Sample records for binding sites detected

  1. PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information

    PubMed Central

    Wu, Hao; Ji, Hongkai

    2014-01-01

    ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116

  2. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  3. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  4. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  5. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  6. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  8. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  9. Cryptic binding sites on proteins: definition, detection, and druggability.

    PubMed

    Vajda, Sandor; Beglov, Dmitri; Wakefield, Amanda E; Egbert, Megan; Whitty, Adrian

    2018-05-22

    Many proteins in their unbound structures lack surface pockets appropriately sized for drug binding. Hence, a variety of experimental and computational tools have been developed for the identification of cryptic sites that are not evident in the unbound protein but form upon ligand binding, and can provide tractable drug target sites. The goal of this review is to discuss the definition, detection, and druggability of such sites, and their potential value for drug discovery. Novel methods based on molecular dynamics simulations are particularly promising and yield a large number of transient pockets, but it has been shown that only a minority of such sites are generally capable of binding ligands with substantial affinity. Based on recent studies, current methodology can be improved by combining molecular dynamics with fragment docking and machine learning approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

    PubMed

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-07-01

    The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

  11. Transcription Factor Information System (TFIS): A Tool for Detection of Transcription Factor Binding Sites.

    PubMed

    Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C

    2017-09-01

    Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).

  12. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  13. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  15. Detecting cis-regulatory binding sites for cooperatively binding proteins

    PubMed Central

    van Oeffelen, Liesbeth; Cornelis, Pierre; Van Delm, Wouter; De Ridder, Fedor; De Moor, Bart; Moreau, Yves

    2008-01-01

    Several methods are available to predict cis-regulatory modules in DNA based on position weight matrices. However, the performance of these methods generally depends on a number of additional parameters that cannot be derived from sequences and are difficult to estimate because they have no physical meaning. As the best way to detect cis-regulatory modules is the way in which the proteins recognize them, we developed a new scoring method that utilizes the underlying physical binding model. This method requires no additional parameter to account for multiple binding sites; and the only necessary parameters to model homotypic cooperative interactions are the distances between adjacent protein binding sites in basepairs, and the corresponding cooperative binding constants. The heterotypic cooperative binding model requires one more parameter per cooperatively binding protein, which is the concentration multiplied by the partition function of this protein. In a case study on the bacterial ferric uptake regulator, we show that our scoring method for homotypic cooperatively binding proteins significantly outperforms other PWM-based methods where biophysical cooperativity is not taken into account. PMID:18400778

  16. Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

    PubMed

    Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

    2008-01-01

    This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

  17. DeepSite: protein-binding site predictor using 3D-convolutional neural networks.

    PubMed

    Jiménez, J; Doerr, S; Martínez-Rosell, G; Rose, A S; De Fabritiis, G

    2017-10-01

    An important step in structure-based drug design consists in the prediction of druggable binding sites. Several algorithms for detecting binding cavities, those likely to bind to a small drug compound, have been developed over the years by clever exploitation of geometric, chemical and evolutionary features of the protein. Here we present a novel knowledge-based approach that uses state-of-the-art convolutional neural networks, where the algorithm is learned by examples. In total, 7622 proteins from the scPDB database of binding sites have been evaluated using both a distance and a volumetric overlap approach. Our machine-learning based method demonstrates superior performance to two other competitive algorithmic strategies. DeepSite is freely available at www.playmolecule.org. Users can submit either a PDB ID or PDB file for pocket detection to our NVIDIA GPU-equipped servers through a WebGL graphical interface. gianni.defabritiis@upf.edu. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  18. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    2016-10-01

    The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  19. Substance P receptor binding sites are expressed by glia in vivo after neuronal injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mantyh, P.W.; Johnson, D.J.; Boehmer, C.G.

    1989-07-01

    In vitro studies have demonstrated that glia can express functional receptors for a variety of neurotransmitters. To determine whether similar neurotransmitter receptors are also expressed by glia in vivo, the authors examined the glial scar in the transected optic nerve of the albino rabbit by quantitative receptor autoradiography. Receptor binding sites for radiolabeled calcitonin gene-related peptide, cholecystokinin, galanin, glutamate, somatostatin, substance P, and vasoactive intestinal peptide were examined. Specific receptor binding sites for each of these neurotransmitters were identified in the rabbit forebrain but were not detected in the normal optic nerve or tract. In the transected optic nerve andmore » tract, only receptor binding sites for substance P were expressed at detectable levels. The density of substance P receptor binding sites observed in this glial scar is among the highest observed in the rabbit forebrain. Ligand displacement and saturation experiments indicate that the substance P receptor binding site expressed by the glial scar has pharmacological characteristics similar to those of substance P receptors in the rabbit striatum, rat brain, and rat and canine gut. The present study demonstrates that glial cells in vivo express high concentrations of substance P receptor binding sites after transection of retinal ganglion cell axons. Because substance P has been shown to regulate inflammatory and immune responses in peripheral tissues, substance P may also, by analogy, be involved in regulating the glial response to injury in the central nervous system.« less

  20. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  1. M13 phage peptide ZL4 exerts its targeted binding effect on schistosoma japonicum via alkaline phosphatase.

    PubMed

    Liu, Yan; Yang, Shenghui; Xiao, Jianhua; Yu, Liang; Chen, Li; Zou, Ju; Wang, Kegeng; Tan, Sijie; Yu, Zhengyang; Zeng, Qingren

    2015-01-01

    The present study was to determine the targeting effect of M13 phage peptide ZL4 (MppZL4) on Schistosoma japonicum (S.j). Mice infected with S.j were injected with MppZL4. Real-time PCR was used to detect the distribution and metabolism of MppZL4 in the livers and lungs of mice. In vivo refusion test was performed to detect the targeting of MppZL4. Western blotting was employed to determine the expression of MppZL4. Live imaging was used to detect the distribution of oligopeptide MppZL4. Immunohistochemistry was employed to determine MppZL4 location on adult S.j body surface. Gomori method was employed to detect the influence of oligopeptide MppZL4 on alkaline phosphatase activity. The distribution and metabolism of MppZL4 and M13KE are not significantly different from each other at each time point. The abundance of MppZL4 is changed as S.j migrates in mice. The targeted binding effect of MppZL4 varies at different stages. ZL4 oligopeptide targets S.j in mice. The specific binding sites of MppZL4 on S.j body are mainly located in syncytial cells. The binding sites of MppZL4 on S.j body surface might be ALP or ALP-related proteins. MppZL4 had targeted binding effect on S.j with its binding site being associated with proteins related to S.j alkaline phosphatase. S.j tegument had a specifically binding site with exogenous peptides, offering new means to explore the interactions between hosts and parasites. Additionally, MppZL4 can possibly be used as targeting molecules in worm-resistant drugs or as tracing molecules in imaging diagnosis technologies.

  2. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  3. Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.

    PubMed

    Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O

    2010-08-01

    Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.

  4. A survey of motif finding Web tools for detecting binding site motifs in ChIP-Seq data

    PubMed Central

    2014-01-01

    Abstract ChIP-Seq (chromatin immunoprecipitation sequencing) has provided the advantage for finding motifs as ChIP-Seq experiments narrow down the motif finding to binding site locations. Recent motif finding tools facilitate the motif detection by providing user-friendly Web interface. In this work, we reviewed nine motif finding Web tools that are capable for detecting binding site motifs in ChIP-Seq data. We showed each motif finding Web tool has its own advantages for detecting motifs that other tools may not discover. We recommended the users to use multiple motif finding Web tools that implement different algorithms for obtaining significant motifs, overlapping resemble motifs, and non-overlapping motifs. Finally, we provided our suggestions for future development of motif finding Web tool that better assists researchers for finding motifs in ChIP-Seq data. Reviewers This article was reviewed by Prof. Sandor Pongor, Dr. Yuriy Gusev, and Dr. Shyam Prabhakar (nominated by Prof. Limsoon Wong). PMID:24555784

  5. Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

    PubMed

    Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

    2006-07-07

    We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

  6. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  7. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  8. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  9. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  10. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  11. Characterization and autoradiographic localization of neurotensin binding sites in human sigmoid colon.

    PubMed

    Azriel, Y; Burcher, E

    2001-06-01

    Radioiodinated neurotensin ((125)I-NT) was used to characterize and localize NT binding sites in normal human sigmoid colon. Specimens were obtained from patients (30-77 years old) undergoing resection for colon carcinoma. Specific binding of (125)I-NT to sigmoid circular muscle membranes was enhanced by o-phenanthroline (1 mM) but other peptidase inhibitors were ineffective. (125)I-NT bound to a high-affinity site of K(d) = 0.88 +/- 0.09 nM and B(max) = 4.03 +/- 0.66 fmol/mg of wet weight tissue (n = 14), although in the majority of patients another site, of low but variable affinity, could also be detected. Specific binding of 50 pM (125)I-NT was inhibited by NT(8-13) > NT > SR142948A > or = neuromedin N > or = SR48692, consistent with binding to the NT1 receptor. In autoradiographic studies, dense specific binding of (125)I-NT was seen over myenteric and submucosal ganglia, moderate binding over circular muscle, and sparse binding over longitudinal muscle and taenia coli. Levocabastine, which has affinity for the NT2 receptor, did not inhibit specific binding of (125)I-NT in membrane competition or autoradiographic studies. NT contracted sigmoid colon circular muscle strips with a pD(2) value of 6.8 +/- 0.2 nM (n = 25). The contractile responses to NT were significantly potentiated in the presence of tetrodotoxin (1 microM), indicating a neural component. Results from functional studies support actions for NT on both muscle and enteric neurons, consistent with the presence of NT receptors on circular muscle and ganglia of human sigmoid colon. The lack of inhibition by levocabastine suggests that the second binding site detected does not correspond to the NT2 receptor.

  12. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  13. Modeling the evolution of regulatory elements by simultaneous detection and alignment with phylogenetic pair HMMs.

    PubMed

    Majoros, William H; Ohler, Uwe

    2010-12-16

    The computational detection of regulatory elements in DNA is a difficult but important problem impacting our progress in understanding the complex nature of eukaryotic gene regulation. Attempts to utilize cross-species conservation for this task have been hampered both by evolutionary changes of functional sites and poor performance of general-purpose alignment programs when applied to non-coding sequence. We describe a new and flexible framework for modeling binding site evolution in multiple related genomes, based on phylogenetic pair hidden Markov models which explicitly model the gain and loss of binding sites along a phylogeny. We demonstrate the value of this framework for both the alignment of regulatory regions and the inference of precise binding-site locations within those regions. As the underlying formalism is a stochastic, generative model, it can also be used to simulate the evolution of regulatory elements. Our implementation is scalable in terms of numbers of species and sequence lengths and can produce alignments and binding-site predictions with accuracy rivaling or exceeding current systems that specialize in only alignment or only binding-site prediction. We demonstrate the validity and power of various model components on extensive simulations of realistic sequence data and apply a specific model to study Drosophila enhancers in as many as ten related genomes and in the presence of gain and loss of binding sites. Different models and modeling assumptions can be easily specified, thus providing an invaluable tool for the exploration of biological hypotheses that can drive improvements in our understanding of the mechanisms and evolution of gene regulation.

  14. CheckMyMetal: a macromolecular metal-binding validation tool

    PubMed Central

    Porebski, Przemyslaw J.

    2017-01-01

    Metals are essential in many biological processes, and metal ions are modeled in roughly 40% of the macromolecular structures in the Protein Data Bank (PDB). However, a significant fraction of these structures contain poorly modeled metal-binding sites. CheckMyMetal (CMM) is an easy-to-use metal-binding site validation server for macromolecules that is freely available at http://csgid.org/csgid/metal_sites. The CMM server can detect incorrect metal assignments as well as geometrical and other irregularities in the metal-binding sites. Guidelines for metal-site modeling and validation in macromolecules are illustrated by several practical examples grouped by the type of metal. These examples show CMM users (and crystallographers in general) problems they may encounter during the modeling of a specific metal ion. PMID:28291757

  15. The hepta-beta-glucoside elicitor-binding proteins from legumes represent a putative receptor family.

    PubMed

    Mithöfer, A; Fliegmann, J; Neuhaus-Url, G; Schwarz, H; Ebel, J

    2000-08-01

    The ability of legumes to recognize and respond to beta-glucan elicitors by synthesizing phytoalexins is consistent with the existence of a membrane-bound beta-glucan-binding site. Related proteins of approximately 75 kDa and the corresponding mRNAs were detected in various species of legumes which respond to beta-glucans. The cDNAs for the beta-glucan-binding proteins of bean and soybean were cloned. The deduced 75-kDa proteins are predominantly hydrophilic and constitute a unique class of glucan-binding proteins with no currently recognizable functional domains. Heterologous expression of the soybean beta-glucan-binding protein in tomato cells resulted in the generation of a high-affinity binding site for the elicitor-active hepta-beta-glucoside conjugate (Kd = 4.5 nM). Ligand competition experiments with the recombinant binding sites demonstrated similar ligand specificities when compared with soybean. In both soybean and transgenic tomato, membrane-bound, active forms of the glucan-binding proteins coexist with immunologically detectable, soluble but inactive forms of the proteins. Reconstitution of a soluble protein fraction into lipid vesicles regained beta-glucoside-binding activity but with lower affinity (Kd = 130 nM). We conclude that the beta-glucan elicitor receptors of legumes are composed of the 75 kDa glucan-binding proteins as the critical components for ligand-recognition, and of an as yet unknown membrane anchor constituting the plasma membrane-associated receptor complex.

  16. Characterization of the increased binding of acetaldehyde to red blood cells in alcoholics.

    PubMed

    Hernández-Muñoz, R; Baraona, E; Blacksberg, I; Lieber, C S

    1989-10-01

    Using equilibrium dialysis, we found that acetaldehyde, at the levels commonly occurring after ethanol ingestion, did not bind detectably to plasma proteins, but there was significant binding to red blood cells, more in alcoholics than in nonalcoholics. The binding to red blood cells was inhibited by pyridoxal phosphate and N-ethylmaleimide, suggesting adduction to amino and thiol groups. Binding kinetics were consistent with at least two sites. The one with the highest affinity for acetaldehyde corresponded to hemoglobin. Its affinity and Bmax were not changed in alcoholics, but these binding sites accounted for only 44% of the sites available in the red blood cells of alcoholics and 80% of those in controls. Moreover, this binding was not inhibited by N-ethylmaleimide. There was no detectable binding to red cell ghosts. Nonprotein binding was then assessed by changes in NADH produced by the addition of protein-free fractions of the cells to an alcohol dehydrogenase system in equilibrium; this revealed a second binder of lower affinity, larger capacity and with sensitivity to both inhibitors. This binding (possibly due to thiazolidine formation with cysteine) was enhanced in alcoholics, whose red blood cell cysteine content was doubled. Levels of red blood cell cysteine and acetaldehyde remained high for 2 weeks after withdrawal. Because of the prolonged persistence after withdrawal, these changes may provide new markers of alcoholism.

  17. Fast pressure jumps can perturb calcium and magnesium binding to troponin C F29W.

    PubMed

    Pearson, David S; Swartz, Darl R; Geeves, Michael A

    2008-11-18

    We have used rapid pressure jump and stopped-flow fluorometry to investigate calcium and magnesium binding to F29W chicken skeletal troponin C. Increased pressure perturbed calcium binding to the N-terminal sites in the presence and absence of magnesium and provided an estimate for the volume change upon calcium binding (-12 mL/mol). We observed a biphasic response to a pressure change which was characterized by fast and slow reciprocal relaxation times of the order 1000/s and 100/s. Between pCa 8-5.4 and at troponin C concentrations of 8-28 muM, the slow relaxation times were invariant, indicating that a protein isomerization was rate-limiting. The fast event was only detected over a very narrow pCa range (5.6-5.4). We have devised a model based on a Monod-Wyman-Changeux cooperative mechanism with volume changes of -9 and +6 mL/mol for the calcium binding to the regulatory sites and closed to open protein isomerization steps, respectively. In the absence of magnesium, we discovered that calcium binding to the C-terminal sites could be detected, despite their position distal to the calcium-sensitive tryptophan, with a volume change of +25 mL/mol. We used this novel observation to measure competitive magnesium binding to the C-terminal sites and deduced an affinity in the range 200-300 muM (and a volume change of +35 mL/mol). This affinity is an order of magnitude tighter than equilibrium fluorescence data suggest based on a model of direct competitive binding. Magnesium thus indirectly modulates binding to the N-terminal sites, which may act as a fine-tuning mechanism in vivo.

  18. Fast Pressure Jumps Can Perturb Calcium and Magnesium Binding to Troponin C F29W

    PubMed Central

    Pearson, David S.; Swartz, Darl R.; Geeves, Michael A.

    2009-01-01

    We have used rapid pressure jump and stopped-flow fluorimetry to investigate calcium and magnesium binding to F29W chicken skeletal troponin C. Increased pressure perturbed calcium binding to the N-terminal sites in the presence and absence of magnesium and provided an estimate for the volume change upon calcium binding (-12 mL.mol-1). We observed a biphasic response to a pressure change which was characterized by fast and slow reciprocal relaxation times of the order 1000 s-1 and 100 s-1. Between pCa 8-5.4 and at troponin C concentrations of 8-28 μM, the slow relaxation times were invariant indicating that a protein isomerization was rate-limiting. The fast event was only detected over a very narrow pCa range (5.6-5.4). We have devised a model based on a Monod-Wyman-Changeux cooperative mechanism with volume changes of -9 and +6 mL/mol for the calcium binding to the regulatory sites and closed to open protein isomerization steps respectively. In the absence of magnesium, we discovered that calcium binding to the C-terminal sites could be detected, despite their position distal to the calcium sensitive tryptophan, with a volume change of +25 mL/mol. We used this novel observation to measure competitive magnesium binding to the C-terminal sites and deduced an affinity in the range 200 - 300 μM (and a volume change of +35 mL/mol). This affinity is an order of magnitude tighter than equilibrium fluorescence data suggest based on a model of direct competitive binding. Magnesium thus indirectly modulates binding to the N-terminal sites, which may act as a fine-tuning mechanism in vivo. PMID:18942859

  19. Mass Spectrometric Determination of ILPR G-quadruplex Binding Sites in Insulin and IGF-2

    PubMed Central

    Xiao, JunFeng

    2009-01-01

    The insulin-linked polymorphic region (ILPR) of the human insulin gene promoter region forms G-quadruplex structures in vitro. Previous studies show that insulin and insulin-like growth factor-2 (IGF-2) exhibit high affinity binding in vitro to 2-repeat sequences of ILPR variants a and h, but negligible binding to variant i. Two-repeat sequences of variants a and h form intramolecular G-quadruplex structures that are not evidenced for variant i. Here we report on the use of protein digestion combined with affinity capture and MALDI-MS detection to pinpoint ILPR binding sites in insulin and IGF-2. Peptides captured by ILPR variants a and h were sequenced by MALDI-MS/MS, LC-MS and in silico digestion. On-bead digestion of insulin-ILPR variant a complexes supported the conclusions. The results indicate that the sequence VCG(N)RGF is generally present in the captured peptides and is likely involved in the affinity binding interactions of the proteins with the ILPR G-quadruplexes. The significance of arginine in the interactions was studied by comparing the affinities of synthesized peptides VCGERGF and VCGEAGF with ILPR variant a. Peptides from other regions of the proteins that are connected through disulfide linkages were also detected in some capture experiments. Identification of binding sites could facilitate design of DNA binding ligands for capture and detection of insulin and IGF-2. The interactions may have biological significance as well. PMID:19747845

  20. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  1. A Surface Energy Transfer Nanoruler for Measuring Binding Site Distances on Live Cell Surfaces

    PubMed Central

    Chen, Yan; O’Donoghue, Meghan B.; Huang, Yu-Fen; Kang, Huaizhi; Phillips, Joseph A.; Chen, Xiaolan; Estevez, M.-Carmen; Tan, Weihong

    2010-01-01

    Measuring distances at molecular length scales in living systems is a significant challenge. Methods like FRET have limitations due to short detection distances and strict orientations. Recently, surface energy transfer (SET) has been used in bulk solutions; however, it cannot be applied to living systems. Here, we have developed an SET nanoruler, using aptamer-gold-nanoparticle conjugates with different diameters, to monitor the distance between binding sites of a receptor on living cells. The nanoruler can measure separation distances well beyond the detection limit of FRET. Thus, for the first time, we have developed an effective SET nanoruler for live cells with long distance, easy construction, fast detection and low background. This is also the first time that the distance between the aptamer and antibody binding sites in the membrane protein PTK7 was measured accurately. The SET nanoruler represents the next leap forward to monitor structural components within living cell membranes. PMID:21038856

  2. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  3. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  4. [3H]aniracetam binds to specific recognition sites in brain membranes.

    PubMed

    Fallarino, F; Genazzani, A A; Silla, S; L'Episcopo, M R; Camici, O; Corazzi, L; Nicoletti, F; Fioretti, M C

    1995-08-01

    [3H]Aniracetam bound to specific and saturable recognition sites in membranes prepared from discrete regions of rat brain. In crude membrane preparation from rat cerebral cortex, specific binding was Na+ independent, was still largely detectable at low temperature (4 degrees C), and underwent rapid dissociation. Scatchard analysis of [3H]aniracetam binding revealed a single population of sites with an apparent KD value of approximately 70 nM and a maximal density of 3.5 pmol/mg of protein. Specifically bound [3H]aniracetam was not displaced by various metabolites of aniracetam, nor by other pyrrolidinone-containing nootropic drugs such as piracetam or oxiracetam. Subcellular distribution studies showed that a high percentage of specific [3H]aniracetam binding was present in purified synaptosomes or mitochondria, whereas specific binding was low in the myelin fraction. The possibility that at least some [3H]aniracetam binding sites are associated with glutamate receptors is supported by the evidence that specific binding was abolished when membranes were preincubated at 37 degrees C under fast shaking (a procedure that substantially reduced the amount of glutamate trapped in the membranes) and could be restored after addition of either glutamate or alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) but not kainate. The action of AMPA was antagonized by DNQX, which also reduced specific [3H]aniracetam binding in unwashed membranes. High levels of [3H]aniracetam binding were detected in hippocampal, cortical, or cerebellar membranes, which contain a high density of excitatory amino acid receptors.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Binding patterns of vanadium ions with different valence states to human serum transferrin studied by HPLC/high-resolution ICP-MS.

    PubMed

    Nagaoka, Megumi Hamano; Yamazaki, Takeshi; Maitani, Tamio

    2002-09-06

    Vanadium (V) is an essential metal for mammals and has different valence states. In blood, V is bound to serum transferrin (Tf), a glycoprotein which has two metal-binding sites, and carbonate is generally required for the binding. In this study, the binding patterns of V(III), V(IV), and V(V) to human serum Tf (hTf) were analyzed using an HPLC system equipped with an anion-exchange column and directly connected to a high-resolution inductively coupled plasma-mass spectrometer for metal detection (51V). In affinity to hTf, the three ions were ranked V(III)>V(IV)>V(V) in the presence of bicarbonate and V(III) reverse congruent V(IV)>V(V) in the absence. Intermediates in the "open forms" binding to the respective sites were detected at the initial stage. V(IV) and V(V) were bound to the N-lobe site in the "closed form" and "open form," respectively. In the absence of bicarbonate, V ions with respective valence states were bound to hTf in the "open form." In terms of binding to hTf, tri-valent V was most favorable in the presence of bicarbonate.

  6. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  7. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  8. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  9. Magnesium-binding architectures in RNA crystal structures: validation, binding preferences, classification and motif detection

    PubMed Central

    Zheng, Heping; Shabalin, Ivan G.; Handing, Katarzyna B.; Bujnicki, Janusz M.; Minor, Wladek

    2015-01-01

    The ubiquitous presence of magnesium ions in RNA has long been recognized as a key factor governing RNA folding, and is crucial for many diverse functions of RNA molecules. In this work, Mg2+-binding architectures in RNA were systematically studied using a database of RNA crystal structures from the Protein Data Bank (PDB). Due to the abundance of poorly modeled or incorrectly identified Mg2+ ions, the set of all sites was comprehensively validated and filtered to identify a benchmark dataset of 15 334 ‘reliable’ RNA-bound Mg2+ sites. The normalized frequencies by which specific RNA atoms coordinate Mg2+ were derived for both the inner and outer coordination spheres. A hierarchical classification system of Mg2+ sites in RNA structures was designed and applied to the benchmark dataset, yielding a set of 41 types of inner-sphere and 95 types of outer-sphere coordinating patterns. This classification system has also been applied to describe six previously reported Mg2+-binding motifs and detect them in new RNA structures. Investigation of the most populous site types resulted in the identification of seven novel Mg2+-binding motifs, and all RNA structures in the PDB were screened for the presence of these motifs. PMID:25800744

  10. From reads to regions: a Bioconductor workflow to detect differential binding in ChIP-seq data

    PubMed Central

    Lun, Aaron T. L.; Smyth, Gordon K.

    2016-01-01

    Chromatin immunoprecipitation with massively parallel sequencing (ChIP-seq) is widely used to identify the genomic binding sites for protein of interest. Most conventional approaches to ChIP-seq data analysis involve the detection of the absolute presence (or absence) of a binding site. However, an alternative strategy is to identify changes in the binding intensity between two biological conditions, i.e., differential binding (DB). This may yield more relevant results than conventional analyses, as changes in binding can be associated with the biological difference being investigated. The aim of this article is to facilitate the implementation of DB analyses, by comprehensively describing a computational workflow for the detection of DB regions from ChIP-seq data. The workflow is based primarily on R software packages from the open-source Bioconductor project and covers all steps of the analysis pipeline, from alignment of read sequences to interpretation and visualization of putative DB regions. In particular, detection of DB regions will be conducted using the counts for sliding windows from the csaw package, with statistical modelling performed using methods in the edgeR package. Analyses will be demonstrated on real histone mark and transcription factor data sets. This will provide readers with practical usage examples that can be applied in their own studies. PMID:26834993

  11. From benchmarking HITS-CLIP peak detection programs to a new method for identification of miRNA-binding sites from Ago2-CLIP data.

    PubMed

    Bottini, Silvia; Hamouda-Tekaya, Nedra; Tanasa, Bogdan; Zaragosi, Laure-Emmanuelle; Grandjean, Valerie; Repetto, Emanuela; Trabucchi, Michele

    2017-05-19

    Experimental evidence indicates that about 60% of miRNA-binding activity does not follow the canonical rule about the seed matching between miRNA and target mRNAs, but rather a non-canonical miRNA targeting activity outside the seed or with a seed-like motifs. Here, we propose a new unbiased method to identify canonical and non-canonical miRNA-binding sites from peaks identified by Ago2 Cross-Linked ImmunoPrecipitation associated to high-throughput sequencing (CLIP-seq). Since the quality of peaks is of pivotal importance for the final output of the proposed method, we provide a comprehensive benchmarking of four peak detection programs, namely CIMS, PIPE-CLIP, Piranha and Pyicoclip, on four publicly available Ago2-HITS-CLIP datasets and one unpublished in-house Ago2-dataset in stem cells. We measured the sensitivity, the specificity and the position accuracy toward miRNA binding sites identification, and the agreement with TargetScan. Secondly, we developed a new pipeline, called miRBShunter, to identify canonical and non-canonical miRNA-binding sites based on de novo motif identification from Ago2 peaks and prediction of miRNA::RNA heteroduplexes. miRBShunter was tested and experimentally validated on the in-house Ago2-dataset and on an Ago2-PAR-CLIP dataset in human stem cells. Overall, we provide guidelines to choose a suitable peak detection program and a new method for miRNA-target identification. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. From benchmarking HITS-CLIP peak detection programs to a new method for identification of miRNA-binding sites from Ago2-CLIP data

    PubMed Central

    Bottini, Silvia; Hamouda-Tekaya, Nedra; Tanasa, Bogdan; Zaragosi, Laure-Emmanuelle; Grandjean, Valerie; Repetto, Emanuela

    2017-01-01

    Abstract Experimental evidence indicates that about 60% of miRNA-binding activity does not follow the canonical rule about the seed matching between miRNA and target mRNAs, but rather a non-canonical miRNA targeting activity outside the seed or with a seed-like motifs. Here, we propose a new unbiased method to identify canonical and non-canonical miRNA-binding sites from peaks identified by Ago2 Cross-Linked ImmunoPrecipitation associated to high-throughput sequencing (CLIP-seq). Since the quality of peaks is of pivotal importance for the final output of the proposed method, we provide a comprehensive benchmarking of four peak detection programs, namely CIMS, PIPE-CLIP, Piranha and Pyicoclip, on four publicly available Ago2-HITS-CLIP datasets and one unpublished in-house Ago2-dataset in stem cells. We measured the sensitivity, the specificity and the position accuracy toward miRNA binding sites identification, and the agreement with TargetScan. Secondly, we developed a new pipeline, called miRBShunter, to identify canonical and non-canonical miRNA-binding sites based on de novo motif identification from Ago2 peaks and prediction of miRNA::RNA heteroduplexes. miRBShunter was tested and experimentally validated on the in-house Ago2-dataset and on an Ago2-PAR-CLIP dataset in human stem cells. Overall, we provide guidelines to choose a suitable peak detection program and a new method for miRNA-target identification. PMID:28108660

  13. Oriented Immobilization of Fab Fragments by Site-Specific Biotinylation at the Conserved Nucleotide Binding Site for Enhanced Antigen Detection.

    PubMed

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-09-08

    Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.

  14. Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

    PubMed Central

    Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

    2007-01-01

    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

  15. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  16. ProBiS-2012: web server and web services for detection of structurally similar binding sites in proteins.

    PubMed

    Konc, Janez; Janezic, Dusanka

    2012-07-01

    The ProBiS web server is a web server for detection of structurally similar binding sites in the PDB and for local pairwise alignment of protein structures. In this article, we present a new version of the ProBiS web server that is 10 times faster than earlier versions, due to the efficient parallelization of the ProBiS algorithm, which now allows significantly faster comparison of a protein query against the PDB and reduces the calculation time for scanning the entire PDB from hours to minutes. It also features new web services, and an improved user interface. In addition, the new web server is united with the ProBiS-Database and thus provides instant access to pre-calculated protein similarity profiles for over 29 000 non-redundant protein structures. The ProBiS web server is particularly adept at detection of secondary binding sites in proteins. It is freely available at http://probis.cmm.ki.si/old-version, and the new ProBiS web server is at http://probis.cmm.ki.si.

  17. ProBiS-2012: web server and web services for detection of structurally similar binding sites in proteins

    PubMed Central

    Konc, Janez; Janežič, Dušanka

    2012-01-01

    The ProBiS web server is a web server for detection of structurally similar binding sites in the PDB and for local pairwise alignment of protein structures. In this article, we present a new version of the ProBiS web server that is 10 times faster than earlier versions, due to the efficient parallelization of the ProBiS algorithm, which now allows significantly faster comparison of a protein query against the PDB and reduces the calculation time for scanning the entire PDB from hours to minutes. It also features new web services, and an improved user interface. In addition, the new web server is united with the ProBiS-Database and thus provides instant access to pre-calculated protein similarity profiles for over 29 000 non-redundant protein structures. The ProBiS web server is particularly adept at detection of secondary binding sites in proteins. It is freely available at http://probis.cmm.ki.si/old-version, and the new ProBiS web server is at http://probis.cmm.ki.si. PMID:22600737

  18. Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase

    PubMed Central

    Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel

    2012-01-01

    The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308

  19. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  20. FINDSITE-metal: Integrating evolutionary information and machine learning for structure-based metal binding site prediction at the proteome level

    PubMed Central

    Brylinski, Michal; Skolnick, Jeffrey

    2010-01-01

    The rapid accumulation of gene sequences, many of which are hypothetical proteins with unknown function, has stimulated the development of accurate computational tools for protein function prediction with evolution/structure-based approaches showing considerable promise. In this paper, we present FINDSITE-metal, a new threading-based method designed specifically to detect metal binding sites in modeled protein structures. Comprehensive benchmarks using different quality protein structures show that weakly homologous protein models provide sufficient structural information for quite accurate annotation by FINDSITE-metal. Combining structure/evolutionary information with machine learning results in highly accurate metal binding annotations; for protein models constructed by TASSER, whose average Cα RMSD from the native structure is 8.9 Å, 59.5% (71.9%) of the best of top five predicted metal locations are within 4 Å (8 Å) from a bound metal in the crystal structure. For most of the targets, multiple metal binding sites are detected with the best predicted binding site at rank 1 and within the top 2 ranks in 65.6% and 83.1% of the cases, respectively. Furthermore, for iron, copper, zinc, calcium and magnesium ions, the binding metal can be predicted with high, typically 70-90%, accuracy. FINDSITE-metal also provides a set of confidence indexes that help assess the reliability of predictions. Finally, we describe the proteome-wide application of FINDSITE-metal that quantifies the metal binding complement of the human proteome. FINDSITE-metal is freely available to the academic community at http://cssb.biology.gatech.edu/findsite-metal/. PMID:21287609

  1. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  2. ProBiS tools (algorithm, database, and web servers) for predicting and modeling of biologically interesting proteins.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2017-09-01

    ProBiS (Protein Binding Sites) Tools consist of algorithm, database, and web servers for prediction of binding sites and protein ligands based on the detection of structurally similar binding sites in the Protein Data Bank. In this article, we review the operations that ProBiS Tools perform, provide comments on the evolution of the tools, and give some implementation details. We review some of its applications to biologically interesting proteins. ProBiS Tools are freely available at http://probis.cmm.ki.si and http://probis.nih.gov. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Binding Site Concentration Explains the Differential Susceptibility of Chilo suppressalis and Sesamia inferens to Cry1A-Producing Rice

    PubMed Central

    Han, Chao; Liu, Zewen; Chen, Fajun; Hou, Maolin; Peng, Yufa

    2014-01-01

    Chilo suppressalis and Sesamia inferens are two important lepidopteran rice pests that occur concurrently during outbreaks in paddy fields in the main rice-growing areas of China. Previous and current field tests demonstrate that the transgenic rice line Huahui 1 (HH1) producing a Cry1Ab-Cry1Ac hybrid toxin from the bacterium Bacillus thuringiensis reduces egg and larval densities of C. suppressalis but not of S. inferens. This differential susceptibility to HH1 rice correlates with the reduced susceptibility to Cry1Ab and Cry1Ac toxins in S. inferens larvae compared to C. suppressalis larvae. The goal of this study was to identify the mechanism responsible for this differential susceptibility. In saturation binding assays, both Cry1Ab and Cry1Ac toxins bound with high affinity and in a saturable manner to midgut brush border membrane vesicles (BBMV) from C. suppressalis and S. inferens larvae. While binding affinities were similar, a dramatically lower concentration of Cry1A toxin binding sites was detected for S. inferens BBMV than for C. suppressalis BBMV. In contrast, no significant differences between species were detected for Cry1Ca toxin binding to BBMV. Ligand blotting detected BBMV proteins binding Cry1Ac or Cry1Ca toxins, some of them unique to C. suppressalis or S. inferens. These data support that reduced Cry1A binding site concentration is associated with a lower susceptibility to Cry1A toxins and HH1 rice in S. inferens larvae than in C. suppressalis larvae. Moreover, our data support Cry1Ca as a candidate for pyramiding efforts with Cry1A-producing rice to extend the activity range and durability of this technology against rice stem borers. PMID:24928872

  4. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  5. [Molecular organization of glutamate-sensitive chemoexcitatory membranes of nerve cells. Binding of L-[3H]glutamate to synaptic membranes of the rat cerebral cortex].

    PubMed

    Dambinova, S A; Gorodinskiĭ, A I

    1984-01-01

    The binding of L-[3H]glutamate to rat cerebral cortex synaptic membranes was investigated. Two types of binding sites, a Na+-independent (Kd = 140-160 nm; Bmax = 3.8-4.5 pmol-mg of protein) and a Na+-dependent (Kd = 2.0 microM; Bmax = 45-50 pmol/mg of protein) ones, were detected. The dependence of Na+-insensitive binding on time and temperature and membrane content in a sample was determined. Mono- and divalent cations (5-10 mM) potentiated specific binding by 2.1-3.3 times. The Na+-dependent binding is associated with active transport systems, while the Na+-independent one-with true receptor binding. The relationship between CNS glutamate receptors and Na+-independent binding sites is discussed.

  6. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  7. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  8. A novel site contributing to growth-arrest-specific gene 6 binding to its receptors as revealed by a human monoclonal antibody

    PubMed Central

    2004-01-01

    Gas6 (growth-arrest-specific gene 6) is a vitamin K-dependent protein known to activate the Axl family of receptor tyrosine kinases. It is an important regulator of thrombosis and many other biological functions. The C-terminus of Gas6 binds to receptors and consists of two laminin-like globular domains LG1 and LG2. It has been reported that a Ca2+-binding site at the junction of LG1 and LG2 domains and a hydrophobic patch at the LG2 domain are important for receptor binding [Sasaki, Knyazev, Cheburkin, Gohring, Tisi, Ullrich, Timpl and Hohenester (2002) J. Biol. Chem. 277, 44164–44170]. In the present study, we developed a neutralizing human monoclonal antibody, named CNTO300, for Gas6. The antibody was generated by immunization of human IgG-expressing transgenic mice with recombinant human Gas6 protein and the anti-Gas6 IgG sequences were rescued from an unstable hybridoma clone. Binding of Gas6 to its receptors was partially inhibited by the CNTO300 antibody in a dose-dependent manner. To characterize further the interaction between Gas6 and this antibody, the binding kinetics of CNTO300 for recombinant Gas6 were compared with independently expressed LG1 and LG2. The CNTO300 antibody showed comparable binding affinity, yet different dependence on Ca2+, to Gas6 and LG1. No binding to LG2 was detected. In the presence of EDTA, binding of the antibody to Gas6 was disrupted, but no significant effect of EDTA on LG1 binding was evident. Further epitope mapping identified a Gas6 peptide sequence recognized by the CNTO300 antibody. This peptide sequence was found to be located at the LG1 domain distant from the Ca2+-binding site and the hydrophobic patch. Co-interaction of Gas6 with its receptor and CNTO300 antibody was detected by BIAcore analysis, suggesting a second receptor-binding site on the LG1 domain. This hypothesis was further supported by direct binding of Gas6 receptors to an independently expressed LG1 domain. Our results revealed, for the first time, a second binding site for Gas6–receptor interaction. PMID:15579134

  9. Programming A Molecular Relay for Ultrasensitive Biodetection through 129 Xe NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yanfei; Roose, Benjamin W.; Philbin, John P.

    2015-12-21

    We reported a supramolecular strategy for detecting specific proteins in complex media by using hyperpolarized 129Xe NMR. A cucurbit[6]uril (CB[6])-based molecular relay was programmed for three sequential equilibrium conditions by designing a two-faced guest (TFG) that initially binds CB[6] and blocks the CB[6]–Xe interaction. Moreover, the protein analyte recruits the TFG and frees CB[6] for Xe binding. TFGs containing CB[6]- and carbonic anhydrase II (CAII)-binding domains were synthesized in one or two steps. X-ray crystallography confirmed TFG binding to Zn 2+ in the deep CAII active-site cleft, which precludes simultaneous CB[6] binding. The molecular relay was reprogrammed to detect avidinmore » by using a different TFG. Finally, Xe binding by CB[6] was detected in buffer and in E. coli cultures expressing CAII through ultrasensitive 129Xe NMR spectroscopy.« less

  10. Demonstration of clomipramine and venlafaxine occupation at serotonin reuptake sites in man in vivo.

    PubMed

    Malizia, A L; Melichar, J M; Brown, D J; Gunn, R N; Reynolds, A; Jones, T; Nutt, D J

    1997-01-01

    We describe the use of 11CRTI-55 and the Multiple Objects Coincidences Counter (MOCC) to detect in-vivo binding to peripheral serotonin reuptake sites (left chest comprising platelet and lung serotonin reuptake sites) in man. Displacement and preloading experiments with clomipramine and venlafaxine in two healthy volunteers demonstrated that 11CRTI-55 binding is decreased in a dose-dependent fashion by both these drugs which bind to the serotonin transporter. In addition parallel data from the total head curve (representing 11CRTI-55 binding to central serotonin and dopamine (DA) reuptake sites) suggest that prior blockade of the serotonin transporter may be a useful strategy to maximize radioactive counts in the head when measuring the DA transporter. The MOCC is likely to be useful to determine sequential indices of relative serotonin reuptake blockade in patients on treatment.

  11. DNA-binding regulates site-specific ubiquitination of IRF-1.

    PubMed

    Landré, Vivien; Pion, Emmanuelle; Narayan, Vikram; Xirodimas, Dimitris P; Ball, Kathryn L

    2013-02-01

    Understanding the determinants for site-specific ubiquitination by E3 ligase components of the ubiquitin machinery is proving to be a challenge. In the present study we investigate the role of an E3 ligase docking site (Mf2 domain) in an intrinsically disordered domain of IRF-1 [IFN (interferon) regulatory factor-1], a short-lived IFNγ-regulated transcription factor, in ubiquitination of the protein. Ubiquitin modification of full-length IRF-1 by E3 ligases such as CHIP [C-terminus of the Hsc (heat-shock cognate) 70-interacting protein] and MDM2 (murine double minute 2), which dock to the Mf2 domain, was specific for lysine residues found predominantly in loop structures that extend from the DNA-binding domain, whereas no modification was detected in the more conformationally flexible C-terminal half of the protein. The E3 docking site was not available when IRF-1 was in its DNA-bound conformation and cognate DNA-binding sequences strongly suppressed ubiquitination, highlighting a strict relationship between ligase binding and site-specific modification at residues in the DNA-binding domain. Hyperubiquitination of a non-DNA-binding mutant supports a mechanism where an active DNA-bound pool of IRF-1 is protected from polyubiquitination and degradation.

  12. Complexation of iron hexacyanides by cytochrome c. Evidence for electron exchange at the exposed heme edge.

    PubMed

    Stellwagen, E; Cass, R D

    1975-03-25

    Electrostatic binding of at least two anionic iron hexacyanides to cationic horse heart cytochrome c was demonstrated by equilibrium dialysis measurements. No binding was detected following trifluoroacetylation of all of the 19 lysine residues. Replacement of the natural heme iron ligand methionine 80 by the alternative intrinsic ligand lysine 79 but not the extrinsic ligand imidazole resulted in the loss of one hexacyanide binding site. It is proposed that this site is located at the exposed heme edge and is functional in electron exchange.

  13. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  14. [125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors

    PubMed Central

    Dumont, Yvan; Quirion, Rémi

    2000-01-01

    GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200

  15. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  16. Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions

    NASA Astrophysics Data System (ADS)

    Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

    2016-11-01

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

  17. Hb taradale [beta82(EF6)Lys-->Arg]: a novel mutation at a 2,3-diphosphoglycerate binding site.

    PubMed

    Brennan, Stephen O; Sheen, Campbell; Chan, Tim; George, Peter M

    2005-01-01

    Hb Taradale [beta82(EF6)Lys-->Arg] was initially detected as a split Hb A0 peak on Hb A1c, monitoring. Red cell parameters, hemoglobin (Hb) electrophoresis and stability tests were normal. Mass spectrometry (ms) clearly identified a variant beta chain with a mass increase of 28 Da and peptide mapping located the mutation site to peptide betaT-9. DNA sequencing confirmed the presence of a novel beta82(EF6)Lys-->Arg mutation. This conservative substitution at a 2,3-diphosphoglycerate (2,3-DPG) binding site did not, however, appear to affect the P50 for oxygen binding.

  18. Novel synthesis and structural characterization of a high-affinity paramagnetic kinase probe for the identification of non-ATP site binders by nuclear magnetic resonance.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moy, Franklin J.; Lee, Arthur; Gavrin, Lori Krim

    2010-07-23

    To aid in the pursuit of selective kinase inhibitors, we have developed a unique ATP site binder tool for the detection of binders outside the ATP site by nuclear magnetic resonance (NMR). We report here the novel synthesis that led to this paramagnetic spin-labeled pyrazolopyrimidine probe (1), which exhibits nanomolar inhibitory activity against multiple kinases. We demonstrate the application of this probe by performing NMR binding experiments with Lck and Src kinases and utilize it to detect the binding of two compounds proximal to the ATP site. The complex structure of the probe with Lck is also presented, revealing howmore » the probe fits in the ATP site and the specific interactions it has with the protein. We believe that this spin-labeled probe is a valuable tool that holds broad applicability in a screen for non-ATP site binders.« less

  19. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. Rapid on-site/in-situ detection of heavy metal ions in environmental water using a structure-switching DNA optical biosensor.

    PubMed

    Long, Feng; Zhu, Anna; Shi, Hanchang; Wang, Hongchen; Liu, Jingquan

    2013-01-01

    A structure-switching DNA optical biosensor for rapid on-site/in situ detection of heavy metal ions is reported. Mercury ions (Hg²⁺), highly toxic and ubiquitous pollutants, were selected as model target. In this system, fluorescence-labeled DNA containing T-T mismatch structure was introduced to bind with DNA probes immobilized onto the sensor surface. In the presence of Hg²⁺, some of the fluorescence-labeled DNAs bind with Hg²⁺ to form T-Hg²⁺-T complexes through the folding of themselves into a hairpin structure and dehybridization from the sensor surface, which leads to decrease in fluorescence signal. The total analysis time for a single sample was less than 10 min with detection limit of 1.2 nM. The rapid on-site/in situ determination of Hg²⁺ was readily performed in natural water. This sensing strategy can be extended in principle to other metal ions by substituting the T-Hg²⁺-T complexes with other specificity structures that selectively bind to other analytes.

  1. RNA detection using peptide-inserted Renilla luciferase.

    PubMed

    Andou, Takashi; Endoh, Tamaki; Mie, Masayasu; Kobatake, Eiry

    2009-01-01

    A novel complementation system with short peptide-inserted-Renilla luciferase (PI-Rluc) and split-RNA probes was constructed for noninvasive RNA detection. The RNA binding peptides HIV-1 Rev and BIV Tat were used as inserted peptides. They display induced fit conformational changes upon binding to specific RNAs and trigger complementation or discomplementation of Rluc. Split-RNA probes were designed to reform the peptide binding site upon hybridization with arbitrarily selected target RNA. This set of recombinant protein and split-RNA probes enabled a high degree of sensitivity in RNA detection. In this study, we show that the Rluc system is comparable to Fluc, but that its detection limit for arbitrarily selected RNA (at least 100 pM) exceeds that of Fluc by approximately two orders of magnitude.

  2. A highly selective and sensitive fluorescent chemosensor and its application for rapid on-site detection of Al3 +

    NASA Astrophysics Data System (ADS)

    Yue, Xiao-li; Wang, Zhao-qing; Li, Chao-rui; Yang, Zheng-yin

    2018-03-01

    In this paper, a simple naphthalene-based derivative (HL) has been designed and synthesized as a Al3 +-selective fluorescent chemosensor based on the PET mechanism. HL exhibited high selectivity and sensitivity towards Al3 + over other commonly coexisting metal ions in ethanol with a detection limit of 2.72 nM. The 1:1 binding stoichiometry of the complex (HL-Al3 +) was determined from the Job's plot based on fluorescence titrations and the ESI-MS spectrum data. Moreover, the binding site of HL with Al3 + was assured by the 1H NMR titration experiment. The binding constant (Ka) of the complex (HL-Al3 +) was calculated to be 5.06 × 104 M- 1 according to the Benesi-Hildebrand equation. In addition, the recognizing process of HL towards Al3 + was chemically reversible by adding Na2EDTA. Importantly, HL could directly and rapidly detect aluminum ion through the filter paper without resorting to additional instrumental analysis.

  3. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    PubMed

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  4. Detection of Specific Solvent Rearrangement Regions of an Enzyme: NMR and ITC Studies with Aminoglycoside Phosphotransferase(3??)-IIIa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ozen, C.; Norris, Adrianne; Land, Miriam L

    2008-01-01

    This work describes differential effects of solvent in complexes of the aminoglycoside phosphotransferase(3¢)-IIIa (APH) with different aminoglycosides and the detection of change in solvent structure at specific sites away from substrates. Binding of kanamycins to APH occurs with a larger negative ¢H in H2O relative to D2O (¢¢H(H2O-D2O) < 0), while the reverse is true for neomycins. Unusually large negative ¢Cp values were observed for binding of aminoglycosides to APH. ¢Cp for the APHneomycin complex was -1.6 kcalâmol-1âdeg-1. A break at 30 C was observed in the APH-kanamycin complex yielding ¢Cp values of -0.7 kcalâmol-1âdeg-1 and -3.8 kcalâmol-1âdeg-1 below andmore » above 30 C, respectively. Neither the change in accessible surface area (¢ASA) nor contributions from heats of ionization were sufficient to explain the large negative ¢Cp values. Most significantly, 15N-1H HSQC experiments showed that temperature-dependent shifts of the backbone amide protons of Leu 88, Ser 91, Cys 98, and Leu143 revealed a break at 30 C only in the APH-kanamycin complex in spectra collected between 21 C and 38 C. These amino acids represent solVent reorganization sites that experience a change in solvent structure in their immediate environment as structurally different ligands bind to the enzyme. These residues were away from the substrate binding site and distributed in three hydrophobic patches in APH. Overall, our results show that a large number of factors affect ¢Cp and binding of structurally different ligand groups cause different solvent structure in the active site as well as differentially affecting specific sites away from the ligand binding site.« less

  5. Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

    PubMed Central

    Gupta, Gagan Deep; Kumar, Vinay

    2012-01-01

    Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

  6. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

    PubMed Central

    Arthur, A K; Höss, A; Fanning, E

    1988-01-01

    The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

  7. In situ detection of warfarin using time-correlated single-photon counting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosengren, Annika M.; Karlsson, Bjoern C.G.; Naeslund, Inga

    Highlights: {yields} Direct in situ measurement of specific isomeric forms of the anticoagulant warfarin. {yields} TCSPC spectroscopy in conjunction with synthetic Sudlow I binding site receptors. {yields} Development of sensor principle for use in clinical and environmental monitoring. -- Abstract: Here we report on a novel method for the direct in situ measurement of specific isomeric forms of the anticoagulant warfarin using time correlated single-photon counting (TCSPC) spectroscopy in conjunction with synthetic Sudlow I binding site receptors. The method is highly robust over the clinically significant concentration range, and demonstrates the potential of the binding site mimics in conjunction withmore » the spectroscopic strategy employed here for the determination of this important pharmaceutical in clinical or even environmental samples.« less

  8. Nicotinamide Cofactors Suppress Active-Site Labeling of Aldehyde Dehydrogenases.

    PubMed

    Stiti, Naim; Chandrasekar, Balakumaran; Strubl, Laura; Mohammed, Shabaz; Bartels, Dorothea; van der Hoorn, Renier A L

    2016-06-17

    Active site labeling by (re)activity-based probes is a powerful chemical proteomic tool to globally map active sites in native proteomes without using substrates. Active site labeling is usually taken as a readout for the active state of the enzyme because labeling reflects the availability and reactivity of active sites, which are hallmarks for enzyme activities. Here, we show that this relationship holds tightly, but we also reveal an important exception to this rule. Labeling of Arabidopsis ALDH3H1 with a chloroacetamide probe occurs at the catalytic Cys, and labeling is suppressed upon nitrosylation and oxidation, and upon treatment with other Cys modifiers. These experiments display a consistent and strong correlation between active site labeling and enzymatic activity. Surprisingly, however, labeling is suppressed by the cofactor NAD(+), and this property is shared with other members of the ALDH superfamily and also detected for unrelated GAPDH enzymes with an unrelated hydantoin-based probe in crude extracts of plant cell cultures. Suppression requires cofactor binding to its binding pocket. Labeling is also suppressed by ALDH modulators that bind at the substrate entrance tunnel, confirming that labeling occurs through the substrate-binding cavity. Our data indicate that cofactor binding adjusts the catalytic Cys into a conformation that reduces the reactivity toward chloroacetamide probes.

  9. Evidence for a modulatory effect of sulbutiamine on glutamatergic and dopaminergic cortical transmissions in the rat brain.

    PubMed

    Trovero, F; Gobbi, M; Weil-Fuggaza, J; Besson, M J; Brochet, D; Pirot, S

    2000-09-29

    Chronic treatment of rats by sulbutiamine induced no change in density of N-methyl-D-aspartate (NMDA) and (+/-)-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors in the cingular cortex, but a significant decrease of the kainate binding sites, as measured by quantitative autoradiography. In the same treated animals, an increase of D1 dopaminergic (DA) binding sites was measured both in the prefrontal and the cingular cortex, while no modification of the D2 binding sites was detected. Furthermore, an acute sulbutiamine administration induced a decrease of kainate binding sites but no change of the density of D1 and D2 DA receptors. Acute sulbutiamine injection led to a decrease of the DA levels in the prefrontal cortex and 3,4-dihydroxyphenylacetic acid levels in both the cingular and the prefrontal cortex. These observations are discussed in terms of a modulatory effect of sulbutiamine on both dopaminergic and glutamatergic cortical transmissions.

  10. Characterization of Conserved Tandem Donor Sites and Intronic Motifs Required for Alternative Splicing in Corticosteroid Receptor Genes

    PubMed Central

    Qian, Xiaoxiao; Matthews, Laura; Lightman, Stafford; Ray, David; Norman, Michael

    2015-01-01

    Alternative splicing events from tandem donor sites result in mRNA variants coding for additional amino acids in the DNA binding domain of both the glucocorticoid (GR) and mineralocorticoid (MR) receptors. We now show that expression of both splice variants is extensively conserved in mammalian species, providing strong evidence for their functional significance. An exception to the conservation of the MR tandem splice site (an A at position +5 of the MR+12 donor site in the mouse) was predicted to decrease U1 small nuclear RNA binding. In accord with this prediction, we were unable to detect the MR+12 variant in this species. The one exception to the conservation of the GR tandem splice site, an A at position +3 of the platypus GRγ donor site that was predicted to enhance binding of U1 snRNA, was unexpectedly associated with decreased expression of the variant from the endogenous gene as well as a minigene. An intronic pyrimidine motif present in both GR and MR genes was found to be critical for usage of the downstream donor site, and overexpression of TIA1/TIAL1 RNA binding proteins, which are known to bind such motifs, led to a marked increase in the proportion of GRγ and MR+12. These results provide striking evidence for conservation of a complex splicing mechanism that involves processes other than stochastic spliceosome binding and identify a mechanism that would allow regulation of variant expression. PMID:19819975

  11. Lectin functionalized ZnO nanoarrays as a 3D nano-biointerface for bacterial detection.

    PubMed

    Zheng, Laibao; Wan, Yi; Qi, Peng; Sun, Yan; Zhang, Dun; Yu, Liangmin

    2017-05-15

    The detection of pathogenic bacteria is essential in various fields, such as food safety, water environmental analysis, or clinical diagnosis. Although rapid and selective techniques have been achieved based on the fast and specific binding of recognitions elements and target, the sensitive detection of bacterial pathogens was limited by their low targets-binding efficiency. The three-dimensional (3D) nano-biointerface, compared with the two-dimensional (2D) flat substrate, has a much higher binding capacity, which can offer more reactive sites to bind with bacterial targets, resulting in a great improvement of detection sensitivity. Herein, a lectin functionalized ZnO nanorod (ZnO-NR) array has been fabricated and employed as a 3D nano-biointerface for Escherichia coli (E. coli) capture and detection by multivalent binding of concanavalin A (ConA) with polysaccharides on the cellular surface of E. coli. The 3D lectin functionalized ZnO-NR array-based assay shows reasonable detection limit and efficiently expanded linear range (1.0×10 3 to 1.0×10 7 cfumL -1 ) for pathogen detection. The platform has a potential for further applications and provides an excellent sensitivity approach for detection of pathogenic bacteria. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Binding site concentration explains the differential susceptibility of Chilo suppressalis and Sesamia inferens to Cry1A-producing rice.

    PubMed

    Han, Lanzhi; Han, Chao; Liu, Zewen; Chen, Fajun; Jurat-Fuentes, Juan Luis; Hou, Maolin; Peng, Yufa

    2014-08-01

    Chilo suppressalis and Sesamia inferens are two important lepidopteran rice pests that occur concurrently during outbreaks in paddy fields in the main rice-growing areas of China. Previous and current field tests demonstrate that the transgenic rice line Huahui 1 (HH1) producing a Cry1Ab-Cry1Ac hybrid toxin from the bacterium Bacillus thuringiensis reduces egg and larval densities of C. suppressalis but not of S. inferens. This differential susceptibility to HH1 rice correlates with the reduced susceptibility to Cry1Ab and Cry1Ac toxins in S. inferens larvae compared to C. suppressalis larvae. The goal of this study was to identify the mechanism responsible for this differential susceptibility. In saturation binding assays, both Cry1Ab and Cry1Ac toxins bound with high affinity and in a saturable manner to midgut brush border membrane vesicles (BBMV) from C. suppressalis and S. inferens larvae. While binding affinities were similar, a dramatically lower concentration of Cry1A toxin binding sites was detected for S. inferens BBMV than for C. suppressalis BBMV. In contrast, no significant differences between species were detected for Cry1Ca toxin binding to BBMV. Ligand blotting detected BBMV proteins binding Cry1Ac or Cry1Ca toxins, some of them unique to C. suppressalis or S. inferens. These data support that reduced Cry1A binding site concentration is associated with a lower susceptibility to Cry1A toxins and HH1 rice in S. inferens larvae than in C. suppressalis larvae. Moreover, our data support Cry1Ca as a candidate for pyramiding efforts with Cry1A-producing rice to extend the activity range and durability of this technology against rice stem borers. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

    PubMed Central

    Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2007-01-01

    We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

  14. Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy.

    PubMed

    Poiroux, Guillaume; Barre, Annick; van Damme, Els J M; Benoist, Hervé; Rougé, Pierre

    2017-06-09

    Aberrant O -glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O -glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola , and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O -glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors.

  15. Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy

    PubMed Central

    Poiroux, Guillaume; Barre, Annick; van Damme, Els J. M.; Benoist, Hervé; Rougé, Pierre

    2017-01-01

    Aberrant O-glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O-glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola, and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O-glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors. PMID:28598369

  16. PoSSuM v.2.0: data update and a new function for investigating ligand analogs and target proteins of small-molecule drugs.

    PubMed

    Ito, Jun-ichi; Ikeda, Kazuyoshi; Yamada, Kazunori; Mizuguchi, Kenji; Tomii, Kentaro

    2015-01-01

    PoSSuM (http://possum.cbrc.jp/PoSSuM/) is a database for detecting similar small-molecule binding sites on proteins. Since its initial release in 2011, PoSSuM has grown to provide information related to 49 million pairs of similar binding sites discovered among 5.5 million known and putative binding sites. This enlargement of the database is expected to enhance opportunities for biological and pharmaceutical applications, such as predictions of new functions and drug discovery. In this release, we have provided a new service named PoSSuM drug search (PoSSuMds) at http://possum.cbrc.jp/PoSSuM/drug_search/, in which we selected 194 approved drug compounds retrieved from ChEMBL, and detected their known binding pockets and pockets that are similar to them. Users can access and download all of the search results via a new web interface, which is useful for finding ligand analogs as well as potential target proteins. Furthermore, PoSSuMds enables users to explore the binding pocket universe within PoSSuM. Additionally, we have improved the web interface with new functions, including sortable tables and a viewer for visualizing and downloading superimposed pockets. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Selective increases in serotonin 5-HT1B/1D and 5-HT2A/2C binding sites in adult rat basal ganglia following lesions of serotonergic neurons.

    PubMed

    Compan, V; Segu, L; Buhot, M C; Daszuta, A

    1998-05-18

    Quantitative autoradiography was used to examine possible adaptive changes in serotonin 5-HT1B/1D and 5-HT2A/2C receptor binding sites in adult rat basal ganglia, after partial or severe lesions of serotonergic neurons produced by intraraphe injections of variable amounts of 5,7-dihydroxytryptamine. In controls, the 5-HT1B/1D sites labeled with S-CM-G[125I]TNH2 were evenly distributed in the core and the shell of the nucleus accumbens. The density of 5-HT1B/1D sites was higher in the ventral than dorsal part of the striatum and no regional differences were detected along the rostrocaudal axis of the structure. The 5-HT2A/2C sites labeled with [125I]DOI were preferentially distributed in the mediodorsal striatum and higher densities were detected in the shell than core of the nucleus accumbens. Following 5,7-dihydroxytryptamine injections, there were no changes in binding of either receptor subtype after partial lesions entailing 80-90% 5-HT depletions. After severe 5-HT depletions (over 95%), large increases in 5-HT1B/1D binding were observed in the substantia nigra (78%), but no changes took place in the globus pallidus. Increases in 5-HT1B/1D binding were also detected in the shell of the nucleus accumbens (27%). Similar sized increases in 5-HT2A/2C binding (22%) were restricted to the medial striatum. The present results suggest a preferential association between 5-HT1B/1D receptors and the striatonigral neurons containing substance P, as indicated by the striatal distribution of these receptors and their selective increases in the substantia nigra after severe 5-HT deprivation. We recently proposed a similar relationship between the 5-HT4 receptors and the striatopallidal neurons containing met-enkephalin. Moreover, the increases in 5-HT1B/1D binding in the substantia nigra and in the shell of the nucleus accumbens reinforce the view of an implication of this receptor subtype in motor functions. In contrast, the prominent increases in 5-HT2A/2C binding after severe 5-HT deprivation as restricted to the medial region of the striatum and suggest up-regulation of most probably 5-HT2C receptors in a region implicated in cognitive functions. Copyright 1998 Elsevier Science B. V.

  18. An Augmented Pocketome: Detection and Analysis of Small-Molecule Binding Pockets in Proteins of Known 3D Structure.

    PubMed

    Bhagavat, Raghu; Sankar, Santhosh; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2018-03-06

    Protein-ligand interactions form the basis of most cellular events. Identifying ligand binding pockets in proteins will greatly facilitate rationalizing and predicting protein function. Ligand binding sites are unknown for many proteins of known three-dimensional (3D) structure, creating a gap in our understanding of protein structure-function relationships. To bridge this gap, we detect pockets in proteins of known 3D structures, using computational techniques. This augmented pocketome (PocketDB) consists of 249,096 pockets, which is about seven times larger than what is currently known. We deduce possible ligand associations for about 46% of the newly identified pockets. The augmented pocketome, when subjected to clustering based on similarities among pockets, yielded 2,161 site types, which are associated with 1,037 ligand types, together providing fold-site-type-ligand-type associations. The PocketDB resource facilitates a structure-based function annotation, delineation of the structural basis of ligand recognition, and provides functional clues for domains of unknown functions, allosteric proteins, and druggable pockets. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Gonadotropin stimulation of cyclic adenosine monophosphate and testosterone production without detectable high-affinity binding sites in purified Leydig cells from rat testis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Browne, E.S.; Bhalla, V.K.

    1991-02-01

    Rat testicular interstitial cells were separated by three different gradient-density procedures and, with each, two biochemically and morphologically distinct cell fractions were isolated. The lighter density cells in fraction-I bound iodine 125-labeled human chorionic gonadotropin (hCG) with high-affinity (apparent equilibrium dissociation constant, Kd, approximately 10{sup {minus} 10} M) without producing either cyclic adenosine monophosphate or testosterone in response to hormone action. The heavier-density cells displayed morphologic features typical of Leydig cells and produced cyclic adenosine monophosphate and testosterone in the presence of hCG without detectable {sup 125}I-labeled hCG high-affinity binding. These cell fractions were further characterized by studies using deglycosylatedmore » hCG, a known antagonist to hCG action. Cell concentration-dependent studies with purified Leydig cells revealed that maximal testosterone production was achieved when lower cell concentrations (0.5 x 10(6) cells/250 microliters) were used for in vitro hCG stimulation assays. Under these conditions, the {sup 125}I-labeled hCG binding was barely detectable (2.24 fmol; 2,698 sites/cell). Furthermore, these studies revealed that the hCG-specific binding in Leydig cells is overestimated by the classic method for nonspecific binding correction using excess unlabeled hormone. An alternate method is presented.« less

  20. Application of NMR Methods to Identify Detection Reagents for Use in the Development of Robust Nanosensors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Krishnan, V V; Balhorn, R

    2004-04-29

    Nuclear Magnetic Resonance (NMR) spectroscopy is a powerful technique for studying bi-molecular interactions at the atomic scale. Our NMR lab is involved in the identification of small molecules, or ligands that bind to target protein receptors, such as tetanus (TeNT) and botulinum (BoNT) neurotoxins, anthrax proteins and HLA-DR10 receptors on non-Hodgkin's lymphoma cancer cells. Once low affinity binders are identified, they can be linked together to produce multidentate synthetic high affinity ligands (SHALs) that have very high specificity for their target protein receptors. An important nanotechnology application for SHALs is their use in the development of robust chemical sensors ormore » biochips for the detection of pathogen proteins in environmental samples or body fluids. Here, we describe a recently developed NMR competition assay based on transferred nuclear Overhauser effect spectroscopy (trNOESY) that enables the identification of sets of ligands that bind to the same site, or a different site, on the surface of TeNT fragment C (TetC) than a known ''marker'' ligand, doxorubicin. Using this assay, we can identify the optimal pairs of ligands to be linked together for creating detection reagents, as well as estimate the relative binding constants for ligands competing for the same site.« less

  1. Detection of the CLOCK/BMAL1 heterodimer using a nucleic acid probe with cycling probe technology.

    PubMed

    Nakagawa, Kazuhiro; Yamamoto, Takuro; Yasuda, Akio

    2010-09-15

    An isothermal signal amplification technique for specific DNA sequences, known as cycling probe technology (CPT), has enabled rapid acquisition of genomic information. Here we report an analogous technique for the detection of an activated transcription factor, a transcription element-binding assay with fluorescent amplification by apurinic/apyrimidinic (AP) site lysis cycle (TEFAL). This simple amplification assay can detect activated transcription factors by using a unique nucleic acid probe containing a consensus binding sequence and an AP site, which enables the CPT reaction with AP endonuclease. In this article, we demonstrate that this method detects the functional CLOCK/BMAL1 heterodimer via the TEFAL probe containing the E-box consensus sequence to which the CLOCK/BMAL1 heterodimer binds. Using TEFAL combined with immunoassays, we measured oscillations in the amount of CLOCK/BMAL1 heterodimer in serum-stimulated HeLa cells. Furthermore, we succeeded in measuring the circadian accumulation of the functional CLOCK/BMAL1 heterodimer in human buccal mucosa cells. TEFAL contributes greatly to the study of transcription factor activation in mammalian tissues and cell extracts and is a powerful tool for less invasive investigation of human circadian rhythms. 2010 Elsevier Inc. All rights reserved.

  2. CisMiner: Genome-Wide In-Silico Cis-Regulatory Module Prediction by Fuzzy Itemset Mining

    PubMed Central

    Navarro, Carmen; Lopez, Francisco J.; Cano, Carlos; Garcia-Alcalde, Fernando; Blanco, Armando

    2014-01-01

    Eukaryotic gene control regions are known to be spread throughout non-coding DNA sequences which may appear distant from the gene promoter. Transcription factors are proteins that coordinately bind to these regions at transcription factor binding sites to regulate gene expression. Several tools allow to detect significant co-occurrences of closely located binding sites (cis-regulatory modules, CRMs). However, these tools present at least one of the following limitations: 1) scope limited to promoter or conserved regions of the genome; 2) do not allow to identify combinations involving more than two motifs; 3) require prior information about target motifs. In this work we present CisMiner, a novel methodology to detect putative CRMs by means of a fuzzy itemset mining approach able to operate at genome-wide scale. CisMiner allows to perform a blind search of CRMs without any prior information about target CRMs nor limitation in the number of motifs. CisMiner tackles the combinatorial complexity of genome-wide cis-regulatory module extraction using a natural representation of motif combinations as itemsets and applying the Top-Down Fuzzy Frequent- Pattern Tree algorithm to identify significant itemsets. Fuzzy technology allows CisMiner to better handle the imprecision and noise inherent to regulatory processes. Results obtained for a set of well-known binding sites in the S. cerevisiae genome show that our method yields highly reliable predictions. Furthermore, CisMiner was also applied to putative in-silico predicted transcription factor binding sites to identify significant combinations in S. cerevisiae and D. melanogaster, proving that our approach can be further applied genome-wide to more complex genomes. CisMiner is freely accesible at: http://genome2.ugr.es/cisminer. CisMiner can be queried for the results presented in this work and can also perform a customized cis-regulatory module prediction on a query set of transcription factor binding sites provided by the user. PMID:25268582

  3. Empirically Optimized Flow Cytometric Immunoassay Validates Ambient Analyte Theory

    PubMed Central

    Parpia, Zaheer A.; Kelso, David M.

    2010-01-01

    Ekins’ ambient analyte theory predicts, counter intuitively, that an immunoassay’s limit of detection can be improved by reducing the amount of capture antibody. In addition, it also anticipates that results should be insensitive to the volume of sample as well as the amount of capture antibody added. The objective of this study is to empirically validate all of the performance characteristics predicted by Ekins’ theory. Flow cytometric analysis was used to detect binding between a fluorescent ligand and capture microparticles since it can directly measure fractional occupancy, the primary response variable in ambient analyte theory. After experimentally determining ambient analyte conditions, comparisons were carried out between ambient and non-ambient assays in terms of their signal strengths, limits of detection, and their sensitivity to variations in reaction volume and number of particles. The critical number of binding sites required for an assay to be in the ambient analyte region was estimated to be 0.1VKd. As predicted, such assays exhibited superior signal/noise levels and limits of detection; and were not affected by variations in sample volume and number of binding sites. When the signal detected measures fractional occupancy, ambient analyte theory is an excellent guide to developing assays with superior performance characteristics. PMID:20152793

  4. Detection of specific protein-protein interactions in nanocages by engineering bipartite FlAsH binding sites.

    PubMed

    Cornell, Thomas A; Fu, Jing; Newland, Stephanie H; Orner, Brendan P

    2013-11-06

    Proteins that form cage-like structures have been of much recent cross-disciplinary interest due to their application to bioconjugate and materials chemistry, their biological functions spanning multiple essential cellular processes, and their complex structure, often defined by highly symmetric protein–protein interactions. Thus, establishing the fundamentals of their formation, through detecting and quantifying important protein–protein interactions, could be crucial to understanding essential cellular machinery, and for further development of protein-based technologies. Herein we describe a method to monitor the assembly of protein cages by detecting specific, oligomerization state dependent, protein–protein interactions. Our strategy relies on engineering protein monomers to include cysteine pairs that are presented proximally if the cage state assembles. These assembled pairs of cysteines act as binding sites for the fluorescent reagent FlAsH, which, once bound, provides a readout for successful oligomerization. As a proof of principle, we applied this technique to the iron storage protein, DNA-binding protein from starved cells from E. coli. Several linker lengths and conformations for the presentation of the cysteine pairs were screened to optimize the engineered binding sites. We confirmed that our designs were successful in both lysates and with purified proteins, and that FlAsH binding was dependent upon cage assembly. Following successful characterization of the assay, its throughput was expanded. A two-dimension matrix of pH and denaturing buffer conditions was screened to optimize nanocage stability. We intend to use this method for the high throughput screening of protein cage libraries and of conditions for the generation of inorganic nanoparticles within the cavity of these and other cage proteins.

  5. Ribosomal targets for antibiotic drug discovery

    DOEpatents

    Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

    2016-09-13

    The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

  6. Engineering Nucleotide Specificity of Succinyl-CoA Synthetase in Blastocystis: The Emerging Role of Gatekeeper Residues.

    PubMed

    Vashisht, Kapil; Verma, Sonia; Gupta, Sunita; Lynn, Andrew M; Dixit, Rajnikant; Mishra, Neelima; Valecha, Neena; Hamblin, Karleigh A; Maytum, Robin; Pandey, Kailash C; van der Giezen, Mark

    2017-01-24

    Charged, solvent-exposed residues at the entrance to the substrate binding site (gatekeeper residues) produce electrostatic dipole interactions with approaching substrates, and control their access by a novel mechanism called "electrostatic gatekeeper effect". This proof-of-concept study demonstrates that the nucleotide specificity can be engineered by altering the electrostatic properties of the gatekeeper residues outside the binding site. Using Blastocystis succinyl-CoA synthetase (SCS, EC 6.2.1.5), we demonstrated that the gatekeeper mutant (ED) resulted in ATP-specific SCS to show high GTP specificity. Moreover, nucleotide binding site mutant (LF) had no effect on GTP specificity and remained ATP-specific. However, via combination of the gatekeeper mutant with the nucleotide binding site mutant (ED+LF), a complete reversal of nucleotide specificity was obtained with GTP, but no detectable activity was obtained with ATP. This striking result of the combined mutant (ED+LF) was due to two changes; negatively charged gatekeeper residues (ED) favored GTP access, and nucleotide binding site residues (LF) altered ATP binding, which was consistent with the hypothesis of the "electrostatic gatekeeper effect". These results were further supported by molecular modeling and simulation studies. Hence, it is imperative to extend the strategy of the gatekeeper effect in a different range of crucial enzymes (synthetases, kinases, and transferases) to engineer substrate specificity for various industrial applications and substrate-based drug design.

  7. Genetically designed biosensing systems for high-throughput screening of pharmaceuticals, clinical diagnostics, and environmental monitoring

    NASA Astrophysics Data System (ADS)

    Wenner, Brett R.; Douglass, Phillip; Shrestha, Suresh; Sharma, Bethel V.; Lai, Siyi; Madou, Marc J.; Daunert, Sylvia

    2001-05-01

    The genetically-modified binding proteins calmodulin, the phosphate binding protein, the sulfate binding protein, and the galactose/glucose binding protein have been successfully employed as biosensing elements for the detection of phenothiazines, phosphate, sulfate, and glucose, respectively. Mutant proteins containing unique cysteine residues were utilized in the site-specific labeling of environment-sensitive fluorescent probes. Changes in the environment of the probes upon ligand-induced conformational changes of the proteins result in changes in fluorescence intensity.

  8. Validating metal binding sites in macromolecule structures using the CheckMyMetal web server

    PubMed Central

    Zheng, Heping; Chordia, Mahendra D.; Cooper, David R.; Chruszcz, Maksymilian; Müller, Peter; Sheldrick, George M.

    2015-01-01

    Metals play vital roles in both the mechanism and architecture of biological macromolecules. Yet structures of metal-containing macromolecules where metals are misidentified and/or suboptimally modeled are abundant in the Protein Data Bank (PDB). This shows the need for a diagnostic tool to identify and correct such modeling problems with metal binding environments. The "CheckMyMetal" (CMM) web server (http://csgid.org/csgid/metal_sites/) is a sophisticated, user-friendly web-based method to evaluate metal binding sites in macromolecular structures in respect to 7350 metal binding sites observed in a benchmark dataset of 2304 high resolution crystal structures. The protocol outlines how the CMM server can be used to detect geometric and other irregularities in the structures of metal binding sites and alert researchers to potential errors in metal assignment. The protocol also gives practical guidelines for correcting problematic sites by modifying the metal binding environment and/or redefining metal identity in the PDB file. Several examples where this has led to meaningful results are described in the anticipated results section. CMM was designed for a broad audience—biomedical researchers studying metal-containing proteins and nucleic acids—but is equally well suited for structural biologists to validate new structures during modeling or refinement. The CMM server takes the coordinates of a metal-containing macromolecule structure in the PDB format as input and responds within a few seconds for a typical protein structure modeled with a few hundred amino acids. PMID:24356774

  9. Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins.

    PubMed

    Cogliati, Clelia; Tomaselli, Simona; Assfalg, Michael; Pedò, Massimo; Ferranti, Pasquale; Zetta, Lucia; Molinari, Henriette; Ragona, Laura

    2009-10-01

    Bile acid-binding proteins (BABPs) are cytosolic lipid chaperones that play central roles in driving bile flow, as well as in the adaptation to various pathological conditions, contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Understanding the mode of binding of bile acids with their cytoplasmic transporters is a key issue in providing a model for the mechanism of their transfer from the cytoplasm to the nucleus, for delivery to nuclear receptors. A number of factors have been shown to modulate bile salt selectivity, stoichiometry, and affinity of binding to BABPs, e.g. chemistry of the ligand, protein plasticity and, possibly, the formation of disulfide bridges. Here, the effects of the presence of a naturally occurring disulfide bridge on liver BABP ligand-binding properties and backbone dynamics have been investigated by NMR. Interestingly, the disulfide bridge does not modify the protein-binding stoichiometry, but has a key role in modulating recognition at both sites, inducing site selectivity for glycocholic and glycochenodeoxycholic acid. Protein conformational changes following the introduction of a disulfide bridge are small and located around the inner binding site, whereas significant changes in backbone motions are observed for several residues distributed over the entire protein, both in the apo form and in the holo form. Site selectivity appears, therefore, to be dependent on protein mobility rather than being governed by steric factors. The detected properties further establish a parallelism with the behaviour of human ileal BABP, substantiating the proposal that BABPs have parallel functions in hepatocytes and enterocytes.

  10. The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

    PubMed

    Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

    2017-07-01

    FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  11. Mediation of CTCF transcriptional insulation by DEAD-box RNA-binding protein p68 and steroid receptor RNA activator SRA

    PubMed Central

    Yao, Hongjie; Brick, Kevin; Evrard, Yvonne; Xiao, Tiaojiang; Camerini-Otero, R. Daniel; Felsenfeld, Gary

    2010-01-01

    CCCTC-binding factor (CTCF) is a DNA-binding protein that plays important roles in chromatin organization, although the mechanism by which CTCF carries out these functions is not fully understood. Recent studies show that CTCF recruits the cohesin complex to insulator sites and that cohesin is required for insulator activity. Here we showed that the DEAD-box RNA helicase p68 (DDX5) and its associated noncoding RNA, steroid receptor RNA activator (SRA), form a complex with CTCF that is essential for insulator function. p68 was detected at CTCF sites in the IGF2/H19 imprinted control region (ICR) as well as other genomic CTCF sites. In vivo depletion of SRA or p68 reduced CTCF-mediated insulator activity at the IGF2/H19 ICR, increased levels of IGF2 expression, and increased interactions between the endodermal enhancer and IGF2 promoter. p68/SRA also interacts with members of the cohesin complex. Depletion of either p68 or SRA does not affect CTCF binding to its genomic sites, but does reduce cohesin binding. The results suggest that p68/SRA stabilizes the interaction of cohesin with CTCF by binding to both, and is required for proper insulator function. PMID:20966046

  12. Multi-specificity of a Psathyrella velutina mushroom lectin: heparin/pectin binding occurs at a site different from the N-acetylglucosamine/N-acetylneuraminic acid-specific site.

    PubMed

    Ueda, H; Saitoh, T; Kojima, K; Ogawa, H

    1999-09-01

    An N-acetylglucosamine (GlcNAc)/N-acetylneuraminic acid-specific lectin from the fruiting body of Psathyrella velutina (PVL) is a useful probe for the detection and fractionation of specific carbohydrates. In this study, PVL was found to exhibit multispecificity to acidic polysaccharides and sulfatides. Purified PVL and a counterpart lectin to PVL in the mycelium interact with heparin neoproteoglycans, as detected by both membrane analysis and solid phase assay. The pH-dependencies of the binding to heparin and GlcNAc5-6 differ. The heparin binding of PVL is inhibited best by pectin, polygalacturonic acid, and highly sulfated polysaccharides, but not by GlcNAc, colominic acid, or other glycosaminoglycans. Sandwich affinity chromatography indicated that PVL can simultaneously interact with heparin- and GlcNAc-containing macromolecules. Extensive biotinylation was found to suppress the binding activity to heparin while the GlcNAc binding activity is retained. On the other hand, biotinyl PVL binds to sulfatide and the binding is not inhibited by GlcNAc, N-acetylneuraminic acid, or heparin. These results indicate that PVL is a multi-ligand adhesive lectin that can interact with various glycoconjugates. This multispecificity needs to be recognized when using PVL as a sugar-specific probe to avoid misleading information about the nature of glycoforms.

  13. Hybrids of a Genetically Engineered Antibody and a Carbon Nanotube Transistor for Detection of Prostate Cancer Biomarkers

    PubMed Central

    Lerner, Mitchell B.; D’Souza, Jimson; Pazina, Tatiana; Dailey, Jennifer; Goldsmith, Brett R.; Robinson, Matthew K.; Johnson, A.T. Charlie

    2012-01-01

    We developed a novel detection method for osteopontin (OPN), a new biomarker for prostate cancer, by attaching a genetically engineered single chain variable fragment (scFv) protein with high binding affinity for OPN to a carbon nanotube field-effect transistor (NTFET). Chemical functionalization using diazonium salts is used to covalently attach scFv to NT-FETs, as confirmed by atomic force microscopy, while preserving the activity of the biological binding site for OPN. Electron transport measurements indicate that functionalized NT-FET may be used to detect the binding of OPN to the complementary scFv protein. A concentration-dependent increase in the source-drain current is observed in the regime of clinical significance, with a detection limit of approximately 30 fM. The scFv-NT hybrid devices exhibit selectivity for OPN over other control proteins. These devices respond to the presence of OPN in a background of concentrated bovine serum albumin, without loss of signal. Based on these observations, the detection mechanism is attributed to changes in scattering at scFv protein-occupied defect sites on the carbon nanotube sidewall. The functionalization procedure described here is expected to be generalizable to any antibody containing an accessible amine group, and to result in biosensors appropriate for detection of corresponding complementary proteins at fM concentrations. PMID:22575126

  14. A global optimization algorithm for protein surface alignment

    PubMed Central

    2010-01-01

    Background A relevant problem in drug design is the comparison and recognition of protein binding sites. Binding sites recognition is generally based on geometry often combined with physico-chemical properties of the site since the conformation, size and chemical composition of the protein surface are all relevant for the interaction with a specific ligand. Several matching strategies have been designed for the recognition of protein-ligand binding sites and of protein-protein interfaces but the problem cannot be considered solved. Results In this paper we propose a new method for local structural alignment of protein surfaces based on continuous global optimization techniques. Given the three-dimensional structures of two proteins, the method finds the isometric transformation (rotation plus translation) that best superimposes active regions of two structures. We draw our inspiration from the well-known Iterative Closest Point (ICP) method for three-dimensional (3D) shapes registration. Our main contribution is in the adoption of a controlled random search as a more efficient global optimization approach along with a new dissimilarity measure. The reported computational experience and comparison show viability of the proposed approach. Conclusions Our method performs well to detect similarity in binding sites when this in fact exists. In the future we plan to do a more comprehensive evaluation of the method by considering large datasets of non-redundant proteins and applying a clustering technique to the results of all comparisons to classify binding sites. PMID:20920230

  15. Tb3+-cleavage assays reveal specific Mg2+ binding sites necessary to pre-fold the btuB riboswitch for AdoCbl binding

    NASA Astrophysics Data System (ADS)

    Choudhary, Pallavi K.; Gallo, Sofia; Sigel, Roland K. O.

    2017-03-01

    Riboswitches are RNA elements that bind specific metabolites in order to regulate the gene expression involved in controlling the cellular concentration of the respective molecule or ion. Ligand recognition is mostly facilitated by Mg2+ mediated pre-organization of the riboswitch to an active tertiary fold. To predict these specific Mg2+ induced tertiary interactions of the btuB riboswitch from E. coli, we here report Mg2+ binding pockets in its aptameric part in both, the ligand-free and the ligand-bound form. An ensemble of weak and strong metal ion binding sites distributed over the entire aptamer was detected by terbium(III) cleavage assays, Tb3+ being an established Mg2+ mimic. Interestingly many of the Mn+ (n = 2 or 3) binding sites involve conserved bases within the class of coenzyme B12-binding riboswitches. Comparison with the published crystal structure of the coenzyme B12 riboswitch of S. thermophilum aided in identifying a common set of Mn+ binding sites that might be crucial for tertiary interactions involved in the organization of the aptamer. Our results suggest that Mn+ binding at strategic locations of the btuB riboswitch indeed facilitates the assembly of the binding pocket needed for ligand recognition. Binding of the specific ligand, coenzyme B12 (AdoCbl), to the btuB aptamer does however not lead to drastic alterations of these Mn+ binding cores, indicating the lack of a major rearrangement within the three-dimensional structure of the RNA. This finding is strengthened by Tb3+ mediated footprints of the riboswitch's structure in its ligand-free and ligand-bound state indicating that AdoCbl indeed induces local changes rather than a global structural rearrangement.

  16. B cell recognition of the conserved HIV-1 co-receptor binding site is altered by endogenous primate CD4.

    PubMed

    Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T

    2008-10-03

    The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.

  17. Determination of human serum albumin using an intramolecular charge transfer fluorescence probe: 4'-dimethylamino-2,5-dihydroxychalcone.

    PubMed

    Xu, Zhicheng; Yang, Weibing; Dong, Chuan

    2005-09-15

    A new intramolecular charge transfer fluorescence probe, namely, 4'-dimethylamino-2,5-dihydroxychalcone (DMADHC), exhibited dramatic enhancement of fluorescence intensity with an accompanying blue shift of the emission maximum when the concentration of human serum albumin (HSA) was increased. Binding to HSA also caused a progressive shift in the absorption spectrum of DMADHC, and a clear isosbestic point appeared. The binding site number and binding constant were calculated. Thermodynamic parameters were given and possible binding site was speculated. The optimum conditions for the determination of HSA were also investigated. A new, fast, and simple spectrofluorimetric method for the determination of HSA was developed. In the detection of HSA in samples of human plasma, this method gave values close to that of the Erythrosin B method.

  18. Recent sequence variation in probe binding site affected detection of respiratory syncytial virus group B by real-time RT-PCR.

    PubMed

    Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James

    2017-03-01

    Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Lipoprotein(A) with An Intact Lysine Binding Site Protects the Retina From an Age-Related Macular Degeneration Phenotype in Mice (An American Ophthalmological Society Thesis)

    PubMed Central

    Handa, James T.; Tagami, Mizuki; Ebrahimi, Katayoon; Leibundgut, Gregor; Janiak, Anna; Witztum, Joseph L.; Tsimikas, Sotirios

    2015-01-01

    Purpose: To test the hypothesis that the accumulation of oxidized phospholipids (OxPL) in the macula is toxic to the retina unless neutralized by a variety of mechanisms, including binding by lipoprotein(a) [Lp(a)], which is composed of apolipoprotein(a) [apo(a)] and apolipoprotein B-100 (apoB). Methods: Human maculas and eyes from two Lp(a) transgenic murine models were subjected to morphologic, ultrastructural, and immunohistochemical analysis. “Wild-type Lp(a)” mice, which express human apoB-100 and apo(a) that contains oxidized phospholipid, and “mutant LBS− Lp(a)” mice with a defective apo(a) lysine binding site (LBS) for oxidized phospholipid binding, were fed a chow or high-fat diet for 2 to 12 months. Oxidized phospholipid–containing lipoproteins were detected by immunoreactivity to E06, a murine monoclonal antibody binding to the phosphocholine headgroup of oxidized, but not native, phospholipids. Results: Oxidized phospholipids, apo(a), and apoB accumulate in maculas, including drusen, of age-related macular degeneration (AMD) samples and age-matched controls. Lp(a) mice fed a high-fat diet developed age-related changes. However, mutant LBS− Lp(a) mice fed a high-fat diet developed retinal pigment epithelial cell degeneration and drusen. These changes were associated with increased OxPL, decreased antioxidant defenses, increased complement, and decreased complement regulators. Conclusions: Human maculas accumulate Lp(a) and OxPL. Mutant LBS− Lp(a) mice, lacking the ability to bind E06-detectable oxidized phospholipid, develop AMD-like changes. The ability of Lp(a) to bind E06-detectable OxPL may play a protective role in AMD. PMID:26538774

  20. Identification of high-specificity H-NS binding site in LEE5 promoter of enteropathogenic Esherichia coli (EPEC).

    PubMed

    Bhat, Abhay Prasad; Shin, Minsang; Choy, Hyon E

    2014-07-01

    Histone-like nucleoid structuring protein (H-NS) is a small but abundant protein present in enteric bacteria and is involved in compaction of the DNA and regulation of the transcription. Recent reports have suggested that H-NS binds to a specific AT rich DNA sequence than to intrinsically curved DNA in sequence independent manner. We detected two high-specificity H-NS binding sites in LEE5 promoter of EPEC centered at -110 and -138, which were close to the proposed consensus H-NS binding motif. To identify H-NS binding sequence in LEE5 promoter, we took a random mutagenesis approach and found the mutations at around -138 were specifically defective in the regulation by H-NS. It was concluded that H-NS exerts maximum repression via the specific sequence at around -138 and subsequently contacts a subunit of RNAP through oligomerization.

  1. Site-directed antibody immobilization using a protein A-gold binding domain fusion protein for enhanced SPR immunosensing.

    PubMed

    de Juan-Franco, Elena; Caruz, Antonio; Pedrajas, J R; Lechuga, Laura M

    2013-04-07

    We have implemented a novel strategy for the oriented immobilization of antibodies onto a gold surface based on the use of a fusion protein, the protein A-gold binding domain (PAG). PAG consists of a gold binding peptide (GBP) coupled to the immunoglobulin-binding domains of staphylococcal protein A. This fusion protein provides an easy and fast oriented immobilization of antibodies preserving its native structure, while leaving the antigen binding sites (Fab) freely exposed. Using this immobilization strategy, we have demonstrated the performance of the immunosensing of the human Growth Hormone by SPR. A limit of detection of 90 ng mL(-1) was obtained with an inter-chip variability lower than 7%. The comparison of this method with other strategies for the direct immobilization of antibodies over gold surfaces has showed the enhanced sensitivity provided by the PAG approach.

  2. Pertussis toxin modifies the characteristics of both the inhibitory GTP binding proteins and the somatostatin receptor in anterior pituitary tumor cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mahy, N.; Woolkalis, M.; Thermos, K.

    1988-08-01

    The effects of pertussis toxin treatment on the characteristics of somatostatin receptors in the anterior pituitary tumor cell line AtT-20 were examined. Pertussis toxin selectively catalyzed the ADP ribosylation of the alpha subunits of the inhibitory GTP binding proteins in AtT-20 cells. Toxin treatment abolished somatostatin inhibition of forskolin-stimulated adenylyl cyclase activity and somatostatin stimulation of GTPase activity. To examine the effects of pertussis toxin treatment on the characteristics of the somatostatin receptor, the receptor was labeled by the somatostatin analog (125I)CGP 23996. (125I)CGP 23996 binding to AtT-20 cell membranes was saturable and within a limited concentration range was tomore » a single high affinity site. Pertussis toxin treatment reduced the apparent density of the high affinity (125I)CGP 23996 binding sites in AtT-20 cell membranes. Inhibition of (125I)CGP 23996 binding by a wide concentration range of CGP 23996 revealed the presence of two binding sites. GTP predominantly reduced the level of high affinity sites in control membranes. Pertussis toxin treatment also diminished the amount of high affinity sites. GTP did not affect (125I)CGP 23996 binding in the pertussis toxin-treated membranes. The high affinity somatostatin receptors were covalently labeled with (125I) CGP 23996 and the photoactivated crosslinking agent n-hydroxysuccinimidyl-4-azidobenzoate. No high affinity somatostatin receptors, covalently bound to (125I)CGP 23996, were detected in the pertussis toxin-treated membranes. These results are most consistent with pertussis toxin uncoupling the inhibitory G proteins from the somatostatin receptor thereby converting the receptor from a mixed population of high and low affinity sites to only low affinity receptors.« less

  3. C-type natriuretic peptide and atrial natriuretic peptide receptors of rat brain.

    PubMed

    Brown, J; Zuo, Z

    1993-03-01

    Natriuretic peptide receptors in rat brain were mapped by in vitro autoradiography using 125I-labeled [Tyr0]CNP-(1-22) to bind atrial natriuretic peptide receptor (ANPR)-B and ANPR-C receptors selectively, and 125I-labeled alpha-ANP to select ANPR-A and ANPR-C receptors. Des-[Gln18,Ser19,Gly20,Leu21,Gly22]ANP-(4- 23)-amide (C-ANP) was used for its selectivity for ANPR-C over ANPR-A. Specific binding of 125I-[Tyr0]CNP-(1-22) with a dissociation constant (Kd) approximately 1 nM occurred in olfactory bulb, cerebral cortex, lateral septal nucleus, choroid plexus, and arachnoid mater. This binding was abolished by C-type natriuretic peptide [CNP-(1-22)], alpha-ANP and C-ANP, and conformed to ANPR-C. 125I-alpha-ANP bound to all structures that bound 125I-[Tyr0]CNP-(1-22). This binding was also inhibited by both CNP-(1-22) and C-ANP, confirming the presence of ANPR-C-like binding sites. However, ANPR-C-like binding sites were heterogenous because only some had high affinities for 125I-[Tyr0]CNP-(1-22) and CNP-(1-22). 125I-alpha-ANP also bound sites without affinities for C-ANP or CNP-(1-22). These sites were consistent with ANPR-A. They occurred mainly on the olfactory bulb, the choroid plexus, and the subfornical organ. Guanosine 3',5'-cyclic monophosphate production was strongly stimulated by alpha-ANP but not by CNP-(1-22) in olfactory bulb. Neither ligand stimulated it in cortical tissue. Thus the natriuretic peptide binding sites of rat brain conformed to ANPR-A and to heterogenous ANPR-C-like sites. No ANPR-B were detected.

  4. Investigation of the Binding Profiles of AZD2184 and Thioflavin T with Amyloid-β(1-42) Fibril by Molecular Docking and Molecular Dynamics Methods.

    PubMed

    Kuang, Guanglin; Murugan, N Arul; Tu, Yaoquan; Nordberg, Agneta; Ågren, Hans

    2015-09-03

    Detecting deposits of amyloid β fibrils in the brain is of paramount importance for an early diagnosis of Alzheimer's disease. A number of PET tracers have been developed for amyloid imaging, but many suffer from poor specificity and large signal to background ratio. Design of tracers with specificity and improved binding affinity requires knowledge about various potential binding sites in the amyloid β fibril available for the tracers and the nature of the local microenvironment of these sites. In this study we investigate the local structure of fibrils using two important probes, namely, thioflavin T (a fluorescent probe) and AZD2184 (a PET tracer). The target structures for amyloid-β(1-42) fibril are based on reported NMR solution models. By explicitly considering the effect of fibril flexibility on the available binding sites for all these models, the binding affinity of these probes has been investigated. The binding profiles of AZD2184 and thioflavin T were studied by molecular docking and molecular dynamics simulation methods. The two compounds were found to bind at the same sites of the fibril: three of which are within the fibril, and one is on the two sides of the Met35 residue on the surface. The binding affinity of AZD2184 and thioflavin T is found to be higher at the core sites than on the surface due to more contact residues. The binding affinity of AZD2184 is much higher than that of thioflavin T at every site due to electrostatic interaction and spatial restriction, which is in good agreement with experimental observation. However, the structural change of thioflavin T is much more significant than that of AZD2184, which is the chemical basis for its usage as a fluorescent probe. The ramifications of these results for the design and optimization of PET radioligands and fluorescent probes are briefly discussed.

  5. Biomimetic/Optical Sensors for Detecting Bacterial Species

    NASA Technical Reports Server (NTRS)

    Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth

    2006-01-01

    Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites that bind only to molecules matched to the sites; other molecules are excluded. In a sensor according to the proposal, the MIP would feature molecular recognition sites that would bind the specific signaling molecules selectively according to their size, shape, and chemical functionality (see figure). As the film took up the signaling molecules in the molecular recognition sites, the index of refraction and thickness of the film would change, causing a wavelength shift of the peak of the resonance spectrum. It has been estimated that by measuring this wavelength shift, it should be possible to detect as little as 10 picomoles of a peptide signaling compound.

  6. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.

    2015-01-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

  7. Novel pppGpp binding site at the C-terminal region of the Rel enzyme from Mycobacterium smegmatis.

    PubMed

    Syal, Kirtimaan; Joshi, Himanshu; Chatterji, Dipankar; Jain, Vikas

    2015-10-01

    Mycobacterium tuberculosis elicits the stringent response under unfavorable growth conditions, such as those encountered by the pathogen inside the host. The hallmark of this response is production of guanosine tetra- and pentaphosphates, collectively termed (p)ppGpp, which have pleiotropic effects on the bacterial physiology. As the stringent response is connected to survival under stress, it is now being targeted for developing inhibitors against bacterial persistence. The Rel enzyme in mycobacteria has two catalytic domains at its N-terminus that are involved in the synthesis and hydrolysis of (p)ppGpp, respectively. However, the function of the C-terminal region of the protein remained unknown. Here, we have identified a binding site for pppGpp in the C-terminal region of Rel. The binding affinity of pppGpp was quantified by isothermal titration calorimetry. The binding site was determined by crosslinking using the nucleotide analog azido-pppGpp, and examining the crosslink product by mass spectrometry. Additionally, mutations in the Rel protein were created to confirm the site of pppGpp binding by isothermal titration calorimetry. These mutants showed increased pppGpp synthesis and reduced hydrolytic activity. We believe that binding of pppGpp to Rel provides a feedback mechanism that allows the protein to detect and adjust the (p)ppGpp level in the cell. Our work suggests that such sites should also be considered while designing inhibitors to target the stringent response. © 2015 FEBS.

  8. A stochastic context free grammar based framework for analysis of protein sequences

    PubMed Central

    Dyrka, Witold; Nebel, Jean-Christophe

    2009-01-01

    Background In the last decade, there have been many applications of formal language theory in bioinformatics such as RNA structure prediction and detection of patterns in DNA. However, in the field of proteomics, the size of the protein alphabet and the complexity of relationship between amino acids have mainly limited the application of formal language theory to the production of grammars whose expressive power is not higher than stochastic regular grammars. However, these grammars, like other state of the art methods, cannot cover any higher-order dependencies such as nested and crossing relationships that are common in proteins. In order to overcome some of these limitations, we propose a Stochastic Context Free Grammar based framework for the analysis of protein sequences where grammars are induced using a genetic algorithm. Results This framework was implemented in a system aiming at the production of binding site descriptors. These descriptors not only allow detection of protein regions that are involved in these sites, but also provide insight in their structure. Grammars were induced using quantitative properties of amino acids to deal with the size of the protein alphabet. Moreover, we imposed some structural constraints on grammars to reduce the extent of the rule search space. Finally, grammars based on different properties were combined to convey as much information as possible. Evaluation was performed on sites of various sizes and complexity described either by PROSITE patterns, domain profiles or a set of patterns. Results show the produced binding site descriptors are human-readable and, hence, highlight biologically meaningful features. Moreover, they achieve good accuracy in both annotation and detection. In addition, findings suggest that, unlike current state-of-the-art methods, our system may be particularly suited to deal with patterns shared by non-homologous proteins. Conclusion A new Stochastic Context Free Grammar based framework has been introduced allowing the production of binding site descriptors for analysis of protein sequences. Experiments have shown that not only is this new approach valid, but produces human-readable descriptors for binding sites which have been beyond the capability of current machine learning techniques. PMID:19814800

  9. A highly selective colorimetric and fluorescent chemosensor for Al(III) based-on simple naphthol in aqueous solution

    NASA Astrophysics Data System (ADS)

    Liu, Zhaodi; Xu, Huajie; Sheng, Liangquan; Chen, Shuisheng; Huang, Deqian; Liu, Jie

    2016-03-01

    A colorimetric and fluorescent chemosensor (L) for Al(III) was synthesized and fully characterized. L could be both used as a colorimetric and fluorescent chemosensor for the detection of Al3 + ions with low detection limit (8.87 × 10- 7 M) in CH3CN-H2O (1:1, v/v) solution. The binding ratio of L-Al3 + was determined from the Job plot (absorption and fluorescence spectra) and MALDI-TOF MS data to be 1:1. The binding constant (Ka) of Al3 + binding to L was calculated to be 4.8 × 105 M- 1 from a Benesi-Hildebrand plot. Moreover, the binding site of L with Al3 + was determined by 1H NMR titration experiment.

  10. Sequence information gain based motif analysis.

    PubMed

    Maynou, Joan; Pairó, Erola; Marco, Santiago; Perera, Alexandre

    2015-11-09

    The detection of regulatory regions in candidate sequences is essential for the understanding of the regulation of a particular gene and the mechanisms involved. This paper proposes a novel methodology based on information theoretic metrics for finding regulatory sequences in promoter regions. This methodology (SIGMA) has been tested on genomic sequence data for Homo sapiens and Mus musculus. SIGMA has been compared with different publicly available alternatives for motif detection, such as MEME/MAST, Biostrings (Bioconductor package), MotifRegressor, and previous work such Qresiduals projections or information theoretic based detectors. Comparative results, in the form of Receiver Operating Characteristic curves, show how, in 70% of the studied Transcription Factor Binding Sites, the SIGMA detector has a better performance and behaves more robustly than the methods compared, while having a similar computational time. The performance of SIGMA can be explained by its parametric simplicity in the modelling of the non-linear co-variability in the binding motif positions. Sequence Information Gain based Motif Analysis is a generalisation of a non-linear model of the cis-regulatory sequences detection based on Information Theory. This generalisation allows us to detect transcription factor binding sites with maximum performance disregarding the covariability observed in the positions of the training set of sequences. SIGMA is freely available to the public at http://b2slab.upc.edu.

  11. Microfabricated, flowthrough porous apparatus for discrete detection of binding reactions

    DOEpatents

    Beattie, Kenneth L.

    1998-01-01

    An improved microfabricated apparatus for conducting a multiplicity of individual and simultaneous binding reactions is described. The apparatus comprises a substrate on which are located discrete and isolated sites for binding reactions. The apparatus is characterized by discrete and isolated regions that extend through said substrate and terminate on a second surface thereof such that when a test sample is allowed to the substrate, it is capable of penetrating through each such region during the course of said binding reaction. The apparatus is especially useful for sequencing by hybridization of DNA molecules.

  12. Two-phase positive inotropic effects of ouabain and the presence of multiple classes of ouabain binding sites in the ferret heart

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ng, Y.C.; Akera, T.

    1986-03-05

    Characteristics of more than one class of ouabain receptors which appear to exist in ferret heart were examined. In isolated papillary muscle, 1 to 30 nM ouabain produced a positive inotropic effect in the presence of 5 ..mu..M propranolol and 2 ..mu..M phentolamine. Higher concentrations of ouabain (0.1 to 10 ..mu..M) produced an additional and prominent inotropic effect. In partially purified Na, K-ATPase, ouabain caused a monophasic inhibition; however, the concentration-inhibition curve spanned over 5 log units, indicating that ouabain is interacting with more than a single class of the enzyme. Scatchard analysis of specific /sup 3/H-ouabain binding revealed approximatelymore » equal abundance of high and low affinity binding sites. The K/sub D/ value for high affinity sites was approximately 20 nM whereas that for low affinity sites was about 45 times higher. When phosphoenzyme was formed in the presence of (..gamma..-/sup 32/P)-ATP, Mg/sup 2 +/ and Na/sup +/ and subjected to SDS gel electrophoresis, two distinct K/sup +/-sensitive bands with about 100,000 dalton molecular weight were detected. Molecular weight difference between these two bands was approximately 2500 dalton. Phosphorylation of either band was abolished by 1 ..mu..M ouabain suggesting that both bands may correspond to the high-affinity binding sites. These results indicate that high and low affinity ouabain binding sites exists in approximately equal abundance in the ferret heart, and that binding of ouabain to these sites cases Na,K-ATPase inhibition and the positive inotropic effect.« less

  13. Ligand Binding Site Detection by Local Structure Alignment and Its Performance Complementarity

    PubMed Central

    Lee, Hui Sun; Im, Wonpil

    2013-01-01

    Accurate determination of potential ligand binding sites (BS) is a key step for protein function characterization and structure-based drug design. Despite promising results of template-based BS prediction methods using global structure alignment (GSA), there is a room to improve the performance by properly incorporating local structure alignment (LSA) because BS are local structures and often similar for proteins with dissimilar global folds. We present a template-based ligand BS prediction method using G-LoSA, our LSA tool. A large benchmark set validation shows that G-LoSA predicts drug-like ligands’ positions in single-chain protein targets more precisely than TM-align, a GSA-based method, while the overall success rate of TM-align is better. G-LoSA is particularly efficient for accurate detection of local structures conserved across proteins with diverse global topologies. Recognizing the performance complementarity of G-LoSA to TM-align and a non-template geometry-based method, fpocket, a robust consensus scoring method, CMCS-BSP (Complementary Methods and Consensus Scoring for ligand Binding Site Prediction), is developed and shows improvement on prediction accuracy. The G-LoSA source code is freely available at http://im.bioinformatics.ku.edu/GLoSA. PMID:23957286

  14. Structural characterization of metal binding to a cold-adapted frataxin.

    PubMed

    Noguera, Martín E; Roman, Ernesto A; Rigal, Juan B; Cousido-Siah, Alexandra; Mitschler, André; Podjarny, Alberto; Santos, Javier

    2015-06-01

    Frataxin is an evolutionary conserved protein that participates in iron metabolism. Deficiency of this small protein in humans causes a severe neurodegenerative disease known as Friedreich's ataxia. A number of studies indicate that frataxin binds iron and regulates Fe-S cluster biosynthesis. Previous structural studies showed that metal binding occurs mainly in a region of high density of negative charge. However, a comprehensive characterization of the binding sites is required to gain further insights into the mechanistic details of frataxin function. In this work, we have solved the X-ray crystal structures of a cold-adapted frataxin from a psychrophilic bacterium in the presence of cobalt or europium ions. We have identified a number of metal-binding sites, mainly solvent exposed, several of which had not been observed in previous studies on mesophilic homologues. No major structural changes were detected upon metal binding, although the structures exhibit significant changes in crystallographic B-factors. The analysis of these B-factors, in combination with crystal packing and RMSD among structures, suggests the existence of localized changes in the internal motions. Based on these results, we propose that bacterial frataxins possess binding sites of moderate affinity for a quick capture and transfer of iron to other proteins and for the regulation of Fe-S cluster biosynthesis, modulating interactions with partner proteins.

  15. Periplasmic binding protein-based detection of maltose using liposomes: a new class of biorecognition elements in competitive assays.

    PubMed

    Edwards, Katie A; Baeumner, Antje J

    2013-03-05

    A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.

  16. COPS: Detecting Co-Occurrence and Spatial Arrangement of Transcription Factor Binding Motifs in Genome-Wide Datasets

    PubMed Central

    Lohmann, Ingrid

    2012-01-01

    In multi-cellular organisms, spatiotemporal activity of cis-regulatory DNA elements depends on their occupancy by different transcription factors (TFs). In recent years, genome-wide ChIP-on-Chip, ChIP-Seq and DamID assays have been extensively used to unravel the combinatorial interaction of TFs with cis-regulatory modules (CRMs) in the genome. Even though genome-wide binding profiles are increasingly becoming available for different TFs, single TF binding profiles are in most cases not sufficient for dissecting complex regulatory networks. Thus, potent computational tools detecting statistically significant and biologically relevant TF-motif co-occurrences in genome-wide datasets are essential for analyzing context-dependent transcriptional regulation. We have developed COPS (Co-Occurrence Pattern Search), a new bioinformatics tool based on a combination of association rules and Markov chain models, which detects co-occurring TF binding sites (BSs) on genomic regions of interest. COPS scans DNA sequences for frequent motif patterns using a Frequent-Pattern tree based data mining approach, which allows efficient performance of the software with respect to both data structure and implementation speed, in particular when mining large datasets. Since transcriptional gene regulation very often relies on the formation of regulatory protein complexes mediated by closely adjoining TF binding sites on CRMs, COPS additionally detects preferred short distance between co-occurring TF motifs. The performance of our software with respect to biological significance was evaluated using three published datasets containing genomic regions that are independently bound by several TFs involved in a defined biological process. In sum, COPS is a fast, efficient and user-friendly tool mining statistically and biologically significant TFBS co-occurrences and therefore allows the identification of TFs that combinatorially regulate gene expression. PMID:23272209

  17. A 23Na Multiple-Quantum-Filtered NMR Study of the Effect of the Cytoskeleton Conformation on the Anisotropic Motion of Sodium Ions in Red Blood Cells

    NASA Astrophysics Data System (ADS)

    Knubovets, Tatyana; Shinar, Hadassah; Eliav, Uzi; Navon, Gil

    1996-01-01

    Recently, it has been shown that23Na double-quantum-filtered NMR spectroscopy can be used to detect anisotropic motion of bound sodium ions in biological systems. The technique is based on the formation of the second-rank tensor when the quadrupolar interaction is not averaged to zero. Using this method, anisotropic motion of bound sodium in human and dog red blood cells was detected, and the effect was shown to depend on the integrity of the membrane cytoskeleton. In the present study, multiple-quantum-filtered techniques were applied in combination with a quadrupolar echo to measure the transverse-relaxation times,T2fandT2s. Line fitting was performed to obtain the values of the residual quadrupolar interaction, which was measured for sodium in a variety of mammalian erythrocytes of different size, shape, rheological properties, and sodium concentrations. Human unsealed white ghosts were used to study sodium bound at the anisotropic sites on the inner side of the RBC membrane. Modulations of the conformation of the cytoskeleton by the variation of either the ionic strength or pH of the suspending medium caused drastic changes in both the residual quadrupolar interaction andT2fdue to changes in the fraction of bound sodium ions as well as changes in the structure of the binding sites. By combining the two spectroscopic parameters, structural change can be followed. The changes in the structure of the sodium anisotropic binding sites deduced by this method were found to correlate with known conformational changes of the membrane cytoskeleton. Variations of the medium pH affected both the fraction of bound sodium ions and the structure of the anisotropic binding sites. Sodium and potassium were shown to bind to the anisotropic binding sites with the same affinity.

  18. Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo.

    PubMed Central

    Truss, M; Bartsch, J; Schelbert, A; Haché, R J; Beato, M

    1995-01-01

    Hormonal induction of the mouse mammary tumour virus (MMTV) promoter is mediated by interactions between hormone receptors and other transcription factors bound to a complex array of sites. Previous results suggested that access to these sites is modulated by their precise organization into a positioned regulatory nucleosome. Using genomic footprinting, we show that MMTV promoter DNA is rotationally phased in intact cells containing either episomal or chromosomally integrated proviral fragments. Prior to induction there is no evidence for factors bound to the promoter. Following progesterone induction of cells with high levels of receptor, genomic footprinting detects simultaneous protection over the binding sites for hormone receptors, NF-I and the octamer binding proteins. Glucocorticoid or progestin induction leads to a characteristic chromatin remodelling that is independent of ongoing transcription. The centre of the regulatory nucleosome becomes more accessible to DNase I and restriction enzymes, but the limits of the nucleosome are unchanged and the 145 bp core region remains protected against micrococcal nuclease digestion. Thus, the nucleosome covering the MMTV promoter is neither removed nor shifted upon hormone induction, and all relevant transcription factors bind to the surface of the rearranged nucleosome. Since these factors cannot bind simultaneously to free DNA, maintainance of the nucleosome may be required for binding of factors to contiguous sites. Images PMID:7737125

  19. Rapid on-site detection of airborne asbestos fibers and potentially hazardous nanomaterials using fluorescence microscopy-based biosensing.

    PubMed

    Kuroda, Akio; Alexandrov, Maxym; Nishimura, Tomoki; Ishida, Takenori

    2016-06-01

    A large number of peptides with binding affinity to various inorganic materials have been identified and used as linkers, catalysts, and building blocks in nanotechnology and nanobiotechnology. However, there have been few applications of material-binding peptides in the fluorescence microscopy-based biosensing (FM method) of environmental pollutants. A notable exception is the application of the FM method for the detection of asbestos, a dangerous industrial toxin that is still widely used in many developing countries. This review details the selection and isolation of asbestos-binding proteins and peptides with sufficient specificity to distinguish asbestos from a large variety of safer fibrous materials used as asbestos substitutes. High sensitivity to nanoscale asbestos fibers (30-35 nm in diameter) invisible under conventional phase contrast microscopy can be achieved. The FM method is the basis for developing an automated system for asbestos biosensing that can be used for on-site testing with a portable fluorescence microscope. In the future, the FM method could also become a useful tool for detecting other potentially hazardous nanomaterials in the environment. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

    PubMed

    Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

    2014-01-01

    Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances ChIP-seq data analysis and allows the identification of multiple SUMOylated TF binding sites simultaneously, which can then be utilized for other functional PTM binding site prediction in future.

  1. PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

    PubMed

    Feng, Youjun; Cronan, John E

    2014-01-01

    Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  2. Mutants of Cre recombinase with improved accuracy

    PubMed Central

    Eroshenko, Nikolai; Church, George M.

    2013-01-01

    Despite rapid advances in genome engineering technologies, inserting genes into precise locations in the human genome remains an outstanding problem. It has been suggested that site-specific recombinases can be adapted towards use as transgene delivery vectors. The specificity of recombinases can be altered either with directed evolution or via fusions to modular DNA-binding domains. Unfortunately, both wildtype and altered variants often have detectable activities at off-target sites. Here we use bacterial selections to identify mutations in the dimerization surface of Cre recombinase (R32V, R32M, and 303GVSdup) that improve the accuracy of recombination. The mutants are functional in bacteria, in human cells, and in vitro (except for 303GVSdup, which we did not purify), and have improved selectivity against both model off-target sites and the entire E. coli genome. We propose that destabilizing binding cooperativity may be a general strategy for improving the accuracy of dimeric DNA-binding proteins. PMID:24056590

  3. Accounting for GC-content bias reduces systematic errors and batch effects in ChIP-seq data.

    PubMed

    Teng, Mingxiang; Irizarry, Rafael A

    2017-11-01

    The main application of ChIP-seq technology is the detection of genomic regions that bind to a protein of interest. A large part of functional genomics' public catalogs is based on ChIP-seq data. These catalogs rely on peak calling algorithms that infer protein-binding sites by detecting genomic regions associated with more mapped reads (coverage) than expected by chance, as a result of the experimental protocol's lack of perfect specificity. We find that GC-content bias accounts for substantial variability in the observed coverage for ChIP-seq experiments and that this variability leads to false-positive peak calls. More concerning is that the GC effect varies across experiments, with the effect strong enough to result in a substantial number of peaks called differently when different laboratories perform experiments on the same cell line. However, accounting for GC content bias in ChIP-seq is challenging because the binding sites of interest tend to be more common in high GC-content regions, which confounds real biological signals with unwanted variability. To account for this challenge, we introduce a statistical approach that accounts for GC effects on both nonspecific noise and signal induced by the binding site. The method can be used to account for this bias in binding quantification as well to improve existing peak calling algorithms. We use this approach to show a reduction in false-positive peaks as well as improved consistency across laboratories. © 2017 Teng and Irizarry; Published by Cold Spring Harbor Laboratory Press.

  4. A zwitterionic squaraine dye with a large Stokes shift for in vivo and site-selective protein sensing.

    PubMed

    Xu, Yongqian; Liu, Qin; Li, Xiaopeng; Wesdemiotis, Chrys; Pang, Yi

    2012-11-28

    A novel squaraine dye (SQ) exhibits improved fluorescence response toward protein detection by incorporation of a zwitterionic structure. With the aid of a dansylamide (DNSA) substituent, the new probe (DNSA-SQ) exhibits remarkable selectivity in binding to site I (a specific substructure in protein).

  5. Mistletoe lectin I in complex with galactose and lactose reveals distinct sugar-binding properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikeska, Ruth; Wacker, Roland; Arni, Raghuvir

    2005-01-01

    The structures of mistletoe lectin I in complex with lactose and galactose reveal differences in binding by the two known sites in subdomains α1 and γ2 and suggest the presence of a third low-affinity site in subdomain β1. The structures of mistletoe lectin I (ML-I) from Viscum album complexed with lactose and galactose have been determined at 2.3 Å resolution and refined to R factors of 20.9% (R{sub free} = 23.6%) and 20.9 (R{sub free} = 24.6%), respectively. ML-I is a heterodimer and belongs to the class of ribosome-inactivating proteins of type II, which consist of two chains. The A-chainmore » has rRNA N-glycosidase activity and irreversibly inhibits eukaryotic ribosomes. The B-chain is a lectin and preferentially binds to galactose-terminated glycolipids and glycoproteins on cell membranes. Saccharide binding is performed by two binding sites in subdomains α1 and γ2 of the ML-I B-chain separated by ∼62 Å from each other. The favoured binding of galactose in subdomain α1 is achieved via hydrogen bonds connecting the 4-hydroxyl and 3-hydroxyl groups of the sugar moiety with the side chains of Asp23B, Gln36B and Lys41B and the main chain of 26B. The aromatic ring of Trp38B on top of the preferred binding pocket supports van der Waals packing of the apolar face of galactose and stabilizes the sugar–lectin complex. In the galactose-binding site II of subdomain γ2, Tyr249B provides the hydrophobic stacking and the side chains of Asp235B, Gln238B and Asn256B are hydrogen-bonding partners for galactose. In the case of the galactose-binding site I, the 2-hydroxyl group also stabilizes the sugar–protein complex, an interaction thus far rarely detected in galactose-specific lectins. Finally, a potential third low-affinity galactose-binding site in subunit β1 was identified in the present ML-I structures, in which a glycerol molecule from the cryoprotectant buffer has bound, mimicking the sugar compound.« less

  6. Identification of the residues involved in stabilization of the semiquinone radical in the high-affinity ubiquinone binding site in cytochrome bo(3) from Escherichia coli by site-directed mutagenesis and EPR spectroscopy.

    PubMed

    Hellwig, Petra; Yano, Takahiro; Ohnishi, Tomoko; Gennis, Robert B

    2002-08-27

    During turnover of cytochrome bo(3) from Escherichia coli, a semiquinone radical is stabilized in a high-affinity binding site. To identify binding partners of this radical, site-directed mutants have been designed on the basis of a recently modeled quinone binding site (Abramson et al., 2000). The R71H, H98F, D75H, and I102W mutant enzymes were found to show very little or no quinol oxidase activity. The thermodynamic and EPR spectroscopic properties of semiquinone radicals in these mutants were characterized. For the H98F and the R71H mutants, no EPR signal of the semiquinone radical was observed in the redox potential range from -100 to 250 mV. During potentiometric titration of the D75H mutant enzyme, a semiquinone signal was detected in the same potential range as that of the wild-type enzyme. However, the EPR spectrum of the D75H mutant lacks the characteristic hyperfine structure of the semiquinone radical signal observed in the wild-type oxidase, indicating that D75 or the introduced His, interacts with the semiquinone radical. For the I102W mutant, a free radical signal was observed with a redox midpoint potential downshifted by about 200 mV. On the basis of these observations, it is suggested that R71, D75, and H98 residues are involved in the stabilization of the semiquinone state in the high-affinity binding site. Details of the possible binding motif and mechanistic implications are discussed.

  7. Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.

    PubMed

    Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart

    2014-01-15

    High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter

  8. Evidence for in vivo phosphorylation of the Grb2 SH2-domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases.

    PubMed

    Schlaepfer, D D; Hunter, T

    1996-10-01

    Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.

  9. The investigation of the binding of 6-mercaptopurine to site I on human serum albumin.

    PubMed

    Sochacka, Jolanta; Baran, Wojciech

    2012-12-01

    6-Mercaptopurine (6-MP) is one of a large series of purine analogues which has been found active against human leukemias. The equilibrium dialysis, circular dichroism (CD) and molecular docking were employed to study the binding of 6-MP to human serum albumin (HSA). The binding of 6-MP to HSA in the equilibrium dialysis experiment was detected by measuring the displacement of 6-MP by specific markers for site I on HSA, warfarin (RWF), phenylbutazone (PhB) and n-butyl p-aminobenzoate (ABE). It was shown, according to CD data, that binding of 6-MP to HSA leads to alteration of HSA secondary structure. Based on the findings from displacement experiment and molecular docking simulation it was found that 6-MP was located within binding cavity of subdomain IIA and the space occupied by site markers overlapped with that of 6-MP. Displacement of 6-MP by the RWF or PhB was not up the level expected for a competitive mechanism, therefore displacement of 6-MP was rather by non-cooperative than that the direct competition. Instead, in case of the interaction between ABE and 6-MP, when the little enhancement of the binding of ABE by 6-MP was found, the interaction could be via a positively cooperative mechanism.

  10. Dynamic Nuclear Polarization Study of Inhibitor Binding to the M218–60 Proton Transporter from Influenza A

    PubMed Central

    Andreas, Loren B.; Barnes, Alexander B.; Corzilius, Björn; Chou, James J.; Miller, Eric A.; Caporini, Marc; Rosay, Melanie; Griffin, Robert G

    2013-01-01

    We demonstrate the use of dynamic nuclear polarization (DNP) to elucidate ligand binding to a membrane protein using dipolar recoupling magic angle spinning (MAS) NMR. In particular, we detect drug binding in the proton transporter M218–60 from influenza A using recoupling experiments at room temperature and with cryogenic DNP. The results indicate that the pore binding site of rimantadine is correlated with previously reported widespread chemical shift changes, suggesting functional binding in the pore. Futhermore, the 15N labeled ammonium of rimantadine was observed near A30 13Cβ and G34 13Cα suggesting a possible hydrogen bond to A30 Carbonyl. Cryogenic DNP was required to observe the weaker external binding site(s) in a ZF-TEDOR spectrum. This approach is generally applicable, particularly for weakly bound ligands, in which case the application of MAS NMR dipolar recoupling requires the low temperatures to quench dynamic exchange processes. For the fully protonated samples investigated, we observed DNP signal enhancements of ~10 at 400 MHz using only 4–6 mM of the polarizing agent TOTAPOL. At 600 MHz and with DNP, we measured a distance between the drug and the protein to a precision of 0.2 Å. PMID:23480101

  11. Structural Basis for High Affinity Volatile Anesthetic Binding in a Natural 4-helix Bundle Protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu,R.; Loll, P.; Eckenhoff, R.

    2005-01-01

    Physiologic sites for inhaled anesthetics are presumed to be cavities within transmembrane 4-{alpha}-helix bundles of neurotransmitter receptors, but confirmation of binding and structural detail of such sites remains elusive. To provide such detail, we screened soluble proteins containing this structural motif, and found only one that exhibited evidence of strong anesthetic binding. Ferritin is a 24-mer of 4-{alpha}-helix bundles; both halothane and isoflurane bind with K{sub A} values of {approx}10{sup 5} M{sup -1, } higher than any previously reported inhaled anesthetic-protein interaction. The crystal structures of the halothane/apoferritin and isoflurane/apoferritin complexes were determined at 1.75 Angstroms resolution, revealing a commonmore » anesthetic binding pocket within an interhelical dimerization interface. The high affinity is explained by several weak polar contacts and an optimal host/guest packing relationship. Neither the acidic protons nor ether oxygen of the anesthetics contribute to the binding interaction. Compared with unliganded apoferritin, the anesthetic produced no detectable alteration of structure or B factors. The remarkably high affinity of the anesthetic/apoferritin complex implies greater selectivity of protein sites than previously thought, and suggests that direct protein actions may underlie effects at lower than surgical levels of anesthetic, including loss of awareness.« less

  12. Computational design of environmental sensors for the potent opioid fentanyl

    DOE PAGES

    Bick, Matthew J.; Greisen, Per J.; Morey, Kevin J.; ...

    2017-09-19

    Here, we describe the computational design of proteins that bind the potent analgesic fentanyl. Our approach employs a fast docking algorithm to find shape complementary ligand placement in protein scaffolds, followed by design of the surrounding residues to optimize binding affinity. Co-crystal structures of the highest affinity binder reveal a highly preorganized binding site, and an overall architecture and ligand placement in close agreement with the design model. We also use the designs to generate plant sensors for fentanyl by coupling ligand binding to design stability. The method should be generally useful for detecting toxic hydrophobic compounds in the environment.

  13. Computational design of environmental sensors for the potent opioid fentanyl

    PubMed Central

    Morey, Kevin J; Antunes, Mauricio S; La, David; Sankaran, Banumathi; Reymond, Luc; Johnsson, Kai; Medford, June I

    2017-01-01

    We describe the computational design of proteins that bind the potent analgesic fentanyl. Our approach employs a fast docking algorithm to find shape complementary ligand placement in protein scaffolds, followed by design of the surrounding residues to optimize binding affinity. Co-crystal structures of the highest affinity binder reveal a highly preorganized binding site, and an overall architecture and ligand placement in close agreement with the design model. We use the designs to generate plant sensors for fentanyl by coupling ligand binding to design stability. The method should be generally useful for detecting toxic hydrophobic compounds in the environment. PMID:28925919

  14. Computational design of environmental sensors for the potent opioid fentanyl

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bick, Matthew J.; Greisen, Per J.; Morey, Kevin J.

    Here, we describe the computational design of proteins that bind the potent analgesic fentanyl. Our approach employs a fast docking algorithm to find shape complementary ligand placement in protein scaffolds, followed by design of the surrounding residues to optimize binding affinity. Co-crystal structures of the highest affinity binder reveal a highly preorganized binding site, and an overall architecture and ligand placement in close agreement with the design model. We also use the designs to generate plant sensors for fentanyl by coupling ligand binding to design stability. The method should be generally useful for detecting toxic hydrophobic compounds in the environment.

  15. Massive GGAAs in genomic repetitive sequences serve as a nuclear reservoir of NF-κB.

    PubMed

    Wu, Jian; Wang, Qiao; Dai, Wei; Wang, Wei; Yue, Ming; Wang, Jinke

    2018-04-13

    Nuclear factor κB (NF-κB) is a DNA-binding transcription factor. Characterizing its genomic binding sites is crucial for understanding its gene regulatory function and mechanism in cells. This study characterized the binding sites of NF-κB RelA/p65 in the tumor neurosis factor-α (TNFα) stimulated HeLa cells by a precise chromatin immunoprecipitation-sequencing (ChIP-seq). The results revealed that NF-κB binds nontraditional motifs (nt-motifs) containing conserved GGAA quadruplet. Moreover, nt-motifs mainly distribute in the peaks nearby centromeres that contain a larger number of repetitive elements such as satellite, simple repeats and short interspersed nuclear elements (SINEs). This intracellular binding pattern was then confirmed by the in vitro detection, indicating that NF-κB dimers can bind the nontraditional κB (nt-κB) sites with low affinity. However, this binding hardly activates transcription. This study thus deduced that NF-κB binding nt-motifs may realize functions other than gene regulation as NF-κB binding traditional motifs (t-motifs). To testify the deduction, many ChIP-seq data of other cell lines were then analyzed. The results indicate that NF-κB binding nt-motifs is also widely present in other cells. The ChIP-seq data analysis also revealed that nt-motifs more widely distribute in the peaks with low-fold enrichment. Importantly, it was also found that NF-κB binding nt-motifs is mainly present in the resting cells, whereas NF-κB binding t-motifs is mainly present in the stimulated cells. Astonishingly, no known function was enriched by the gene annotation of nt-motif peaks. Based on these results, this study proposed that the nt-κB sites that extensively distribute in larger numbers of repeat elements function as a nuclear reservoir of NF-κB. The nuclear NF-κB proteins stored at nt-κB sites in the resting cells may be recruited to the t-κB sites for regulating its target genes upon stimulation. Copyright © 2018 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  16. Non-B-Form DNA Is Enriched at Centromeres

    PubMed Central

    Henikoff, Steven

    2018-01-01

    Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

  17. Site-Specific Photoconjugation of Beta-Lactamase Fragments to Monoclonal Antibodies Enables Sensitive Analyte Detection via Split-Enzyme Complementation.

    PubMed

    Yu, Feifan; Alesand, Veronica; Nygren, Per-Åke

    2018-02-27

    Protein fragment complementation assays (PCA) rely on a proximity-driven reconstitution of a split reporter protein activity, typically via interaction between bait and prey units separately fused to the reporter protein halves. The PCA principle can also be formatted for use in immunossays for analyte detection, e.g., via the use of small immunoglobulin binding proteins (IgBp) as fusion partners to split-reporter protein fragments for conversion of pairs of antibodies into split-protein half-probes. However, the non-covalent binding between IgBp and antibodies is not ideal for development of robust assays. Here, the authors describe how split-enzyme reporter halves can be both site-specifically and covalently photoconjugated at antibody Fc-parts for use in homogeneous dual-antibody in vitro immunoassays based on analyte-dependent split-enzyme fragment complementation. The half-probes consist of parts of a beta-lactamase split-protein reporter fused to an immunoglobulin Fc binding domain equipped with a unique cysteine residue at which a photoactivable maleimide benzophenone group (MBP) is attached. Using such antibody conjugates the authors obtain an analyte-driven complementation of the reporter enzyme fragments monitored via conversion of a chromogenic substrate. Results from detection of human interferon-gamma and the extracellular domain of HER2 is shown. The described principles for site-specific conjugation of proteins to antibodies should be broadly applicable. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Development of a paper-based carbon nanotube sensing microfluidic device for biological detection.

    PubMed

    Yang, Shih-I; Lei, Kin Fong; Tsai, Shiao-Wen; Hsu, Hsiao-Ting

    2013-01-01

    Carbon nanotube (CNT) has been utilized for the biological detection due to its extremely sensitive to biological molecules. A paper-based CNT sensing microfluidic device has been developed for the detection of protein, i.e., biotin-avidin, binding. We have developed a fabrication method that allows controlled deposition of bundled CNTs with well-defined dimensions to form sensors on paper. Then, polydimethyl siloxane (PDMS) was used to pattern the hydrophobic boundary on paper to form the reaction sites. The proposed fabrication method is based on vacuum filtration process with a metal mask covering on a filter paper for the definition of the dimension of sensor. The length, width, and thickness of the CNT-based sensors are readily controlled by the metal mask and the weight of the CNT powder used during the filtration process, respectively. Homogeneous deposition of CNTs with well-defined dimensions can be achieved. The CNT-based sensor on paper has been demonstrated on the detection of the protein binding. Biotin was first immobilized on the CNT's sidewall and avidin suspended solution was applied to the site. The result of the biotin-avidin binding was measured by the resistance change of the sensor, which is a label-free detection method. It showed the CNT is sensitive to the biological molecules and the proposed paper-based CNT sensing device is a possible candidate for point-of-care biosensors. Thus, electrical bio-assays on paper-based microfluidics can be realized to develop low cost, sensitive, and specific diagnostic devices.

  19. Distribution of sup 125 I-neurotensin binding sites in human forebrain: Comparison with the localization of acetylcholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szigethy, E.; Quirion, R.; Beaudet, A.

    1990-07-22

    The distribution of 125I-neurotensin binding sites was compared with that of acetylcholinesterase reactivity in the human basal forebrain by using combined light microscopic radioautography/histochemistry. High 125I-neurotensin binding densities were observed in the bed nucleus of the stria terminalis, islands of Calleja, claustrum, olfactory tubercle, and central nucleus of the amygdala; lower levels were seen in the caudate, putamen, medial septum, diagonal band nucleus, and nucleus basalis of Meynert. Adjacent sections processed for cholinesterase histochemistry demonstrated a regional overlap between the distribution of labeled neurotensin binding sites and that of intense acetylcholinesterase staining in all of the above regions, except inmore » the bed nucleus of the stria terminalis, claustrum, and central amygdaloid nucleus, where dense 125I-neurotensin labeling was detected over areas containing only weak to moderate cholinesterase staining. At higher magnification, 125I-neurotensin-labeled binding sites in the islands of Calleja, supraoptic nucleus of the hypothalamus, medial septum, diagonal band nucleus, and nucleus basalis of Meynert were selectively associated with neuronal perikarya found to be cholinesterase-positive in adjacent sections. Moderate 125I-neurotensin binding was also apparent over the cholinesterase-reactive neuropil of these latter three regions. These data suggest that neurotensin (NT) may directly influence the activity of magnocellular cholinergic neurons in the human basal forebrain, and may be involved in the physiopathology of dementing disorders such as Alzheimer's disease, in which these neurons have been shown to be affected.« less

  20. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

    PubMed Central

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-01-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

  1. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

    PubMed

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-08-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  2. A new design for a green calcium indicator with a smaller size and a reduced number of calcium-binding sites

    PubMed Central

    Barykina, Natalia V.; Subach, Oksana M.; Doronin, Danila A.; Sotskov, Vladimir P.; Roshchina, Marina A.; Kunitsyna, Tatiana A.; Malyshev, Aleksey Y.; Smirnov, Ivan V.; Azieva, Asya M.; Sokolov, Ilya S.; Piatkevich, Kiryl D.; Burtsev, Mikhail S.; Varizhuk, Anna M.; Pozmogova, Galina E.; Anokhin, Konstantin V.; Subach, Fedor V.; Enikolopov, Grigori N.

    2016-01-01

    Genetically encoded calcium indicators (GECIs) are mainly represented by two- or one-fluorophore-based sensors. One type of two-fluorophore-based sensor, carrying Opsanus troponin C (TnC) as the Ca2+-binding moiety, has two binding sites for calcium ions, providing a linear response to calcium ions. One-fluorophore-based sensors have four Ca2+-binding sites but are better suited for in vivo experiments. Herein, we describe a novel design for a one-fluorophore-based GECI with two Ca2+-binding sites. The engineered sensor, called NTnC, uses TnC as the Ca2+-binding moiety, inserted in the mNeonGreen fluorescent protein. Monomeric NTnC has higher brightness and pH-stability in vitro compared with the standard GECI GCaMP6s. In addition, NTnC shows an inverted fluorescence response to Ca2+. Using NTnC, we have visualized Ca2+ dynamics during spontaneous activity of neuronal cultures as confirmed by control NTnC and its mutant, in which the affinity to Ca2+ is eliminated. Using whole-cell patch clamp, we have demonstrated that NTnC dynamics in neurons are similar to those of GCaMP6s and allow robust detection of single action potentials. Finally, we have used NTnC to visualize Ca2+ neuronal activity in vivo in the V1 cortical area in awake and freely moving mice using two-photon microscopy or an nVista miniaturized microscope. PMID:27677952

  3. Insights into the complex association of bovine factor Va with acidic-lipid-containing synthetic membranes.

    PubMed Central

    Cutsforth, G A; Koppaka, V; Krishnaswamy, S; Wu, J R; Mann, K G; Lentz, B R

    1996-01-01

    The mechanism of binding of blood coagulation cofactor factor Va to acidic-lipid-containing membranes has been addressed. Binding isotherms were generated at room temperature using the change in fluorescence anisotropy of pyrene-labeled bovine factor Va to detect binding to sonicated membrane vesicles containing either bovine brain phosphatidylserine (PS) or 1,2-dioleoyl-3-sn-phosphatidylglycerol (DOPG) in combination with 1-palmitoyl-2-oleoyl-3-sn-phosphatidylcholine (POPC). The composition of the membranes was varied from 0 to 40 mol% for PS/POPC and from 0 to 65 mol % for DOPG/POPC membranes. Fitting the data to a classical Langmuir adsorption model yielded estimates of the dissociation constant (Kd) and the stoichiometry of binding. The values of Kd defined in this way displayed a maximum at low acidic lipid content but were nearly constant at intermediate to high fractions of acidic lipid. Fitting the binding isotherms to a two-process binding model (nonspecific adsorption in addition to binding of acidic lipids to sites on the protein) suggested a significant acidic-lipid-independent binding affinity in addition to occupancy of three protein sites that bind PS in preference to DOPG. Both analyses indicated that interaction of factor Va with an acidic-lipid-containing membrane is much more complex than those of factor Xa or prothrombin. Furthermore, a change in the conformation of bound pyrene-labeled factor Va with surface concentration of acidic lipid was implied by variation of both the saturating fluorescence anisotropy and the binding parameters with the acidic lipid content of the membrane. Finally, the results cannot support the contention that binding occurs through nonspecific adsorption to a patch or domain of acidic lipids in the membrane. Factor Va is suggested to associate with membranes by a complex process that includes both acidic-lipid-specific and acidic-lipid-independent sites and a protein structure change induced by occupancy of acidic-lipid-specific sites on the factor Va molecule. Images FIGURE 5 PMID:8744332

  4. Monoclonal and anti-idiotypic anti-EBV/C3d receptor antibodies detect two binding sites, one for EBV and one for C3d on glycoprotein 140, the EBV/C3dR, expressed on human B lymphocytes.

    PubMed

    Barel, M; Fiandino, A; Delcayre, A X; Lyamani, F; Frade, R

    1988-09-01

    Glycoprotein (gp) 140, the EBV/C3dR of B lymphocytes, is a membrane site involved in human cell regulation. To analyze the specificities of the binding sites for EBV and for C3d on the gp 140 molecule, two distinct approaches were used. First, anti-EBV/C3dR mAb were prepared against highly purified EBV/C3dR. Nine anti-EBV/C3dR mAb were obtained. Four of these anti-EBV/C3dR mAb inhibited C3d binding but not EBV binding on gp 140, whereas four others exerted an inverse effect. These differences could not be due to differences in isotype, antibody concentration, affinity constant, and number of molecules bound on cell surface, as these parameters were identical for the nine used mAb. Second, polyclonal anti-idiotypic antibodies (Ab2) were prepared against F(ab)'2 fragments of polyclonal anti-EBV/C3dR (Ab1). Ab2 recognized the variable portion of Ab1 as controlled by immunoblotting experiments. Ab2, which did not react with the cell surface, inhibited Ab1 binding on Raji cells. Ab2 mimicked the EBV/C3dR by its properties to bind to particle-bound C3d and EBV, preventing their binding on Raji cell surface. C3d binding specificities contained in Ab2 were isolated by affinity chromatography on C3b/C3bi-Sepharose. These specificities, being the internal image of C3d binding site of EBV/C3dR, reacted with Ab1 and inhibited particle-bound C3d binding on Raji cells but did not react with EBV. Taken together, these data support strongly that gp 140, the EBV/C3dR, carried two distinct binding sites, one for EBV and one for C3d.

  5. System and method for detecting components of a mixture including a valving scheme for competition assays

    DOEpatents

    Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

    2017-09-19

    Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

  6. System and method for detecting components of a mixture including a valving scheme for competition assays

    DOEpatents

    Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

    2017-07-11

    Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

  7. Differences in the binding mechanism of RU486 and progesterone to the progesterone receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Skafar, D.F.

    1991-11-12

    The binding mechanism of the antagonist RU486 to the progesterone receptor was compared with that of the agonists progesterone and R5020. Both progesterone and RU486 bound to the receptor with a Hill coefficient of 1.2, indicating the binding of each ligand is positive cooperative. However, when each ligand was used to compete with ({sup 3}H)progesterone for binding to the receptor at receptor concentrations near 8 nM, at which the receptor is likely a dimer, the competition curve for RU486 was significantly steeper than the curves for progesterone and R5020. This indicated that a difference in the binding mechanism of RU486more » and progesterone can be detected when both ligands are present. In contrast, at receptor concentrations near 1 nM, at which the receptor is likely a monomer, the competition curves for all three ligands were indistinguishable. These results indicate that RU486 and agonists have different binding mechanisms for the receptor and further suggest that this difference may be related to site-site interactions within the receptor.« less

  8. Fluoxetine (Prozac) Binding to Serotonin Transporter Is Modulated by Chloride and Conformational Changes

    PubMed Central

    Tavoulari, Sotiria; Forrest, Lucy R.; Rudnick, Gary

    2010-01-01

    Serotonin transporter (SERT) is the main target for widely used antidepressant agents. Several of these drugs, including imipramine, citalopram, sertraline, and fluoxetine (Prozac), bound more avidly to SERT in the presence of Cl–. In contrast, Cl– did not enhance cocaine or paroxetine binding. A Cl– binding site recently identified in SERT, and shown to be important for Cl– dependent transport, was also critical for the Cl– dependence of antidepressant affinity. Mutation of the residues contributing to this site eliminated the Cl–-mediated affinity increase for imipramine and fluoxetine. Analysis of ligand docking to a single state of SERT indicated only small differences in the energy of interaction between bound ligands and Cl–. These differences in interaction energy cannot account for the affinity differences observed for Cl– dependence. However, fluoxetine binding led to a conformational change, detected by cysteine accessibility experiments, that was qualitatively different from that induced by cocaine or other ligands. Given the known Cl– requirement for serotonin-induced conformational changes, we propose that Cl– binding facilitates conformational changes required for optimal binding of fluoxetine and other antidepressant drugs. PMID:19641126

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fedynyshyn, J.P.

    The opioid binding characteristics of the rat (PAG) and the signal transduction mechanisms of the opioid receptors were examined with in vitro radioligand binding, GTPase, adenylyl cyclase, and inositol phosphate assays. The nonselective ligand {sup 3}H-ethylketocyclazocine (EKC), the {mu} and {delta} selective ligand {sup 3}H-(D-Ala{sup 2}, D-Leu{sup 5}) enkephalin (DADLE), the {mu} selective ligand {sup 3}H-(D-Ala{sup 2}, N-methyl Phe{sup 4}, Glyol{sup 5}) enkephalin (DAGO), and the {delta} selective ligand {sup 3}H-(D-Pen{sup 2}, D-Pen{sup 5}) enkephalin (DPDPE) were separately used as tracer ligands to label opioid binding sites in rat PAG enriched P{sub 2} membrane in competition with unlabeled DADLE, DAGO,more » DPDPE, or the {kappa} selective ligand trans-3,4-dichloro-N-(2-(1-pyrrolidinyl)cyclohexyl)benzeneacetamide, methane sulfonate, hydrate (U50, 488H). Only {mu} selective high affinity opioid binding was observed. No high affinity {delta} or {kappa} selective binding was detected. {sup 3}H-DAGO was used as a tracer ligand to label {mu} selective high affinity opioid binding sites in PAG enriched P{sub 2} membrane in competition with unlabeled {beta}-endorphin, dynorphin A (1-17), BAM-18, methionine enkephalin, dynorphin A (1-8), and leucine enkephalin. Of these endogenous opioid peptides only those with previously reported high affinity {mu} type opioid binding activity competed with {sup 3}H-DAGO for binding sites in rat PAG enriched P{sub 2} membrane with affinities similar to that of unlabeled DAGO.« less

  10. Use of terbium as a probe of tRNA tertiary structure and folding.

    PubMed Central

    Hargittai, M R; Musier-Forsyth, K

    2000-01-01

    Lanthanide metals such as terbium have previously been shown to be useful for mapping metal-binding sites in RNA. Terbium binds to the same sites on RNA as magnesium, however, with a much higher affinity. Thus, low concentrations of terbium ions can easily displace magnesium and promote phosphodiester backbone scission. At higher concentrations, terbium cleaves RNA in a sequence-independent manner, with a preference for single-stranded, non-Watson-Crick base-paired regions. Here, we show that terbium is a sensitive probe of human tRNALys,3 tertiary structure and folding. When 1 microM tRNA is used, the optimal terbium ion concentration for detecting Mg2+-induced tertiary structural changes is 50-60 microM. Using these concentrations of RNA and terbium, a magnesium-dependent folding transition with a midpoint (KMg) of 2.6 mM is observed for unmodified human tRNALys,3. At lower Tb3+ concentrations, cleavage is restricted to nucleotides that constitute specific metal-binding pockets. This small chemical probe should also be useful for detecting protein induced structural changes in RNA. PMID:11105765

  11. HLA-A SNPs and amino acid variants are associated with nasopharyngeal carcinoma in Malaysian Chinese.

    PubMed

    Chin, Yoon-Ming; Mushiroda, Taisei; Takahashi, Atsushi; Kubo, Michiaki; Krishnan, Gopala; Yap, Lee-Fah; Teo, Soo-Hwang; Lim, Paul Vey-Hong; Yap, Yoke-Yeow; Pua, Kin-Choo; Kamatani, Naoyuki; Nakamura, Yusuke; Sam, Choon-Kook; Khoo, Alan Soo-Beng; Ng, Ching-Ching

    2015-02-01

    Nasopharyngeal carcinoma (NPC) arises from the mucosal epithelium of the nasopharynx and is constantly associated with Epstein-Barr virus type 1 (EBV-1) infection. We carried out a genome-wide association study (GWAS) of 575,247 autosomal SNPs in 184 NPC patients and 236 healthy controls of Malaysian Chinese ethnicity. Potential association signals were replicated in a separate cohort of 260 NPC patients and 245 healthy controls. We confirmed the association of HLA-A to NPC with the strongest signal detected in rs3869062 (p = 1.73 × 10(-9)). HLA-A fine mapping revealed associations in the amino acid variants as well as its corresponding SNPs in the antigen peptide binding groove (p(HLA-A-aa-site-99) = 3.79 × 10(-8), p(rs1136697) = 3.79 × 10(-8)) and T-cell receptor binding site (p(HLA-A-aa-site-145) = 1.41 × 10(-4), p(rs1059520) = 1.41 × 10(-4)) of the HLA-A. We also detected strong association signals in the 5'-UTR region with predicted active promoter states (p(rs41545520) = 7.91 × 10(-8)). SNP rs41545520 is a potential binding site for repressor ATF3, with increased binding affinity for rs41545520-G correlated with reduced HLA-A expression. Multivariate logistic regression diminished the effects of HLA-A amino acid variants and SNPs, indicating a correlation with the effects of HLA-A*11:01, and to a lesser extent HLA-A*02:07. We report the strong genetic influence of HLA-A on NPC susceptibility in the Malaysian Chinese. © 2014 UICC.

  12. Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.

    PubMed

    Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S

    2001-04-01

    The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.

  13. csaw: a Bioconductor package for differential binding analysis of ChIP-seq data using sliding windows

    PubMed Central

    Lun, Aaron T.L.; Smyth, Gordon K.

    2016-01-01

    Chromatin immunoprecipitation with massively parallel sequencing (ChIP-seq) is widely used to identify binding sites for a target protein in the genome. An important scientific application is to identify changes in protein binding between different treatment conditions, i.e. to detect differential binding. This can reveal potential mechanisms through which changes in binding may contribute to the treatment effect. The csaw package provides a framework for the de novo detection of differentially bound genomic regions. It uses a window-based strategy to summarize read counts across the genome. It exploits existing statistical software to test for significant differences in each window. Finally, it clusters windows into regions for output and controls the false discovery rate properly over all detected regions. The csaw package can handle arbitrarily complex experimental designs involving biological replicates. It can be applied to both transcription factor and histone mark datasets, and, more generally, to any type of sequencing data measuring genomic coverage. csaw performs favorably against existing methods for de novo DB analyses on both simulated and real data. csaw is implemented as a R software package and is freely available from the open-source Bioconductor project. PMID:26578583

  14. Anticancer drug-DNA interactions measured using a photoinduced electron-transfer mechanism based on luminescent quantum dots.

    PubMed

    Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang

    2009-01-01

    A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.

  15. Size versus polarizability in protein-ligand interactions: binding of noble gases within engineered cavities in phage T4 lysozyme.

    PubMed

    Quillin, M L; Breyer, W A; Griswold, I J; Matthews, B W

    2000-09-29

    To investigate the relative importance of size and polarizability in ligand binding within proteins, we have determined the crystal structures of pseudo wild-type and cavity-containing mutant phage T4 lysozymes in the presence of argon, krypton, and xenon. These proteins provide a representative sample of predominantly apolar cavities of varying size and shape. Even though the volumes of these cavities range up to the equivalent of five xenon atoms, the noble gases bind preferentially at highly localized sites that appear to be defined by constrictions in the walls of the cavities, coupled with the relatively large radii of the noble gases. The cavities within pseudo wild-type and L121A lysozymes each bind only a single atom of noble gas, while the cavities within mutants L133A and F153A have two independent binding sites, and the L99A cavity has three interacting sites. The binding of noble gases within two double mutants was studied to characterize the additivity of binding at such sites. In general, when a cavity in a protein is created by a "large-to-small" substitution, the surrounding residues relax somewhat to reduce the volume of the cavity. The binding of xenon and, to a lesser degree, krypton and argon, tend to expand the volume of the cavity and to return it closer to what it would have been had no relaxation occurred. In nearly all cases, the extent of binding of the noble gases follows the trend xenon>krypton>argon. Pressure titrations of the L99A mutant have confirmed that the crystallographic occupancies accurately reflect fractional saturation of the binding sites. The trend in noble gas affinity can be understood in terms of the effects of size and polarizability on the intermolecular potential. The plasticity of the protein matrix permits repulsion due to increased ligand size to be more than compensated for by attraction due to increased ligand polarizability. These results have implications for the mechanism of general anesthesia, the migration of small ligands within proteins, the detection of water molecules within apolar cavities and the determination of crystallographic phases. Copyright 2000 Academic Press.

  16. Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lishanski, A.; Ostrander, E.A.; Rine, J.

    1994-03-29

    An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS proteinmore » bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.« less

  17. High-resolution physical and functional mapping of the template adjacent DNA binding site in catalytically active telomerase.

    PubMed

    Romi, Erez; Baran, Nava; Gantman, Marina; Shmoish, Michael; Min, Bosun; Collins, Kathleen; Manor, Haim

    2007-05-22

    Telomerase is a cellular reverse transcriptase, which utilizes an integral RNA template to extend single-stranded telomeric DNA. We used site-specific photocrosslinking to map interactions between DNA primers and the catalytic protein subunit (tTERT) of Tetrahymena thermophila telomerase in functional enzyme complexes. Our assays reveal contact of the single-stranded DNA adjacent to the primer-template hybrid and tTERT residue W187 at the periphery of the N-terminal domain. This contact was detected in complexes with three different registers of template in the active site, suggesting that it is maintained throughout synthesis of a complete telomeric repeat. Substitution of nearby residue Q168, but not W187, alters the K(m) for primer elongation, implying that it plays a role in the DNA recognition. These findings are the first to directly demonstrate the physical location of TERT-DNA contacts in catalytically active telomerase and to identify amino acid determinants of DNA binding affinity. Our data also suggest a movement of the TERT active site relative to the template-adjacent single-stranded DNA binding site within a cycle of repeat synthesis.

  18. Native Mass Spectrometry in Fragment-Based Drug Discovery.

    PubMed

    Pedro, Liliana; Quinn, Ronald J

    2016-07-28

    The advent of native mass spectrometry (MS) in 1990 led to the development of new mass spectrometry instrumentation and methodologies for the analysis of noncovalent protein-ligand complexes. Native MS has matured to become a fast, simple, highly sensitive and automatable technique with well-established utility for fragment-based drug discovery (FBDD). Native MS has the capability to directly detect weak ligand binding to proteins, to determine stoichiometry, relative or absolute binding affinities and specificities. Native MS can be used to delineate ligand-binding sites, to elucidate mechanisms of cooperativity and to study the thermodynamics of binding. This review highlights key attributes of native MS for FBDD campaigns.

  19. LIBRA-WA: a web application for ligand binding site detection and protein function recognition.

    PubMed

    Toti, Daniele; Viet Hung, Le; Tortosa, Valentina; Brandi, Valentina; Polticelli, Fabio

    2018-03-01

    Recently, LIBRA, a tool for active/ligand binding site prediction, was described. LIBRA's effectiveness was comparable to similar state-of-the-art tools; however, its scoring scheme, output presentation, dependence on local resources and overall convenience were amenable to improvements. To solve these issues, LIBRA-WA, a web application based on an improved LIBRA engine, has been developed, featuring a novel scoring scheme consistently improving LIBRA's performance, and a refined algorithm that can identify binding sites hosted at the interface between different subunits. LIBRA-WA also sports additional functionalities like ligand clustering and a completely redesigned interface for an easier analysis of the output. Extensive tests on 373 apoprotein structures indicate that LIBRA-WA is able to identify the biologically relevant ligand/ligand binding site in 357 cases (∼96%), with the correct prediction ranking first in 349 cases (∼98% of the latter, ∼94% of the total). The earlier stand-alone tool has also been updated and dubbed LIBRA+, by integrating LIBRA-WA's improved engine for cross-compatibility purposes. LIBRA-WA and LIBRA+ are available at: http://www.computationalbiology.it/software.html. polticel@uniroma3.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  20. Cholinergic nicotinic and muscarinic receptors in dementia of Alzheimer, Parkinson and Lewy body types.

    PubMed

    Perry, E K; Smith, C J; Court, J A; Perry, R H

    1990-01-01

    Cholinergic nicotinic and muscarinic receptor binding were measured in post mortem human brain tissue, using low (nM) concentrations of (3H)-nicotine to detect predominately the high affinity nicotinic site and (3H)-N-methylscopolamine in the presence and absence of 3 x 10(-4) M carbachol to measure both the low and high affinity agonist subtypes of the muscarinic receptor group. Consistent with most previous reports, the nicotinic but not muscarinic binding was reduced in the different forms of dementia associated with cortical cholinergic deficits, including Alzheimer's and Parkinson's disease, senile dementia of Lewy body type (SDLT) and Down's syndrome (over 50 years). Analysis of (3H)-nicotine binding displaced by a range of carbachol concentrations (10(-9)-10(-3) M) indicated 2 binding sites for nicotine and that the high affinity rather than low affinity site was reduced in Alzheimer's disease. In all 3 cortical areas investigated (temporal, parietal and occipital) there were increases in the low affinity muscarinic site in Parkinson's disease and SDLT but not Alzheimer's disease or middle-aged Down's syndrome. This observation raised the question of whether the presence of neurofibrillary tangles (evident in the latter but not former 2 disorders) is incompatible with denervation-induced muscarinic supersensitivity in cholinoceptive neurons which include cortical pyramids generally affeted by tangle formation.

  1. Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

    PubMed Central

    Augustin, Regina; Lichtenthaler, Stefan F.; Greeff, Michael; Hansen, Jens; Wurst, Wolfgang; Trümbach, Dietrich

    2011-01-01

    The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD) pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases. PMID:21559189

  2. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

    PubMed Central

    Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

    2015-01-01

    A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

  3. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

    PubMed

    Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

    2015-01-01

    A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

  4. Rationally designed fluorescently labeled sulfate-binding protein mutants: evaluation in the development of a sensing system for sulfate

    NASA Technical Reports Server (NTRS)

    Shrestha, Suresh; Salins, Lyndon L E.; Mark Ensor, C.; Daunert, Sylvia

    2002-01-01

    Periplasmic binding proteins from E. coli undergo large conformational changes upon binding their respective ligands. By attaching a fluorescent probe at rationally selected unique sites on the protein, these conformational changes in the protein can be monitored by measuring the changes in fluorescence intensity of the probe which allow the development of reagentless sensing systems for their corresponding ligands. In this work, we evaluated several sites on bacterial periplasmic sulfate-binding protein (SBP) for attachment of a fluorescent probe and rationally designed a reagentless sensing system for sulfate. Eight different mutants of SBP were prepared by employing the polymerase chain reaction (PCR) to introduce a unique cysteine residue at a specific location on the protein. The sites Gly55, Ser90, Ser129, Ala140, Leu145, Ser171, Val181, and Gly186 were chosen for mutagenesis by studying the three-dimensional X-ray crystal structure of SBP. An environment-sensitive fluorescent probe (MDCC) was then attached site-specifically to the protein through the sulfhydryl group of the unique cysteine residue introduced. Each fluorescent probe-conjugated SBP mutant was characterized in terms of its fluorescence properties and Ser171 was determined to be the best site for the attachment of the fluorescent probe that would allow for the development of a reagentless sensing system for sulfate. Three different environment-sensitive fluorescent probes (1,5-IAEDANS, MDCC, and acylodan) were studied with the SBP171 mutant protein. A calibration curve for sulfate was constructed using the labeled protein and relating the change in the fluorescence intensity with the amount of sulfate present in the sample. The detection limit for sulfate was found to be in the submicromolar range using this system. The selectivity of the sensing system was demonstrated by evaluating its response to other anions. A fast and selective sensing system with detection limits for sulfate in the submicromolar range was developed. Copyright 2002 Wiley Periodicals, Inc. Biotechnol Bioeng 78: 517-526, 2002.

  5. Dynamic Factors Affecting Gaseous Ligand Binding in an Artificial Oxygen Transport Protein‡

    PubMed Central

    Zhang, Lei; Andersen, Eskil M.E.; Khajo, Abdelahad; Magliozzo, Richard S.; Koder, Ronald L.

    2013-01-01

    We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7 this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime which may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when when exposed to oxygen. Compared to HP7, distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off-rate. EPR comparison of these ferric hemoproteins demonstrates that the mutation increases disorder at the heme binding site. NMR-detected deuterium exchange demonstrates that the mutation greatly increases water penetration into the protein core. The inability of the mutant protein to bind oxygen may be due to increased water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together these data underline the importance of the control of protein dynamics in the design of functional artificial proteins. PMID:23249163

  6. Dynamic factors affecting gaseous ligand binding in an artificial oxygen transport protein.

    PubMed

    Zhang, Lei; Andersen, Eskil M E; Khajo, Abdelahad; Magliozzo, Richard S; Koder, Ronald L

    2013-01-22

    We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7, this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities, and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime that may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when exposed to oxygen. Compared to that of HP7, the distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off rate. Electron paramagnetic resonance comparison of these ferric hemoproteins demonstrates that the mutation increases the level of disorder at the heme binding site. Nuclear magnetic resonance-detected deuterium exchange demonstrates that the mutation greatly increases the degree of penetration of water into the protein core. The inability of the mutant protein to bind oxygen may be due to an increased level of water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together, these data underline the importance of the control of protein dynamics in the design of functional artificial proteins.

  7. How does huperzine A enter and leave the binding gorge of acetylcholinesterase? Steered molecular dynamics simulations.

    PubMed

    Xu, Yechun; Shen, Jianhua; Luo, Xiaomin; Silman, Israel; Sussman, Joel L; Chen, Kaixian; Jiang, Hualiang

    2003-09-17

    The entering and leaving processes of Huperzine A (HupA) binding with the long active-site gorge of Torpedo californica acetylcholinesterase (TcAChE) have been investigated by using steered molecular dynamics simulations. The analysis of the force required along the pathway shows that it is easier for HupA to bind to the active site of AChE than to disassociate from it, which for the first time interprets at the atomic level the previous experimental result that unbinding process of HupA is much slower than its binding process to AChE. The direct hydrogen bonds, water bridges, and hydrophobic interactions were analyzed during two steered molecular dynamics (SMD) simulations. Break of the direct hydrogen bond needs a great pulling force. The steric hindrance of bottleneck might be the most important factor to produce the maximal rupture force for HupA to leave the binding site but it has a little effect on the binding process of HupA with AChE. Residue Asp72 forms a lot of water bridges with HupA leaving and entering the AChE binding gorge, acting as a clamp to take out HupA from or put HupA into the active site. The flip of the peptide bond between Gly117 and Gly118 has been detected during both the conventional MD and SMD simulations. The simulation results indicate that this flip phenomenon could be an intrinsic property of AChE and the Gly117-Gly118 peptide bond in both HupA bound and unbound AChE structures tends to adopt the native enzyme structure. At last, in a vacuum the rupture force is increased up to 1500 pN while in water solution the greatest rupture force is about 800 pN, which means water molecules in the binding gorge act as lubricant to facilitate HupA entering or leaving the binding gorge.

  8. Lactose-containing starburst dendrimers: influence of dendrimer generation and binding-site orientation of receptors (plant/animal lectins and immunoglobulins) on binding properties.

    PubMed

    André, S; Ortega, P J; Perez, M A; Roy, R; Gabius, H J

    1999-11-01

    Starburst glycodendrimers offer the potential to serve as high-affinity ligands for clinically relevant sugar receptors. In order to define areas of application, their binding behavior towards sugar receptors with differential binding-site orientation but identical monosaccharide specificity must be evaluated. Using poly(amidoamine) starburst dendrimers of five generations, which contain the p-isothiocyanato derivative of p-aminophenyl-beta-D-lactoside as ligand group, four different types of galactoside-binding proteins were chosen for this purpose, i.e., the (AB)(2)-toxic agglutinin from mistletoe, a human immunoglobulin G fraction, the homodimeric galectin-1 with its two binding sites at opposite ends of the jelly-roll-motif-harboring protein and monomeric galectin-3. Direct solid-phase assays with surface-immobilized glycodendrimers resulted in obvious affinity enhancements by progressive core branching for the plant agglutinin and less pronounced for the antibody and galectin-1. High density of binding of galectin-3 with modest affinity increases only from the level of the 32-mer onwards points to favorable protein-protein interactions of the monomeric lectin and a spherical display of the end groups without a major share of backfolding. When the inhibitory potency of these probes was evaluated as competitor of receptor binding to an immobilized neoglycoprotein or to asialofetuin, a marked selectivity was detected. The 32- and 64-mers were second to none as inhibitors for the plant agglutinin against both ligand-exposing matrices and for galectin-1 on the matrix with a heterogeneous array of interglycoside distances even on the per-sugar basis. In contrast, a neoglycoprotein with the same end group was superior in the case of the antibody and, less pronounced, monomeric galectin-3. Intimate details of topological binding-site presentation and the ligand display on different generations of core assembly are major operative factors which determine the potential of dendrimers for applications as lectin-targeting device, as attested by these observations.

  9. Identity of a peptide domain of human C9 that is bound by the cell-surface complement inhibitor, CD59.

    PubMed

    Chang, C P; Hüsler, T; Zhao, J; Wiedmer, T; Sims, P J

    1994-10-21

    The CD59 antigen is a plasma membrane glycoprotein that serves as an inhibitor of the C5b-9 complex of complement. This inhibitory activity appears related to the capacity of CD59 to bind with high affinity to sites that are nascently exposed in the alpha-chain subunit of human C8, as well as within the C9b domain (amino acid residues 245-538) of human C9, during assembly of the C5b-9 complex on the target membrane (Ninomiya, H., and Sims, P. J. (1992) J. Biol. Chem. 267, 13675-13680). The CD59 binding site in C9 was first investigated by N-terminal sequencing of CD59-binding peptides generated by limited digest of the isolated C9b domain. These experiments revealed a 17-kDa fragment (starting at C9 residue Thr-320) that retained affinity for CD59, suggesting the possibility for localizing the CD59 binding site by mapping with small C9-derived peptides. Peptides spanning the entire C9b sequence were expressed in Escherichia coli and then probed with CD59. CD59 bound specifically to all peptides starting N-terminal to C9 residue 359 with C termini extending beyond residue 411. Little to no CD59 binding was observed for various C9-derived peptides that started C-terminal to residue 359 or that were truncated N-terminal to residue 411. Affinity-purified antibody against C9 residues 320-411 inhibited CD59 binding to C9 by > 50% and completely inhibited its binding to the isolated C9b domain. Little to no specific binding of CD59 was detected for peptides restricted to the putative hinge domain within C9b (residues 245-271). These results indicate that a CD59 binding site is located between residues 320 and 411 of the C9 polypeptide and suggest that the affinity of this site is principally determined by residues 359-411.

  10. High-throughput kinase assays with protein substrates using fluorescent polymer superquenching.

    PubMed

    Rininsland, Frauke; Stankewicz, Casey; Weatherford, Wendy; McBranch, Duncan

    2005-05-31

    High-throughput screening is used by the pharmaceutical industry for identifying lead compounds that interact with targets of pharmacological interest. Because of the key role that aberrant regulation of protein phosphorylation plays in diseases such as cancer, diabetes and hypertension, kinases have become one of the main drug targets. With the exception of antibody-based assays, methods to screen for specific kinase activity are generally restricted to the use of small synthetic peptides as substrates. However, the use of natural protein substrates has the advantage that potential inhibitors can be detected that affect enzyme activity by binding to a site other than the catalytic site. We have previously reported a non-radioactive and non-antibody-based fluorescence quench assay for detection of phosphorylation or dephosphorylation using synthetic peptide substrates. The aim of this work is to develop an assay for detection of phosphorylation of chemically unmodified proteins based on this polymer superquenching platform. Using a modified QTL Lightspeed assay, phosphorylation of native protein was quantified by the interaction of the phosphorylated proteins with metal-ion coordinating groups co-located with fluorescent polymer deposited onto microspheres. The binding of phospho-protein inhibits a dye-labeled "tracer" peptide from associating to the phosphate-binding sites present on the fluorescent microspheres. The resulting inhibition of quench generates a "turn on" assay, in which the signal correlates with the phosphorylation of the substrate. The assay was tested on three different proteins: Myelin Basic Protein (MBP), Histone H1 and Phosphorylated heat- and acid-stable protein (PHAS-1). Phosphorylation of the proteins was detected by Protein Kinase Calpha (PKCalpha) and by the Interleukin -1 Receptor-associated Kinase 4 (IRAK4). Enzyme inhibition yielded IC50 values that were comparable to those obtained using peptide substrates. Statistical parameters that are used in the high-throughput community to determine assay robustness (Z'-value) demonstrate the suitability of this format for high-throughput screening applications for detection of inhibitors of enzyme activity. The QTL Lightspeed protein detection system provides a simple mix and measure "turn on" assay for the detection of kinase activity using natural protein substrates. The platform is robust and allows for identification of inhibitors of kinase activity.

  11. Kinase Associated-1 Domains Drive MARK/PAR1 Kinases to Membrane Targets by Binding Acidic Phospholipids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moravcevic, Katarina; Mendrola, Jeannine M.; Schmitz, Karl R.

    Phospholipid-binding modules such as PH, C1, and C2 domains play crucial roles in location-dependent regulation of many protein kinases. Here, we identify the KA1 domain (kinase associated-1 domain), found at the C terminus of yeast septin-associated kinases (Kcc4p, Gin4p, and Hsl1p) and human MARK/PAR1 kinases, as a membrane association domain that binds acidic phospholipids. Membrane localization of isolated KA1 domains depends on phosphatidylserine. Using X-ray crystallography, we identified a structurally conserved binding site for anionic phospholipids in KA1 domains from Kcc4p and MARK1. Mutating this site impairs membrane association of both KA1 domains and intact proteins and reveals the importancemore » of phosphatidylserine for bud neck localization of yeast Kcc4p. Our data suggest that KA1 domains contribute to coincidence detection, allowing kinases to bind other regulators (such as septins) only at the membrane surface. These findings have important implications for understanding MARK/PAR1 kinases, which are implicated in Alzheimer's disease, cancer, and autism.« less

  12. SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

    PubMed Central

    Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

    2016-01-01

    Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

  13. Conformational Sampling and Binding Site Assessment of Suppression of Tumorigenicity 2 Ectodomain

    PubMed Central

    Yang, Chao-Yie; Delproposto, James; Chinnaswamy, Krishnapriya; Brown, William Clay; Wang, Shuying; Stuckey, Jeanne A.; Wang, Xinquan

    2016-01-01

    Suppression of Tumorigenicity 2 (ST2), a member of the interleukin-1 receptor (IL-1R) family, activates type 2 immune responses to pathogens and tissue damage via binding to IL-33. Dysregulated responses contribute to asthma, graft-versus-host and autoinflammatory diseases and disorders. To study ST2 structure for inhibitor development, we performed the principal component (PC) analysis on the crystal structures of IL1-1R1, IL1-1R2, ST2 and the refined ST2 ectodomain (ST2ECD) models, constructed from previously reported small-angle X-ray scattering data. The analysis facilitates mapping of the ST2ECD conformations to PC subspace for characterizing structural changes. Extensive coverage of ST2ECD conformations was then obtained using the accelerated molecular dynamics simulations started with the IL-33 bound ST2ECD structure as instructed by their projected locations on the PC subspace. Cluster analysis of all conformations further determined representative conformations of ST2ECD ensemble in solution. Alignment of the representative conformations with the ST2/IL-33 structure showed that the D3 domain of ST2ECD (containing D1-D3 domains) in most conformations exhibits no clashes with IL-33 in the crystal structure. Our experimental binding data informed that the D1-D2 domain of ST2ECD contributes predominantly to the interaction between ST2ECD and IL-33 underscoring the importance of the D1-D2 domain in binding. Computational binding site assessment revealed one third of the total detected binding sites in the representative conformations may be suitable for binding to potent small molecules. Locations of these sites include the D1-D2 domain ST2ECD and modulation sites conformed to ST2ECD conformations. Our study provides structural models and analyses of ST2ECD that could be useful for inhibitor discovery. PMID:26735493

  14. An enzyme immunoassay for rat growth hormone - Applications to the study of growth hormone variants

    NASA Technical Reports Server (NTRS)

    Farrington, Marianne A.; Hymer, W. C.

    1987-01-01

    A sensitive and specific competitive enzyme immunoassay for rat growth hormone (GH) is described and its use in the detection of GH variants is demonstrated. In the present assay, soluble GH and GH adsorbed to a solid-phase support compete for monkey anti-GH antibody binding sites. The immobilized antibody-GH complex is detected and quantified using goat antimonkey immunoglobin G covalently conjugated to horseradish peroxidase. It is noted that the assay can be performed in 27 hours and that sensitivities in the range of 0.19 to 25 ng can be obtained in the region of 10 to 90 percent binding.

  15. Genome-wide DNA methylation measurements in prostate tissues uncovers novel prostate cancer diagnostic biomarkers and transcription factor binding patterns.

    PubMed

    Kirby, Marie K; Ramaker, Ryne C; Roberts, Brian S; Lasseigne, Brittany N; Gunther, David S; Burwell, Todd C; Davis, Nicholas S; Gulzar, Zulfiqar G; Absher, Devin M; Cooper, Sara J; Brooks, James D; Myers, Richard M

    2017-04-17

    Current diagnostic tools for prostate cancer lack specificity and sensitivity for detecting very early lesions. DNA methylation is a stable genomic modification that is detectable in peripheral patient fluids such as urine and blood plasma that could serve as a non-invasive diagnostic biomarker for prostate cancer. We measured genome-wide DNA methylation patterns in 73 clinically annotated fresh-frozen prostate cancers and 63 benign-adjacent prostate tissues using the Illumina Infinium HumanMethylation450 BeadChip array. We overlaid the most significantly differentially methylated sites in the genome with transcription factor binding sites measured by the Encyclopedia of DNA Elements consortium. We used logistic regression and receiver operating characteristic curves to assess the performance of candidate diagnostic models. We identified methylation patterns that have a high predictive power for distinguishing malignant prostate tissue from benign-adjacent prostate tissue, and these methylation signatures were validated using data from The Cancer Genome Atlas Project. Furthermore, by overlaying ENCODE transcription factor binding data, we observed an enrichment of enhancer of zeste homolog 2 binding in gene regulatory regions with higher DNA methylation in malignant prostate tissues. DNA methylation patterns are greatly altered in prostate cancer tissue in comparison to benign-adjacent tissue. We have discovered patterns of DNA methylation marks that can distinguish prostate cancers with high specificity and sensitivity in multiple patient tissue cohorts, and we have identified transcription factors binding in these differentially methylated regions that may play important roles in prostate cancer development.

  16. Robust, sensitive and facile method for detection of F-, CN- and Ac- anions

    NASA Astrophysics Data System (ADS)

    Madhusudhana Reddy, P.; Hsieh, Shih-Rong; Chen, Jem-Kun; Chang, Chi-Jung; Kang, Jing-Yuan; Chen, Chih-Hsien

    2017-11-01

    Sensing of F-, CN- and Ac- is important from the viewpoint of both medically and environmentally. Particularly, sensing of the anions in 100% water by a colorimetric chemical sensor is a highly difficult task as water molecules interfere the sensing mechanism. In this regard, sensor R1, having azo and nitrophenyl groups as signaling units and thiourea as a binding site was prepared. This sensor exclusively detected CN- ion over other testing anions in 30% aq. DMSO solution by exhibiting distinct spectral and visual color changes. However, in 15% aq. DMSO solution, R1 exhibited obvious spectral and color changes in response to F-, CN- and Ac-. On the other hand, we have also designed sensor, R2, having same signaling units of R1, but a different binding site of urea group. Surprisingly, in contrast to R1, R2 exhibited obvious spectral and color changes in 5% aq. DMSO solution only. Further, economically viable ;test stripes; were prepared in a facile mode to detect the CN- in 100% aqueous solution. Such stripes can serve as a practical colorimetric probe for ;in the field; detection of the ions and thus avoid additional expensive equipment.

  17. The role of CH/π interactions in the high affinity binding of streptavidin and biotin.

    PubMed

    Ozawa, Motoyasu; Ozawa, Tomonaga; Nishio, Motohiro; Ueda, Kazuyoshi

    2017-08-01

    The streptavidin-biotin complex has an extraordinarily high affinity (Ka: 10 15 mol -1 ) and contains one of the strongest non-covalent interactions known. This strong interaction is widely used in biological tools, including for affinity tags, detection, and immobilization of proteins. Although hydrogen bond networks and hydrophobic interactions have been proposed to explain this high affinity, the reasons for it remain poorly understood. Inspired by the deceased affinity of biotin observed for point mutations of streptavidin at tryptophan residues, we hypothesized that a CH/π interaction may also contribute to the strong interaction between streptavidin and biotin. CH/π interactions were explored and analyzed at the biotin-binding site and at the interface of the subunits by the fragment molecular orbital method (FMO) and extended applications: PIEDA and FMO4. The results show that CH/π interactions are involved in the high affinity for biotin at the binding site of streptavidin. We further suggest that the involvement of CH/π interactions at the subunit interfaces and an extended CH/π network play more critical roles in determining the high affinity, rather than involvement at the binding site. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. The Effects of Protein-Ligand Associations on the Subunit Interactions of Phosphofructokinase from B. stearothermophilus†

    PubMed Central

    Quinlan, R. Jason; Reinhart, Gregory D.

    2008-01-01

    Differences between the crystal structures of inhibitor-bound and uninihibited forms of phosphofructokinase (PFK) from B. stearothermophilus have led to a structural model for allosteric inhibition by phosphenolpyruvate (PEP) wherein a dimer-dimer interface within the tetrameric enzyme undergoes a quaternary shift. We have developed a labeling and hybridization technique to generate a tetramer with subunits containing two different extrinsic fluorophores simultaneously in known subunit orientations. This construct has been utilized in the examination of the effects of allosteric ligand and substrate binding on the subunit affinities of tetrameric PFK using several biophysical and spectroscopic techniques including 2-photon, dual-channel Fluorescence Correlation Spectroscopy (FCS). We demonstrate that PEP-binding at the allosteric site is sufficient to reduce the affinity of the active site interface from beyond the limits of experimental detection to nanomolar affinity, while conversely strengthening the interface at which it is bound. The reduced interface affinity is specific to inhibitor-binding, as binding the activator ADP at the same allosteric site causes no reduction in subunit affinity. With inhibitor bound, the weakened subunit affinity has allowed the kinetics of dimer association to be elucidated. PMID:16981693

  19. The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

    NASA Astrophysics Data System (ADS)

    Knight, Jonathan D.; Li, Rong; Botchan, Michael

    1991-04-01

    The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

  20. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    PubMed

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Bisphenol-A sensors on polyimide fabricated by laser direct writing for on-site river water monitoring at attomolar concentration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, Cheng; Wang, Shutong; Wu, Jayne

    This work presents an aptamer-based, highly sensitive and specific sensor for atto- to femtomolar level detection of bisphenol A (BPA). Because of its widespread use in numerous products, BPA enters surface water from effluent discharges during its manufacture, use, and from waste landfill sites throughout the world. On-site measurement of BPA concentrations in water is important for evaluating compliance with water quality standards or environmental risk levels of the harmful compound in the environment. The sensor in this work is porous, conducting, interdigitated electrodes that are formed by laser-induced carbonization of flexible polyimide sheets. BPA-specific aptamer is immobilized on themore » electrodes as the probe, and its binding with BPA at the electrode surface is detected by capacitive sensing. The binding process is aided by ac electroosmotic effect that accelerates the transport of BPA molecules to the nanoporous graphene-like structured electrodes. The sensor achieved a limit of detection of 58.28 aM with a response time of 20 s. The sensor is further applied for recovery analysis of BPA spiked in surface water. In conclusion, this work provides an affordable platform for highly sensitive, real time, and field-deployable BPA surveillance critical to the evaluation of the ecological impact of BPA exposure.« less

  2. Bisphenol-A sensors on polyimide fabricated by laser direct writing for on-site river water monitoring at attomolar concentration

    DOE PAGES

    Cheng, Cheng; Wang, Shutong; Wu, Jayne; ...

    2016-06-28

    This work presents an aptamer-based, highly sensitive and specific sensor for atto- to femtomolar level detection of bisphenol A (BPA). Because of its widespread use in numerous products, BPA enters surface water from effluent discharges during its manufacture, use, and from waste landfill sites throughout the world. On-site measurement of BPA concentrations in water is important for evaluating compliance with water quality standards or environmental risk levels of the harmful compound in the environment. The sensor in this work is porous, conducting, interdigitated electrodes that are formed by laser-induced carbonization of flexible polyimide sheets. BPA-specific aptamer is immobilized on themore » electrodes as the probe, and its binding with BPA at the electrode surface is detected by capacitive sensing. The binding process is aided by ac electroosmotic effect that accelerates the transport of BPA molecules to the nanoporous graphene-like structured electrodes. The sensor achieved a limit of detection of 58.28 aM with a response time of 20 s. The sensor is further applied for recovery analysis of BPA spiked in surface water. In conclusion, this work provides an affordable platform for highly sensitive, real time, and field-deployable BPA surveillance critical to the evaluation of the ecological impact of BPA exposure.« less

  3. Human Blue Cone Opsin Regeneration Involves Secondary Retinal Binding with Analog Specificity.

    PubMed

    Srinivasan, Sundaramoorthy; Fernández-Sampedro, Miguel A; Morillo, Margarita; Ramon, Eva; Jiménez-Rosés, Mireia; Cordomí, Arnau; Garriga, Pere

    2018-03-27

    Human color vision is mediated by the red, green, and blue cone visual pigments. Cone opsins are G-protein-coupled receptors consisting of an opsin apoprotein covalently linked to the 11-cis-retinal chromophore. All visual pigments share a common evolutionary origin, and red and green cone opsins exhibit a higher homology, whereas blue cone opsin shows more resemblance to the dim light receptor rhodopsin. Here we show that chromophore regeneration in photoactivated blue cone opsin exhibits intermediate transient conformations and a secondary retinoid binding event with slower binding kinetics. We also detected a fine-tuning of the conformational change in the photoactivated blue cone opsin binding site that alters the retinal isomer binding specificity. Furthermore, the molecular models of active and inactive blue cone opsins show specific molecular interactions in the retinal binding site that are not present in other opsins. These findings highlight the differential conformational versatility of human cone opsin pigments in the chromophore regeneration process, particularly compared to rhodopsin, and point to relevant functional, unexpected roles other than spectral tuning for the cone visual pigments. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  4. LUSH-based SPR sensor for the detection of alcohols and pheromone

    NASA Astrophysics Data System (ADS)

    Lau, Hui-Chong; Lee, Yeon-Kyung; Kwon, Jae-Young; Sohn, Young-Soo; Lim, Jeong Ok

    2013-05-01

    Protein is a widely used sensing substrate in the biosensing technology. In the study conducted here, we used odorant binding protein, LUSH from Drosophila as a biosensing substrate in a miniaturized surface plasmon resonance (SPR) sensor. LUSH contains the specific alcohols binding sites, which mediates the detection of alcohols and pheromone. We first modified the surface of the gold sensor chip using the self assembled monolayer in the chloroform solution. The saturated concentration was determined prior to the detection of alcohols and pheromone at various concentrations. The results showed that the LUSH was saturated at 1000 μg/ml on the gold sensor chip. The detection response of LUSH was significant at higher concentration of alcohols. LUSH detected ethanol at concentration >=50% propanol was detected at >=25% whereas pheromone was detected at >=1.25 μg/μl. The results provide some fundamental information on the potential use of LUSH-based SPR as a simple and easy protein-based sensor in the near future.

  5. Lipid A binding proteins in macrophages detected by ligand blotting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.H.

    1987-05-01

    Endotoxin (LPS) stimulates a variety of eukaryotic cells. These actions are involved in the pathogenesis of Gram-negative septicemia. The site of action of the LPS toxic moiety, lipid A (LA), is unclear. Their laboratory has previously identified a bioactive LA precursor lipid IV/sub A/, which can be enzymatically labeled with /sup 32/P/sub i/ (10/sup 9/ dpm/nmole) and purified (99%). They now show that this ligand binds to specific proteins immobilized on nitrocellulose (NC) from LPS-sensitive RAW 264.7 cultured macrophages. NC blots were incubated with (/sup 32/P)-IV/sub A/ in a buffer containing BSA, NaCl, polyethylene glycol, and azide. Binding was assessedmore » using autoradiography or scintillation counting. Dot blot binding of the radioligand was inhibited by excess cold IV/sub A/, LA, or ReLPS but not by phosphatidylcholine, cardiolipin, phosphatidylinositol, or phosphatidic acid. Binding was trypsin-sensitive and dependent on protein concentration. Particulate macrophage proteins were subjected to SDS-PAGE and then electroblotted onto NC. Several discrete binding proteins were observed. Identical treatment of fetal bovine serum or molecular weight standards revealed no detectable binding. By avoiding high nonspecific binding of intact membranes, this ligand blotting assay may be useful in elucidating the molecular actions of LPS.« less

  6. Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes

    PubMed Central

    Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori

    2015-01-01

    Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955

  7. Synaptosomal binding of 125I-labelled daboiatoxin, a new PLA2 neurotoxin from the venom of Daboia russelli siamensis.

    PubMed

    Maung-Maung-Thwin; Gopalakrishnakone, P; Yuen, R; Tan, C H

    1996-02-01

    Daboiatoxin (DbTx), the PLA2 neurotoxin from Daboia russelli siamensis venom, was shown to bind specifically and saturably to rat cerebrocortical synaptosomes and synaptic membrane fragments. Two families of binding sites were detected by equilibrium binding analysis in the presence and absence of Ca2+. Scatchard analysis of biphasic plateaus revealed Kdl 5 nM and Bmax1, 6 pmoles/mg protein, and Kd2 80 nM and Bmax2 20 pmoles/mg protein, respectively, for the high- and low-affinity binding sites. The binding of 125I-DbTx to synaptosomes did not show marked dependence on Ca2+, Mg2+, Co2+ and Sr2+. Native DbTx was the only strong competitor to 125I-DbTx synaptosomal binding (IC50 12.5 nM, KI 5.5 nM). Two other crotalid PLA2 neurotoxins, crotoxin CB and mojave toxin basic subunit, and nontoxic C. Atrox PLA2 enzyme, were relatively weaker inhibitors, while two viperid PLA2 neurotoxins, ammodytoxin A and VRV PL V, were very weak inhibitors. Crotoxin CA was a poor inhibitor even at microM concentrations, whereas no inhibitory effect at all was observed with crotoxin CACB, ammodytoxin C, VRV PL VIIIa, taipoxin, beta-bungarotoxin, or with PLA2 enzymes from N. naja venom, E. schistosa venom, bee venom and porcine pancreas. All other pharmacologically active ligands examined (epinephrine, norepinephrine, histamine, choline, dopamine, serotonin, GABA, naloxone, WB-4101, atropine, hexamethonium and alpha-bun-garotoxin) also failed to interfere with 125I-DbTx binding. As those competitors that showed partial inhibition were effective only at microM concentration range compared to the Kd (5 nM) of 125I-DbTx synaptosomal binding, DbTx could well recognize a different neuronal binding site. Rabbit anti-DbTx polyclonal antisera completely blocked the specific binding. When a range of Ca2+ and K+ channels modulators were examined, Ca2+ channel blockers (omega-conotoxins GVIA and MVIIC, taicatoxin, calciseptine and nitrendiprene) did not affect the binding even at high concentrations, while charybdotoxin was the only K+ channel effector that could partially displace 125I-DbTx synaptosomal binding amongst the K+ channel blockers tested (apamin, dendrotoxin-I, iberiotoxin, MCD-peptide, 4-aminopyridine and tetraethylammonium), suggesting that neither K+ nor Ca2+ channels are associated with DbTx binding sites.

  8. [11C]Flumazenil PET in patients with epilepsy with dual pathology.

    PubMed

    Juhász, C; Nagy, F; Muzik, O; Watson, C; Shah, J; Chugani, H T

    1999-05-01

    Coexistence of hippocampal sclerosis and a potentially epileptogenic cortical lesion is referred to as dual pathology and can be responsible for poor surgical outcome in patients with medically intractable partial epilepsy. [11C]Flumazenil (FMZ) positron emission tomography (PET) is a sensitive method for visualizing epileptogenic foci. In this study of 12 patients with dual pathology, we addressed the sensitivity of FMZ PET to detect hippocampal abnormalities and compared magnetic resonance imaging (MRI) with visual as well as quantitative FMZ PET findings. All patients underwent volumetric MRI, prolonged video-EEG monitoring, and glucose metabolism PET before the FMZ PET. MRI-coregistered partial volume-corrected PET images were used to measure FMZ-binding asymmetries by using asymmetry indices (AIs) in the whole hippocampus and in three (anterior, middle, and posterior) hippocampal subregions. Cortical sites of decreased FMZ binding also were evaluated by using AIs for regions with MRI-verified cortical lesions as well as for non-lesional areas with visually detected asymmetry. Abnormally decreased FMZ binding could be detected by quantitative analysis in the atrophic hippocampus of all 12 patients, including three patients with discordant or inconclusive EEG findings. Decreased FMZ binding was restricted to only one subregion of the hippocampus in three patients. Areas of decreased cortical FMZ binding were obvious visually in all patients. Decreased FMZ binding was detected visually in nonlesional cortical areas in four patients. The AIs for these nonlesional regions with visual asymmetry were significantly lower than those for regions showing MRI lesions (paired t test, p = 0.0075). Visual as well as quantitative analyses of FMZ-binding asymmetry are sensitive methods to detect decreased benzodiazepine-receptor binding in the hippocampus and neocortex of patients with dual pathology. MRI-defined hippocampal atrophy is always associated with decreased FMZ binding, although the latter may be localized to only one sub-region within the hippocampus. FMZ PET abnormalities can occur in areas with normal appearance on MRI, but FMZ-binding asymmetry of these regions is lower when compared with that of lesional areas. FMZ PET can be especially helpful when MRI and EEG findings of patients with intractable epilepsy are discordant.

  9. Evolutionary Analysis of Functional Divergence among Chemokine Receptors, Decoy Receptors, and Viral Receptors

    PubMed Central

    Daiyasu, Hiromi; Nemoto, Wataru; Toh, Hiroyuki

    2012-01-01

    Chemokine receptors (CKRs) function in the inflammatory response and in vertebrate homeostasis. Decoy and viral receptors are two types of CKR homologs with modified functions from those of the typical CKRs. The decoy receptors are able to bind ligands without signaling. On the other hand, the viral receptors show constitutive signaling without ligands. We examined the sites related to the functional difference. At first, the decoy and viral receptors were each classified into five groups, based on the molecular phylogenetic analysis. A multiple amino acid sequence alignment between each group and the CKRs was then constructed. The difference in the amino acid composition between the group and the CKRs was evaluated as the Kullback–Leibler (KL) information value at each alignment site. The KL information value is considered to reflect the difference in the functional constraints at the site. The sites with the top 5% of KL information values were selected and mapped on the structure of a CKR. The comparisons with decoy receptor groups revealed that the detected sites were biased on the intracellular side. In contrast, the sites detected from the comparisons with viral receptor groups were found on both the extracellular and intracellular sides. More sites were found in the ligand binding pocket in the analyses of the viral receptor groups, as compared to the decoy receptor groups. Some of the detected sites were located in the GPCR motifs. For example, the DRY motif of the decoy receptors was often degraded, although the motif of the viral receptors was basically conserved. The observations for the viral receptor groups suggested that the constraints in the pocket region are loose and that the sites on the intracellular side are different from those for the decoy receptors, which may be related to the constitutive signaling activity of the viral receptors. PMID:22855685

  10. Evolutionary Analysis of Functional Divergence among Chemokine Receptors, Decoy Receptors, and Viral Receptors.

    PubMed

    Daiyasu, Hiromi; Nemoto, Wataru; Toh, Hiroyuki

    2012-01-01

    Chemokine receptors (CKRs) function in the inflammatory response and in vertebrate homeostasis. Decoy and viral receptors are two types of CKR homologs with modified functions from those of the typical CKRs. The decoy receptors are able to bind ligands without signaling. On the other hand, the viral receptors show constitutive signaling without ligands. We examined the sites related to the functional difference. At first, the decoy and viral receptors were each classified into five groups, based on the molecular phylogenetic analysis. A multiple amino acid sequence alignment between each group and the CKRs was then constructed. The difference in the amino acid composition between the group and the CKRs was evaluated as the Kullback-Leibler (KL) information value at each alignment site. The KL information value is considered to reflect the difference in the functional constraints at the site. The sites with the top 5% of KL information values were selected and mapped on the structure of a CKR. The comparisons with decoy receptor groups revealed that the detected sites were biased on the intracellular side. In contrast, the sites detected from the comparisons with viral receptor groups were found on both the extracellular and intracellular sides. More sites were found in the ligand binding pocket in the analyses of the viral receptor groups, as compared to the decoy receptor groups. Some of the detected sites were located in the GPCR motifs. For example, the DRY motif of the decoy receptors was often degraded, although the motif of the viral receptors was basically conserved. The observations for the viral receptor groups suggested that the constraints in the pocket region are loose and that the sites on the intracellular side are different from those for the decoy receptors, which may be related to the constitutive signaling activity of the viral receptors.

  11. Interactions of L-3,5,3'-Triiodothyronine, Allopregnanolone, and Ivermectin with the GABAA Receptor: Evidence for Overlapping Intersubunit Binding Modes

    PubMed Central

    Westergard, Thomas; Salari, Reza; Martin, Joseph V.; Brannigan, Grace

    2015-01-01

    Structural mechanisms of modulation of γ-aminobutyric acid (GABA) type A receptors by neurosteroids and hormones remain unclear. The thyroid hormone L-3,5,3’-triiodothyronine (T3) inhibits GABAA receptors at micromolar concentrations and has common features with neurosteroids such as allopregnanolone (ALLOP). Here we use functional experiments on α2β1γ2 GABAA receptors expressed in Xenopus oocytes to detect competitive interactions between T3 and an agonist (ivermectin, IVM) with a crystallographically determined binding site at subunit interfaces in the transmembrane domain of a homologous receptor (glutamate-gated chloride channel, GluCl). T3 and ALLOP also show competitive effects, supporting the presence of both a T3 and ALLOP binding site at one or more subunit interfaces. Molecular dynamics (MD) simulations over 200 ns are used to investigate the dynamics and energetics of T3 in the identified intersubunit sites. In these simulations, T3 molecules occupying all intersubunit sites (with the exception of the α-β interface) display numerous energetically favorable conformations with multiple hydrogen bonding partners, including previously implicated polar/acidic sidechains and a structurally conserved deformation in the M1 backbone. PMID:26421724

  12. Interactions of L-3,5,3'-Triiodothyronine [corrected], Allopregnanolone, and Ivermectin with the GABAA Receptor: Evidence for Overlapping Intersubunit Binding Modes.

    PubMed

    Westergard, Thomas; Salari, Reza; Martin, Joseph V; Brannigan, Grace

    2015-01-01

    Structural mechanisms of modulation of γ-aminobutyric acid (GABA) type A receptors by neurosteroids and hormones remain unclear. The thyroid hormone L-3,5,3'-triiodothyronine (T3) inhibits GABAA receptors at micromolar concentrations and has common features with neurosteroids such as allopregnanolone (ALLOP). Here we use functional experiments on α2β1γ2 GABAA receptors expressed in Xenopus oocytes to detect competitive interactions between T3 and an agonist (ivermectin, IVM) with a crystallographically determined binding site at subunit interfaces in the transmembrane domain of a homologous receptor (glutamate-gated chloride channel, GluCl). T3 and ALLOP also show competitive effects, supporting the presence of both a T3 and ALLOP binding site at one or more subunit interfaces. Molecular dynamics (MD) simulations over 200 ns are used to investigate the dynamics and energetics of T3 in the identified intersubunit sites. In these simulations, T3 molecules occupying all intersubunit sites (with the exception of the α-β interface) display numerous energetically favorable conformations with multiple hydrogen bonding partners, including previously implicated polar/acidic sidechains and a structurally conserved deformation in the M1 backbone.

  13. Actin-binding and cell proliferation activities of angiomotin family members are regulated by Hippo pathway-mediated phosphorylation.

    PubMed

    Chan, Siew Wee; Lim, Chun Jye; Guo, Fusheng; Tan, Ivan; Leung, Thomas; Hong, Wanjin

    2013-12-27

    Whether the Hippo pathway has downstream targets other than YAP and TAZ is unknown. In this report, we have identified angiomotin (Amot) family members as novel substrates of Hippo core kinases. The N-terminal regions of Amot proteins contain a conserved HXRXXS consensus site for LATS1/2-mediated phosphorylation. Phospho-specific antibodies showed that Hippo core kinases could mediate phosphorylation of endogenous as well as exogenous Amot family members. Knockdown of LATS1 and LATS2 endogenously reduced the phosphorylation of Amots detected by the phospho-specific antibodies. Mutation of the serine to alanine within this HXRXXS site in Amot and AmotL2 established that this site was essential for Hippo core kinase-mediated phosphorylation. Wild-type and non-phosphorylated Amot (Amot-S175A) were targeted to actin filaments, whereas phospho-mimic Amot (Amot-S175D) failed to be localized with actin. Overexpression of LATS2 caused dissociation of Amot from actin but not Amot-S175A. Mapping of the actin-binding site of Amot showed that serine 175 of Amot was important for the actin-binding activity. Amot-S175A promoted, whereas Amot and Amot-S175D inhibited, cell proliferation. These results collectively suggest that the Hippo pathway negatively regulates the actin-binding activity of Amot family members through direct phosphorylation.

  14. Determination of an organic-acid analog of DOC for use in copper toxicity studies on salmonids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MacRae, R.K.; Meyer, J.S.; Hansen, J.A.

    1995-12-31

    Concentrations of dissolved copper in streams draining mine sites often exceed concentrations shown to cause acute and chronic mortality in salmonids. However, toxicity and impaired behaviors may be modified by dissolved organic carbon (DOC) and other inorganic components present in the site water. The effects of DOC on copper speciation, and thus bioavailability and toxicity, were determined by titrating stream waters with copper, using a cupric ion-specific electrode to detect free copper concentrations. Effects of various competing cations (e.g., Ca{sup +2}, Co{sup +2}) on copper-DOC binding were also evaluated. Titration results were evaluated using Scatchard and non-linear regression analyses tomore » quantify the strength and capacity of copper-DOC binding. Inorganic speciation was determined using the geochemical model MINEQL{sup +}. Results of these titrations indicated the presence of two or three distinct copper binding components in site water DOC. Three commercially available organic acids where then chosen to mimic the binding characteristics of natural DOC. This DOC-analog was used successfully in fish toxicity studies to evaluate the influence of DOC on copper bioavailability. Geochemical models were developed to predict copper speciation in both laboratory test waters and site waters, for any typical combination of water chemistry parameters (pH, alkalinity, [DOC], etc.). A combined interpretation of fish toxicity and modeling results indicate that some DOC-bound copper was bioavailable.« less

  15. Identification of protein–protein interfaces by decreased amide proton solvent accessibility

    PubMed Central

    Mandell, Jeffrey G.; Falick, Arnold M.; Komives, Elizabeth A.

    1998-01-01

    Matrix-assisted laser desorption ionization–time-of-flight mass spectrometry was used to identify peptic fragments from protein complexes that retained deuterium under hydrogen exchange conditions due to decreased solvent accessibility at the interface of the complex. Short deuteration times allowed preferential labeling of rapidly exchanging surface amides so that primarily solvent accessibility changes and not conformational changes were detected. A single mass spectrum of the peptic digest mixture was analyzed to determine the deuterium content of all proteolytic fragments of the protein. The protein–protein interface was reliably indicated by those peptides that retained more deuterons in the complex compared with control experiments in which only one protein was present. The method was used to identify the kinase inhibitor [PKI(5–24)] and ATP-binding sites in the cyclic-AMP-dependent protein kinase. Three overlapping peptides identified the ATP-binding site, three overlapping peptides identified the glycine-rich loop, and two peptides identified the PKI(5–24)-binding site. A complex of unknown structure also was analyzed, human α-thrombin bound to an 83-aa fragment of human thrombomodulin [TMEGF(4–5)]. Five peptides from thrombin showed significantly decreased solvent accessibility in the complex. Three peptides identified the anion-binding exosite I, confirming ligand competition experiments. Two peptides identified a new region of thrombin near the active site providing a potential mechanism of how thrombomodulin alters thrombin substrate specificity. PMID:9843953

  16. A novel reagentless sensing system for measuring glucose based on the galactose/glucose-binding protein

    NASA Technical Reports Server (NTRS)

    Salins, L. L.; Ware, R. A.; Ensor, C. M.; Daunert, S.

    2001-01-01

    The galactose/glucose-binding protein (GBP) is synthesized in the cytoplasm of Escherichia coli in a precursor form and exported into the periplasmic space upon cleavage of a 23-amino-acid leader sequence. GBP binds galactose and glucose in a highly specific manner. The ligand induces a hinge motion in GBP and the resultant protein conformational change constitutes the basis of the sensing system. The mglB gene, which codes for GBP, was isolated from the chromosome of E. coli using the polymerase chain reaction (PCR). Since wild-type GBP lacks cysteines in its structure, introducing this amino acid by site-directed mutagenesis ensures single-label attachment at specific sites with a sulfhydro-specific fluorescent probe. Site-directed mutagenesis by overlap extension PCR was performed to prepare three different mutants to introduce a single cysteine residue at positions 148, 152, and 182. Since these residues are not involved in ligand binding and since they are located at the edge of the binding cleft, they experience a significant change in environment upon binding of galactose or glucose. The sensing system strategy is based on the fluorescence changes of the probe as the protein undergoes a structural change on binding. In this work a reagentless sensing system has been rationally designed that can detect submicromolar concentrations of glucose. The calibration plots have a linear working range of three orders of magnitude. Although the system can sense galactose as well, this epimer is not a potential interfering substance since its concentration in blood is negligible. Copyright 2001 Academic Press.

  17. Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods

    PubMed Central

    Wu, Yuhua; Wang, Yulei; Li, Jun; Li, Wei; Zhang, Li; Li, Yunjing; Li, Xiaofei; Li, Jun; Zhu, Li; Wu, Gang

    2014-01-01

    The Cauliflower mosaic virus (CaMV) 35S promoter (P35S) is a commonly used target for detection of genetically modified organisms (GMOs). There are currently 24 reported detection methods, targeting different regions of the P35S promoter. Initial assessment revealed that due to the absence of primer binding sites in the P35S sequence, 19 of the 24 reported methods failed to detect P35S in MON88913 cotton, and the other two methods could only be applied to certain GMOs. The rest three reported methods were not suitable for measurement of P35S in some testing events, because SNPs in binding sites of the primer/probe would result in abnormal amplification plots and poor linear regression parameters. In this study, we discovered a conserved region in the P35S sequence through sequencing of P35S promoters from multiple transgenic events, and developed new qualitative and quantitative detection systems targeting this conserved region. The qualitative PCR could detect the P35S promoter in 23 unique GMO events with high specificity and sensitivity. The quantitative method was suitable for measurement of P35S promoter, exhibiting good agreement between the amount of template and Ct values for each testing event. This study provides a general P35S screening method, with greater coverage than existing methods. PMID:25483893

  18. Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles

    PubMed Central

    1994-01-01

    Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685

  19. Nicotine Induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    PubMed Central

    Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

    2011-01-01

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485

  20. Berberine Induces Toxicity in HeLa Cells through Perturbation of Microtubule Polymerization by Binding to Tubulin at a Unique Site.

    PubMed

    Raghav, Darpan; Ashraf, Shabeeba M; Mohan, Lakshmi; Rathinasamy, Krishnan

    2017-05-23

    Berberine has been used traditionally for its diverse pharmacological actions. It exhibits remarkable anticancer activities and is currently under clinical trials. In this study, we report that the anticancer activity of berberine could be partly due to its inhibitory actions on tubulin and microtubule assembly. Berberine inhibited the proliferation of HeLa cells with an IC 50 of 18 μM and induced significant depolymerization of interphase and mitotic microtubules. At its IC 50 , berberine exerted a moderate G2/M arrest and mitotic block as detected by fluorescence-activated cell sorting analysis and fluorescence microscopy, respectively. In a wound closure assay, berberine inhibited the migration of HeLa cells at concentrations lower than its IC 50 , indicating its excellent potential as an anticancer agent. In vitro studies with tubulin isolated from goat brain indicated that berberine binds to tubulin at a single site with a K d of 11 μM. Berberine inhibited the assembly of tubulin into microtubules and also disrupted the preformed microtubules polymerized in the presence of glutamate and paclitaxel. Competition experiments indicated that berberine could partially displace colchicine from its binding site. Results from fluorescence resonance energy transfer, computational docking, and molecular dynamics simulations suggest that berberine forms a stable complex with tubulin and binds at a novel site 24 Å from the colchicine site on the β-tubulin. Data obtained from synchronous fluorescence analysis of the tryptophan residues of tubulin and from the Fourier transform infrared spectroscopy studies revealed that binding of berberine alters the conformation of the tubulin heterodimer, which could be the molecular mechanism behind the depolymerizing effects on tubulin assembly.

  1. Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction.

    PubMed

    Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

    2014-01-01

    Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.

  2. Predicting RNA-protein binding sites and motifs through combining local and global deep convolutional neural networks.

    PubMed

    Pan, Xiaoyong; Shen, Hong-Bin

    2018-05-02

    RNA-binding proteins (RBPs) take over 5∼10% of the eukaryotic proteome and play key roles in many biological processes, e.g. gene regulation. Experimental detection of RBP binding sites is still time-intensive and high-costly. Instead, computational prediction of the RBP binding sites using pattern learned from existing annotation knowledge is a fast approach. From the biological point of view, the local structure context derived from local sequences will be recognized by specific RBPs. However, in computational modeling using deep learning, to our best knowledge, only global representations of entire RNA sequences are employed. So far, the local sequence information is ignored in the deep model construction process. In this study, we present a computational method iDeepE to predict RNA-protein binding sites from RNA sequences by combining global and local convolutional neural networks (CNNs). For the global CNN, we pad the RNA sequences into the same length. For the local CNN, we split a RNA sequence into multiple overlapping fixed-length subsequences, where each subsequence is a signal channel of the whole sequence. Next, we train deep CNNs for multiple subsequences and the padded sequences to learn high-level features, respectively. Finally, the outputs from local and global CNNs are combined to improve the prediction. iDeepE demonstrates a better performance over state-of-the-art methods on two large-scale datasets derived from CLIP-seq. We also find that the local CNN run 1.8 times faster than the global CNN with comparable performance when using GPUs. Our results show that iDeepE has captured experimentally verified binding motifs. https://github.com/xypan1232/iDeepE. xypan172436@gmail.com or hbshen@sjtu.edu.cn. Supplementary data are available at Bioinformatics online.

  3. Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

    PubMed Central

    Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

    2009-01-01

    Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

  4. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  5. Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

    PubMed

    Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

    2013-06-14

    Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

  6. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  7. Mutation of mapped TIA-1/TIAR binding sites in the 3' terminal stem-loop of West Nile virus minus-strand RNA in an infectious clone negatively affects genomic RNA amplification.

    PubMed

    Emara, Mohamed M; Liu, Hsuan; Davis, William G; Brinton, Margo A

    2008-11-01

    Previous data showed that the cellular proteins TIA-1 and TIAR bound specifically to the West Nile virus 3' minus-strand stem-loop [WNV3'(-)SL] RNA (37) and colocalized with flavivirus replication complexes in WNV- and dengue virus-infected cells (21). In the present study, the sites on the WNV3'(-)SL RNA required for efficient in vitro T-cell intracellular antigen-related (TIAR) and T-cell intracellular antigen-1 (TIA-1) protein binding were mapped to short AU sequences (UAAUU) located in two internal loops of the WNV3'(-)SL RNA structure. Infectious clone RNAs with all or most of the binding site nucleotides in one of the 3' (-)SL loops deleted or substituted did not produce detectable virus after transfection or subsequent passage. With one exception, deletion/mutation of a single terminal nucleotide in one of the binding sequences had little effect on the efficiency of protein binding or virus production, but mutation of a nucleotide in the middle of a binding sequence reduced both the in vitro protein binding efficiency and virus production. Plaque size, intracellular genomic RNA levels, and virus production progressively decreased with decreasing in vitro TIAR/TIA-1 binding activity, but the translation efficiency of the various mutant RNAs was similar to that of the parental RNA. Several of the mutant RNAs that inefficiently interacted with TIAR/TIA-1 in vitro rapidly reverted in vivo, indicating that they could replicate at a low level and suggesting that an interaction between TIAR/TIA-1 and the viral 3'(-)SL RNA is not required for initial low-level symmetric RNA replication but instead facilitates the subsequent asymmetric amplification of genome RNA from the minus-strand template.

  8. An ultrasensitive label-free biosensor for assaying of sequence-specific DNA-binding protein based on amplifying fluorescent conjugated polymer.

    PubMed

    Liu, Xingfen; Ouyang, Lan; Cai, Xiaohui; Huang, Yanqin; Feng, Xiaomiao; Fan, Quli; Huang, Wei

    2013-03-15

    Sensitive, reliable, and simple detection of sequence-specific DNA-binding proteins (DBP) is of paramount importance in the area of proteomics, genomics, and biomedicine. We describe herein a novel fluorescent-amplified strategy for ultrasensitive, visual, quantitative, and "turn-on" detection of DBP. A Förster resonance energy transfer (FRET) assay utilizing a cationic conjugated polymer (CCP) and an intercalating dye was designed to detect a key transcription factor, nuclear factor-kappa B (NF-κB), the model target. A series of label-free DNA probes bearing one or two protein-binding sites (PBS) were used to identify the target protein specifically. The binding DBP protects the probe from digestion by exonuclease III, resulting in high efficient FRET due to the high affinity between the intercalating dye and duplex DNA, as well as strong electrostatic interactions between the CCP and DNA probe. By using label-free hairpin DNA or double-stranded DNA containing two PBS as probe, we could detect as low as 1 pg/μL of NF-κB in HeLa nuclear extracts, which is 10000-fold more sensitive than the previously reported methods. The approach also allows naked-eye detection by observing fluorescent color of solutions with the assistance of a hand-held UV lamp. Additionally, a less than 10% relative standard deviation was obtained, which offers a new platform for superior precision, low-cost, and simple detection of DBP. The features of our optical biosensor shows promising potential for early diagnosis of many diseases and high-throughput screening of new drugs targeted to DNA-binding proteins. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Photoaffinity labelling and solubilization on the central 5-HT1A receptor binding site.

    PubMed

    Gozlan, H; Emerit, M B; el Mestikawy, S; Cossery, J M; Marquet, A; Besselievre, R; Hamon, M

    1987-01-01

    Two complementary approaches, covalent labelling and solubilization, have been used to study the biochemical properties of the central 5-HT1A receptor binding site. We have first designed a photoaffinity ligand containing the structure of 8-OH-DPAT, a potent and specific agonist of 5-HT1A sites. Thus, 8-methoxy-2[N-n-propyl,N-3-(2-nitro-4-azido-phenyl)- aminopropyl]aminotetralin or 8-methoxy-3'-NAP-amino-PAT, was found to displace, in the dark, [3H]8-OH-DPAT from 5-HT1A sites in rat hippocampal membranes with an IC50 of 6.6 nM. Under two cumulative UV irradiations (366 nm, for 20 min at 4 degrees C), 8-methoxy-3-'-NAP-amino-PAT (30 nM) blocked irreversibly 55-60% of 5-HT1A binding sites. This blockade was specific of 5-HT1A sites since the other serotoninergic sites, 5-HT1B, 5-HT2 and also the presynaptic 5-HT3 sites were not affected by the treatment. In addition, the binding of [3H]Spiperone and [3H]7-OH-DPAT to striatal dopamine sites remained unchanged under similar photolysis conditions. The tritiated derivative of the photoaffinity ligand (92 Ci/mmol) was then synthesized for the identification of the covalently bound protein(s). SDS-PAGE of solubilized membranes irradiated in the presence of 20 nM 3H-8-methoxy-3'-NAP-amino-PAT allowed the detection of a 63 kD protein whose labelling appeared specific. Thus, 3H-incorporation into the 63 kD band could be prevented by microM concentrations of 5-HT, 8-OH-DPAT and other selective 5-HT1A ligands such as isapirone. In contrast, the 5-HT2 antagonist ketanserin, norepinephrine and dopamine-related ligands (including 7-OH-DPAT) were ineffective. Direct solubilization of 5-HT1A receptor binding sites was also attempted from rat hippocampal membranes. The best results were obtained using CHAPS (10 mM) plus NaCl (0.2 M), which led to 50% recovery of 5-HT1A sites in the 100,000 g supernatant. The pharmacological properties and sensitivity to N-ethyl-maleimide and GppNHp of soluble sites appeared near identical to those of membrane-bound 5-HT1A sites.

  10. SOS response in bacteria: Inhibitory activity of lichen secondary metabolites against Escherichia coli RecA protein.

    PubMed

    Bellio, Pierangelo; Di Pietro, Letizia; Mancini, Alisia; Piovano, Marisa; Nicoletti, Marcello; Brisdelli, Fabrizia; Tondi, Donatella; Cendron, Laura; Franceschini, Nicola; Amicosante, Gianfranco; Perilli, Mariagrazia; Celenza, Giuseppe

    2017-06-15

    RecA is a bacterial multifunctional protein essential to genetic recombination, error-prone replicative bypass of DNA damages and regulation of SOS response. The activation of bacterial SOS response is directly related to the development of intrinsic and/or acquired resistance to antimicrobials. Although recent studies directed towards RecA inactivation via ATP binding inhibition described a variety of micromolar affinity ligands, inhibitors of the DNA binding site are still unknown. Twenty-seven secondary metabolites classified as anthraquinones, depsides, depsidones, dibenzofurans, diphenyl-butenolides, paraconic acids, pseudo-depsidones, triterpenes and xanthones, were investigated for their ability to inhibit RecA from Escherichia coli. They were isolated in various Chilean regions from 14 families and 19 genera of lichens. The ATP hydrolytic activity of RecA was quantified detecting the generation of free phosphate in solution. The percentage of inhibition was calculated fixing at 100µM the concentration of the compounds. Deeper investigations were reserved to those compounds showing an inhibition higher than 80%. To clarify the mechanism of inhibition, the semi-log plot of the percentage of inhibition vs. ATP and vs. ssDNA, was evaluated. Only nine compounds showed a percentage of RecA inhibition higher than 80% (divaricatic, perlatolic, alpha-collatolic, lobaric, lichesterinic, protolichesterinic, epiphorellic acids, sphaerophorin and tumidulin). The half-inhibitory concentrations (IC 50 ) calculated for these compounds were ranging from 14.2µM for protolichesterinic acid to 42.6µM for sphaerophorin. Investigations on the mechanism of inhibition showed that all compounds behaved as uncompetitive inhibitors for ATP binding site, with the exception of epiphorellic acid which clearly acted as non-competitive inhibitor of the ATP site. Further investigations demonstrated that epiphorellic acid competitively binds the ssDNA binding site. Kinetic data were confirmed by molecular modelling binding predictions which shows that epiphorellic acid is expected to bind the ssDNA site into the L2 loop of RecA protein. In this paper the first RecA ssDNA binding site ligand is described. Our study sets epiphorellic acid as a promising hit for the development of more effective RecA inhibitors. In our drug discovery approach, natural products in general and lichen in particular, represent a successful source of active ligands and structural diversity. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Exploiting three kinds of interface propensities to identify protein binding sites.

    PubMed

    Liu, Bin; Wang, Xiaolong; Lin, Lei; Dong, Qiwen; Wang, Xuan

    2009-08-01

    Predicting the binding sites between two interacting proteins provides important clues to the function of a protein. In this study, we present a building block of proteins called order profiles to use the evolutionary information of the protein sequence frequency profiles and apply this building block to produce a class of propensities called order profile interface propensities. For comparisons, we revisit the usage of residue interface propensities and binary profile interface propensities for protein binding site prediction. Each kind of propensities combined with sequence profiles and accessible surface areas are inputted into SVM. When tested on four types of complexes (hetero-permanent complexes, hetero-transient complexes, homo-permanent complexes and homo-transient complexes), experimental results show that the order profile interface propensities are better than residue interface propensities and binary profile interface propensities. Therefore, order profile is a suitable profile-level building block of the protein sequences and can be widely used in many tasks of computational biology, such as the sequence alignment, the prediction of domain boundary, the designation of knowledge-based potentials and the protein remote homology detection.

  12. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  13. TINS, target immobilized NMR screening: an efficient and sensitive method for ligand discovery.

    PubMed

    Vanwetswinkel, Sophie; Heetebrij, Robert J; van Duynhoven, John; Hollander, Johan G; Filippov, Dmitri V; Hajduk, Philip J; Siegal, Gregg

    2005-02-01

    We propose a ligand screening method, called TINS (target immobilized NMR screening), which reduces the amount of target required for the fragment-based approach to drug discovery. Binding is detected by comparing 1D NMR spectra of compound mixtures in the presence of a target immobilized on a solid support to a control sample. The method has been validated by the detection of a variety of ligands for protein and nucleic acid targets (K(D) from 60 to 5000 muM). The ligand binding capacity of a protein was undiminished after 2000 different compounds had been applied, indicating the potential to apply the assay for screening typical fragment libraries. TINS can be used in competition mode, allowing rapid characterization of the ligand binding site. TINS may allow screening of targets that are difficult to produce or that are insoluble, such as membrane proteins.

  14. Spectroscopic detection of etoposide binding to chromatin components: The role of histone proteins

    NASA Astrophysics Data System (ADS)

    Chamani, Elham; Rabbani-Chadegani, Azra; Zahraei, Zohreh

    2014-12-01

    Chromatin has been introduced as a main target for most anticancer drugs. Etoposide is known as a topoisomerase II inhibitor, but its effect on chromatin components is unknown. This report, for the first time, describes the effect of etoposide on DNA, histones and DNA-histones complex in the structure of nucleosomes employing thermal denaturation, fluorescence, UV absorbance and circular dichroism spectroscopy techniques. The results showed that the binding of etoposide decreased UV absorbance and fluorescence emission intensity, altered secondary structure of chromatin and hypochromicity was occurred in thermal denaturation profiles. The drug exhibited higher affinity to chromatin compared to DNA. Quenching of drug chromophores with tyrosine residues of histones indicated that globular domain of histones is the site of etoposide binding. Moreover, the binding of etoposide to histones altered their secondary structure accompanied with hypochromicity revealing compaction of histones in the presence of the drug. From the results it is concludes that apart from topoisomerase II, chromatin components especially its protein moiety can be introduced as a new site of etoposide binding and histone proteins especially H1 play a fundamental role in this process and anticancer activity of etoposide.

  15. Degenerate Pax2 and Senseless binding motifs improve detection of low-affinity sites required for enhancer specificity

    PubMed Central

    Zandvakili, Arya; Campbell, Ian; Weirauch, Matthew T.

    2018-01-01

    Cells use thousands of regulatory sequences to recruit transcription factors (TFs) and produce specific transcriptional outcomes. Since TFs bind degenerate DNA sequences, discriminating functional TF binding sites (TFBSs) from background sequences represents a significant challenge. Here, we show that a Drosophila regulatory element that activates Epidermal Growth Factor signaling requires overlapping, low-affinity TFBSs for competing TFs (Pax2 and Senseless) to ensure cell- and segment-specific activity. Testing available TF binding models for Pax2 and Senseless, however, revealed variable accuracy in predicting such low-affinity TFBSs. To better define parameters that increase accuracy, we developed a method that systematically selects subsets of TFBSs based on predicted affinity to generate hundreds of position-weight matrices (PWMs). Counterintuitively, we found that degenerate PWMs produced from datasets depleted of high-affinity sequences were more accurate in identifying both low- and high-affinity TFBSs for the Pax2 and Senseless TFs. Taken together, these findings reveal how TFBS arrangement can be constrained by competition rather than cooperativity and that degenerate models of TF binding preferences can improve identification of biologically relevant low affinity TFBSs. PMID:29617378

  16. Simulation of a model nanopore sensor: Ion competition underlies device behavior.

    PubMed

    Mádai, Eszter; Valiskó, Mónika; Dallos, András; Boda, Dezső

    2017-12-28

    We study a model nanopore sensor with which a very low concentration of analyte molecules can be detected on the basis of the selective binding of the analyte molecules to the binding sites on the pore wall. The bound analyte ions partially replace the current-carrier cations in a thermodynamic competition. This competition depends both on the properties of the nanopore and the concentrations of the competing ions (through their chemical potentials). The output signal given by the device is the current reduction caused by the presence of the analyte ions. The concentration of the analyte ions can be determined through calibration curves. We model the binding site with the square-well potential and the electrolyte as charged hard spheres in an implicit background solvent. We study the system with a hybrid method in which we compute the ion flux with the Nernst-Planck (NP) equation coupled with the Local Equilibrium Monte Carlo (LEMC) simulation technique. The resulting NP+LEMC method is able to handle both strong ionic correlations inside the pore (including finite size of ions) and bulk concentrations as low as micromolar. We analyze the effect of bulk ion concentrations, pore parameters, binding site parameters, electrolyte properties, and voltage on the behavior of the device.

  17. Simulation of a model nanopore sensor: Ion competition underlies device behavior

    NASA Astrophysics Data System (ADS)

    Mádai, Eszter; Valiskó, Mónika; Dallos, András; Boda, Dezső

    2017-12-01

    We study a model nanopore sensor with which a very low concentration of analyte molecules can be detected on the basis of the selective binding of the analyte molecules to the binding sites on the pore wall. The bound analyte ions partially replace the current-carrier cations in a thermodynamic competition. This competition depends both on the properties of the nanopore and the concentrations of the competing ions (through their chemical potentials). The output signal given by the device is the current reduction caused by the presence of the analyte ions. The concentration of the analyte ions can be determined through calibration curves. We model the binding site with the square-well potential and the electrolyte as charged hard spheres in an implicit background solvent. We study the system with a hybrid method in which we compute the ion flux with the Nernst-Planck (NP) equation coupled with the Local Equilibrium Monte Carlo (LEMC) simulation technique. The resulting NP+LEMC method is able to handle both strong ionic correlations inside the pore (including finite size of ions) and bulk concentrations as low as micromolar. We analyze the effect of bulk ion concentrations, pore parameters, binding site parameters, electrolyte properties, and voltage on the behavior of the device.

  18. Study on interaction between a new fluorescent probe 2-methylbenzo[b][1,10]phenanthrolin-7(12H)-one and BSA.

    PubMed

    Qiu, Bin; Guo, Longhua; Chen, Mingluan; Lin, Zhenyu; Chen, Guonan

    2011-03-07

    A new fluorescence reagent, 2-methylbenzo[b][1,10]phenanthrolin-7(12H)-one (mBPO), synthesized in our laboratory was used as the probe for protein and its interaction with Bovine Serum Albumin (BSA) was investigated in detail in this paper. It was found that BSA had the ability to quench the fluorescence of mBPO at 411 nm (λ(ex) = 286 nm), and the quenched intensity of fluorescence was proportional to the concentration of BSA. Based on this fact, mBPO has been used as a fluorescence probe for the detection of BSA. Under the optimal conditions, the calibration graph is linear up to 0.5 mg L(-1) for BSA and the limit of detection (LOD) was 0.06 mg L(-1). The regression equation is y = 1048.8x + 7.2093 with R(2) = 0.9913. The mechanism for the interaction of mBPO with BSA was also studied, while the binding constant and the number of binding sites were calculated. According to the thermodynamics parameter, the binding mode between mBPO and BSA was deduced. The results suggested the interaction between mBPO and BSA to be hydrophobic force in nature. It also proved that the fluorescence quenching reaction was affected by the tryptophan residue of BSA. For there are two tryptophan (Trp) residues, in site 134 and site 212 of BSA, and mBPO maybe has interaction with them respectively.

  19. In Silico Detection of Sequence Variations Modifying Transcriptional Regulation

    PubMed Central

    Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob

    2008-01-01

    Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319

  20. Fiber optic detector and method for using same for detecting chemical species

    DOEpatents

    Baylor, Lewis C.; Buchanan, Bruce R.

    1995-01-01

    An optical sensing device for uranyl and other substances, a method for making an optical sensing device and a method for chemically binding uranyl and other indicators to glass, quartz, cellulose and similar substrates. The indicator, such as arsenazo III, is immobilized on the substrate using a chemical binding process. The immobilized arsenazo III causes uranyl from a fluid sample to bind irreversibly to the substrate at its active sites, thus causing absorption of a portion of light transmitted through the substrate. Determination of the amount of light absorbed, using conventional means, yields the concentration of uranyl present in the sample fluid. The binding of uranyl on the substrate can be reversed by subsequent exposure of the substrate to a solution of 2,6-pyridinedicarboxylic acid. The chemical binding process is suitable for similarly binding other indicators, such as bromocresol green.

  1. NMR structural studies of the supramolecular adducts between a liver cytosolic bile acid binding protein and gadolinium(III)-chelates bearing bile acids residues: molecular determinants of the binding of a hepatospecific magnetic resonance imaging contrast agent.

    PubMed

    Assfalg, Michael; Gianolio, Eliana; Zanzoni, Serena; Tomaselli, Simona; Russo, Vito Lo; Cabella, Claudia; Ragona, Laura; Aime, Silvio; Molinari, Henriette

    2007-11-01

    The binding affinities of a selected series of Gd(III) chelates bearing bile acid residues, potential hepatospecific MRI contrast agents, to a liver cytosolic bile acid transporter, have been determined through relaxivity measurements. The Ln(III) complexes of compound 1 were selected for further NMR structural analysis aimed at assessing the molecular determinants of binding. A number of NMR experiments have been carried out on the bile acid-like adduct, using both diamagnetic Y(III) and paramagnetic Gd(III) complexes, bound to a liver bile acid binding protein. The identified protein "hot spots" defined a single binding site located at the protein portal region. The presented findings will serve in a medicinal chemistry approach for the design of hepatocytes-selective gadolinium chelates for liver malignancies detection.

  2. Probing electrostatic interactions and ligand binding in aspartyl-tRNA synthetase through site-directed mutagenesis and computer simulations.

    PubMed

    Thompson, Damien; Lazennec, Christine; Plateau, Pierre; Simonson, Thomas

    2008-05-15

    Faithful genetic code translation requires that each aminoacyl-tRNA synthetase recognise its cognate amino acid ligand specifically. Aspartyl-tRNA synthetase (AspRS) distinguishes between its negatively-charged Asp substrate and two competitors, neutral Asn and di-negative succinate, using a complex network of electrostatic interactions. Here, we used molecular dynamics simulations and site-directed mutagenesis experiments to probe these interactions further. We attempt to decrease the Asp/Asn binding free energy difference via single, double and triple mutations that reduce the net positive charge in the active site of Escherichia coli AspRS. Earlier, Glutamine 199 was changed to a negatively-charged glutamate, giving a computed reduction in Asp affinity in good agreement with experiment. Here, Lysine 198 was changed to a neutral leucine; then, Lys198 and Gln199 were mutated simultaneously. Both mutants are predicted to have reduced Asp binding and improved Asn binding, but the changes are insufficient to overcome the initial, high specificity of the native enzyme, which retains a preference for Asp. Probing the aminoacyl-adenylation reaction through pyrophosphate exchange experiments, we found no detectable activity for the mutant enzymes, indicating weaker Asp binding and/or poorer transition state stabilization. The simulations show that the mutations' effect is partly offset by proton uptake by a nearby histidine. Therefore, we performed additional simulations where the nearby Histidines 448 and 449 were mutated to neutral or negative residues: (Lys198Leu, His448Gln, His449Gln), and (Lys198Leu, His448Glu, His449Gln). This led to unexpected conformational changes and loss of active site preorganization, suggesting that the AspRS active site has a limited structural tolerance for electrostatic modifications. The data give insights into the complex electrostatic network in the AspRS active site and illustrate the difficulty in engineering charged-to-neutral changes of the preferred ligand. 2007 Wiley-Liss, Inc.

  3. Fragment screening using capillary electrophoresis (CEfrag) for hit identification of heat shock protein 90 ATPase inhibitors.

    PubMed

    Austin, Carol; Pettit, Simon N; Magnolo, Sharon K; Sanvoisin, Jonathan; Chen, Wenjie; Wood, Stephen P; Freeman, Lauren D; Pengelly, Reuben J; Hughes, Dallas E

    2012-08-01

    CEfrag is a new fragment screening technology based on affinity capillary electrophoresis (ACE). Here we report on the development of a mobility shift competition assay using full-length human heat shock protein 90α (Hsp90α), radicicol as the competitor probe ligand, and successful screening of the Selcia fragment library. The CEfrag assay was able to detect weaker affinity (IC(50) >500 µM) fragments than were detected by a fluorescence polarization competition assay using FITC-labeled geldanamycin. The binding site of selected fragments was determined by co-crystallization with recombinant Hsp90α N-terminal domain and X-ray analysis. The results of this study confirm that CEfrag is a sensitive microscale technique enabling detection of fragments binding to the biological target in near-physiological solution.

  4. Prediction and Dissection of Protein-RNA Interactions by Molecular Descriptors.

    PubMed

    Liu, Zhi-Ping; Chen, Luonan

    2016-01-01

    Protein-RNA interactions play crucial roles in numerous biological processes. However, detecting the interactions and binding sites between protein and RNA by traditional experiments is still time consuming and labor costing. Thus, it is of importance to develop bioinformatics methods for predicting protein-RNA interactions and binding sites. Accurate prediction of protein-RNA interactions and recognitions will highly benefit to decipher the interaction mechanisms between protein and RNA, as well as to improve the RNA-related protein engineering and drug design. In this work, we summarize the current bioinformatics strategies of predicting protein-RNA interactions and dissecting protein-RNA interaction mechanisms from local structure binding motifs. In particular, we focus on the feature-based machine learning methods, in which the molecular descriptors of protein and RNA are extracted and integrated as feature vectors of representing the interaction events and recognition residues. In addition, the available methods are classified and compared comprehensively. The molecular descriptors are expected to elucidate the binding mechanisms of protein-RNA interaction and reveal the functional implications from structural complementary perspective.

  5. A method of chemiluminescence coupled with ultrafiltration for investigating the interaction between ibuprofen and human serum albumin.

    PubMed

    Xiong, Xunyu; Zhang, Qunzheng; Nan, Yefei; Gu, Xuefan

    2013-01-01

    In acidic media, ibuprofen substantially enhanced the weak chemiluminescence (CL) produced by sodium sulfite and potassium permanganate. The increased signals were linearly correlated with ibuprofen concentrations ranging from 1.2 × 10(-3) to 4.8 μM, with a detection limit of 4.8 × 10(-4) μM. Two ultrafiltration (UF) membranes were used to construct a unit for trapping 0.15 and 0.75 μM human serum albumin (HSA) and coupled online with the CL system. At low HSA concentrations, the numbers of bound molecules per binding site were calculated to be 0.9 for Sudlow site I and 6.2 for Sudlow site II. The association constants on these binding sites were 5.9 × 10(5) and 3.4 × 10(4) M(-1), respectively. Our CL-UF protocol presents a rapid and sensitive method for studies on drug-protein interaction. Copyright © 2012 John Wiley & Sons, Ltd.

  6. Detecting Local Ligand-Binding Site Similarity in Non-Homologous Proteins by Surface Patch Comparison

    PubMed Central

    Sael, Lee; Kihara, Daisuke

    2012-01-01

    Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. PMID:22275074

  7. Detecting local ligand-binding site similarity in nonhomologous proteins by surface patch comparison.

    PubMed

    Sael, Lee; Kihara, Daisuke

    2012-04-01

    Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. Copyright © 2011 Wiley Periodicals, Inc.

  8. ATP hydrolysis in Eg5 kinesin involves a catalytic two-water mechanism.

    PubMed

    Parke, Courtney L; Wojcik, Edward J; Kim, Sunyoung; Worthylake, David K

    2010-02-19

    Motor proteins couple steps in ATP binding and hydrolysis to conformational switching both in and remote from the active site. In our kinesin.AMPPPNP crystal structure, closure of the active site results in structural transformations appropriate for microtubule binding and organizes an orthosteric two-water cluster. We conclude that a proton is shared between the lytic water, positioned for gamma-phosphate attack, and a second water that serves as a general base. To our knowledge, this is the first experimental detection of the catalytic base for any ATPase. Deprotonation of the second water by switch residues likely triggers subsequent large scale structural rearrangements. Therefore, the catalytic base is responsible for initiating nucleophilic attack of ATP and for relaying the positive charge over long distances to initiate mechanotransduction. Coordination of switch movements via sequential proton transfer along paired water clusters may be universal for nucleotide triphosphatases with conserved active sites, such as myosins and G-proteins.

  9. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  10. BiFC Assay to Detect Calmodulin Binding to Plant Receptor Kinases.

    PubMed

    Fischer, Cornelia; Sauter, Margret; Dietrich, Petra

    2017-01-01

    Plant receptor-like kinases (RLKs) are regulated at various levels including posttranscriptional modification and interaction with regulatory proteins. Calmodulin (CaM) is a calcium-sensing protein that was shown to bind to some RLKs such as the PHYTOSULFOKINE RECEPTOR1 (PSKR1). The CaM-binding site is embedded in subdomain VIa of the kinase domain. It is possible that many more of RLKs interact with CaM than previously described. To unequivocally confirm CaM binding, several methods exist. Bimolecular fluorescence complementation (BiFC) and pull-down assays have been successfully used to study CaM binding to PSKR1 and are described in this chapter (BiFC) and in Chapter 15 (pull down). The two methods are complementary. BiFC is useful to show localization and interaction of soluble as well as of membrane-bound proteins in planta.

  11. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

  12. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  13. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  14. Characterization of the Binding of a Potent Synthetic Androgen, Methyltrienolone, to Human Tissues

    PubMed Central

    Menon, Mani; Tananis, Catherine E.; Hicks, L. Louise; Hawkins, Edward F.; McLoughlin, Martin G.; Walsh, Patrick C.

    1978-01-01

    The potent synthetic androgen methytrienolone (R 1881), which does not bind to serum proteins, was utilized to characterize binding to receptors in human androgen responsive tissues. Cytosol extracts prepared from hypertrophic prostates (BPH) were utilized as the source of receptor for the initial studies. High affinity binding was detected in the cytosol of 29 of 30 samples of BPH (average number of binding sites, 45.8±4.7 fmol/mg of protein; dissociation constant, 0.9±0.2 nM). This binding had the characteristics of a receptor: heat lability, precipitability by 0-33% ammonium sulfate and by protamine sulfate, and 8S sedimentation coefficient. High affinity binding was also detected in cytosol prepared from seminal vesicle, epididymis, and genital skin but not in non-genital skin or muscle. However, similar binding was demonstrated in the cytosol of human uterus. The steroid specificities of binding to the cytosol of male tissues of accessory reproduction and of uterus were similar in that progestational agents were more effective competitors than natural androgens. Binding specificities in cytosol prepared from genital skin were distinctly different and were similar to those of ventral prostate from the castrated rat in that dihydrotestosterone was much more potent than progestins in competition. Thus binding of R 1881 to the cytosol of prostate, epididymis, and seminal vesicle has some characteristics of binding to a progesterone receptor. When the nuclear extract from BPH was analyzed, high affinity binding was demonstrated that conformed to the specificities of binding to an androgen receptor. Here dihydrotestosterone was a more potent competitor than progestational agents. Similar patterns of binding were detected in the crude nuclear extracts from seminal vesicle, epididymis, and genital skin but not in uterus, muscle, or non-genital skin. We conclude that the androgen receptor is not demonstrable in the cytosol of prostate, epididymis, or seminal vesicle of non-castrated men but can be measured in the cytosol of genital skin and the nuclear extracts of androgen responsive tissues. Because steroid hormones exert their major influence within the nucleus of target tissues, the measurement of nuclear receptor may provide valuable insight into the regulation of growth of target tissues. PMID:73547

  15. Analytical Application of Flow Immunosensor in Detection of Thyroxine and Triiodothyronine in Serum.

    PubMed

    Wani, Tanveer A; Zargar, Seema; Majid, Salma; Darwish, Ibrahim A

    2016-11-01

    In this study, an immunosensor based on kinetic exclusion analysis (KinExA) was used for thyroxine (T4) and triiodothyronine (T3) estimation. A KinExA™ 3200 instrument was used for this analysis, which is an automated flow fluorimeter designed to separate free unbound antibody binding sites in reaction mixtures of antibody, antigen, and antibody-antigen complex. A T3-BSA- and T4-BSA-coated polymethyl methacrylate (PMMA) bead microcolumn is generated inside the flow cell of the instrument. A sample mixture containing T3 and T4 with their respective monoclonal antibodies and their complexes are drawn past the microbead column. The unbound T3 or T4 monoclonal antibody binding sites are captured by their respective T3 and T4 antigens coated on the PMMA beads as bovine serum albumin conjugates. Fluorescently labeled secondary antibodies bind to the T3 or T4 antigen-antibody complex to generate fluorescence intensity for analysis. The limit of detection for the T3 and T4 assays was found to be 0.06 and 1.9 ng mL -1 with acceptable precision values. The convenience of the automated KinExA format may be valuable in medical diagnostic laboratories.

  16. Synthesis and characterization of (18)F-labeled active site inhibited factor VII (ASIS).

    PubMed

    Erlandsson, Maria; Nielsen, Carsten H; Jeppesen, Troels E; Kristensen, Jesper B; Petersen, Lars C; Madsen, Jacob; Kjaer, Andreas

    2015-05-15

    Activated factor VII blocked in the active site with Phe-Phe-Arg-chloromethyl ketone (active site inhibited factor VII (ASIS)) is a 50-kDa protein that binds with high affinity to its receptor, tissue factor (TF). TF is a transmembrane glycoprotein that plays an important role in, for example, thrombosis, metastasis, tumor growth, and tumor angiogenesis. The aim of this study was to develop an (18)F-labeled ASIS derivative to assess TF expression in tumors. Active site inhibited factor VII was labeled using N-succinimidyl-4-[(18)F]fluorobenzoate, and the [(18)F]ASIS was purified on a PD-10 desalting column. The radiochemical yield was 25 ± 6%, the radiochemical purity was >97%, and the pseudospecific radioactivity was 35 ± 9 GBq/µmol. The binding efficacy was evaluated in pull-down experiments, which monitored the binding of unlabeled ASIS and [(18)F]ASIS to TF and to a specific anti-factor VII antibody (F1A2-mAb). No significant difference in binding efficacy between [(18)F]ASIS and ASIS could be detected. Furthermore, [(18)F]ASIS was relatively stable in vitro and in vivo in mice. In conclusion, [(18)F]ASIS has for the first time been successfully synthesized as a possible positron emission tomography tracer to image TF expression levels. In vivo positron emission tomography studies to evaluate the full potential of [(18)F]ASIS are in progress. Copyright © 2015 John Wiley & Sons, Ltd.

  17. In vivo biotinylation and incorporation of a photo-inducible unnatural amino acid to an antibody-binding domain improve site-specific labeling of antibodies.

    PubMed

    Kanje, Sara; Hober, Sophia

    2015-04-01

    Antibodies are important molecules in many research fields, where they play a key role in various assays. Antibody labeling is therefore of great importance. Currently, most labeling techniques take advantage of certain amino acid side chains that commonly appear throughout proteins. This makes it hard to control the position and exact degree of labeling of each antibody. Hence, labeling of the antibody may affect the antibody-binding site. This paper presents a novel protein domain based on the IgG-binding domain C2 of streptococcal protein G, containing the unnatural amino acid BPA, that can cross-link other molecules. This novel domain can, with improved efficiency compared to previously reported similar domains, site-specifically cross-link to IgG at the Fc region. An efficient method for simultaneous in vivo incorporation of BPA and specific biotinylation in a flask cultivation of Escherichia coli is described. In comparison to a traditionally labeled antibody sample, the C2-labeled counterpart proved to have a higher proportion of functional antibodies when immobilized on a solid surface and the same limit of detection in an ELISA. This method of labeling is, due to its efficiency and simplicity, of high interest for all antibody-based assays where it is important that labeling does not interfere with the antibody-binding site. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Structural basis for a hand-like site in the calcium sensor CatchER with fast kinetics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Ying; Reddish, Florence; Tang, Shen

    2013-12-01

    High-resolution crystal structures of the designed calcium sensor CatchER revealed snapshots of calcium and gadolinium ions binding within the designed site in agreement with its fast kinetics. Calcium ions, which are important signaling molecules, can be detected in the endoplasmic reticulum by an engineered mutant of green fluorescent protein (GFP) designated CatchER with a fast off-rate. High resolution (1.78–1.20 Å) crystal structures were analyzed for CatchER in the apo form and in complexes with calcium or gadolinium to probe the binding site for metal ions. While CatchER exhibits a 1:1 binding stoichiometry in solution, two positions were observed for eachmore » of the metal ions bound within the hand-like site formed by the carboxylate side chains of the mutated residues S147E, S202D, Q204E, F223E and T225E that may be responsible for its fast kinetic properties. Comparison of the structures of CatchER, wild-type GFP and enhanced GFP confirmed that different conformations of Thr203 and Glu222 are associated with the two forms of Tyr66 of the chromophore which are responsible for the absorbance wavelengths of the different proteins. Calcium binding to CatchER may shift the equilibrium for conformational population of the Glu222 side chain and lead to further changes in its optical properties.« less

  19. Human blood-brain barrier insulin-like growth factor receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duffy, K.R.; Pardridge, W.M.; Rosenfeld, R.G.

    1988-02-01

    Insulin-like growth factor (IGF)-1 and IGF-2, may be important regulatory molecules in the CNS. Possible origins of IGFs in brain include either de novo synthesis or transport of circulating IGFs from blood into brain via receptor mediated transcytosis mechanisms at the brain capillary endothelial wall, ie, the blood-brain barrier (BBB). In the present studies, isolated human brain capillaries are used as an in vitro model system of the human BBB and the characteristics of IGF-1 or IGF-2 binding to this preparation were assessed. The total binding of IGF-2 at 37 degrees C exceeded 130% per mg protein and was threefoldmore » greater than the total binding for IGF-1. However, at 37 degrees C nonsaturable binding equaled total binding, suggesting that endocytosis is rate limiting at physiologic temperatures. Binding studies performed at 4 degrees C slowed endocytosis to a greater extent than membrane binding, and specific binding of either IGF-1 or IGF-2 was detectable. Scatchard plots for either peptide were linear and the molar dissociation constant of IGF-1 and IGF-2 binding was 2.1 +/- 0.4 and 1.1 +/- 0.1 nmol/L, respectively. Superphysiologic concentrations of porcine insulin inhibited the binding of both IGF-1 (ED50 = 2 micrograms/mL) and IGF-2 (ED50 = 0.5 microgram/mL). Affinity cross linking of /sup 125/I-IGF-1, /sup 125/I-IGF-2, and /sup 125/I-insulin to isolated human brain capillaries was performed using disuccinimidylsuberate (DSS). These studies revealed a 141 kd binding site for both IGF-1 and IGF-2, and a 133 kd binding site for insulin.« less

  20. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  1. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  2. MUB40 Binds to Lactoferrin and Stands as a Specific Neutrophil Marker.

    PubMed

    Anderson, Mark C; Chaze, Thibault; Coïc, Yves-Marie; Injarabian, Louise; Jonsson, Friederike; Lombion, Naelle; Selimoglu-Buet, Dorothée; Souphron, Judith; Ridley, Caroline; Vonaesch, Pascale; Baron, Bruno; Arena, Ellen T; Tinevez, Jean-Yves; Nigro, Giulia; Nothelfer, Katharina; Solary, Eric; Lapierre, Valérie; Lazure, Thierry; Matondo, Mariette; Thornton, David; Sansonetti, Philippe J; Baleux, Françoise; Marteyn, Benoit S

    2018-04-19

    Neutrophils represent the most abundant immune cells recruited to inflamed tissues. A lack of dedicated tools has hampered their detection and study. We show that a synthesized peptide, MUB 40 , binds to lactoferrin, the most abundant protein stored in neutrophil-specific and tertiary granules. Lactoferrin is specifically produced by neutrophils among other leukocytes, making MUB 40 a specific neutrophil marker. Naive mammalian neutrophils (human, guinea pig, mouse, rabbit) were labeled by fluorescent MUB 40 conjugates (-Cy5, Dylight405). A peptidase-resistant retro-inverso MUB 40 (RI-MUB 40 ) was synthesized and its lactoferrin-binding property validated. Neutrophil lactoferrin secretion during in vitro Shigella infection was assessed with RI-MUB 40 -Cy5 using live cell microscopy. Systemically administered RI-MUB 40 -Cy5 accumulated at sites of inflammation in a mouse arthritis inflammation model in vivo and showed usefulness as a potential tool for inflammation detection using non-invasive imaging. Improving neutrophil detection with the universal and specific MUB 40 marker will aid the study of broad ranges of inflammatory diseases. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Rif1 Binding and Control of Chromosome-Internal DNA Replication Origins Is Limited by Telomere Sequestration.

    PubMed

    Hafner, Lukas; Lezaja, Aleksandra; Zhang, Xu; Lemmens, Laure; Shyian, Maksym; Albert, Benjamin; Follonier, Cindy; Nunes, Jose Manuel; Lopes, Massimo; Shore, David; Mattarocci, Stefano

    2018-04-24

    The Saccharomyces cerevisiae telomere-binding protein Rif1 plays an evolutionarily conserved role in control of DNA replication timing by promoting PP1-dependent dephosphorylation of replication initiation factors. However, ScRif1 binding outside of telomeres has never been detected, and it has thus been unclear whether Rif1 acts directly on the replication origins that it controls. Here, we show that, in unperturbed yeast cells, Rif1 primarily regulates late-replicating origins within 100 kb of a telomere. Using the chromatin endogenous cleavage ChEC-seq technique, we robustly detect Rif1 at late-replicating origins that we show are targets of its inhibitory action. Interestingly, abrogation of Rif1 telomere association by mutation of its Rap1-binding module increases Rif1 binding and origin inhibition elsewhere in the genome. Our results indicate that Rif1 inhibits replication initiation by interacting directly with origins and suggest that Rap1-dependent sequestration of Rif1 increases its effective concentration near telomeres, while limiting its action at chromosome-internal sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Juvenile hormone-binding proteins of Melanoplus bivittatus identified by EFDA photoaffinity labeling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Winder, B.S.

    1988-01-01

    Proteins that bind juvenile hormone in the hemolymph and fat body of the grasshopper, Melanoplus bivittatus were identified by photoaffinity labeling with radiolabeled epoxyfarnesyl diazoacetate ({sup 3}H-EFDA), and were characterized by electrophoretic analysis. A protocol was developed which allowed detection of {sup 3}H-EFDA that was covalently linked to proteins upon exposure to ultraviolet light at 254 nm. Quantification of protein-linked {sup 3}H-EFDA by liquid scintillation spectrometry took advantage of the differential solubility of unlinked {sup 3}H-EFDA in toluene alone, and of the protein-linked {sup 3}H-EFDA in toluene plus the detergent, Triton X-100. Competition between EFDA and juvenile hormone (JH) formore » binding to JH-specific binding sites was measured by hydroxyapatite protein binding assays in the presence of radiolabeled JH or EFDA and competing non-radiolabeled hormone. The protein-linked EFDA was detected on fluorograms of SDS or nondenaturing polyacrylamide gels (PAGE), and by liquid scintillation spectrometry of membranes to which the proteins had been electrophoretically transferred. Proteins which specifically bound JH were identified by photolabeling proteins in the presence and absence of nonlabeled JH-III.« less

  5. Structural study of the Fox-1 RRM protein hydration reveals a role for key water molecules in RRM-RNA recognition

    PubMed Central

    Blatter, Markus; Cléry, Antoine; Damberger, Fred F.

    2017-01-01

    Abstract The Fox-1 RNA recognition motif (RRM) domain is an important member of the RRM protein family. We report a 1.8 Å X-ray structure of the free Fox-1 containing six distinct monomers. We use this and the nuclear magnetic resonance (NMR) structure of the Fox-1 protein/RNA complex for molecular dynamics (MD) analyses of the structured hydration. The individual monomers of the X-ray structure show diverse hydration patterns, however, MD excellently reproduces the most occupied hydration sites. Simulations of the protein/RNA complex show hydration consistent with the isolated protein complemented by hydration sites specific to the protein/RNA interface. MD predicts intricate hydration sites with water-binding times extending up to hundreds of nanoseconds. We characterize two of them using NMR spectroscopy, RNA binding with switchSENSE and free-energy calculations of mutant proteins. Both hydration sites are experimentally confirmed and their abolishment reduces the binding free-energy. A quantitative agreement between theory and experiment is achieved for the S155A substitution but not for the S122A mutant. The S155 hydration site is evolutionarily conserved within the RRM domains. In conclusion, MD is an effective tool for predicting and interpreting the hydration patterns of protein/RNA complexes. Hydration is not easily detectable in NMR experiments but can affect stability of protein/RNA complexes. PMID:28505313

  6. Single-Stranded Nucleic Acids Bind to the Tetramer Interface of SAMHD1 and Prevent Formation of the Catalytic Homotetramer.

    PubMed

    Seamon, Kyle J; Bumpus, Namandjé N; Stivers, James T

    2016-11-08

    Sterile alpha motif and HD domain protein 1 (SAMHD1) is a unique enzyme that plays important roles in nucleic acid metabolism, viral restriction, and the pathogenesis of autoimmune diseases and cancer. Although much attention has been focused on its dNTP triphosphohydrolase activity in viral restriction and disease, SAMHD1 also binds to single-stranded RNA and DNA. Here we utilize a UV cross-linking method using 5-bromodeoxyuridine-substituted oligonucleotides coupled with high-resolution mass spectrometry to identify the binding site for single-stranded nucleic acids (ssNAs) on SAMHD1. Mapping cross-linked amino acids on the surface of existing crystal structures demonstrated that the ssNA binding site lies largely along the dimer-dimer interface, sterically blocking the formation of the homotetramer required for dNTPase activity. Surprisingly, the disordered C-terminus of SAMHD1 (residues 583-626) was also implicated in ssNA binding. An interaction between this region and ssNA was confirmed in binding studies using the purified SAMHD1 583-626 peptide. Despite a recent report that SAMHD1 possesses polyribonucleotide phosphorylase activity, we did not detect any such activity in the presence of inorganic phosphate, indicating that nucleic acid binding is unrelated to this proposed activity. These data suggest an antagonistic regulatory mechanism in which the mutually exclusive oligomeric state requirements for ssNA binding and dNTP hydrolase activity modulate these two functions of SAMHD1 within the cell.

  7. Stereochemistry of quinoxaline antagonist binding to a glutamate receptor investigated by Fourier transform infrared spectroscopy.

    PubMed

    Madden, D R; Thiran, S; Zimmermann, H; Romm, J; Jayaraman, V

    2001-10-12

    The stereochemistry of the interactions between quinoxaline antagonists and the ligand-binding domain of the glutamate receptor 4 (GluR4) have been investigated by probing their vibrational modes using Fourier transform infrared spectroscopy. In solution, the electron-withdrawing nitro groups of both compounds establish a resonance equilibrium that appears to stabilize the keto form of one of the cyclic amide carbonyl bonds. Changes in the 6,7-dinitro-2,3-dihydroxyquinoxaline vibrational spectra on binding to the glutamate receptor, interpreted within the framework of a published crystal structure, illuminate the stereochemistry of the interaction and suggest that the binding site imposes a more polarized electronic bonding configuration on this antagonist. Similar spectral changes are observed for 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline, confirming that its interactions with the binding site are highly similar to those of 6,7-dinitro-2,3-dihydroxyquinoxaline and leading to a model of the 6-cyano-7-dinitro-2,3-dihydroxyquinoxaline-S1S2 complex, for which no crystal structure is available. Conformational changes within the GluR ligand binding domain were also monitored. Compared with the previously reported spectral changes seen on binding of the agonist glutamate, only a relatively small change is detected on antagonist binding. This correlation between the functional effects of different classes of ligand and the magnitude of the spectroscopic changes they induce suggests that the spectral data reflect physiologically relevant conformational processes.

  8. Nanopore Force Spectroscopy of Aptamer–Ligand Complexes

    PubMed Central

    Arnaut, Vera; Langecker, Martin; Simmel, Friedrich C.

    2013-01-01

    The stability of aptamer–ligand complexes is probed in nanopore-based dynamic force spectroscopy experiments. Specifically, the ATP-binding aptamer is investigated using a backward translocation technique, in which the molecules are initially pulled through an α-hemolysin nanopore from the cis to the trans side of a lipid bilayer membrane, allowed to refold and interact with their target, and then translocated back in the trans–cis direction. From these experiments, the distribution of bound and unbound complexes is determined, which in turn allows determination of the dissociation constant Kd ≈ 0.1 mM of the aptamer and of voltage-dependent unfolding rates. The experiments also reveal differences in binding of the aptamer to AMP, ADP, or ATP ligands. Investigation of an aptamer variant with a stabilized ATP-binding site indicates fast conformational switching of the original aptamer before ATP binding. Nanopore force spectroscopy is also used to study binding of the thrombin-binding aptamer to its target. To detect aptamer–target interactions in this case, the stability of the ligand-free aptamer—containing G-quadruplexes—is tuned via the potassium content of the buffer. Although the presence of thrombin was detected, limitations of the method for aptamers with strong secondary structures and complexes with nanomolar Kd were identified. PMID:24010663

  9. Common structural features of cholesterol binding sites in crystallized soluble proteins

    PubMed Central

    Bukiya, Anna N.; Dopico, Alejandro M.

    2017-01-01

    Cholesterol-protein interactions are essential for the architectural organization of cell membranes and for lipid metabolism. While cholesterol-sensing motifs in transmembrane proteins have been identified, little is known about cholesterol recognition by soluble proteins. We reviewed the structural characteristics of binding sites for cholesterol and cholesterol sulfate from crystallographic structures available in the Protein Data Bank. This analysis unveiled key features of cholesterol-binding sites that are present in either all or the majority of sites: i) the cholesterol molecule is generally positioned between protein domains that have an organized secondary structure; ii) the cholesterol hydroxyl/sulfo group is often partnered by Asn, Gln, and/or Tyr, while the hydrophobic part of cholesterol interacts with Leu, Ile, Val, and/or Phe; iii) cholesterol hydrogen-bonding partners are often found on α-helices, while amino acids that interact with cholesterol’s hydrophobic core have a slight preference for β-strands and secondary structure-lacking protein areas; iv) the steroid’s C21 and C26 constitute the “hot spots” most often seen for steroid-protein hydrophobic interactions; v) common “cold spots” are C8–C10, C13, and C17, at which contacts with the proteins were not detected. Several common features we identified for soluble protein-steroid interaction appear evolutionarily conserved. PMID:28420706

  10. Identification of a unique IgG Fc binding site in human intestinal epithelium.

    PubMed

    Kobayashi, K; Blaser, M J; Brown, W R

    1989-10-15

    In experiments to determine whether serum antibodies in patients with Crohn's disease could be used as probes for detecting potentially etiologic Ag in the patients' tissues, we found that peroxidase (HRP)-labeled IgG from healthy persons, as well as from the patients, bound to normal colonic and small intestinal epithelium, mostly or entirely to goblet cells. The binding was due to a reaction involving the Fc region of IgG because HRP-labeled Fc fragments of IgG bound, but HRP-Fab, HRP-IgA, and HRP-bovine albumin did not, and because binding of HRP-IgG was inhibited competitively by unlabeled IgG or Fc fragments but not by IgG Fab fragments or IgA. These immunohistochemical results were confirmed by ELISA with microtiter wells coated with a sonicated homogenate from human colonocytes. The epithelial IgG Fc binding site was characterized by SDS-PAGE as consisting of a high Mr (greater than 200,000 Da) and a 78,000-Da component. It bound all four subclasses of human IgG and bound aggregated as well as monomeric IgG. It is distinct from known human Fc-gamma R by lack of recognition by mAb to those receptors and differences in affinity for various subclasses of human and murine IgG. This unique IgG Fc binding site might be involved in immunologic defense of the gut, perhaps by mediating reactions between foreign Ag and the contents of goblet cells.

  11. Ontogenesis of the angiotensin II (ANGII) receptor system in the duck brain.

    PubMed

    Müller, A R; Gerstberger, R

    1994-03-18

    The ontogenetic development of the central nervous angiotensin II (ANGII) receptor system in the duck was studied at embryonic days E20 and E27 and at postnatal days P3 and P14 by computerized semiquantitative autoradiography employing the receptor antagonist 125I[1Sar,8Ile]ANGII as radioligand. For circumventricular structures involved in the sensing of brain-intrinsic (AV3V region) or blood-borne (subfornical organ, SFO) ANGII, binding sites for 125I[1Sar,8Ile]ANGII were first detectable at E27, with a steady rise in binding density up to P14. The choroid plexus of the lateral (PCVL) and third (PCVIII) cerebral ventricles responsible for cerebrospinal fluid (CSF) production were endowed with maximal ANGII receptor densities at E20 with subsequent reduction to constant medium (PCVIII) or low (PCVL) values. Besides the choroid plexus, the magnocellular paraventricular nucleus (PVN) was the only structure presenting ANGII specific binding sites at E20, although at low density. As for the SFO and AV3V region, labelling of ANGII binding sites in the PVN increased continuously during development to high values at P14. Nuclear components of the limbic system (archistriatum, amygdala and habenular complex) did not reveal specific labelling by the radioligand at E20 with constant, moderate binding densities evaluated for E27, P3 and P14. In the duck brain, functionally related structures exhibited a homogeneous ontogenetic development of their ANGII receptor system.

  12. EzyAmp signal amplification cascade enables isothermal detection of nucleic acid and protein targets.

    PubMed

    Linardy, Evelyn M; Erskine, Simon M; Lima, Nicole E; Lonergan, Tina; Mokany, Elisa; Todd, Alison V

    2016-01-15

    Advancements in molecular biology have improved the ability to characterize disease-related nucleic acids and proteins. Recently, there has been an increasing desire for tests that can be performed outside of centralised laboratories. This study describes a novel isothermal signal amplification cascade called EzyAmp (enzymatic signal amplification) that is being developed for detection of targets at the point of care. EzyAmp exploits the ability of some restriction endonucleases to cleave substrates containing nicks within their recognition sites. EzyAmp uses two oligonucleotide duplexes (partial complexes 1 and 2) which are initially cleavage-resistant as they lack a complete recognition site. The recognition site of partial complex 1 can be completed by hybridization of a triggering oligonucleotide (Driver Fragment 1) that is generated by a target-specific initiation event. Binding of Driver Fragment 1 generates a completed complex 1, which upon cleavage, releases Driver Fragment 2. In turn, binding of Driver Fragment 2 to partial complex 2 creates completed complex 2 which when cleaved releases additional Driver Fragment 1. Each cleavage event separates fluorophore quencher pairs resulting in an increase in fluorescence. At this stage a cascade of signal production becomes independent of further target-specific initiation events. This study demonstrated that the EzyAmp cascade can facilitate detection and quantification of nucleic acid targets with sensitivity down to aM concentration. Further, the same cascade detected VEGF protein with a sensitivity of 20nM showing that this universal method for amplifying signal may be linked to the detection of different types of analytes in an isothermal format. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.

    PubMed

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-11-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.

  14. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  15. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  17. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  18. Activation and Regulation of Purinergic P2X Receptor Channels

    PubMed Central

    Coddou, Claudio; Yan, Zonghe; Obsil, Tomas; Huidobro-Toro, J. Pablo

    2011-01-01

    Mammalian ATP-gated nonselective cation channels (P2XRs) can be composed of seven possible subunits, denoted P2X1 to P2X7. Each subunit contains a large ectodomain, two transmembrane domains, and intracellular N and C termini. Functional P2XRs are organized as homomeric and heteromeric trimers. This review focuses on the binding sites involved in the activation (orthosteric) and regulation (allosteric) of P2XRs. The ectodomains contain three ATP binding sites, presumably located between neighboring subunits and formed by highly conserved residues. The detection and coordination of three ATP phosphate residues by positively charged amino acids are likely to play a dominant role in determining agonist potency, whereas an AsnPheArg motif may contribute to binding by coordinating the adenine ring. Nonconserved ectodomain histidines provide the binding sites for trace metals, divalent cations, and protons. The transmembrane domains account not only for the formation of the channel pore but also for the binding of ivermectin (a specific P2X4R allosteric regulator) and alcohols. The N- and C- domains provide the structures that determine the kinetics of receptor desensitization and/or pore dilation and are critical for the regulation of receptor functions by intracellular messengers, kinases, reactive oxygen species and mercury. The recent publication of the crystal structure of the zebrafish P2X4.1R in a closed state provides a major advance in the understanding of this family of receptor channels. We will discuss data obtained from numerous site-directed mutagenesis experiments accumulated during the last 15 years with reference to the crystal structure, allowing a structural interpretation of the molecular basis of orthosteric and allosteric ligand actions. PMID:21737531

  19. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  20. Muscarinic cholinergic receptor binding: in vivo depiction using single photon emission computed tomography and radioiodinated quinuclidinyl benzilate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drayer, B.; Jaszczak, R.; Coleman, E.

    1982-06-01

    An attempt was made to characterize, in vivo, specific binding to the muscarinic cholinergic receptor in the calf using the radioiodinated ligand quinuclidinyl benzilate (/sup 123/I-OH-QNB) and single photon detection emission computed tomography (SPECT). The supratentorial brain activity was significantly increased after the intravenous infusion of /sup 123/I-OH-QNB as compared to free /sup 123/I. Scopolamine, a muscarinic cholinergic receptor antagonist, decreased the measured brain activity when infused prior to /sup 123/I-OH-QNB consistent with pharmacologic blockade of specific receptor binding. Quantitative in vitro tissue distribution studies obtained following SPECT imaging were consistent with regionally distinct specific receptor binding in the striatummore » and cortical gray matter, nonspecific binding in the cerebellum, and pharmacologic blockade of specific binding sites with scopolamine. Although /sup 123/I-OH-QNB is not the ideal radioligand, our limited success will hopefully encourage the development of improved binding probes for SPECT imaging and quantitation.« less

  1. Heterogeneity of D2 dopamine receptors in different brain regions.

    PubMed Central

    Leonard, M N; Macey, C A; Strange, P G

    1987-01-01

    The binding of [3H]spiperone has been examined in membranes derived from different regions of bovine brain. In caudate nucleus, nucleus accumbens, olfactory tubercle and putamen binding is to D2 dopamine and 5HT2 serotonin receptors, whereas in cingulate cortex only serotonin 5HT2 receptor binding can be detected. D2 dopamine receptors were examined in detail in caudate nucleus, olfactory tubercle and putamen using [3H]spiperone binding in the presence of 0.3 microM-mianserin (to block 5HT2 serotonin receptors). No evidence for heterogeneity among D2 dopamine receptors either between brain regions or within a brain region was found from the displacements of [3H]spiperone binding by a range of antagonists, including dibenzazepines and substituted benzamides. Regulation of agonist binding by guanine nucleotides did, however, differ between regions. In caudate nucleus a population of agonist binding sites appeared resistant to guanine nucleotide regulation, whereas this was not the case in olfactory tubercle and putamen. PMID:2963621

  2. IsoCleft Finder – a web-based tool for the detection and analysis of protein binding-site geometric and chemical similarities

    PubMed Central

    Najmanovich, Rafael

    2013-01-01

    IsoCleft Finder is a web-based tool for the detection of local geometric and chemical similarities between potential small-molecule binding cavities and a non-redundant dataset of ligand-bound known small-molecule binding-sites. The non-redundant dataset developed as part of this study is composed of 7339 entries representing unique Pfam/PDB-ligand (hetero group code) combinations with known levels of cognate ligand similarity. The query cavity can be uploaded by the user or detected automatically by the system using existing PDB entries as well as user-provided structures in PDB format. In all cases, the user can refine the definition of the cavity interactively via a browser-based Jmol 3D molecular visualization interface. Furthermore, users can restrict the search to a subset of the dataset using a cognate-similarity threshold. Local structural similarities are detected using the IsoCleft software and ranked according to two criteria (number of atoms in common and Tanimoto score of local structural similarity) and the associated Z-score and p-value measures of statistical significance. The results, including predicted ligands, target proteins, similarity scores, number of atoms in common, etc., are shown in a powerful interactive graphical interface. This interface permits the visualization of target ligands superimposed on the query cavity and additionally provides a table of pairwise ligand topological similarities. Similarities between top scoring ligands serve as an additional tool to judge the quality of the results obtained. We present several examples where IsoCleft Finder provides useful functional information. IsoCleft Finder results are complementary to existing approaches for the prediction of protein function from structure, rational drug design and x-ray crystallography. IsoCleft Finder can be found at: http://bcb.med.usherbrooke.ca/isocleftfinder. PMID:24555058

  3. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  4. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  5. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  6. Observing single protein binding by optical transmission through a double nanohole aperture in a metal film

    PubMed Central

    Al Balushi, Ahmed A.; Zehtabi-Oskuie, Ana; Gordon, Reuven

    2013-01-01

    We experimentally demonstrate protein binding at the single particle level. A double nanohole (DNH) optical trap was used to hold onto a 20 nm biotin-coated polystyrene (PS) particle which subsequently is bound to streptavidin. Biotin-streptavidin binding has been detected by an increase in the optical transmission through the DNH. Similar optical transmission behavior was not observed when streptavidin binding sites where blocked by mixing streptavidin with excess biotin. Furthermore, interaction of non-functionalized PS particles with streptavidin did not induce a change in the optical transmission through the DNH. These results are promising as the DNH trap can make an excellent single molecule resolution sensor which would enable studying biomolecular interactions and dynamics at a single particle/molecule level. PMID:24049672

  7. Femtogram detection of explosive nitroaromatics: fluoranthene-based fluorescent chemosensors.

    PubMed

    Venkatramaiah, N; Kumar, Shiv; Patil, Satish

    2012-11-12

    Herein we report a novel fluoranthene-based fluorescent fluorophore 7,10-bis(4-bromophenyl)-8,9-bis[4-(hexyloxy)phenyl]fluoranthene (S(3)) and its remarkable properties in applications of explosive detection. The sensitivity towards the detection of nitroaromatics (NACs) was evaluated through fluorescence quenching in solution, vapor, and contact mode approaches. The contact mode approach using thin-layer silica chromatographic plates exhibited a femtogram (1.15 fg cm(-2)) detection limit for trinitrotoluene (TNT) and picric acid (PA), whereas the solution-phase quenching showed PA detection at the 2-20 ppb level. Fluorescence lifetime measurements revealed that the quenching is static in nature and the quenching process is fully reversible. Binding energies between model binding sites of the S(3) and analyte compounds reveal that analyte molecules enter into the cavity created by substituted phenyl rings of fluoranthene and are stabilized by strong intermolecular interactions with alkyl chains. It is anticipated that the sensor S(3) could be a promising material for the construction of portable optical devices for the detection of onsite explosive nitroaromatics. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Definition of a consensus DNA-binding site for PecS, a global regulator of virulence gene expression in Erwinia chrysanthemi and identification of new members of the PecS regulon.

    PubMed

    Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William

    2004-07-16

    In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

  9. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  10. Cysteine-390 is the binding site of luminous substance with symplectin, a photoprotein from Okinawan squid, Symplectoteuthis oualaniensis

    PubMed Central

    Isobe, Minoru; Kuse, Masaki; Tani, Naoki; Fujii, Tatsuya; Matsuda, Tsukasa

    2008-01-01

    Symplectin is a photoprotein from a luminous squid, Symplectoteuthis oualaniensis. It has a luminous substrate, dehydrocoelenterazine (DCZ), linked through a thioether bond with a cysteine residue. We have proven the binding site of luminous substrate in symplectin by using an artificial analogue of DCZ, ortho-fluoro-DCZ (F-DCZ). F-DCZ-symplectin emitting strong blue light was reconstituted from apo-symplectin and F-DCZ. Proteolytic digestion of the reconstituted F-DCZ-symplectin afforded peptides including C390GLK-F-DCZ (amide), which was detected with a house assembled nano-LC-ESI-Q-TOF-MS. The chromo-peptide derived from the F-DCZ-symplectin after luminescence showed the lower molecular mass than that before the luminescence by 12 mass units, corresponding to the loss of one carbon atom upon emitting light. Thus, we have concluded that F-DCZ analogue binds to Cys390 in symplectin so as to emit light. PMID:18997450

  11. Bioinformatics approaches to predict target genes from transcription factor binding data.

    PubMed

    Essebier, Alexandra; Lamprecht, Marnie; Piper, Michael; Bodén, Mikael

    2017-12-01

    Transcription factors regulate gene expression and play an essential role in development by maintaining proliferative states, driving cellular differentiation and determining cell fate. Transcription factors are capable of regulating multiple genes over potentially long distances making target gene identification challenging. Currently available experimental approaches to detect distal interactions have multiple weaknesses that have motivated the development of computational approaches. Although an improvement over experimental approaches, existing computational approaches are still limited in their application, with different weaknesses depending on the approach. Here, we review computational approaches with a focus on data dependency, cell type specificity and usability. With the aim of identifying transcription factor target genes, we apply available approaches to typical transcription factor experimental datasets. We show that approaches are not always capable of annotating all transcription factor binding sites; binding sites should be treated disparately; and a combination of approaches can increase the biological relevance of the set of genes identified as targets. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Structural insights into Aspergillus fumigatus lectin specificity: AFL binding sites are functionally non-equivalent.

    PubMed

    Houser, Josef; Komarek, Jan; Cioci, Gianluca; Varrot, Annabelle; Imberty, Anne; Wimmerova, Michaela

    2015-03-01

    The Aspergillus fumigatus lectin AFL was recently described as a new member of the AAL lectin family. As a lectin from an opportunistic pathogen, it might play an important role in the interaction of the pathogen with the human host. A detailed study of structures of AFL complexed with several monosaccharides and oligosaccharides, including blood-group epitopes, was combined with affinity data from SPR and discussed in the context of previous findings. Its six binding sites are non-equivalent, and owing to minor differences in amino-acid composition they exhibit a marked difference in specific ligand recognition. AFL displays a high affinity in the micromolar range towards oligosaccharides which were detected in plants and also those bound on the human epithelia. All of these results indicate AFL to be a complex member of the lectin family and a challenging target for future medical research and, owing to its binding properties, a potentially useful tool in specific biotechnological applications.

  13. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  14. Structure of clathrin coat with bound Hsc70 and auxilin: mechanism of Hsc70-facilitated disassembly

    PubMed Central

    Xing, Yi; Böcking, Till; Wolf, Matthias; Grigorieff, Nikolaus; Kirchhausen, Tomas; Harrison, Stephen C

    2010-01-01

    The chaperone Hsc70 drives the clathrin assembly–disassembly cycle forward by stimulating dissociation of a clathrin lattice. A J-domain containing co-chaperone, auxilin, associates with a freshly budded clathrin-coated vesicle, or with an in vitro assembled clathrin coat, and recruits Hsc70 to its specific heavy-chain-binding site. We have determined by electron cryomicroscopy (cryoEM), at about 11 Å resolution, the structure of a clathrin coat (in the D6-barrel form) with specifically bound Hsc70 and auxilin. The Hsc70 binds a previously analysed site near the C-terminus of the heavy chain, with a stoichiometry of about one per three-fold vertex. Its binding is accompanied by a distortion of the clathrin lattice, detected by a change in the axial ratio of the D6 barrel. We propose that when Hsc70, recruited to a position close to its target by the auxilin J-domain, splits ATP, it clamps firmly onto its heavy-chain site and locks in place a transient fluctuation. Accumulation of the local strain thus imposed at multiple vertices can then lead to disassembly. PMID:20033059

  15. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  16. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  18. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pejcha, Robert; Ludwig, Martha L.

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domainmore » evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.« less

  19. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    NASA Astrophysics Data System (ADS)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  20. Oxysterol-binding Protein Activation at Endoplasmic Reticulum-Golgi Contact Sites Reorganizes Phosphatidylinositol 4-Phosphate Pools*

    PubMed Central

    Goto, Asako; Charman, Mark; Ridgway, Neale D.

    2016-01-01

    Oxysterol-binding protein (OSBP) exchanges cholesterol and phosphatidylinositol 4-phosphate (PI-4P) at contact sites between the endoplasmic reticulum (ER) and the trans-Golgi/trans-Golgi network. 25-Hydroxycholesterol (25OH) competitively inhibits this exchange reaction in vitro and causes the constitutive localization of OSBP at the ER/Golgi interface and PI-4P-dependent recruitment of ceramide transfer protein (CERT) for sphingomyelin synthesis. We used PI-4P probes and mass analysis to determine how OSBP controls the availability of PI-4P for this metabolic pathway. Treatment of fibroblasts or Chinese hamster ovary (CHO) cells with 25OH caused a 50–70% reduction in Golgi-associated immunoreactive PI-4P that correlated with Golgi localization of OSBP. In contrast, 25OH caused an OSBP-dependent enrichment in Golgi PI-4P that was detected with a pleckstrin homology domain probe. The cellular mass of phosphatidylinositol monophosphates and Golgi PI-4P measured with an unbiased PI-4P probe (P4M) was unaffected by 25OH and OSBP silencing, indicating that OSBP shifts the distribution of PI-4P upon localization to ER-Golgi contact sites. The PI-4P and sterol binding activities of OSBP were both required for 25OH activation of sphingomyelin synthesis, suggesting that 25OH must be exchanged for PI-4P to be concentrated at contact sites. We propose a model wherein 25OH activation of OSBP promotes the binding and retention of PI-4P at ER-Golgi contact sites. This pool of PI-4P specifically recruits pleckstrin homology domain-containing proteins involved in lipid transfer and metabolism, such as CERT. PMID:26601944

  1. Oxysterol-binding Protein Activation at Endoplasmic Reticulum-Golgi Contact Sites Reorganizes Phosphatidylinositol 4-Phosphate Pools.

    PubMed

    Goto, Asako; Charman, Mark; Ridgway, Neale D

    2016-01-15

    Oxysterol-binding protein (OSBP) exchanges cholesterol and phosphatidylinositol 4-phosphate (PI-4P) at contact sites between the endoplasmic reticulum (ER) and the trans-Golgi/trans-Golgi network. 25-Hydroxycholesterol (25OH) competitively inhibits this exchange reaction in vitro and causes the constitutive localization of OSBP at the ER/Golgi interface and PI-4P-dependent recruitment of ceramide transfer protein (CERT) for sphingomyelin synthesis. We used PI-4P probes and mass analysis to determine how OSBP controls the availability of PI-4P for this metabolic pathway. Treatment of fibroblasts or Chinese hamster ovary (CHO) cells with 25OH caused a 50-70% reduction in Golgi-associated immunoreactive PI-4P that correlated with Golgi localization of OSBP. In contrast, 25OH caused an OSBP-dependent enrichment in Golgi PI-4P that was detected with a pleckstrin homology domain probe. The cellular mass of phosphatidylinositol monophosphates and Golgi PI-4P measured with an unbiased PI-4P probe (P4M) was unaffected by 25OH and OSBP silencing, indicating that OSBP shifts the distribution of PI-4P upon localization to ER-Golgi contact sites. The PI-4P and sterol binding activities of OSBP were both required for 25OH activation of sphingomyelin synthesis, suggesting that 25OH must be exchanged for PI-4P to be concentrated at contact sites. We propose a model wherein 25OH activation of OSBP promotes the binding and retention of PI-4P at ER-Golgi contact sites. This pool of PI-4P specifically recruits pleckstrin homology domain-containing proteins involved in lipid transfer and metabolism, such as CERT. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    PubMed Central

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  3. Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2003-01-01

    Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides –154 and –107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786–4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus. PMID:12851461

  4. Coupled motions in the SH2 and kinase domains of Csk control Src phosphorylation.

    PubMed

    Wong, Lilly; Lieser, Scot A; Miyashita, Osamu; Miller, Meghan; Tasken, Kjetil; Onuchic, Josè N; Adams, Joseph A; Woods, Virgil L; Jennings, Patricia A

    2005-08-05

    The C-terminal Src kinase (Csk) phosphorylates and down-regulates Src family tyrosine kinases. The Csk-binding protein (Cbp) localizes Csk close to its substrates at the plasma membrane, and increases the specific activity of the kinase. To investigate this long-range catalytic effect, the phosphorylation of Src and the conformation of Csk were investigated in the presence of a high-affinity phosphopeptide derived from Cbp. This peptide binds tightly to the SH2 domain and enhances Src recognition (lowers K(m)) by increasing the apparent phosphoryl transfer rate in the Csk active site, a phenomenon detected in rapid quench flow experiments. Previous studies demonstrated that the regulation of Csk activity is linked to conformational changes in the enzyme that can be probed with hydrogen-deuterium exchange methods. We show that the Cbp peptide impacts deuterium incorporation into its binding partner (the SH2 domain), and into the SH2-kinase linker and several sequences in the kinase domain, including the glycine-rich loop in the active site. These findings, along with computational data from normal mode analyses, suggest that the SH2 domain moves in a cantilever fashion with respect to the small lobe of the kinase domain, ordering the active site for catalysis. The binding of a small Cbp-derived peptide to the SH2 domain of Csk modifies these motions, enhancing Src recognition.

  5. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  6. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    NASA Astrophysics Data System (ADS)

    Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

    2008-10-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  7. Involvement of a bifunctional, paired-like DNA-binding domain and a transpositional enhancer in Sleeping Beauty transposition.

    PubMed

    Izsvák, Zsuzsanna; Khare, Dheeraj; Behlke, Joachim; Heinemann, Udo; Plasterk, Ronald H; Ivics, Zoltán

    2002-09-13

    Sleeping Beauty (SB) is the most active Tc1/mariner-like transposon in vertebrate species. Each of the terminal inverted repeats (IRs) of SB contains two transposase-binding sites (DRs). This feature, termed the IR/DR structure, is conserved in a group of Tc1-like transposons. The DNA-binding region of SB transposase, similar to the paired domain of Pax proteins, consists of two helix-turn-helix subdomains (PAI + RED = PAIRED). The N-terminal PAI subdomain was found to play a dominant role in contacting the DRs. Transposase was able to bind to mutant sites retaining the 3' part of the DRs; thus, primary DNA binding is not sufficient to determine the specificity of the transposition reaction. The PAI subdomain was also found to bind to a transpositional enhancer-like sequence within the left IR of SB, and to mediate protein-protein interactions between transposase subunits. A tetrameric form of the transposase was detected in solution, consistent with an interaction between the IR/DR structure and a transposase tetramer. We propose a model in which the transpositional enhancer and the PAI subdomain stabilize complexes formed by a transposase tetramer bound at the IR/DR. These interactions may result in enhanced stability of synaptic complexes, which might explain the efficient transposition of Sleeping Beauty in vertebrate cells.

  8. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  9. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  10. Lectin histochemistry of metastatic adenocarcinomas of the lung.

    PubMed

    Thöm, Ina; Schult-Kronefeld, Olaf; Burkholder, Iris; Goern, Michael; Andritzky, Birte; Blonski, Katharina; Kugler, Christian; Edler, Lutz; Bokemeyer, Carsten; Schumacher, Udo; Laack, Eckart

    2007-06-01

    Several clinical studies indicate that primary tumour cells with high metastatic potential often show aberrant glycosylation as detected by lectin histochemistry. However, it is unclear whether aberrant glycosylation is still present in metastatic deposits. The aim of the present investigation was thus to analyse a possible association between the presence of lectin binding sites of pulmonary adenocarcinoma cells and their lymph node and haematogenous metastatic cells. For this purpose, the expression of HPA, PHA-L and UEA-I was assessed in primary tumours, lymph node metastases and haematogenous metastases of 96 patients with metastatic adenocarcinomas of the lung that underwent surgery between 1999 and 2002. Besides, lectin-binding data and other known prognostic factors were correlated with survival. We found a significant positive correlation between the binding of the lectins HPA (p=0.002), PHA-L (p<0.00001) and UEA-I (p<0.00001) to the cells of the primary tumour and to their lymph node metastases. There was a positive correlation between the binding of HPA to the cells of the primary tumour and the haematogenous metastases as well. Patients with tumours which did not show HPA binding sites had a median overall survival of 27.9 months (95%-CI 7.7-infinity months). Patients with a HPA binding tumour had a median overall survival of 20.9 months (95%-CI 18.5-28.7 months). This is the first investigation to demonstrate a positive correlation between the binding of the lectins HPA, PHA-L and UEA-I to the cells of the primary tumour and to their lymph node metastases. Expression of HPA binding sites is also preserved in the haematogenous metastases. In summary, our results support the hypothesis that altered glycosylation of the membrane-bound glycoproteins of the tumour cells is associated with, but not sufficient for promotion of lymphogenic and haematogenous metastasis.

  11. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  12. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  13. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  14. Interaction of ibogaine with human α3β4-nicotinic acetylcholine receptors in different conformational states

    PubMed Central

    Arias, Hugo R.; Rosenberg, Avraham; Targowska-Duda, Katarzyna M.; Feuerbach, Dominik; Yuan, Xiao Juan; Jozwiak, Krzysztof; Moaddel, Ruin; Wainer, Irving W.

    2015-01-01

    The interaction of ibogaine and phencyclidine (PCP) with human (h) α3β4-nicotinic acetylcholine receptors (AChRs) in different conformational states was determined by functional and structural approaches including, radioligand binding assays, Ca2+ influx detections, and thermodynamic and kinetics measurements. The results established that (a) ibogaine inhibits (±)-epibatidine-induced Ca2+ influx in hα3β4 AChRs with ~9-fold higher potency than that for PCP, (b) [3H]ibogaine binds to a single site in the hα3β4 AChR ion channel with relatively high affinity (Kd = 0.46 ± 0.06 µM), and ibogaine inhibits [3H]ibogaine binding to the desensitized hα3β4 AChR with slightly higher affinity compared to the resting AChR. This is explained by a slower dissociation rate from the desensitized ion channel compared to the resting ion channel, and (c) PCP inhibits [3H]ibogaine binding to the hα3β4 AChR, suggesting overlapping sites. The experimental results correlate with the docking simulations suggesting that ibogaine and PCP interact with a binding domain located between the serine (position 6′) and valine/phenylalanine (position 13′) rings. This interaction is mediated mainly by van der Waals contacts, which is in agreement with the observed enthalpic contribution determined by non-linear chromatography. However, the calculated entropic contribution also indicates local conformational changes. Collectively our data suggest that ibogaine and PCP bind to overlapping sites located between the serine and valine/phenylalanine rings, to finally block the AChR ion channel, and in the case of ibogaine, to probably maintain the AChR in the desensitized state for longer time. PMID:20684041

  15. Interaction of ibogaine with human alpha3beta4-nicotinic acetylcholine receptors in different conformational states.

    PubMed

    Arias, Hugo R; Rosenberg, Avraham; Targowska-Duda, Katarzyna M; Feuerbach, Dominik; Yuan, Xiao Juan; Jozwiak, Krzysztof; Moaddel, Ruin; Wainer, Irving W

    2010-09-01

    The interaction of ibogaine and phencyclidine (PCP) with human (h) alpha3beta4-nicotinic acetylcholine receptors (AChRs) in different conformational states was determined by functional and structural approaches including, radioligand binding assays, Ca2+ influx detections, and thermodynamic and kinetics measurements. The results established that (a) ibogaine inhibits (+/-)-epibatidine-induced Ca2+ influx in h(alpha)3beta4 AChRs with approximately 9-fold higher potency than that for PCP, (b) [3H]ibogaine binds to a single site in the h(alpha)3beta4 AChR ion channel with relatively high affinity (Kd = 0.46 +/- 0.06 microM), and ibogaine inhibits [3H]ibogaine binding to the desensitized h(alpha)3beta4 AChR with slightly higher affinity compared to the resting AChR. This is explained by a slower dissociation rate from the desensitized ion channel compared to the resting ion channel, and (c) PCP inhibits [3H]ibogaine binding to the h(alpha)3beta4 AChR, suggesting overlapping sites. The experimental results correlate with the docking simulations suggesting that ibogaine and PCP interact with a binding domain located between the serine (position 6') and valine/phenylalanine (position 13') rings. This interaction is mediated mainly by van der Waals contacts, which is in agreement with the observed enthalpic contribution determined by non-linear chromatography. However, the calculated entropic contribution also indicates local conformational changes. Collectively our data suggest that ibogaine and PCP bind to overlapping sites located between the serine and valine/phenylalanine rings, to finally block the AChR ion channel, and in the case of ibogaine, to probably maintain the AChR in the desensitized state for longer time.

  16. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  17. Evolution of CCL11: genetic characterization in lagomorphs and evidence of positive and purifying selection in mammals.

    PubMed

    Neves, Fabiana; Abrantes, Joana; Esteves, Pedro J

    2016-07-01

    The interactions between chemokines and their receptors are crucial for differentiation and activation of inflammatory cells. CC chemokine ligand 11 (CCL11) binds to CCR3 and to CCR5 that in leporids underwent gene conversion with CCR2. Here, we genetically characterized CCL11 in lagomorphs (leporids and pikas). All lagomorphs have a potentially functional CCL11, and the Pygmy rabbit has a mutation in the stop codon that leads to a longer protein. Other mammals also have mutations at the stop codon that result in proteins with different lengths. By employing maximum likelihood methods, we observed that, in mammals, CCL11 exhibits both signatures of purifying and positive selection. Signatures of purifying selection were detected in sites important for receptor binding and activation. Of the three sites detected as under positive selection, two were located close to the stop codon. Our results suggest that CCL11 is functional in all lagomorphs, and that the signatures of purifying and positive selection in mammalian CCL11 probably reflect the protein's biological roles. © The Author(s) 2016.

  18. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  19. (/sup 3/H)Ethylketocyclazocine binding to mouse brain membranes: evidence for a kappa opioid receptor type

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garzon, J.; Sanchez-Blazquez, P.; Lee, N.M.

    1984-10-01

    The binding of the putative kappa agonist ethylketocyclazocine (EKC) to synaptosomal membranes of mouse brain was studied. This benzomorphan was able to bind to different opioid receptors. A portion of this binding was not inhibited by the agonist naloxone, even at high concentrations (10 microM). This population of receptors, to which opioate alkaloids and opiod peptides display very low affinity, is probably the sigma receptor. Another class of binding sites was identified by the simultaneous addition of the selective agonists Sandoz FK-33824 and D-Ala2-D-Leu5-enkephalin, which blocked the access of EKC to mu and delta opioid receptors, respectively, leaving a portionmore » of naloxone-displaceable benzomorphan binding still detectable. Analysis of this remaining binding revealed a small population of receptors of high affinity, the kappa receptor. Therefore, EKC binds to the mu, delta, kappa and sigma receptors in the mouse brain, with similar affinities for the mu and kappa (0.22 and 0.15 nM). These results confirm the existence of a kappa opioid receptor type in the mouse brain.« less

  20. Fibroblast growth factor regulates insulin-like growth factor-binding protein production by vascular smooth muscle cells.

    PubMed

    Ververis, J; Ku, L; Delafontaine, P

    1994-02-01

    Insulin-like growth factor I is an important mitogen for vascular smooth muscle cells, and its effects are regulated by several binding proteins. Western ligand blotting of conditioned medium from rat aortic smooth muscle cells detected a 24 kDa binding protein and a 28 kDa glycosylated variant of this protein, consistent with insulin-like growth factor binding protein-4 by size. Low amounts of a glycosylated 38 to 42 kDa doublet (consistent with binding protein-3) and a 31 kDa non-glycosylated protein also were present. Basic fibroblast growth factor markedly increased secretion of the 24 kDa binding protein and its 28 kDa glycosylated variant. This effect was dose- and time-dependent and was inhibited by co-incubation with cycloheximide. Crosslinking of [125I]-insulin-like growth factor I to cell monolayers revealed no surface-associated binding proteins, either basally or after agonist treatment. Induction of binding protein production by fibroblast growth factor at sites of vascular injury may be important in vascular proliferative responses in vivo.

  1. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  2. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  3. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  4. Structural analyses of von Willebrand factor C domains of collagen 2A and CCN3 reveal an alternative mode of binding to bone morphogenetic protein-2.

    PubMed

    Xu, Emma-Ruoqi; Blythe, Emily E; Fischer, Gerhard; Hyvönen, Marko

    2017-07-28

    Bone morphogenetic proteins (BMPs) are secreted growth factors that promote differentiation processes in embryogenesis and tissue development. Regulation of BMP signaling involves binding to a variety of extracellular proteins, among which are many von Willebrand factor C (vWC) domain-containing proteins. Although the crystal structure of the complex of crossveinless-2 (CV-2) vWC1 and BMP-2 previously revealed one mode of the vWC/BMP-binding mechanism, other vWC domains may bind to BMP differently. Here, using X-ray crystallography, we present for the first time structures of the vWC domains of two proteins thought to interact with BMP-2: collagen IIA and matricellular protein CCN3. We found that these two vWC domains share a similar N-terminal fold that differs greatly from that in CV-2 vWC, which comprises its BMP-2-binding site. We analyzed the ability of these vWC domains to directly bind to BMP-2 and detected an interaction only between the collagen IIa vWC and BMP-2. Guided by the collagen IIa vWC domain crystal structure and conservation of surface residues among orthologous domains, we mapped the BMP-binding epitope on the subdomain 1 of the vWC domain. This binding site is different from that previously observed in the complex between CV-2 vWC and BMP-2, revealing an alternative mode of interaction between vWC domains and BMPs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Binding of extracellular matrix proteins to Aspergillus fumigatus conidia.

    PubMed Central

    Gil, M L; Peñalver, M C; Lopez-Ribot, J L; O'Connor, J E; Martinez, J P

    1996-01-01

    As detected by confocal immunofluorescence microscopy, binding of fibronectin and laminin appeared to be associated with the protrusions present on the outer cell wall layer of resting Aspergillus fumigatus conidia. Flow cytometry confirmed that binding of laminin to conidia was dose dependent and saturable. Laminin binding was virtually eliminated in trypsin-treated organisms, thus suggesting the protein nature of the binding site. Conidia were also able to specifically adhere to laminin immobilized on microtiter plates. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting (immunoblotting) with laminin and antilaminin antibody of whole conidial homogenates allowed identification, among the complex array of protein and glycoprotein species, of one polypeptide with an apparent molecular mass of 37 kDa which specifically interacts with laminin. The fact that binding of conidia to soluble or immobilized laminin or fibronectin was inhibited by fibronectin or laminin, respectively, suggests the existence of common binding sites for both ligands on the surface of conidia. Intact conidia were also able to adhere to type I and IV collagen immobilized on microtiter plates; adhesion was found to be dose dependent and saturable. Adhesion to immobilized type I and IV collagen was markedly inhibited by laminin and weakly inhibited by fibronectin. Coincubation of conidia with Arg-Gly-Asp (RGD) peptides caused a dose-dependent decrease in binding of cells to immobilized or soluble fibronectin, yet interaction of cells with soluble or immobilized laminin and type I and IV collagen remained unaffected. Interactions described here could be important in mediating attachment of the fungus to host tissues, thus playing a role in the establishment of the disease. PMID:8945572

  6. Glycosaminoglycans are interactants of Langerin: comparison with gp120 highlights an unexpected calcium-independent binding mode.

    PubMed

    Chabrol, Eric; Nurisso, Alessandra; Daina, Antoine; Vassal-Stermann, Emilie; Thepaut, Michel; Girard, Eric; Vivès, Romain R; Fieschi, Franck

    2012-01-01

    Langerin is a C-type lectin specifically expressed in Langerhans cells. As recently shown for HIV, Langerin is thought to capture pathogens and mediate their internalisation into Birbeck Granules for elimination. However, the precise functions of Langerin remain elusive, mostly because of the lack of information on its binding properties and physiological ligands. Based on recent reports that Langerin binds to sulfated sugars, we conducted here a comparative analysis of Langerin interaction with mannose-rich HIV glycoprotein gp120 and glycosaminoglycan (GAGs), a family of sulfated polysaccharides expressed at the surface of most mammalian cells. Our results first revealed that Langerin bound to these different glycans through very distinct mechanisms and led to the identification of a novel, GAG-specific binding mode within Langerin. In contrast to the canonical lectin domain, this new binding site showed no Ca(2+)-dependency, and could only be detected in entire, trimeric extracellular domains of Langerin. Interestingly binding to GAGs, did not simply rely on a net charge effect, but rather on more discrete saccharide features, such as 6-O-sulfation, or iduronic acid content. Using molecular modelling simulations, we proposed a model of Langerin/heparin complex, which located the GAG binding site at the interface of two of the three Carbohydrate-recognition domains of the protein, at the edge of the a-helix coiled-coil. To our knowledge, the binding properties that we have highlighted here for Langerin, have never been reported for C-type lectins before. These findings provide new insights towards the understanding of Langerin biological functions.

  7. Cross-species analysis of Fc engineered anti-Lewis-Y human IgG1 variants in human neonatal receptor transgenic mice reveal importance of S254 and Y436 in binding human neonatal Fc receptor

    PubMed Central

    Burvenich, Ingrid J. G.; Farrugia, William; Lee, Fook T.; Catimel, Bruno; Liu, Zhanqi; Makris, Dahna; Cao, Diana; O'Keefe, Graeme J.; Brechbiel, Martin W.; King, Dylan; Spirkoska, Violeta; Allan, Laura C.; Ramsland, Paul A.; Scott, Andrew M.

    2016-01-01

    ABSTRACT IgG has a long half-life through engagement of its Fc region with the neonatal Fc receptor (FcRn). The FcRn binding site on IgG1 has been shown to contain I253 and H310 in the CH2 domain and H435 in the CH3 domain. Altering the half-life of IgG has been pursued with the aim to prolong or reduce the half-life of therapeutic IgGs. More recent studies have shown that IgGs bind differently to mouse and human FcRn. In this study we characterize a set of hu3S193 IgG1 variants with mutations in the FcRn binding site. A double mutation in the binding site is necessary to abrogate binding to murine FcRn, whereas a single mutation in the FcRn binding site is sufficient to no longer detect binding to human FcRn and create hu3S193 IgG1 variants with a half-life similar to previously studied hu3S193 F(ab')2 (t1/2β, I253A, 12.23 h; H310A, 12.94; H435A, 12.57; F(ab')2, 12.6 h). Alanine substitutions in S254 in the CH2 domain and Y436 in the CH3 domain showed reduced binding in vitro to human FcRn and reduced elimination half-lives in huFcRn transgenic mice (t1/2β, S254A, 37.43 h; Y436A, 39.53 h; wild-type, 83.15 h). These variants had minimal effect on half-life in BALB/c nu/nu mice (t1/2β, S254A, 119.9 h; Y436A, 162.1 h; wild-type, 163.1 h). These results provide insight into the interaction of human Fc by human FcRn, and are important for antibody-based therapeutics with optimal pharmacokinetics for payload strategies used in the clinic. PMID:27030023

  8. Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages

    NASA Astrophysics Data System (ADS)

    Djordjevic, Marko

    2005-11-01

    Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely resembles temperate phages, such as lambda. It, however, encodes its own T7-like RNA polymerase (characteristic of virulent phages), whose role in gene expression was unclear. Our analysis resulted in quantitative understanding of the role of both host and phage RNA polymerase, and in the identification of the previously unknown promoter sequence for Xp10 RNA polymerase. More generally, an increasing number of phage genomes are being sequenced every year, and we expect that methods of quantitative data analysis that we introduced will provide an efficient way to study gene expression strategies of novel bacterial viruses.

  9. A small-molecule-linked DNA-graphene oxide-based fluorescence-sensing system for detection of biotin.

    PubMed

    Zhang, Hao; Li, Yan; Su, Xingguang

    2013-11-15

    In this paper, we establish a novel fluorescence-sensing system for the detection of biotin based on the interaction between DNA and graphene oxide and on protection of the terminal of the biotinylated single-stranded DNA fluorescent probe by streptavidin. In this system, streptavidin binds to the biotinylated DNA, which protects the DNA from hydrolysis by exonuclease I. The streptavidin-DNA conjugate is then adsorbed to the graphene oxide resulting in the fluorescence being quenched. Upon the addition of free biotin, it competes with the labeled biotin for the binding sites of streptavidin and then the exonuclease I digests the unbound DNA probe from the 3' to the 5' terminal, releasing the fluorophore from the DNA. Because of the weak affinity between the fluorophore and graphene oxide, the fluorescence is recovered. Under optimal conditions, the fluorescence intensity is proportional to the concentration of biotin in the concentration range of 0.5-20nmol/L. The detection limit for biotin is 0.44nmol/L. The proposed fluorescence-sensing system was applied to the determination of biotin in some real samples with satisfactory reproducibility and accuracy. This work could provide a common platform for detecting small biomolecules based on protein-small molecule ligand binding. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  11. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  12. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  13. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  14. Biotin-Streptavidin Competition Mediates Sensitive Detection of Biomolecules in Enzyme Linked Immunosorbent Assay.

    PubMed

    Lakshmipriya, Thangavel; Gopinath, Subash C B; Tang, Thean-Hock

    2016-01-01

    Enzyme Linked Immunosorbent Assay (ELISA) is the gold standard assay for detecting and identifying biomolecules using antibodies as the probe. Improving ELISA is crucial for detecting disease-causing agents and facilitating diagnosis at the early stages of disease. Biotinylated antibody and streptavidin-conjugated horse radish peroxide (streptavidin-HRP) often are used with ELISA to enhance the detection of various kinds of targets. In the present study, we used a competition-based strategy in which we pre-mixed free biotin with streptavidin-HRP to generate high-performance system, as free biotin occupies some of the biotin binding sites on streptavidin, thereby providing more chances for streptavidin-HRP to bind with biotinylated antibody. ESAT-6, which is a protein secreted early during tuberculosis infection, was used as the model target. We found that 8 fM of free biotin mixed with streptavidin-HRP anchored the higher detection level of ESAT-6 by four-fold compared with detection without free biotin (only streptavidin-HRP), and the limit of detection of the new method was 250 pM. These results suggest that biotin-streptavidin competition can be used to improve the diagnosis of analytes in other types of sensors.

  15. Biotin-Streptavidin Competition Mediates Sensitive Detection of Biomolecules in Enzyme Linked Immunosorbent Assay

    PubMed Central

    Lakshmipriya, Thangavel; Gopinath, Subash C. B.; Tang, Thean-Hock

    2016-01-01

    Enzyme Linked Immunosorbent Assay (ELISA) is the gold standard assay for detecting and identifying biomolecules using antibodies as the probe. Improving ELISA is crucial for detecting disease-causing agents and facilitating diagnosis at the early stages of disease. Biotinylated antibody and streptavidin-conjugated horse radish peroxide (streptavidin-HRP) often are used with ELISA to enhance the detection of various kinds of targets. In the present study, we used a competition-based strategy in which we pre-mixed free biotin with streptavidin-HRP to generate high-performance system, as free biotin occupies some of the biotin binding sites on streptavidin, thereby providing more chances for streptavidin-HRP to bind with biotinylated antibody. ESAT-6, which is a protein secreted early during tuberculosis infection, was used as the model target. We found that 8 fM of free biotin mixed with streptavidin-HRP anchored the higher detection level of ESAT-6 by four-fold compared with detection without free biotin (only streptavidin-HRP), and the limit of detection of the new method was 250 pM. These results suggest that biotin-streptavidin competition can be used to improve the diagnosis of analytes in other types of sensors. PMID:26954237

  16. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  17. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  18. Bisphenol A Sensors on Polyimide Fabricated by Laser Direct Writing for Onsite River Water Monitoring at Attomolar Concentration.

    PubMed

    Cheng, Cheng; Wang, Shutong; Wu, Jayne; Yu, Yongchao; Li, Ruozhou; Eda, Shigetoshi; Chen, Jiangang; Feng, Guoying; Lawrie, Benjamin; Hu, Anming

    2016-07-20

    This work presents an aptamer-based, highly sensitive and specific sensor for atto- to femtomolar level detection of bisphenol A (BPA). Because of its widespread use in numerous products, BPA enters surface water from effluent discharges during its manufacture, use, and from waste landfill sites throughout the world. On-site measurement of BPA concentrations in water is important for evaluating compliance with water quality standards or environmental risk levels of the harmful compound in the environment. The sensor in this work is porous, conducting, interdigitated electrodes that are formed by laser-induced carbonization of flexible polyimide sheets. BPA-specific aptamer is immobilized on the electrodes as the probe, and its binding with BPA at the electrode surface is detected by capacitive sensing. The binding process is aided by ac electroosmotic effect that accelerates the transport of BPA molecules to the nanoporous graphene-like structured electrodes. The sensor achieved a limit of detection of 58.28 aM with a response time of 20 s. The sensor is further applied for recovery analysis of BPA spiked in surface water. This work provides an affordable platform for highly sensitive, real time, and field-deployable BPA surveillance critical to the evaluation of the ecological impact of BPA exposure.

  19. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  20. Anti-DNA antibodies--quintessential biomarkers of SLE.

    PubMed

    Pisetsky, David S

    2016-02-01

    Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.

  1. Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site.

    PubMed

    Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R

    2008-05-01

    Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.

  2. An isoleucine to leucine mutation that switches the cofactor requirement of the EcoRV restriction endonuclease from magnesium to manganese.

    PubMed

    Vipond, I B; Moon, B J; Halford, S E

    1996-02-13

    The EcoRV restriction endonuclease cleaves DNA at its recognition sequence more readily with Mg2+ as the cofactor than with Mn2+ but, at noncognate sequences that differ from the EcoRV site by one base pair, Mn2+ gives higher rates than Mg2+. A mutant of EcoRV, in which an isoleucine near the active site was replaced by leucine, showed the opposite behavior. It had low activity with Mg2+, but, in the presence of Mn2+ ions, it cleaved the recognition site faster than wild-type EcoRV with either Mn2+ or Mg2+. The mutant was also more specific for the recognition sequence than the native enzyme: the noncognate DNA cleavages by wild-type EcoRV and Mn2+ were not detected with the mutant. Further mutagenesis showed that the protein required the same acidic residues at its active site as wild-type EcoRV. The Ile-->Leu mutation seems to perturb the configuration of the metal-binding ligands at the active site so that the protein has virtually no affinity for Mg2+ yet it can still bind Mn2+ ions, though the latter only occurs when the protein is at the recognition site. This contrasts to wild-type EcoRV, where Mn2+ ions bind readily to complexes with either cognate and noncognate DNA and only Mg2+ shows the discrimination between the complexes. The structural perturbation is a specific consequence of leucine in place of isoleucine, since mutants with valine or alanine were similar to wild-type EcoRV.

  3. Evolution of New cis-Regulatory Motifs Required for Cell-Specific Gene Expression in Caenorhabditis

    PubMed Central

    Félix, Marie-Anne

    2016-01-01

    Patterning of C. elegans vulval cell fates relies on inductive signaling. In this induction event, a single cell, the gonadal anchor cell, secretes LIN-3/EGF and induces three out of six competent precursor cells to acquire a vulval fate. We previously showed that this developmental system is robust to a four-fold variation in lin-3/EGF genetic dose. Here using single-molecule FISH, we find that the mean level of expression of lin-3 in the anchor cell is remarkably conserved. No change in lin-3 expression level could be detected among C. elegans wild isolates and only a low level of change—less than 30%—in the Caenorhabditis genus and in Oscheius tipulae. In C. elegans, lin-3 expression in the anchor cell is known to require three transcription factor binding sites, specifically two E-boxes and a nuclear-hormone-receptor (NHR) binding site. Mutation of any of these three elements in C. elegans results in a dramatic decrease in lin-3 expression. Yet only a single E-box is found in the Drosophilae supergroup of Caenorhabditis species, including C. angaria, while the NHR-binding site likely only evolved at the base of the Elegans group. We find that a transgene from C. angaria bearing a single E-box is sufficient for normal expression in C. elegans. Even a short 58 bp cis-regulatory fragment from C. angaria with this single E-box is able to replace the three transcription factor binding sites at the endogenous C. elegans lin-3 locus, resulting in the wild-type expression level. Thus, regulatory evolution occurring in cis within a 58 bp lin-3 fragment, results in a strict requirement for the NHR binding site and a second E-box in C. elegans. This single-cell, single-molecule, quantitative and functional evo-devo study demonstrates that conserved expression levels can hide extensive change in cis-regulatory site requirements and highlights the evolution of new cis-regulatory elements required for cell-specific gene expression. PMID:27588814

  4. Directing an artificial zinc finger protein to new targets by fusion to a non-DNA-binding domain.

    PubMed

    Lim, Wooi F; Burdach, Jon; Funnell, Alister P W; Pearson, Richard C M; Quinlan, Kate G R; Crossley, Merlin

    2016-04-20

    Transcription factors are often regarded as having two separable components: a DNA-binding domain (DBD) and a functional domain (FD), with the DBD thought to determine target gene recognition. While this holds true for DNA bindingin vitro, it appears thatin vivoFDs can also influence genomic targeting. We fused the FD from the well-characterized transcription factor Krüppel-like Factor 3 (KLF3) to an artificial zinc finger (AZF) protein originally designed to target the Vascular Endothelial Growth Factor-A (VEGF-A) gene promoter. We compared genome-wide occupancy of the KLF3FD-AZF fusion to that observed with AZF. AZF bound to theVEGF-Apromoter as predicted, but was also found to occupy approximately 25,000 other sites, a large number of which contained the expected AZF recognition sequence, GCTGGGGGC. Interestingly, addition of the KLF3 FD re-distributes the fusion protein to new sites, with total DNA occupancy detected at around 50,000 sites. A portion of these sites correspond to known KLF3-bound regions, while others contained sequences similar but not identical to the expected AZF recognition sequence. These results show that FDs can influence and may be useful in directing AZF DNA-binding proteins to specific targets and provide insights into how natural transcription factors operate. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  6. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  7. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  8. Nanobody Binding to a Conserved Epitope Promotes Norovirus Particle Disassembly

    PubMed Central

    Koromyslova, Anna D.

    2014-01-01

    ABSTRACT Human noroviruses are icosahedral single-stranded RNA viruses. The capsid protein is divided into shell (S) and protruding (P) domains, which are connected by a flexible hinge region. There are numerous genetically and antigenically distinct noroviruses, and the dominant strains evolve every other year. Vaccine and antiviral development is hampered by the difficulties in growing human norovirus in cell culture and the continually evolving strains. Here, we show the X-ray crystal structures of human norovirus P domains in complex with two different nanobodies. One nanobody, Nano-85, was broadly reactive, while the other, Nano-25, was strain specific. We showed that both nanobodies bound to the lower region on the P domain and had nanomolar affinities. The Nano-85 binding site mainly comprised highly conserved amino acids among the genetically distinct genogroup II noroviruses. Several of the conserved residues also were recognized by a broadly reactive monoclonal antibody, which suggested this region contained a dominant epitope. Superposition of the P domain nanobody complex structures into a cryoelectron microscopy particle structure revealed that both nanobodies bound at occluded sites on the particles. The flexible hinge region, which contained ∼10 to 12 amino acids, likely permitted a certain degree of P domain movement on the particles in order to accommodate the nanobodies. Interestingly, the Nano-85 binding interaction with intact particles caused the particles to disassemble in vitro. Altogether, these results suggested that the highly conserved Nano-85 binding epitope contained a trigger mechanism for particle disassembly. Principally, this epitope represents a potential site of norovirus vulnerability. IMPORTANCE We characterized two different nanobodies (Nano-85 and Nano-25) that bind to human noroviruses. Both nanobodies bound with high affinities to the lower region of the P domain, which was occluded on intact particles. Nano-25 was specific for GII.10, whereas Nano-85 bound several different GII genotypes, including GII.4, GII.10, and GII.12. We showed that Nano-85 was able to detect norovirus virions in clinical stool specimens using a sandwich enzyme-linked immunosorbent assay. Importantly, we found that Nano-85 binding to intact particles caused the particles to disassemble. We believe that with further testing, Nano-85 not only will work as a diagnostic reagent in norovirus detection systems but also could function as a broadly reactive GII norovirus antiviral. PMID:25520510

  9. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  10. Fluorescent Receptor Binding Assay for Detecting Ciguatoxins in Fish

    PubMed Central

    Hardison, D. Ransom; Holland, William C.; McCall, Jennifer R.; Bourdelais, Andrea J.; Baden, Daniel G.; Darius, H. Taiana; Chinain, Mireille; Tester, Patricia A.; Shea, Damian; Flores Quintana, Harold A.; Morris, James A.; Litaker, R. Wayne

    2016-01-01

    Ciguatera fish poisoning is an illness suffered by > 50,000 people yearly after consumption of fish containing ciguatoxins (CTXs). One of the current methodologies to detect ciguatoxins in fish is a radiolabeled receptor binding assay (RBA(R)). However, the license requirements and regulations pertaining to radioisotope utilization can limit the applicability of the RBA(R) in certain labs. A fluorescence based receptor binding assay (RBA(F)) was developed to provide an alternative method of screening fish samples for CTXs in facilities not certified to use radioisotopes. The new assay is based on competition binding between CTXs and fluorescently labeled brevetoxin-2 (BODIPY®- PbTx-2) for voltage-gated sodium channel receptors at site 5 instead of a radiolabeled brevetoxin. Responses were linear in fish tissues spiked from 0.1 to 1.0 ppb with Pacific ciguatoxin-3C (P-CTX-3C) with a detection limit of 0.075 ppb. Carribean ciguatoxins were confirmed in Caribbean fish by LC-MS/MS analysis of the regional biomarker (C-CTX-1). Fish (N = 61) of six different species were screened using the RBA(F). Results for corresponding samples analyzed using the neuroblastoma cell-based assay (CBA-N2a) correlated well (R2 = 0.71) with those of the RBA(F), given the low levels of CTX present in positive fish. Data analyses also showed the resulting toxicity levels of P-CTX-3C equivalents determined by CBA-N2a were consistently lower than the RBA(F) affinities expressed as % binding equivalents, indicating that a given amount of toxin bound to the site 5 receptors translates into corresponding lower cytotoxicity. Consequently, the RBA(F), which takes approximately two hours to perform, provides a generous estimate relative to the widely used CBA-N2a which requires 2.5 days to complete. Other RBA(F) advantages include the long-term (> 5 years) stability of the BODIPY®- PbTx-2 and having similar results as the commonly used RBA(R). The RBA(F) is cost-effective, allows high sample throughput, and is well-suited for routine CTX monitoring programs. PMID:27073998

  11. GRID-seq reveals the global RNA-chromatin interactome

    PubMed Central

    Li, Xiao; Zhou, Bing; Chen, Liang; Gou, Lan-Tao; Li, Hairi; Fu, Xiang-Dong

    2017-01-01

    Higher eukaryotic genomes are bound by a large number of coding and non-coding RNAs, but approaches to comprehensively map the identity and binding sites of these RNAs are lacking. Here we report a method to in situ capture global RNA interactions with DNA by deep sequencing (GRID-seq), which enables the comprehensive identification of the entire repertoire of chromatin-interacting RNAs and their respective binding sites. In human, mouse and Drosophila cells, we detected a large set of tissue-specific coding and non-coding RNAs that are bound to active promoters and enhancers, especially super-enhancers. Assuming that most mRNA-chromatin interactions indicate the physical proximity of a promoter and an enhancer, we constructed a three-dimensional global connectivity map of promoters and enhancers, revealing transcription activity-linked genomic interactions in the nucleus. PMID:28922346

  12. Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

    PubMed Central

    Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

    2003-01-01

    The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

  13. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  14. Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marrot, L.; Leng, M.

    The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less

  15. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  16. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  17. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  19. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  20. Fungal effector Ecp6 outcompetes host immune receptor for chitin binding through intrachain LysM dimerization

    PubMed Central

    Kombrink, Anja; Hansen, Guido; Valkenburg, Dirk-Jan

    2013-01-01

    While host immune receptors detect pathogen-associated molecular patterns to activate immunity, pathogens attempt to deregulate host immunity through secreted effectors. Fungi employ LysM effectors to prevent recognition of cell wall-derived chitin by host immune receptors, although the mechanism to compete for chitin binding remained unclear. Structural analysis of the LysM effector Ecp6 of the fungal tomato pathogen Cladosporium fulvum reveals a novel mechanism for chitin binding, mediated by intrachain LysM dimerization, leading to a chitin-binding groove that is deeply buried in the effector protein. This composite binding site involves two of the three LysMs of Ecp6 and mediates chitin binding with ultra-high (pM) affinity. Intriguingly, the remaining singular LysM domain of Ecp6 binds chitin with low micromolar affinity but can nevertheless still perturb chitin-triggered immunity. Conceivably, the perturbation by this LysM domain is not established through chitin sequestration but possibly through interference with the host immune receptor complex. DOI: http://dx.doi.org/10.7554/eLife.00790.001 PMID:23840930

  1. ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    PubMed Central

    He, Qiye; Johnston, Jeff; Zeitlinger, Julia

    2014-01-01

    Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

  2. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  3. Polypyrimidine tract binding protein 1 protects mRNAs from recognition by the nonsense-mediated mRNA decay pathway

    PubMed Central

    Ge, Zhiyun; Quek, Bao Lin; Beemon, Karen L; Hogg, J Robert

    2016-01-01

    The nonsense-mediated mRNA decay (NMD) pathway degrades mRNAs containing long 3'UTRs to perform dual roles in mRNA quality control and gene expression regulation. However, expansion of vertebrate 3'UTR functions has required a physical expansion of 3'UTR lengths, complicating the process of detecting nonsense mutations. We show that the polypyrimidine tract binding protein 1 (PTBP1) shields specific retroviral and cellular transcripts from NMD. When bound near a stop codon, PTBP1 blocks the NMD protein UPF1 from binding 3'UTRs. PTBP1 can thus mark specific stop codons as genuine, preserving both the ability of NMD to accurately detect aberrant mRNAs and the capacity of long 3'UTRs to regulate gene expression. Illustrating the wide scope of this mechanism, we use RNA-seq and transcriptome-wide analysis of PTBP1 binding sites to show that many human mRNAs are protected by PTBP1 and that PTBP1 enrichment near stop codons correlates with 3'UTR length and resistance to NMD. DOI: http://dx.doi.org/10.7554/eLife.11155.001 PMID:26744779

  4. An Arabidopsis lipid flippase is required for timely recruitment of defenses to the host-pathogen interface at the plant cell surface

    USDA-ARS?s Scientific Manuscript database

    Deposition of cell wall-reinforcing papillae is an integral component of the plant immune response. The Arabidopsis PENETRATION 3 (PEN3) ATP binding cassette (ABC) transporter plays a role in defense against numerous pathogens and is recruited to sites of pathogen detection where it accumulates with...

  5. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  6. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  8. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  10. Identification of the Regulon of AphB and Its Essential Roles in LuxR and Exotoxin Asp Expression in the Pathogen Vibrio alginolyticus.

    PubMed

    Gao, Xiating; Liu, Yang; Liu, Huan; Yang, Zhen; Liu, Qin; Zhang, Yuanxing; Wang, Qiyao

    2017-10-15

    In Vibrio species, AphB is essential to activate virulence cascades by sensing low-pH and anaerobiosis signals; however, its regulon remains largely unknown. Here, AphB is found to be a key virulence regulator in Vibrio alginolyticus , a pathogen for marine animals and humans. Chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq) enabled the detection of 20 loci in the V. alginolyticus genome that contained AphB-binding peaks. An AphB-specific binding consensus was confirmed by electrophoretic mobility shift assays (EMSAs), and the regulation of genes flanking such binding sites was demonstrated using quantitative real-time PCR analysis. AphB binds directly to its own promoter and positively controls its own expression in later growth stages. AphB also activates the expression of the exotoxin Asp by binding directly to the promoter regions of asp and the master quorum-sensing (QS) regulator luxR DNase I footprinting analysis uncovered distinct AphB-binding sites (BBS) in these promoters. Furthermore, a BBS in the luxR promoter region overlaps that of LuxR-binding site I, which mediates the positive control of luxR promoter activity by AphB. This study provides new insights into the AphB regulon and reveals the mechanisms underlying AphB regulation of physiological adaptation and QS-controlled virulence in V. alginolyticus IMPORTANCE In this work, AphB is determined to play essential roles in the expression of genes associated with QS, physiology, and virulence in V. alginolyticus , a pathogen for marine animals and humans. AphB was found to bind directly to 20 genes and control their expression by a 17-bp consensus binding sequence. Among the 20 genes, the aphB gene itself was identified to be positively autoregulated, and AphB also positively controlled asp and luxR expression. Taken together, these findings improve our understanding of the roles of AphB in controlling physiological adaptation and QS-controlled virulence gene expression. Copyright © 2017 American Society for Microbiology.

  11. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  12. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  13. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  14. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  15. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  16. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  17. Cardiac distribution of the binding sites for natriuretic peptides in vertebrates.

    PubMed

    Cerra, M C

    1994-12-01

    Natriuretic peptides are hormones that play an important role in the cardiovascular control of mammalian and non-mammalian vertebrates. They have been classified into four groups. Of these, ANP (atrial natriuretic peptide), BNP (brain atriuretic peptides), CNP (C-type natriuretic peptide) are detected in cardiac and non cardiac tissues of all vertebrates; while VNP (ventricular natriuretic peptide) has been isolated only from the fish ventricle. All peptides have shown a high degree of sequence homology. The expression of the three principal types of natriuretic peptide (ANP, BNP and CNP) in cardiac tissues is developmentally and functionally regulated in a highly tissue-specific manner. Three types of natriuretic peptide receptors have been identified in numerous target tissues. Two receptors are transmembrane guanylyl cyclases (ANPR-A and ANPR-B) that mediate biological effects of natriuretic peptides; the third one (ANPR-C) has no guanylyl cyclase and is called "clearance receptor." The presence of natriuretic peptide binding sites in the heart suggests new aspects of paracrine control of cardiac function. A relevant localization of natriuretic peptide receptors was found in those cardiac regions particularly suitable for monitoring blood volume and pressure oscillations such as the inflow tract and the outflow tract. For example, in birds (quail) the highest levels of natriuretic peptide receptors were detected in the inflow tract represented by the vena cava. In both fish and birds, the outflow chamber, the bulbus cordis, had a high number of natriuretic peptide binding sites. In mammals, a remarkable concentration of natriuretic peptide receptors was also observed in the coronary vessels. This zoning of cardiac natriuretic peptide receptors indicates an intracardiac action of the hormones and adds a humoral dimension to the morphofunctional design of the vertebrate heart.

  18. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  19. Binding of the host-specific toxins from Helminthosporium maydis race T and Phyllosticta maydis to mitochondria isolated from Zea mays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frantzen, K.A.

    1985-01-01

    Helminthosphorium maydis race I and Phyllosticta maydis, the causal agents of southern and yellow corn leaf blights, respectively, produce host-specific toxins. The toxic specificity of these natural products is identical to the host-specificity of the pathogens for certain varieties of corn. Susceptible genotypes carry the Texas type of cytoplasmic male sterility. Isolated mitochondria from susceptible plant species are highly sensitive to these toxins, whereas other plant species, including resistant corn varieties, and their mitochondria are not. The mitochondrion may be the primary cellular site of action for these toxins. The toxins from H. maydis and P. maydis were tritiated bymore » reduction with borotritide salts. The labeled products had a high specific activity (3.8 to 8 Ci/mmole), high biological activity, and specificity identical to that of the native toxins. A filtration binding assay was developed to investigate the binding characteristics of these labeled toxins to isolated mitochondria. Mitochondria isolated from both cytoplasmic male sterile (Texas) and normal corn demonstrated similar binding characteristics including ligand displaceable binding with both labeled toxins. Ligand displaceable binding was also detectable in mitochondria from soybeans, a nonhost plant for these fungi. The ability to displace the bound labeled toxins was generally correlated with the biological activity of the competing toxin. The results of this study suggest that a receptor site hypothesis for the mode of action of these toxins may not be valid.« less

  20. Identification of a Lacosamide Binding Protein Using an Affinity Bait and Chemical Reporter Strategy: 14-3-3 ζ

    PubMed Central

    Park, Ki Duk; Kim, Dong Wook; Reamtong, Onrapak; Eyers, Claire; Gaskell, Simon J.; Liu, Rihe; Kohn, Harold

    2011-01-01

    We have advanced a useful strategy to elucidate binding partners of ligands (drugs) with modest binding affinity. Key to this strategy is attaching to the ligand an affinity bait (AB) and a chemical reporter (CR) group, where the AB irreversibly attaches the ligand to the receptor upon binding and the CR group is employed for receptor detection and isolation. We have tested this AB&CR strategy using lacosamide ((R)-1), a low-molecular-weight antiepileptic drug. We demonstrate that using a (R)-lacosamide AB&CR agent ((R)-2) 14-3-3 ζ in rodent brain soluble lysates is preferentially adducted, adduction is stereospecific with respect to the AB&CR agent, and adduction depends upon the presence of endogenous levels of the small molecule metabolite xanthine. Substitution of lacosamide AB agent ((R)- 5) for (R)-2 led to the identification of the 14-3-3 ζ adduction site (K120) by mass spectrometry. Competition experiments using increasing amounts of (R)-1 in the presence of (R)-2 demonstrated that (R)-1 binds at or near the (R)-2 modification site on 14-3-3 ζ. Structure-activity studies of xanthine derivatives provided information concerning the likely binding interaction between this metabolite and recombinant 14-3-3 ζ. Documentation of the 14-3-3 ζ-xanthine interaction was obtained with isothermal calorimetry using xanthine and the xanthine analogue 1,7-dimethylxanthine. PMID:21692503

  1. Efficient one-cycle affinity selection of binding proteins or peptides specific for a small-molecule using a T7 phage display pool.

    PubMed

    Takakusagi, Yoichi; Kuramochi, Kouji; Takagi, Manami; Kusayanagi, Tomoe; Manita, Daisuke; Ozawa, Hiroko; Iwakiri, Kanako; Takakusagi, Kaori; Miyano, Yuka; Nakazaki, Atsuo; Kobayashi, Susumu; Sugawara, Fumio; Sakaguchi, Kengo

    2008-11-15

    Here, we report an efficient one-cycle affinity selection using a natural-protein or random-peptide T7 phage pool for identification of binding proteins or peptides specific for small-molecules. The screening procedure involved a cuvette type 27-MHz quartz-crystal microbalance (QCM) apparatus with introduction of self-assembled monolayer (SAM) for a specific small-molecule immobilization on the gold electrode surface of a sensor chip. Using this apparatus, we attempted an affinity selection of proteins or peptides against synthetic ligand for FK506-binding protein (SLF) or irinotecan (Iri, CPT-11). An affinity selection using SLF-SAM and a natural-protein T7 phage pool successfully detected FK506-binding protein 12 (FKBP12)-displaying T7 phage after an interaction time of only 10 min. Extensive exploration of time-consuming wash and/or elution conditions together with several rounds of selection was not required. Furthermore, in the selection using a 15-mer random-peptide T7 phage pool and subsequent analysis utilizing receptor ligand contact (RELIC) software, a subset of SLF-selected peptides clearly pinpointed several amino-acid residues within the binding site of FKBP12. Likewise, a subset of Iri-selected peptides pinpointed part of the positive amino-acid region of residues from the Iri-binding site of the well-known direct targets, acetylcholinesterase (AChE) and carboxylesterase (CE). Our findings demonstrate the effectiveness of this method and general applicability for a wide range of small-molecules.

  2. Concentration Gradient Immunoassay I. A Rapid Immunoassay Based on Interdiffusion and Surface Binding in a Microchannel

    PubMed Central

    Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul

    2008-01-01

    We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332

  3. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  4. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  5. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  6. Biophysical influence of isocarbophos on bovine serum albumin: Spectroscopic probing

    NASA Astrophysics Data System (ADS)

    Zhang, Hua-xin; Zhou, Ying; Liu, E.

    Isocarbophos (ICP) is a phosphorous pesticide with high toxicity. It has been detected in several kinds of food and therefore can enter human body. In this paper, spectroscopic approaches including three-dimensional fluorescence (3D-FL) spectroscopy, UV-visible absorption spectroscopy and circular dichroism (CD) spectroscopy were employed to explore the binding of ICP to bovine serum albumin (BSA) at simulated physiological conditions. It was found that the fluorescence quenching of BSA was caused by the formation of ICP-BSA complex at ground state and belonged to static quenching mechanism. The binding constants, the number of binding sites, enthalpy change (ΔHθ), Gibbs free energy change (ΔGθ) and entropy change (ΔSθ) were calculated at four different temperatures according to Scatchard model and thermodynamic equations. To identify the binding location, fluorescence probe techniques were used. The results showed that warfarin, an acknowledged site marker for BSA, could be partially replaced by ICP when ICP was added to warfarin-BSA systems, which demonstrated that ICP primarily bound on Sudlow's site I in domain IIA of BSA molecule. The distance r (3.06 nm) between donor (Trp-212) and acceptor (ICP) was obtained based on Förster's non-radiation fluorescence resonance energy transfer (FRET) theory. Furthermore, the CD spectral results indicated that the secondary structure of BSA was changed in presence of ICP. The study is helpful to evaluating the toxicology of ICP and understanding its effects on the function of protein during the blood transportation process.

  7. Induction of Cyclooxygenase-2 Expression by Hepatitis B Virus Depends on Demethylation-associated Recruitment of Transcription Factors to the Promoter

    PubMed Central

    2011-01-01

    Background The hepatitis B virus (HBV) is a major etiological factor of inflammation and damage to the liver resulting in hepatocellular carcinoma. Transcription factors play important roles in the disordered gene expression and liver injury caused by HBV. However, the molecular mechanisms behind this observation have not been defined. Results In this study, we observed that circulating prostaglandin (PGE) 2 synthesis was increased in patients with chronic hepatitis B infection, and detected elevated cyclooxygenase (COX)-2 expression in HBV- and HBx-expressing liver cells. Likewise, the association of HBx with C/EBPβ contributed to the induction of COX-2. The COX-2 promoter was hypomethylated in HBV-positive cells, and specific demethylation of CpG dinucleotides within each of the two NF-AT sites in the COX-2 promoter resulted in the increased binding affinity of NF-AT to the cognate sites in the promoter, followed by increased COX-2 expression and PGE2 accumulation. The DNA methylatransferase DNMT3B played a key role in the methylation of the COX-2 promoter, and its decreased binding to the promoter was responsible for the regional demethylation of CpG sites, and for the increased binding of transcription factors in HBV-positive cells. Conclusion Our results indicate that upregulation of COX-2 by HBV and HBx is mediated by both demethylation events and recruitment of multiple transcription factors binding to the promoter. PMID:21401943

  8. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    PubMed

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  9. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  10. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  11. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  12. Structure of a small-molecule inhibitor complexed with GlmU from Haemophilus influenzae reveals an allosteric binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mochalkin, Igor; Lightle, Sandra; Narasimhan, Lakshmi

    2008-04-02

    N-Acetylglucosamine-1-phosphate uridyltransferase (GlmU) is an essential enzyme in aminosugars metabolism and an attractive target for antibiotic drug discovery. GlmU catalyzes the formation of uridine-diphospho-N-acetylglucosamine (UDP-GlcNAc), an important precursor in the peptidoglycan and lipopolisaccharide biosynthesis in both Gram-negative and Gram-positive bacteria. Here we disclose a 1.9 {angstrom} resolution crystal structure of a synthetic small-molecule inhibitor of GlmU from Haemophilus influenzae (hiGlmU). The compound was identified through a high-throughput screening (HTS) configured to detect inhibitors that target the uridyltransferase active site of hiGlmU. The original HTS hit exhibited a modest micromolar potency (IC{sub 50} - 18 {mu}M in a racemic mixture) againstmore » hiGlmU and no activity against Staphylococcus aureus GlmU (saGlmU). The determined crystal structure indicated that the inhibitor occupies an allosteric site adjacent to the GlcNAc-1-P substrate-binding region. Analysis of the mechanistic model of the uridyltransferase reaction suggests that the binding of this allosteric inhibitor prevents structural rearrangements that are required for the enzymatic reaction, thus providing a basis for structure-guided design of a new class of mechanism-based inhibitors of GlmU.« less

  13. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  14. Interaction of CSFV E2 Protein with Swine Host Factors as Detected by Yeast Two-Hybrid System

    PubMed Central

    Gladue, Douglas P.; Baker-Bransetter, Ryan; Holinka, Lauren G.; Fernandez-Sainz, Ignacio J.; O’Donnell, Vivian; Fletcher, Paige; Lu, Zhiqiang; Borca, Manuel V.

    2014-01-01

    E2 is one of the envelope glycoproteins of pestiviruses, including classical swine fever virus (CSFV) and bovine viral diarrhea virus (BVDV). E2 is involved in several critical functions, including virus entry into target cells, induction of a protective immune response and virulence in swine. However, there is no information regarding any host binding partners for the E2 proteins. Here, we utilized the yeast two-hybrid system and identified fifty-seven host proteins as positive binding partners which bound E2 from both CSFV and BVDV with the exception of two proteins that were found to be positive for binding only to CSFV E2. Alanine scanning of CSFV E2 demonstrated that the binding sites for these cellular proteins on E2 are likely non-linear binding sites. The possible roles of the identified host proteins are discussed as the results presented here will be important for future studies to elucidate mechanisms of host protein-virus interactions during pestivirus infection. However, due to the limitations of the yeast two hybrid system, the proteins identified is not exhaustive and each interaction identified needs to be confirmed by independent experimental approaches in the context of virus-infected cells before any definitive conclusion can be drawn on relevance for the virus life cycle. PMID:24416391

  15. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  16. Monovalent Strep-Tactin for strong and site-specific tethering in nanospectroscopy.

    PubMed

    Baumann, Fabian; Bauer, Magnus S; Milles, Lukas F; Alexandrovich, Alexander; Gaub, Hermann E; Pippig, Diana A

    2016-01-01

    Strep-Tactin, an engineered form of streptavidin, binds avidly to the genetically encoded peptide Strep-tag II in a manner comparable to streptavidin binding to biotin. These interactions have been used in protein purification and detection applications. However, in single-molecule studies, for example using atomic force microscopy-based single-molecule force spectroscopy (AFM-SMFS), the tetravalency of these systems impedes the measurement of monodispersed data. Here, we introduce a monovalent form of Strep-Tactin that harbours a unique binding site for Strep-tag II and a single cysteine that allows Strep-Tactin to specifically attach to the atomic force microscope cantilever and form a consistent pulling geometry to obtain homogeneous rupture data. Using AFM-SMFS, the mechanical properties of the interaction between Strep-tag II and monovalent Strep-Tactin were characterized. Rupture forces comparable to biotin:streptavidin unbinding were observed. Using titin kinase and green fluorescent protein, we show that monovalent Strep-Tactin is generally applicable to protein unfolding experiments. We expect monovalent Strep-Tactin to be a reliable anchoring tool for a range of single-molecule studies.

  17. Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

    PubMed Central

    Zheng, Zhaoqing; Keifer, Joyce

    2014-01-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

  18. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    PubMed

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  19. Monovalent Strep-Tactin for strong and site-specific tethering in nanospectroscopy

    NASA Astrophysics Data System (ADS)

    Baumann, Fabian; Bauer, Magnus S.; Milles, Lukas F.; Alexandrovich, Alexander; Gaub, Hermann E.; Pippig, Diana A.

    2016-01-01

    Strep-Tactin, an engineered form of streptavidin, binds avidly to the genetically encoded peptide Strep-tag II in a manner comparable to streptavidin binding to biotin. These interactions have been used in protein purification and detection applications. However, in single-molecule studies, for example using atomic force microscopy-based single-molecule force spectroscopy (AFM-SMFS), the tetravalency of these systems impedes the measurement of monodispersed data. Here, we introduce a monovalent form of Strep-Tactin that harbours a unique binding site for Strep-tag II and a single cysteine that allows Strep-Tactin to specifically attach to the atomic force microscope cantilever and form a consistent pulling geometry to obtain homogeneous rupture data. Using AFM-SMFS, the mechanical properties of the interaction between Strep-tag II and monovalent Strep-Tactin were characterized. Rupture forces comparable to biotin:streptavidin unbinding were observed. Using titin kinase and green fluorescent protein, we show that monovalent Strep-Tactin is generally applicable to protein unfolding experiments. We expect monovalent Strep-Tactin to be a reliable anchoring tool for a range of single-molecule studies.

  20. Inhibition of kinesin-driven microtubule motility by monoclonal antibodies to kinesin heavy chains

    PubMed Central

    1988-01-01

    We have prepared and characterized seven mouse monoclonal antibodies (SUK 1-7) to the 130-kD heavy chain of sea urchin egg kinesin. On immunoblots, SUK 3 and SUK 4 cross-reacted with Drosophila embryo 116- kD heavy chains, and SUK 4, SUK 5, SUK 6, and SUK 7 bound to the 120-kD heavy chains of bovine brain kinesin. Three out of seven monoclonal antikinesins (SUK 4, SUK 6, and SUK 7) caused a dose-dependent inhibition of sea urchin egg kinesin-induced microtubule translocation, whereas the other four monoclonal antibodies had no detectable effect on this motility. The inhibitory monoclonal antibodies (SUK 4, SUK 6, and SUK 7) appear to bind to spatially related sites on an ATP- sensitive microtubule binding 45-kD chymotryptic fragment of the 130-kD heavy chain, whereas SUK 2 binds to a spatially distinct site. None of the monoclonal antikinesins inhibited the microtubule activated MgATPase activity of kinesin, suggesting that SUK 4, SUK 6, and SUK 7 uncouple this MgATPase activity from motility. PMID:2974459

  1. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  2. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  3. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  4. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  5. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  6. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  7. Direct detection of formate ligation in cytochrome c oxidase by ATR-FTIR spectroscopy.

    PubMed

    Iwaki, Masayo; Rich, Peter R

    2004-03-03

    The IR signature of binding of formate to the heme a(3-)Cu(B) binuclear site of bovine cytochrome c oxidase has been obtained by perfusion ATR-FTIR spectroscopy. The data show unequivocally that formate binds in its anionic form despite its binding being electroneutral overall. The bound formate can be distinguished from free ligand by the binding-induced sharpening and downshifting of vibrational bands. Formate ligation also causes shifts of vibrational modes of heme a(3) and its substituents and perturbation of histidine residues. The association of the accompanying protonation change with a carboxylate or tyrosine can be ruled out and may involve a histidine metal ligand or, more likely, a simple displacement into the bulk phase of a hydroxide ligand to heme a(3) or CU(B), a reaction which would account for stoichiometric proton uptake and maintenance of net charge within the binuclear center domain.

  8. CCL2 binding is CCR2 independent in primary adult human astrocytes.

    PubMed

    Fouillet, A; Mawson, J; Suliman, O; Sharrack, B; Romero, I A; Woodroofe, M N

    2012-02-09

    Chemokines are low relative molecular mass proteins, which have chemoattractant actions on many cell types. The chemokine, CCL2, has been shown to play a major role in the recruitment of monocytes in central nervous system (CNS) lesions in multiple sclerosis (MS). Since resident astrocytes constitute a major source of chemokine synthesis including CCL2, we were interested to assess the regulation of CCL2 by astrocytes. We showed that CCL2 bound to the cell surface of astrocytes and binding was not modulated by inflammatory conditions. However, CCR2 protein was not detected nor was activation of the classical CCR2 downstream signaling pathways. Recent studies have shown that non-signaling decoy chemokine receptors bind and modulate the expression of chemokines at site of inflammation. Here, we show that the D6 chemokine decoy receptor is constitutively expressed by primary human adult astrocytes at both mRNA and protein level. In addition, CCL3, which binds to D6, but not CCL19, which does not bind to D6, displaced CCL2 binding to astrocytes; indicating that CCL2 may bind to this cell type via the D6 receptor. Our results suggest that CCL2 binding to primary adult human astrocytes is CCR2-independent and is likely to be mediated via the D6 decoy chemokine receptor. Therefore we propose that astrocytes are implicated in both the establishment of chemokine gradients for the migration of leukocytes into and within the CNS and in the regulation of CCL2 levels at inflammatory sites in the CNS. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Predicting Nonspecific Ion Binding Using DelPhi

    PubMed Central

    Petukh, Marharyta; Zhenirovskyy, Maxim; Li, Chuan; Li, Lin; Wang, Lin; Alexov, Emil

    2012-01-01

    Ions are an important component of the cell and affect the corresponding biological macromolecules either via direct binding or as a screening ion cloud. Although some ion binding is highly specific and frequently associated with the function of the macromolecule, other ions bind to the protein surface nonspecifically, presumably because the electrostatic attraction is strong enough to immobilize them. Here, we test such a scenario and demonstrate that experimentally identified surface-bound ions are located at a potential that facilitates binding, which indicates that the major driving force is the electrostatics. Without taking into consideration geometrical factors and structural fluctuations, we show that ions tend to be bound onto the protein surface at positions with strong potential but with polarity opposite to that of the ion. This observation is used to develop a method that uses a DelPhi-calculated potential map in conjunction with an in-house-developed clustering algorithm to predict nonspecific ion-binding sites. Although this approach distinguishes only the polarity of the ions, and not their chemical nature, it can predict nonspecific binding of positively or negatively charged ions with acceptable accuracy. One can use the predictions in the Poisson-Boltzmann approach by placing explicit ions in the predicted positions, which in turn will reduce the magnitude of the local potential and extend the limits of the Poisson-Boltzmann equation. In addition, one can use this approach to place the desired number of ions before conducting molecular-dynamics simulations to neutralize the net charge of the protein, because it was shown to perform better than standard screened Coulomb canned routines, or to predict ion-binding sites in proteins. This latter is especially true for proteins that are involved in ion transport, because such ions are loosely bound and very difficult to detect experimentally. PMID:22735539

  10. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  11. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  12. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  13. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  14. Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

    PubMed Central

    Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

    2016-01-01

    Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

  15. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  16. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  17. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  18. Discovering transcription factor binding sites in highly repetitive regions of genomes with multi-read analysis of ChIP-Seq data.

    PubMed

    Chung, Dongjun; Kuan, Pei Fen; Li, Bo; Sanalkumar, Rajendran; Liang, Kun; Bresnick, Emery H; Dewey, Colin; Keleş, Sündüz

    2011-07-01

    Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) is rapidly replacing chromatin immunoprecipitation combined with genome-wide tiling array analysis (ChIP-chip) as the preferred approach for mapping transcription-factor binding sites and chromatin modifications. The state of the art for analyzing ChIP-seq data relies on using only reads that map uniquely to a relevant reference genome (uni-reads). This can lead to the omission of up to 30% of alignable reads. We describe a general approach for utilizing reads that map to multiple locations on the reference genome (multi-reads). Our approach is based on allocating multi-reads as fractional counts using a weighted alignment scheme. Using human STAT1 and mouse GATA1 ChIP-seq datasets, we illustrate that incorporation of multi-reads significantly increases sequencing depths, leads to detection of novel peaks that are not otherwise identifiable with uni-reads, and improves detection of peaks in mappable regions. We investigate various genome-wide characteristics of peaks detected only by utilization of multi-reads via computational experiments. Overall, peaks from multi-read analysis have similar characteristics to peaks that are identified by uni-reads except that the majority of them reside in segmental duplications. We further validate a number of GATA1 multi-read only peaks by independent quantitative real-time ChIP analysis and identify novel target genes of GATA1. These computational and experimental results establish that multi-reads can be of critical importance for studying transcription factor binding in highly repetitive regions of genomes with ChIP-seq experiments.

  19. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  20. Transforming growth factor (TGF. beta. ) decreases the proliferation of human bone marrow fibroblasts by inhibiting the platelet-derived growth factor (PDGF) binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bryckaert, M.C.; Tobelem, G.; Lindroth, M.

    1988-12-01

    Human bone marrow fibroblasts were cultivated and characterized by immunofluorescent staining and electron microscopy. Their interactions with PDGF and TGF{beta} were studied. While a positive intracellular antifibronectin staining was observed, the cultured cells were not labeled with specific antibodies toward factor VIII von Willebrand factor (F VIII/vWF), desmin, and macrophage antigen. The binding of pure human PDGF to the cultured bone marrow fibroblasts was investigated. Addition of an excess of unlabeled PDGF decreased the binding to 75 and 80%, which means that the nonspecific binding represented 20-25% of total binding, whereas epidermal growth factor (EGF) had no effect. Two classesmore » of sites were detected by Scatchard analysis. The stimulation of DNA synthesis of PDGF was quantified by ({sup 3}H)thymidine incorporation. The results suggested that PDGF and TGF{beta} could modulate the growth of bone marrow fibroblasts.« less

  1. Down-regulation of pituitary receptors for luteinizing hormone-releasing hormone (LH-RH) in rats by LH-RH antagonist Cetrorelix.

    PubMed Central

    Halmos, G; Schally, A V; Pinski, J; Vadillo-Buenfil, M; Groot, K

    1996-01-01

    Antagonists of luteinizing hormone-releasing hormone (LH-RH), unlike the LH-RH agonists, suppress gonadotropins and sex steroid secretion immediately after administration, without initial stimulatory effects. [Ac-D-Nal(2)1,D-Ph(4Cl)2,D-Pal(3)3,D-Cit6,D-Ala10]LH-R H (SB-75; Cetrorelix) is a modern, potent antagonistic analog of LH-RH. In this study, the binding characteristics of receptors for LH-RH in membrane fractions from rat anterior pituitaries were investigated after a single injection of Cetrorelix at a dose of 100 microg per rat. To determine whether the treatment with Cetrorelix can affect the concentration of measurable LH-RH binding sites, we applied an in vitro method to desaturate LH-RH receptors by chaotropic agents such as manganous chloride (MnCl2) and ammonium thiocyanate (NH4SCN). Our results show that the percentages of occupied LH-RH receptors at 1, 3, and 6 h after administration of Cetrorelix were approximately 28%, 14%, and 10%, respectively, of total receptors. At later time intervals, we could not detect occupied LH-RH binding sites. Ligand competition assays, following in vitro desaturation, demonstrated that rat pituitary LH-RH receptors were significantly (P < 0.01) down-regulated for at least 72 h after administration of Cetrorelix. The lowest receptor concentration was found 3-6 h after Cetrorelix treatment and a recovery in receptor number began within approximately 24 h. The down-regulation of LH-RH binding sites induced by Cetrorelix was accompanied by serum LH and testosterone suppression. Higher LH-RH receptor concentrations coincided with elevated serum hormone levels at later time intervals. Our results indicate that administration of LH-RH antagonist Cetrorelix produces a marked down-regulation of pituitary receptors for LH-RH and not merely an occupancy of binding sites. PMID:8637885

  2. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  3. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor

    PubMed Central

    Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.

    2012-01-01

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850

  4. Unraveling transcriptional control and cis-regulatory codes using the software suite GeneACT

    PubMed Central

    Cheung, Tom Hiu; Kwan, Yin Lam; Hamady, Micah; Liu, Xuedong

    2006-01-01

    Deciphering gene regulatory networks requires the systematic identification of functional cis-acting regulatory elements. We present a suite of web-based bioinformatics tools, called GeneACT , that can rapidly detect evolutionarily conserved transcription factor binding sites or microRNA target sites that are either unique or over-represented in differentially expressed genes from DNA microarray data. GeneACT provides graphic visualization and extraction of common regulatory sequence elements in the promoters and 3'-untranslated regions that are conserved across multiple mammalian species. PMID:17064417

  5. Protein specific fluorescent microspheres for labelling a protein

    NASA Technical Reports Server (NTRS)

    Rembaum, Alan (Inventor)

    1982-01-01

    Highly fluorescent, stable and biocompatible microspheres are obtained by copolymerizing an acrylic monomer containing a covalent bonding group such as hydroxyl, amine or carboxyl, for example, hydroxyethylmethacrylate, with an addition polymerizable fluorescent comonomer such as dansyl allyl amine. A lectin or antibody is bound to the covalent site to provide cell specificity. When the microspheres are added to a cell suspension the marked microspheres will specifically label a cell membrane by binding to a specific receptor site thereon. The labeled membrane can then be detected by fluorescence of the fluorescent monomer.

  6. ASPeak: an abundance sensitive peak detection algorithm for RIP-Seq.

    PubMed

    Kucukural, Alper; Özadam, Hakan; Singh, Guramrit; Moore, Melissa J; Cenik, Can

    2013-10-01

    Unlike DNA, RNA abundances can vary over several orders of magnitude. Thus, identification of RNA-protein binding sites from high-throughput sequencing data presents unique challenges. Although peak identification in ChIP-Seq data has been extensively explored, there are few bioinformatics tools tailored for peak calling on analogous datasets for RNA-binding proteins. Here we describe ASPeak (abundance sensitive peak detection algorithm), an implementation of an algorithm that we previously applied to detect peaks in exon junction complex RNA immunoprecipitation in tandem experiments. Our peak detection algorithm yields stringent and robust target sets enabling sensitive motif finding and downstream functional analyses. ASPeak is implemented in Perl as a complete pipeline that takes bedGraph files as input. ASPeak implementation is freely available at https://sourceforge.net/projects/as-peak under the GNU General Public License. ASPeak can be run on a personal computer, yet is designed to be easily parallelizable. ASPeak can also run on high performance computing clusters providing efficient speedup. The documentation and user manual can be obtained from http://master.dl.sourceforge.net/project/as-peak/manual.pdf.

  7. Inhibition of the binding of MSG-intermolt-specific complex, MIC, to the sericin-1 gene promoter and sericin-1 gene expression by POU-M1/SGF-3.

    PubMed

    Kimoto, Mai; Kitagawa, Tsuyuki; Kobayashi, Isao; Nakata, Tomohiro; Kuroiwa, Asato; Takiya, Shigeharu

    2012-11-01

    The sericin-1 gene encoding a glue protein is expressed in the middle silk gland (MSG) of the silkworm, Bombyx mori. A member of the class III POU domain transcription factors, POU-M1, was cloned as the factor bound to the SC site of the sericin-1 promoter and has been proposed to be a positive transcription factor. In this study, we analyzed the expression pattern of the POU-M1 gene in fourth and fifth instars in comparison with the pattern of the sericin-1 gene. The POU-M1 gene was expressed strongly in the region anterior to the sericin-1-expressing portion of the silk gland at both feeding stages. As the sericin-1-expressing region expands from the posterior to middle portions of the MSG in the fifth instar, the POU-M1-expressing region retreated from the middle to anterior portion. Introduction of the expression vector of POU-M1 into the silk glands by gene gun technology repressed promoter activity of the sericin-1 gene, suggesting that POU-M1 regulates the sericin-1 gene negatively. An in vitro binding assay showed that POU-M1 bound not only to the SC site but also to other promoter elements newly detected in vivo. Another spatiotemporal specific factor MIC binds to these elements, and POU-M1 competed with MIC to bind at the -70 site essential for promoter activity. These results suggest that POU-M1 is involved in restricting the anterior boundary of the sericin-1-expressing region in the silk gland by inhibiting the binding of the transcriptional activator to the promoter elements.

  8. Computational characterization of how the VX nerve agent binds human serum paraoxonase 1.

    PubMed

    Fairchild, Steven Z; Peterson, Matthew W; Hamza, Adel; Zhan, Chang-Guo; Cerasoli, Douglas M; Chang, Wenling E

    2011-01-01

    Human serum paraoxonase 1 (HuPON1) is an enzyme that can hydrolyze various chemical warfare nerve agents including VX. A previous study has suggested that increasing HuPON1's VX hydrolysis activity one to two orders of magnitude would make the enzyme an effective countermeasure for in vivo use against VX. This study helps facilitate further engineering of HuPON1 for enhanced VX-hydrolase activity by computationally characterizing HuPON1's tertiary structure and how HuPON1 binds VX. HuPON1's structure is first predicted through two homology modeling procedures. Docking is then performed using four separate methods, and the stability of each bound conformation is analyzed through molecular dynamics and solvated interaction energy calculations. The results show that VX's lone oxygen atom has a strong preference for forming a direct electrostatic interaction with HuPON1's active site calcium ion. Various HuPON1 residues are also detected that are in close proximity to VX and are therefore potential targets for future mutagenesis studies. These include E53, H115, N168, F222, N224, L240, D269, I291, F292, and V346. Additionally, D183 was found to have a predicted pKa near physiological pH. Given D183's location in HuPON1's active site, this residue could potentially act as a proton donor or accepter during hydrolysis. The results from the binding simulations also indicate that steered molecular dynamics can potentially be used to obtain accurate binding predictions even when starting with a closed conformation of a protein's binding or active site.

  9. Multifunctional Nutrient-Binding Proteins Adapt Human Symbiotic Bacteria for Glycan Competition in the Gut by Separately Promoting Enhanced Sensing and Catalysis

    PubMed Central

    Cameron, Elizabeth A.; Kwiatkowski, Kurt J.; Lee, Byung-Hoo; Hamaker, Bruce R.; Koropatkin, Nicole M.

    2014-01-01

    ABSTRACT To compete for the dynamic stream of nutrients flowing into their ecosystem, colonic bacteria must respond rapidly to new resources and then catabolize them efficiently once they are detected. The Bacteroides thetaiotaomicron starch utilization system (Sus) is a model for nutrient acquisition by symbiotic gut bacteria, which harbor thousands of related Sus-like systems. Structural investigation of the four Sus outer membrane proteins (SusD, -E, -F, and -G) revealed that they contain a total of eight starch-binding sites that we demonstrated, using genetic and biochemical approaches, to play distinct roles in starch metabolism in vitro and in vivo in gnotobiotic mice. SusD, whose homologs are abundant in the human microbiome, is critical for the initial sensing of available starch, allowing sus transcriptional activation at much lower concentrations than without this function. In contrast, seven additional binding sites across SusE, -F, and -G are dispensable for sus activation. However, they optimize the rate of growth on starch in a manner dependent on the expression of the bacterial polysaccharide capsule, suggesting that they have evolved to offset the diffusion barrier created by this structure. These findings demonstrate how proteins with similar biochemical behavior can serve orthogonal functions during different stages of cellular adaptation to nutrients. Finally, we demonstrated in gnotobiotic mice fed a starch-rich diet that the Sus binding sites confer a competitive advantage to B. thetaiotaomicron in vivo in a manner that is dependent on other colonizing microbes. This study reveals how numerically dominant families of carbohydrate-binding proteins in the human microbiome fulfill separate and sometimes cooperative roles to optimize gut commensal bacteria for nutrient acquisition. PMID:25205092

  10. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

    PubMed

    Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

    1994-12-20

    The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

  11. Whole blood flow cytometry measurements of in vivo platelet activation in critically-Ill patients are influenced by variability in blood sampling techniques.

    PubMed

    Rondina, Matthew T; Grissom, Colin K; Men, Shaohua; Harris, Estelle S; Schwertz, Hansjorg; Zimmerman, Guy A; Weyrich, Andrew S

    2012-06-01

    Flow cytometry is often used to measure in vivo platelet activation in critically-ill patients. Variability in blood sampling techniques, which may confound these measurements, remains poorly characterized. Platelet activation was measured by flow cytometry performed on arterial and venous blood from 116 critically-ill patients. We determined how variability in vascular sampling site, processing times, and platelet counts influenced levels of platelet-monocyte aggregates (PMA), PAC-1 binding (for glycoprotein (GP) IIbIIIa), and P-selectin (P-SEL) expression. Levels of PMA, but not PAC-1 binding or P-SEL expression, were significantly affected by variability in vascular sampling site. Average PMA levels were approximately 60% higher in whole blood drawn from an arterial vessel compared to venous blood (16.2±1.8% vs. 10.7±1.2%, p<0.05). Levels of PMA in both arterial and venous blood increased significantly during ex vivo processing delays (1.7% increase for every 10 minute delay, p<0.05). In contrast, PAC-1 binding and P-SEL expression were unaffected by processing delays. Levels of PMA, but not PAC-1 binding or P-SEL expression, were correlated with platelet count quartiles (9.4±1.6% for the lowest quartile versus 15.4±1.6% for the highest quartile, p<0.05). In critically-ill patients, variability in vascular sampling site, processing times, and platelet counts influence levels of PMA, but not PAC-1 binding or P-SEL expression. These data demonstrate the need for rigorous adherence to blood sampling protocols, particularly when levels of PMA, which are most sensitive to variations in blood collection, are measured for detection of in vivo platelet activation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  13. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  14. Distinct regulators of Shh transcription in the floor plate and notochord indicate separate origins for these tissues in the mouse node.

    PubMed

    Jeong, Yongsu; Epstein, Douglas J

    2003-08-01

    The establishment of the floor plate at the ventral midline of the CNS is dependent on an inductive signaling process mediated by the secreted protein Sonic hedgehog (Shh). To understand molecularly how floor plate induction proceeds we identified a Shh-responsive regulatory element that directs transgene reporter expression to the ventral midline of the CNS and notochord in a Shh-like manner and characterized critical cis-acting sequences regulating this element. Cross-species comparisons narrowed the activity of the Shh floor plate enhancer to an 88-bp sequence within intron 2 of Shh that included highly conserved binding sites matching the consensus for homeodomain, Tbx and Foxa transcription factors. Mutational analysis revealed that the homeodomain and Foxa binding sites are each required for activation of the Shh floor plate enhancer, whereas the Tbx site was required for repression in regions of the CNS where Shh is not normally expressed. We further show that Shh enhancer activity was detected in the mouse node from where the floor plate and notochord precursors derive. Shh reporter expression was restricted to the ventral (mesodermal) layer of the node in a pattern similar to endogenous Shh. X-gal-positive cells emerging from the node were only detected in the notochord lineage, suggesting that the floor plate and notochord arise from distinct precursors in the mouse node.

  15. Nitric-oxide Synthase Forms N-NO-pterin and S-NO-Cys

    PubMed Central

    Rosenfeld, Robin J.; Bonaventura, Joseph; Szymczyna, Blair R.; MacCoss, Michael J.; Arvai, Andrew S.; Yates, John R.; Tainer, John A.; Getzoff, Elizabeth D.

    2010-01-01

    Inducible nitric-oxide synthase (iNOS) produces biologically stressful levels of nitric oxide (NO) as a potent mediator of cellular cytotoxicity or signaling. Yet, how this nitrosative stress affects iNOS function in vivo is poorly understood. Here we define two specific non-heme iNOS nitrosation sites discovered by combining UV-visible spectroscopy, chemiluminescence, mass spectrometry, and x-ray crystallography. We detected auto-S-nitrosylation during enzymatic turnover by using chemiluminescence. Selective S-nitrosylation of the ZnS4 site, which bridges the dimer interface, promoted a dimer-destabilizing order-to-disorder transition. The nitrosated iNOS crystal structure revealed an unexpected N-NO modification on the pterin cofactor. Furthermore, the structurally defined N-NO moiety is solvent-exposed and available to transfer NO to a partner. We investigated glutathione (GSH) as a potential transnitrosation partner because the intracellular GSH concentration is high and NOS can form S-nitrosoglutathione. Our computational results predicted a GSH binding site adjacent to the N-NO-pterin. Moreover, we detected GSH binding to iNOS with saturation transfer difference NMR spectroscopy. Collectively, these observations resolve previous paradoxes regarding this uncommon pterin cofactor in NOS and suggest means for regulating iNOS activity via N-NO-pterin and S-NO-Cys modifications. The iNOS self-nitrosation characterized here appears appropriate to help control NO production in response to cellular conditions. PMID:20659888

  16. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  17. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  18. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  19. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  20. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  1. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  2. Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

    PubMed Central

    Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

    2008-01-01

    Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

  3. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  4. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  5. Insights into the surface topology of polyhydroxyalkanoate synthase: self-assembly of functionalized inclusions.

    PubMed

    Hooks, David O; Rehm, Bernd H A

    2015-10-01

    The polyhydroxyalkanoate (PHA) synthase catalyzes the synthesis of PHA and remains attached to the hydrophobic PHA inclusions it creates. Although this feature is actively exploited to generate functionalized biobeads via protein engineering, little is known about the structure of the PHA synthase. Here, the surface topology of Ralstonia eutropha PHA synthase was probed to inform rational protein engineering toward the production of functionalized PHA beads. Surface-exposed residues were detected by conjugating biotin to inclusion-bound PHA synthase and identifying the biotin-conjugated lysine and cysteine residues using peptide fingerprinting analysis. The identified sites (K77, K90, K139, C382, C459, and K518) were investigated as insertion sites for the generation of new protein fusions. Insertions of FLAG epitopes into exposed sites K77, K90, K139, and K518 were tolerated, retaining >65 % of in vivo activity. Sites K90, K139, and K518 were also tested by insertion of the immunoglobulin G (IgG)-binding domain (ZZ), successfully producing PHA inclusions able to bind human IgG in vitro. Although simultaneous insertions of the ZZ domain into two sites was permissive, insertion at all three lysine sites inactivated the synthase. The K90/K139 double ZZ insertion had the optimum IgG-binding capacity of 16 mg IgG/g wet PHA beads and could selectively purify the IgG fraction from human serum. Overall, this study identified surface-exposed flexible regions of the PHA synthase which either tolerate protein/peptide insertions or are critical for protein function. This further elucidates the structure and function of PHA synthase and provides new opportunities for generating functionalized PHA biobeads.

  6. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  7. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  8. A homogeneous, Anti-dsDNA antibody-based assay for multicolor detection of cancer stem cell transcription factors.

    PubMed

    Ma, Jiehua; Shi, Hai; Zhang, Meiling; Li, Chao; Xiang, Yang; Liu, Ping

    2018-10-31

    Cancer stem cells (CSCs) are responsible for maintaining tumor growth, metastasis and recurrence. The high expression of cancer stem cell transcription factors (Oct4, Sox2 and Nanog) is a valuable prognostic factor, suggesting a higher risk of tumor recurrence and metastasis. So, the development of a convenient and cost-effective method for multiplex assay of these transcription factors (TFs) is highly required. In this work, we have proposed a universal homogeneous assay for multicolor detection of these TFs based on anti-dsDNA antibody-decorated Fe 3 O 4 magnetite nanoparticles (aadMNPs). In the presence of analytes, the dye-labeled dsDNAs are bound by specific TFs, which will inhibit the interactions between the dsDNAs and aadMNPs, generating higher fluorescence that may provide signal readout for the immunosensing process. By using the proposed method, Oct4 can be determined in a linear range from 3 to 1200 ng/mL with a detection limit of 0.035 ng/mL. Furthermore, we have presented assays for the sensitive, selective and rapid detection of Oct4, Sox2 and Nanog in cell extract, as well as the analysis of binding affinity of the mutated binding sequences. This work may provide potential applications in clinical CSCs detections, and may open new opportunity for the study of nucleotide polymorphisms in TF binding sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. New detection targets for amyloid-reactive probes: spectroscopic recognition of bacterial spores

    NASA Astrophysics Data System (ADS)

    Jones, Guilford, II; Landsman, Pavel

    2005-05-01

    We report characteristic changes in fluorescence of amyloid-binding dyes Thioflavin T (TfT), pinacyanol (PIN) and related dyes, caused by their interaction with suspended Bacillus spore cultures (B. subtilis, B thuringiensis). The gain in TfT emission in the presence of spores allowed their immediate detection in aqueous suspensions, with a sensitivity limit of < 105 spores per ml. The spectroscopic signatures are consistent with a large number of binding sites for the two dyes on spore coats. The possible structural relationship of these dye binding loci with characteristic motifs (β-stacks) of amyloid deposits and other misfolded protein formations suggests new designs for probing biocontamination and also for clinical studies of non-microbial human pathogens (e.g., amyloid-related protein aggregates in prion-related transmissible encephalopathies or in Alzheimer's disease). Also reported is a special screening technique that was designed and used herein for calibration of new detection probes and assays for spore detection. It employed spectroscopic interactions between the candidate amyloid stains and poly(vinylpyrrolidone)-coated colloid silica (Percoll) nanoparticles that also display remarkable parallelism with the corresponding dye-amyloid and dye-spore reactivities. Percoll may thus find new applications as a convenient non-biological structural model mimicking the putative probe-targeted motifs in both classes of bioanalytes. These findings are important in the design of new probes and assays for important human pathogens (i.e. bacterial spores and amyloidogenic protein aggregates).

  10. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  11. How Robust Is the Mechanism of Folding-Upon-Binding for an Intrinsically Disordered Protein?

    PubMed

    Bonetti, Daniela; Troilo, Francesca; Brunori, Maurizio; Longhi, Sonia; Gianni, Stefano

    2018-04-24

    The mechanism of interaction of an intrinsically disordered protein (IDP) with its physiological partner is characterized by a disorder-to-order transition in which a recognition and a binding step take place. Even if the mechanism is quite complex, IDPs tend to bind their partner in a cooperative manner such that it is generally possible to detect experimentally only the disordered unbound state and the structured complex. The interaction between the disordered C-terminal domain of the measles virus nucleoprotein (N TAIL ) and the X domain (XD) of the viral phosphoprotein allows us to detect and quantify the two distinct steps of the overall reaction. Here, we analyze the robustness of the folding of N TAIL upon binding to XD by measuring the effect on both the folding and binding steps of N TAIL when the structure of XD is modified. Because it has been shown that wild-type XD is structurally heterogeneous, populating an on-pathway intermediate under native conditions, we investigated the binding to 11 different site-directed variants of N TAIL of one particular variant of XD (I504A XD) that populates only the native state. Data reveal that the recognition and the folding steps are both affected by the structure of XD, indicating a highly malleable pathway. The experimental results are briefly discussed in the light of previous experiments on other IDPs. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  13. Mapping of melanin-concentrating hormone receptor 1 B cell epitopes predicts two major binding sites for vitiligo patient autoantibodies.

    PubMed

    Gavalas, Nikos G; Gottumukkala, Raju V S R K; Gawkrodger, David J; Watson, Philip F; Weetman, Anthony P; Kemp, E Helen

    2009-05-01

    The melanin-concentrating hormone receptor 1 (MCHR1) has been identified as a B cell autoantigen in vitiligo with antibodies to the receptor detectable in binding and function-blocking assays. Two epitope domains (amino acids 1-138 and 139-298) have been previously identified. In this study, we aimed to further define the epitope specificity of MCHR1 antibodies using phage-display technology and to identify the epitopes recognised by receptor antibodies detected in MCHR1 function-blocking assays. Antibody reactivity to MCHR1 peptides 51-80, 85-98, 154-158 and 254-260 was identified by phage-display and subsequently confirmed in phage ELISA in 2/12, 5/12, 3/12 and 6/12 of vitiligo patients, respectively. The results suggest that major autoantibody epitopes are localised in the 85-98 and 254-260 amino acid regions of MCHR1 with minor epitopes in amino acid sequences 51-80 and 154-158. Antibodies with MCHR1 function-blocking activity were determined to recognise epitope 254-260, this being the first epitope to be reported as a target site for antibodies that block the function of the receptor.

  14. Endothelin ETA receptor expression in human cerebrovascular smooth muscle cells.

    PubMed

    Yu, J C; Pickard, J D; Davenport, A P

    1995-11-01

    1. Endothelin (ET) has been implicated in cerebrovasospasm for example, following subarachnoid haemorrhage, and blocking the interaction of ET with its receptors on cerebral vessels, may be of therapeutic benefit. The aim of our study was to characterize endothelin receptor sub-types on medial smooth muscle cells of human cerebral vessels. Cultures of vascular smooth muscle cells were explanted from human cerebral resistance vessels and characterized as human brain smooth muscle cells (HBSMCs). 2. Over a 48 h incubation period, HBSMC cultures secreted comparable levels of immunoreactive (IR) big endothelin-1 (big ET-1) and IR endothelin (ET): 12.7 +/- 10.3 and 8.3 +/- 5.6 pmol/10(6) cells, respectively (mean +/- s.e. mean from three different individuals), into the culture medium. 3. Total RNA was extracted from cultures of human brain smooth muscle cells. Reverse-transcriptase polymerase chain reaction (RI-PCR) assays and subsequent product separation by agarose gel electrophoresis revealed single bands corresponding to the expected product sizes encoding cDNA for ETA (299 base pairs) and ETB (428 base pairs) (n = 3 different cultures). 4. Autoradiography demonstrated the presence of specific binding sites for [125I]-ET-1 which labels all ET receptors, and [125I]-PD151242, an ETA subtype-selective antagonist which exclusively labels ETA receptors, but no specific-binding was detected using ETB subtype-selective [125I]-BQ3020 (n = 3 different cultures, in duplicate). 5. In saturation binding assays, [123I]-ET-1 bound with high affinity: KD = 0.8 +/- 0.1 nM and Bmax = 690 +/- 108 fmol mg-1. A one-site fit was preferred and Hill slopes were close to unity over the concentration range (10(-12) to 10(-8) M). [125I]-PD151242 also bound with similar affinity: KD = 0.4 +/- 0.1 nM and Bmax = 388 +/- 68 fmol mg-1 (mean +/- s.e. mean, n = 3 different cultures). Again, a one-site fit was preferred and Hill slopes were close to unity over the concentration range. Unlabelled PD151242 competed for the binding of [125I]-ET-1 monophasically and analysis of the competition curves indicated that a one-site fit was preferred over a two-site model, implying that the cultures express mainly ETA receptors. 6. Although messenger RNA encoding both ETA and ETB receptors was detected, autoradiographical analysis, as well as binding studies indicate that human cultured brain smooth muscle cells express only ETA receptor protein. Antagonism of this sub-type may be necessary to block the actions of ET-1 in the human cerebral resistance vessels in the vasospasm observed subsequent to subarachnoid haemorrhage.

  15. Reduction and Reoxidation of Humic Acid: Influence on Spectroscopic Properties and Proton Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maurer, F.; Christl, I; Kretzschmar, R

    2010-01-01

    Previous studies on proton and metal binding to humic substances have not considered a potential influence of reduction and oxidation of functional groups. Therefore, we investigated how proton binding of a purified soil humic acid was affected by reduction. Reduction of the humic acid was carried out using an electrochemical cell that allowed us to measure the amounts of electrons and protons involved in reduction reactions. We further applied spectroscopic methods (UV-vis, fluorescence, FT-IR, C-1s NEXAFS) to detect possible chemical changes in the humic acid induced by reduction and reoxidation. The effect of reduction on proton binding was determined withmore » acid-base titrations in the pH range 4-10 under controlled redox conditions. During reduction, 0.54 mol kg{sup -1} protons and 0.55 mol kg{sup -1} electrons were transferred to humic acid. NICA-Donnan modeling revealed an equivalent increase in proton-reactive sites (0.52 mol kg{sup -1}) in the alkaline pH-range. Our results indicate that reduction of humic acid increased the amount of proton-reactive sites by 15% compared to the untreated state. Spectroscopic differences between the untreated and reduced humic acid were minor, apart from a lower UV-vis absorption of the reduced humic acid between 400 and 700 nm.« less

  16. Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

    PubMed Central

    Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

    2010-01-01

    Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

  17. Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

    PubMed

    Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

    2010-06-01

    Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

  18. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2more » hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol /sup 125/I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function.« less

  20. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  1. Site of ADP-ribosylation and the RNA-binding site are situated in different domains of the elongation factor EF-2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davydova, E.K.

    1987-01-01

    One of the proteins participating in the process of elongation of polypeptide chains - elongation factor 2 (EF-2) - can be ADP-ribosylated at a unique amino acid residue - diphthamide. Since the ADP-ribosylation of EF-2 at dipthamide leads to a loss of affinity of the factor for RNA while the presence of RNA inhibits the ADP-ribosylation reaction, it seemed probable to the authors that diphthamide participated directly in the binding of EF-2 to DNA. The experiments presented in this article showed that this was not the case: diphthamide and the RNA-binding site are situated on different domains of EF-2. Thus,more » ADP-ribosylation of factor EF-2 in one domain leads to a loss of the ability to bind to RNA in the other. The authors investigated the mutual arrangement of diphthamide and the RNA-binding site on the EF-2 molecule by preparing a factor from rabbit reticulocytes and subjecting it to proteolytic digestion with elastase. The factor was incubated with elastase for 15 min at 37/sup 0/C at an enzyme:substrate ratio of 1:100 in buffer solution containing 20 mM Tris-HCl, pH 7.6, 10 mM KCl, 1 mM MgCl/sub 2/, and 2 mM dithiothreitol. The reaction was stopped by adding para-methylsulfonyl fluoride to 50 micro-M. The authors obtained a preparation as a result of proteolysis and applied it on a column with RNA-Sepharose and separated into two fractions: RNA-binding and without affinity for RNA. The initial preparation and its fractions were subjected to exhaustive ADP-ribosylation in the presence of diphtheria toxin and (U-/sup 14/C) nicotinaide adenine dinucleotide ((/sup 14/C)NAD) (296 mCi/mmole). The samples were analyzed electrophoretically in a polyacrylamide gel gradient in the presence of sodium dodecyl sulfate. For the detection of (/sup 14/C) ADP-ribosylated components, the gels were dried and exposed with RM-V x-ray film.« less

  2. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  3. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  4. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  5. Quantitative monitoring of two simultaneously binding species using Label-Enhanced surface plasmon resonance.

    PubMed

    Eng, Lars; Garcia, Brandon L; Geisbrecht, Brian V; Hanning, Anders

    2018-02-26

    Surface plasmon resonance (SPR) is a well-established method for biomolecular interaction studies. SPR monitors the binding of molecules to a solid surface, embodied as refractive index changes close to the surface. One limitation of conventional SPR is the universal nature of the detection that results in an inability to qualitatively discriminate between different binding species. Furthermore, it is impossible to directly discriminate two species simultaneously binding to different sites on a protein, which limits the utility of SPR, for example, in the study of allosteric binders or bi-specific molecules. It is also impossible in principle to discriminate protein conformation changes from actual binding events. Here we demonstrate how Label-Enhanced SPR can be utilized to discriminate and quantitatively monitor the simultaneous binding of two different species - one dye-labeled and one unlabeled - on a standard, single-wavelength SPR instrument. This new technique increases the versatility of SPR technology by opening up application areas where the usefulness of the approach has previously been limited. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. DNA-binding study of anticancer drug cytarabine by spectroscopic and molecular docking techniques.

    PubMed

    Shahabadi, Nahid; Falsafi, Monireh; Maghsudi, Maryam

    2017-01-02

    The interaction of anticancer drug cytarabine with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multispectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove-binding mode, while the binding constant of UV-vis and the number of binding sites were 4.0 ± 0.2 × 10 4 L mol -1 and 1.39, respectively. The fluorimetric studies showed that the reaction between the drugs with CT-DNA is exothermic. Circular dichroism spectroscopy was employed to measure the conformational change of DNA in the presence of cytarabine. Furthermore, the drug induces detectable changes in its viscosity for DNA interaction. The molecular modeling results illustrated that cytarabine strongly binds to groove of DNA by relative binding energy of docked structure -20.61 KJ mol -1 . This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the interaction of small molecular pollutants and drugs with biomacromolecules for clarifying the molecular mechanism of toxicity or side effect in vivo.

  7. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  8. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  9. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  10. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  11. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  12. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  13. Searching for statistically significant regulatory modules.

    PubMed

    Bailey, Timothy L; Noble, William Stafford

    2003-10-01

    The regulatory machinery controlling gene expression is complex, frequently requiring multiple, simultaneous DNA-protein interactions. The rate at which a gene is transcribed may depend upon the presence or absence of a collection of transcription factors bound to the DNA near the gene. Locating transcription factor binding sites in genomic DNA is difficult because the individual sites are small and tend to occur frequently by chance. True binding sites may be identified by their tendency to occur in clusters, sometimes known as regulatory modules. We describe an algorithm for detecting occurrences of regulatory modules in genomic DNA. The algorithm, called mcast, takes as input a DNA database and a collection of binding site motifs that are known to operate in concert. mcast uses a motif-based hidden Markov model with several novel features. The model incorporates motif-specific p-values, thereby allowing scores from motifs of different widths and specificities to be compared directly. The p-value scoring also allows mcast to only accept motif occurrences with significance below a user-specified threshold, while still assigning better scores to motif occurrences with lower p-values. mcast can search long DNA sequences, modeling length distributions between motifs within a regulatory module, but ignoring length distributions between modules. The algorithm produces a list of predicted regulatory modules, ranked by E-value. We validate the algorithm using simulated data as well as real data sets from fruitfly and human. http://meme.sdsc.edu/MCAST/paper

  14. Electron-paramagnetic-resonance studies on nitrogenase of Klebsiella pneumoniae. Evidence for acetylene- and ethylene-nitrogenase transient complexes.

    PubMed Central

    Lowe, D J; Eady, R R; Thorneley, N F

    1978-01-01

    Klebsiella pneumoniae nitrogenase exhibited four new electron-paramagnetic-resonance signals during turnover at 10 degrees C, pH7.4, which were assigned to intermediates present in low concentrations in the steady state. 57Fe-substituted Mo--Fe protein showed that they arose from Fe--S clusters in the Mo--Fe protein of nitrogenase. The new signals are designated: Ic, g values at 4.67, 3.37 and approx. 2.0; VI, g values at 2.125, 2.000 and 2.000; VII, g values at 5.7 and 5.4; VIII, g values at 2.092, 1.974 and 1.933. The sharp axial signal VI arises from a Fe4S4 cluster at the --1 oxidation level. This signal was only detected in the presence of ethylene and provides the first evidence of an enzyme--product complex for nitrogenase. [13C]Acetylene and [13C]ethylene provided no evidence for direct binding of this substrate and product to the Fe--S clusters giving rise to these signals. The dependence of signal intensities on acetylene concentration indicated two types of binding site, with apparent dissociation constants K less than 16 micron and K approximately 13mM. A single binding site for ethylene (K=1.5mM) was detected. A scheme is proposed for the mechanism of reduction of acetylene to ethylene and inhibition of this reaction by CO. PMID:210766

  15. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  16. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  17. Probing Structural Changes among Analogous Inhibitor-Bound Forms of HIV-1 Protease and a Drug-Resistant Mutant in Solution by Nuclear Magnetic Resonance.

    PubMed

    Khan, Shahid N; Persons, John D; Paulsen, Janet L; Guerrero, Michel; Schiffer, Celia A; Kurt-Yilmaz, Nese; Ishima, Rieko

    2018-03-13

    In the era of state-of-the-art inhibitor design and high-resolution structural studies, detection of significant but small protein structural differences in the inhibitor-bound forms is critical to further developing the inhibitor. Here, we probed differences in HIV-1 protease (PR) conformation among darunavir and four analogous inhibitor-bound forms and compared them with a drug-resistant mutant using nuclear magnetic resonance chemical shifts. Changes in amide chemical shifts of wild-type (WT) PR among these inhibitor-bound forms, ΔCSP, were subtle but detectable and extended >10 Å from the inhibitor-binding site, asymmetrically between the two subunits of PR. Molecular dynamics simulations revealed differential local hydrogen bonding as the molecular basis of this remote asymmetric change. Inhibitor-bound forms of the drug-resistant mutant also showed a similar long-range ΔCSP pattern. Differences in ΔCSP values of the WT and the mutant (ΔΔCSPs) were observed at the inhibitor-binding site and in the surrounding region. Comparing chemical shift changes among highly analogous inhibitors and ΔΔCSPs effectively eliminated local environmental effects stemming from different chemical groups and enabled exploitation of these sensitive parameters to detect subtle protein conformational changes and to elucidate asymmetric and remote conformational effects upon inhibitor interaction.

  18. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  19. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  20. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  1. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  2. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  3. Modular fluorescence complementation sensors for live cell detection of epigenetic signals at endogenous genomic sites.

    PubMed

    Lungu, Cristiana; Pinter, Sabine; Broche, Julian; Rathert, Philipp; Jeltsch, Albert

    2017-09-21

    Investigation of the fundamental role of epigenetic processes requires methods for the locus-specific detection of epigenetic modifications in living cells. Here, we address this urgent demand by developing four modular fluorescence complementation-based epigenetic biosensors for live-cell microscopy applications. These tools combine engineered DNA-binding proteins with domains recognizing defined epigenetic marks, both fused to non-fluorescent fragments of a fluorescent protein. The presence of the epigenetic mark at the target DNA sequence leads to the reconstitution of a functional fluorophore. With this approach, we could for the first time directly detect DNA methylation and histone 3 lysine 9 trimethylation at endogenous genomic sites in live cells and follow dynamic changes in these marks upon drug treatment, induction of epigenetic enzymes and during the cell cycle. We anticipate that this versatile technology will improve our understanding of how specific epigenetic signatures are set, erased and maintained during embryonic development or disease onset.Tools for imaging epigenetic modifications can shed light on the regulation of epigenetic processes. Here, the authors present a fluorescence complementation approach for detection of DNA and histone methylation at endogenous genomic sites allowing following of dynamic changes of these marks by live-cell microscopy.

  4. In vivo binding properties of SH2 domains from GTPase-activating protein and phosphatidylinositol 3-kinase.

    PubMed Central

    Cooper, J A; Kashishian, A

    1993-01-01

    We have used a transient expression system and mutant platelet-derived growth factor (PDGF) receptors to study the binding specificities of the Src homology 2 (SH2) regions of the Ras GTPase-activator protein (GAP) and the p85 alpha subunit of phosphatidylinositol 3-kinase (PI3 kinase). A number of fusion proteins, each tagged with an epitope allowing recognition by a monoclonal antibody, were expressed at levels comparable to those of endogenous GAP. Fusion proteins containing the central SH2-SH3-SH2 region of GAP or the C-terminal region of p85 alpha, which includes two SH2 domains, bound to PDGF receptors in response to PDGF stimulation. Both fusion proteins showed the same requirements for tyrosine phosphorylation sites in the PDGF receptor as the full-length proteins from which they were derived, i.e., binding of the GAP fusion protein was reduced by mutation of Tyr-771, and binding of the p85 fusion protein was reduced by mutation of Tyr-740, Tyr-751, or both residues. Fusion proteins containing single SH2 domains from either GAP or p85 alpha did not bind detectably to PDGF receptors in this system, suggesting that two SH2 domains in a single polypeptide cooperate to raise the affinity of binding. The sequence specificities of individual SH2 domains were deduced from the binding properties of fusion proteins containing one SH2 domain from GAP and another from p85. The results suggest that the C-terminal GAP SH2 domain specifies binding to Tyr-771, the C-terminal p85 alpha SH2 domain binds to either Tyr-740 or Tyr-751, and each protein's N-terminal SH2 domain binds to unidentified phosphorylation sites.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8382774

  5. Geomfinder: a multi-feature identifier of similar three-dimensional protein patterns: a ligand-independent approach.

    PubMed

    Núñez-Vivanco, Gabriel; Valdés-Jiménez, Alejandro; Besoaín, Felipe; Reyes-Parada, Miguel

    2016-01-01

    Since the structure of proteins is more conserved than the sequence, the identification of conserved three-dimensional (3D) patterns among a set of proteins, can be important for protein function prediction, protein clustering, drug discovery and the establishment of evolutionary relationships. Thus, several computational applications to identify, describe and compare 3D patterns (or motifs) have been developed. Often, these tools consider a 3D pattern as that described by the residues surrounding co-crystallized/docked ligands available from X-ray crystal structures or homology models. Nevertheless, many of the protein structures stored in public databases do not provide information about the location and characteristics of ligand binding sites and/or other important 3D patterns such as allosteric sites, enzyme-cofactor interaction motifs, etc. This makes necessary the development of new ligand-independent methods to search and compare 3D patterns in all available protein structures. Here we introduce Geomfinder, an intuitive, flexible, alignment-free and ligand-independent web server for detailed estimation of similarities between all pairs of 3D patterns detected in any two given protein structures. We used around 1100 protein structures to form pairs of proteins which were assessed with Geomfinder. In these analyses each protein was considered in only one pair (e.g. in a subset of 100 different proteins, 50 pairs of proteins can be defined). Thus: (a) Geomfinder detected identical pairs of 3D patterns in a series of monoamine oxidase-B structures, which corresponded to the effectively similar ligand binding sites at these proteins; (b) we identified structural similarities among pairs of protein structures which are targets of compounds such as acarbose, benzamidine, adenosine triphosphate and pyridoxal phosphate; these similar 3D patterns are not detected using sequence-based methods; (c) the detailed evaluation of three specific cases showed the versatility of Geomfinder, which was able to discriminate between similar and different 3D patterns related to binding sites of common substrates in a range of diverse proteins. Geomfinder allows detecting similar 3D patterns between any two pair of protein structures, regardless of the divergency among their amino acids sequences. Although the software is not intended for simultaneous multiple comparisons in a large number of proteins, it can be particularly useful in cases such as the structure-based design of multitarget drugs, where a detailed analysis of 3D patterns similarities between a few selected protein targets is essential.

  6. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  7. The glucocorticoid receptor regulates the binding of C/EPBbeta on the alpha-1-acid glycoprotein promoter in vivo.

    PubMed

    Savoldi, G; Fenaroli, A; Ferrari, F; Rigaud, G; Albertini, A; Di Lorenzo, D

    1997-12-01

    A complex interaction between the Glucocorticoid Receptor (GR), C/EBPbeta, and other transcription factors activate the Alpha-1 Acid Glycoprotein (AGP) promoter in HTC(JZ-1) rat hepatoma culture cells. This effect is mediated by the so-called Steroid Responsive Unit (SRU) of the AGP promoter that contains several binding sites for C/EBP transcription factors, some of which overlap with the Glucocorticoid Responsive Element (GRE). Our in vivo footprinting experiments revealed that the GRE- and the C/EBP-binding sites were already occupied glucocorticoid dependently in HTC(JZ-1) cells 10 min after dexamethasone administration (10(-6) M). Furthermore, local changes in the chromatine structure shown by the appearance of DNAse I hypersensitive sites (HS sites) also took place. These changes were probably dependent on a tissue-specific organization of the chromatine at the SRU because they were not detectable in a different glucocorticoid-responsive cell line (PC12) that did not express AGP. Here, we have also shown that withdrawal of dexamethasone or addition of the anti-glucocorticoid RU486 were able to revert the pattern induced by dexamethasone in vivo. The disappearance of the protected region and the hypersensitive sites, typical of the hormone activated promoter, confirmed the necessity of the GR to be bound by the agonist and the inability of the GR-antagonist complex to bind the DNA. By functional assays, we showed that the occupancy of the SRU by these transcriptional proteins in vivo correlated with the activation of the AGP gene transcription. With these results, we have shown that one of the functions of the GR to activate transcription of the AGP gene is to recruit C/EBPbeta and to maintain it bound at its target DNA sequences (SRU). This process was not accomplished by RU486.

  8. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  9. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  10. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  11. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  12. Facile synthesis of zwitterionic polymer-coated core-shell magnetic nanoparticles for highly specific capture of N-linked glycopeptides

    NASA Astrophysics Data System (ADS)

    Chen, Yajing; Xiong, Zhichao; Zhang, Lingyi; Zhao, Jiaying; Zhang, Quanqing; Peng, Li; Zhang, Weibing; Ye, Mingliang; Zou, Hanfa

    2015-02-01

    Highly selective and efficient capture of glycosylated proteins and peptides from complex biological samples is of profound significance for the discovery of disease biomarkers in biological systems. Recently, hydrophilic interaction liquid chromatography (HILIC)-based functional materials have been extensively utilized for glycopeptide enrichment. However, the low amount of immobilized hydrophilic groups on the affinity material has limited its specificity, detection sensitivity and binding capacity in the capture of glycopeptides. Herein, a novel affinity material was synthesized to improve the binding capacity and detection sensitivity for glycopeptides by coating a poly(2-(methacryloyloxy)ethyl)-dimethyl-(3-sulfopropyl) ammonium hydroxide (PMSA) shell onto Fe3O4@SiO2 nanoparticles, taking advantage of reflux-precipitation polymerization for the first time (denoted as Fe3O4@SiO2@PMSA). The thick polymer shell endows the nanoparticles with excellent hydrophilic property and several functional groups on the polymer chains. The resulting Fe3O4@SiO2@PMSA demonstrated an outstanding ability for glycopeptide enrichment with high selectivity, extremely high detection sensitivity (0.1 fmol), large binding capacity (100 mg g-1), high enrichment recovery (above 73.6%) and rapid magnetic separation. Furthermore, in the analysis of real complicated biological samples, 905 unique N-glycosylation sites from 458 N-glycosylated proteins were reliably identified in three replicate analyses of a 65 μg protein sample extracted from mouse liver, showing the great potential of Fe3O4@SiO2@PMSA in the detection and identification of low-abundance N-linked glycopeptides in biological samples.Highly selective and efficient capture of glycosylated proteins and peptides from complex biological samples is of profound significance for the discovery of disease biomarkers in biological systems. Recently, hydrophilic interaction liquid chromatography (HILIC)-based functional materials have been extensively utilized for glycopeptide enrichment. However, the low amount of immobilized hydrophilic groups on the affinity material has limited its specificity, detection sensitivity and binding capacity in the capture of glycopeptides. Herein, a novel affinity material was synthesized to improve the binding capacity and detection sensitivity for glycopeptides by coating a poly(2-(methacryloyloxy)ethyl)-dimethyl-(3-sulfopropyl) ammonium hydroxide (PMSA) shell onto Fe3O4@SiO2 nanoparticles, taking advantage of reflux-precipitation polymerization for the first time (denoted as Fe3O4@SiO2@PMSA). The thick polymer shell endows the nanoparticles with excellent hydrophilic property and several functional groups on the polymer chains. The resulting Fe3O4@SiO2@PMSA demonstrated an outstanding ability for glycopeptide enrichment with high selectivity, extremely high detection sensitivity (0.1 fmol), large binding capacity (100 mg g-1), high enrichment recovery (above 73.6%) and rapid magnetic separation. Furthermore, in the analysis of real complicated biological samples, 905 unique N-glycosylation sites from 458 N-glycosylated proteins were reliably identified in three replicate analyses of a 65 μg protein sample extracted from mouse liver, showing the great potential of Fe3O4@SiO2@PMSA in the detection and identification of low-abundance N-linked glycopeptides in biological samples. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05955g

  13. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  14. Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain

    PubMed Central

    Khadake, Jyoti; Heggestad, Arnold D.; Ma, Xiaojie; Johnstone, Karen A.; Resnick, James L.; Yang, Thomas P.

    2013-01-01

    The Angelman/Prader-Willi syndrome (AS/PWS) domain contains at least 8 imprinted genes regulated by a bipartite imprinting center (IC) associated with the SNRPN gene. One component of the IC, the PWS-IC, governs the paternal epigenotype and expression of paternal genes. The mechanisms by which imprinting and expression of paternal genes within the AS/PWS domain – such as MKRN3 and NDN – are regulated by the PWS-IC are unclear. The syntenic region in the mouse is organized and imprinted similarly to the human domain with the murine PWS-IC defined by a 6 kb interval within the Snrpn locus that includes the promoter. To identify regulatory elements that may mediate PWS-IC function, we mapped the location and allele-specificity of DNase I hypersensitive (DH) sites within the PWS-IC in brain cells, then identified transcription factor binding sites within a subset of these DH sites. Six major paternal-specific DH sites were detected in the Snrpn gene, five of which map within the 6 kb PWS-IC. We postulate these five DH sites represent functional components of the murine PWS-IC. Analysis of transcription factor binding within multiple DH sites detected nuclear respiratory factors (NRF's) and YY1 specifically on the paternal allele. NRF's and YY1 were also detected in the paternal promoter region of the murine Mrkn3 and Ndn genes. These results suggest that NRF's and YY1 may facilitate PWS-IC function and coordinately regulate expression of paternal genes. The presence of NRF's also suggests a link between transcriptional regulation within the AS/PWS domain and regulation of respiration. 3C analyses indicated Mkrn3 lies in close proximity to the PWS-IC on the paternal chromosome, evidence that the PWS-IC functions by allele-specific interaction with its distal target genes. This could occur by allele-specific co-localization of the PWS-IC and its target genes to transcription factories containing NRF's and YY1. PMID:23390487

  15. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  16. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  17. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  18. Detection of koala retrovirus subgroup B (KoRV-B) in animals housed at European zoos.

    PubMed

    Fiebig, Uwe; Keller, Martina; Denner, Joachim

    2016-12-01

    Many koalas carry an endogenous retrovirus, KoRV-A, in their genome. Recently, a second retrovirus, KoRV-B, was detected in koalas in Japanese and U.S. zoos. However, this virus is not endogenous, differs in the receptor binding site of the surface envelope protein, and uses a receptor different from that of KoRV-A. We describe here a KoRV-B found in koalas at zoos in Germany and Belgium that differs slightly from that found in the Los Angeles zoo.

  19. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Fluorescence spectroscopy approaches for the development of a real-time organophosphate detection system using an enzymatic sensor.

    PubMed

    Carullo, Paola; Cetrangolo, Giovanni Paolo; Mandrich, Luigi; Manco, Giuseppe; Febbraio, Ferdinando

    2015-02-09

    Organophosphates are organic substances that contain a phosphoryl or a thiophosphoryl bond. They are mainly used around the world as pesticides, but can also be used as chemical warfare agents. Their detection is normally entrusted to techniques like GC- and LC-MS that, although sensitive, do not allow their identification on site and in real time. We have approached their identification by exploiting the high-affinity binding of these compounds with the esterase 2 from Alicyclobacillus acidocaldarius. Using an in silico analysis to evaluate the binding affinities of the enzyme with organophosphate inhibitors, like paraoxon, and other organophosphate compounds, like parathion, chlorpyriphos, and other organophosphate thio-derivatives, we have designed fluorescence spectroscopy experiments to study the quenching of the tryptophan residues after esterase 2 binding with the organophosphate pesticides. The changes in the fluorescence signals permitted an immediate and quantitative identification of these compounds from nano- to picomolar concentrations. A fluorescence based polarity-sensitive probe (ANS) was also employed as a means to understand the extent of the interactions involved, as well as to explore other ways to detect organophosphate pesticides. Finally, we designed a framework for the development of a biosensor that exploits fluorescence technology in combination with a sensitive and very stable bio-receptor.

Top