence quenching data indicate that DLL-II exhibits weak binding to Gal in the presence of (NH₄)₂SO₄ with a stoichiometry of one bound ligand per dimer. ITC data fitted using a two sets of sites binding model presented a similar picture. The K(a)'s for Gal, Lac and GalNAc in the presence of (NH₄)₂SO₄ were 0.16±0.002, 0.21±0.004 and 8.45±0.78 (×10⁻³) M⁻¹ respectively. The Hill plot for the binding of these sugars to DLL-II was curvilinear with a tangent slope <1.0 indicating negative cooperativity. DLL-II thus exhibits half-of-the-site binding, an extreme form of negative cooperativity in which the second ligand does not bind at all. This is the first report of a legume lectin, exhibiting half-of-the-sites binding. Copyright © 2012 Elsevier Inc. All rights reserved.
Negatively Cooperative Binding of High Density Lipoprotein to the HDL Receptor SR-BI†
Nieland, Thomas J.F.; Xu, Shangzhe; Penman, Marsha; Krieger, Monty
2011-01-01
Scavenger receptor class B, type I (SR-BI) is a high-density lipoprotein (HDL) receptor, which also binds low density lipoprotein (LDL), and mediates the cellular selective uptake of cholesteryl esters from lipoproteins. SR-BI also is a co-receptor for hepatitis C virus and a signaling receptor that regulates cell metabolism. Many investigators have reported that lipoproteins bind to SR-BI via a single class of independent (not interacting), high affinity binding sites (one site model). We have re-investigated the ligand concentration dependence of 125I-HDL binding to SR-BI and SR-BI-mediated specific uptake of [3H]CE from [3H]CE-HDL using an expanded range of ligand concentrations (<1 µg protein/ml, lower than previously reported). Scatchard and non-linear least squares model fitting analyses of the binding and uptake data were both inconsistent with a single class of independent binding sites binding univalent lipoprotein ligands. The data are best fit by models in which SR-BI has either two independent classes of binding sites, or one class of sites exhibiting negative cooperativity due to either classic allostery or ensemble effects (‘ lattice model’). Similar results were observed for LDL. Application of the ‘infinite dilution’ dissociation rate method established that the binding of 125I-HDL to SR-BI at 4 °C exhibits negative cooperativity. The unexpected complexity of the interactions of lipoproteins with SR-BI should be taken into account when interpreting the results of experiments that explore the mechanism(s) by which SR-BI mediates ligand binding, lipid transport and cell signaling. PMID:21254782
Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan
2007-01-01
The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395
Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J
2018-05-01
The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.
Bertaccini, Edward J.; Yoluk, Ozge; Lindahl, Erik R.; Trudell, James R.
2013-01-01
Background Anesthetics mediate portions of their activity via modulation of the γ-aminobutyric acid receptor (GABAaR). While its molecular structure remains unknown, significant progress has been made towards understanding its interactions with anesthetics via molecular modeling. Methods The structure of the torpedo acetylcholine receptor (nAChRα), the structures of the α4 and β2 subunits of the human nAChR, the structures of the eukaryotic glutamate-gated chloride channel (GluCl), and the prokaryotic pH sensing channels, from Gloeobacter violaceus and Erwinia chrysanthemi, were aligned with the SAlign and 3DMA algorithms. A multiple sequence alignment from these structures and those of the GABAaR was performed with ClustalW. The Modeler and Rosetta algorithms independently created three-dimensional constructs of the GABAaR from the GluCl template. The CDocker algorithm docked a congeneric series of propofol derivatives into the binding pocket and scored calculated binding affinities for correlation with known GABAaR potentiation EC50’s. Results Multiple structure alignments of templates revealed a clear consensus of residue locations relevant to anesthetic effects except for torpedo nAChR. Within the GABAaR models generated from GluCl, the residues notable for modulating anesthetic action within transmembrane segments 1, 2, and 3 converged on the intersubunit interface between alpha and beta subunits. Docking scores of a propofol derivative series into this binding site showed strong linear correlation with GABAaR potentiation EC50. Conclusion Consensus structural alignment based on homologous templates revealed an intersubunit anesthetic binding cavity within the transmembrane domain of the GABAaR, which showed correlation of ligand docking scores with experimentally measured GABAaR potentiation. PMID:23770602
Czogalla, Katrin J.; Liphardt, Kerstin; Höning, Klara; Hornung, Veit; Biswas, Arijit; Watzka, Matthias
2018-01-01
Vitamin K reduction is catalyzed by 2 enzymes in vitro: the vitamin K 2,3-epoxide reductase complex subunit 1 (VKORC1) and its isozyme VKORC1-like1 (VKORC1L1). In vivo, VKORC1 reduces vitamin K to sustain γ-carboxylation of vitamin K-dependent proteins, including coagulation factors. Inhibition of VKORC1 by oral anticoagulants (OACs) is clinically used in therapy and in prevention of thrombosis. However, OACs also inhibit VKORC1L1, which was previously shown to play a role in intracellular redox homeostasis in vitro. Here, we report data for the first time on specific inhibition of both VKOR enzymes for various OACs and rodenticides examined in a cell-based assay. Effects on endogenous VKORC1 and VKORC1L1 were independently investigated in genetically engineered HEK 293T cells that were knocked out for the respective genes by CRISPR/Cas9 technology. In general, dose-responses for 4-hydroxycoumarins and 1,3-indandiones were enzyme-dependent, with lower susceptibility for VKORC1L1 compared with VKORC1. In contrast, rodenticides exhibited nearly identical dose-responses for both enzymes. To explain the distinct inhibition pattern, we performed in silico modeling suggesting different warfarin binding sites for VKORC1 and VKORC1L1. We identified arginine residues at positions 38, 42, and 68 in the endoplasmatic reticulum luminal loop of VKORC1L1 responsible for charge-stabilized warfarin binding, resulting in a binding pocket that is diametrically opposite to that of VKORC1. In conclusion, our findings provide insight into structural and molecular drug binding on VKORC1, and especially on VKORC1L1. PMID:29581108
Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin
2017-04-01
Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Badr, Myriam A; Pinto, Jose R; Davidson, Michael W; Chase, P Bryant
2016-01-01
Cardiac troponin C (cTnC) is a key effector in cardiac muscle excitation-contraction coupling as the Ca2+ sensing subunit responsible for controlling contraction. In this study, we generated several FRET sensors for divalent cations based on cTnC flanked by a donor fluorescent protein (CFP) and an acceptor fluorescent protein (YFP). The sensors report Ca2+ and Mg2+ binding, and relay global structural information about the structural relationship between cTnC's N- and C-domains. The sensors were first characterized using end point titrations to decipher the response to Ca2+ binding in the presence or absence of Mg2+. The sensor that exhibited the largest responses in end point titrations, CTV-TnC, (Cerulean, TnC, and Venus) was characterized more extensively. Most of the divalent cation-dependent FRET signal originates from the high affinity C-terminal EF hands. CTV-TnC reconstitutes into skinned fiber preparations indicating proper assembly of troponin complex, with only ~0.2 pCa unit rightward shift of Ca2+-sensitive force development compared to WT-cTnC. Affinity of CTV-TnC for divalent cations is in agreement with known values for WT-cTnC. Analytical ultracentrifugation indicates that CTV-TnC undergoes compaction as divalent cations bind. C-terminal sites induce ion-specific (Ca2+ versus Mg2+) conformational changes in cTnC. Our data also provide support for the presence of additional, non-EF-hand sites on cTnC for Mg2+ binding. In conclusion, we successfully generated a novel FRET-Ca2+ sensor based on full length cTnC with a variety of cellular applications. Our sensor reveals global structural information about cTnC upon divalent cation binding.
Cortactin as a Target for FAK in the Regulation of Focal Adhesion Dynamics
Ghassemian, Majid; Schlaepfer, David D.
2012-01-01
Background Efficient cell movement requires the dynamic regulation of focal adhesion (FA) formation and turnover. FAs are integrin-associated sites of cell attachment and establish linkages to the cellular actin cytoskeleton. Cells without focal adhesion kinase (FAK), an integrin-activated tyrosine kinase, exhibit defects in FA turnover and cell motility. Cortactin is an actin binding adaptor protein that can influence FA dynamics. FAK and cortactin interact, but the cellular role of this complex remains unclear. Principal Findings Using FAK-null fibroblasts stably reconstituted with green fluorescent protein (GFP) tagged FAK constructs, we find that FAK activity and FAK C-terminal proline-rich region 2 (PRR2) and PRR3 are required for FA turnover and cell motility. Cortactin binds directly to FAK PRR2 and PRR3 sites via its SH3 domain and cortactin expression is important in promoting FA turnover and GFP-FAK release from FAs. FAK-cortactin binding is negatively-regulated by FAK activity and associated with cortactin tyrosine phosphorylation. FAK directly phosphorylates cortactin at Y421 and Y466 and over-expression of cortactin Y421, Y466, and Y482 mutated to phenylalanine (3YF) prevented FAK-enhanced FA turnover and cell motility. However, phospho-mimetic cortactin mutated to glutamic acid (3YE) did not affect FA dynamics and did not rescue FA turnover defects in cells with inhibited FAK activity or with PRR2-mutated FAK that does not bind cortactin. Conclusions Our results support a model whereby FAK-mediated FA remodeling may occur through the formation of a FAK-cortactin signaling complex. This involves a cycle of cortactin binding to FAK, cortactin tyrosine phosphorylation, and subsequent cortactin-FAK dissociation accompanied by FA turnover and cell movement. PMID:22952866
The Role of Histone Tails in the Nucleosome: A Computational Study
Erler, Jochen; Zhang, Ruihan; Petridis, Loukas; Cheng, Xiaolin; Smith, Jeremy C.; Langowski, Jörg
2014-01-01
Histone tails play an important role in gene transcription and expression. We present here a systematic computational study of the role of histone tails in the nucleosome, using replica exchange molecular dynamics simulations with an implicit solvent model and different well-established force fields. We performed simulations for all four histone tails, H4, H3, H2A, and H2B, isolated and with inclusion of the nucleosome. The results confirm predictions of previous theoretical studies for the secondary structure of the isolated tails but show a strong dependence on the force field used. In the presence of the entire nucleosome for all force fields, the secondary structure of the histone tails is destabilized. Specific contacts are found between charged lysine and arginine residues and DNA phosphate groups and other binding sites in the minor and major DNA grooves. Using cluster analysis, we found a single dominant configuration of binding to DNA for the H4 and H2A histone tails, whereas H3 and H2B show multiple binding configurations with an equal probability. The leading stabilizing contribution for those binding configurations is the attractive interaction between the positively charged lysine and arginine residues and the negatively charged phosphate groups, and thus the resulting charge neutralization. Finally, we present results of molecular dynamics simulations in explicit solvent to confirm our conclusions. Results from both implicit and explicit solvent models show that large portions of the histone tails are not bound to DNA, supporting the complex role of these tails in gene transcription and expression and making them possible candidates for binding sites of transcription factors, enzymes, and other proteins. PMID:25517156
Discovery of a small-molecule HIV-1 integrase inhibitor-binding site | Center for Cancer Research
The lowest energy-binding conformation of an inhibitor bound to the dimeric interface of HIV-1 integrase core domain. The yellow region represents a unique allosteric binding site identified by affinity labeling and mass spectrometry and validated through mutagenesis. This site can provide a potential platform for the rational design of inhibitors selective for disruption of
Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy
2011-01-01
During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254
Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy
2011-01-14
During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.
Non-competitive inhibition by active site binders.
Blat, Yuval
2010-06-01
Classical enzymology has been used for generations to understand the interactions of inhibitors with their enzyme targets. Enzymology tools enabled prediction of the biological impact of inhibitors as well as the development of novel, more potent, ones. Experiments designed to examine the competition between the tested inhibitor and the enzyme substrate(s) are the tool of choice to identify inhibitors that bind in the active site. Competition between an inhibitor and a substrate is considered a strong evidence for binding of the inhibitor in the active site, while the lack of competition suggests binding to an alternative site. Nevertheless, exceptions to this notion do exist. Active site-binding inhibitors can display non-competitive inhibition patterns. This unusual behavior has been observed with enzymes utilizing an exosite for substrate binding, isomechanism enzymes, enzymes with multiple substrates and/or products and two-step binding inhibitors. In many of these cases, the mechanisms underlying the lack of competition between the substrate and the inhibitor are well understood. Tools like alternative substrates, testing the enzyme reaction in the reverse direction and monitoring inhibition time dependence can be applied to enable distinction between 'badly behaving' active site binders and true exosite inhibitors.
PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information
Wu, Hao; Ji, Hongkai
2014-01-01
ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116
The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum
Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...
2017-06-24
In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less